Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SFRS4	6429	broad.mit.edu	37	1	29475063	29475063	+	Silent	SNP	G	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29475063G>C	uc001bro.2	-	6	1717	c.1344C>G	c.(1342-1344)TCC>TCG	p.S448S	SFRS4_uc010ofy.1_3'UTR	NM_005626	NP_005617	Q08170	SRSF4_HUMAN	splicing factor, arginine/serine-rich 4	448	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding				0		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)		GTTTCGATTTGGAATTGGATC	0.512													84	240	---	---	---	---	PASS
KIAA0319L	79932	broad.mit.edu	37	1	35917273	35917273	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35917273C>T	uc001byx.2	-	13	2276	c.2018G>A	c.(2017-2019)AGG>AAG	p.R673K	KIAA0319L_uc001byw.2_Missense_Mutation_p.R115K|KIAA0319L_uc010ohv.1_Missense_Mutation_p.R315K	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like	673	PKD 4.|Extracellular (Potential).					cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTGCAGGTTCCTCTCATCTTT	0.502											OREG0013354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	86	246	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86947888	86947888	+	Silent	SNP	A	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86947888A>G	uc001dlt.2	+	5	687	c.558A>G	c.(556-558)AGA>AGG	p.R186R	CLCA1_uc001dls.1_Silent_p.R125R	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	186					calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		ATATTTTCAGATGTTCAGCAG	0.393													10	64	---	---	---	---	PASS
PRMT6	55170	broad.mit.edu	37	1	107599560	107599560	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107599560C>A	uc010ous.1	+	1	294	c.223C>A	c.(223-225)CTT>ATT	p.L75I		NM_018137	NP_060607	Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	75					base-excision repair|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone binding|histone methyltransferase activity (H2A-R3 specific)|histone methyltransferase activity (H3-R2 specific)|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity				0		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		CCTGGGTATCCTTCGGAACTG	0.662													11	36	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155205493	155205493	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155205493A>T	uc001fjh.2	-	9	1517	c.1367T>A	c.(1366-1368)TTC>TAC	p.F456Y	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Missense_Mutation_p.F343Y|GBA_uc010pfx.1_Missense_Mutation_p.F407Y|GBA_uc001fji.2_Missense_Mutation_p.F456Y|GBA_uc001fjj.2_Missense_Mutation_p.F456Y|GBA_uc001fjk.2_Missense_Mutation_p.F456Y|GBA_uc001fjl.2_Missense_Mutation_p.F456Y|GBA_uc010pfy.1_Missense_Mutation_p.F369Y	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	456			F -> V (in GD).		carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	AAGGTGGTAGAACATGGGCTG	0.532									Gaucher_disease_type_I				3	12	---	---	---	---	PASS
LMNA	4000	broad.mit.edu	37	1	156106775	156106775	+	Missense_Mutation	SNP	C	T	T	rs57920071		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156106775C>T	uc001fni.2	+	8	1693	c.1444C>T	c.(1444-1446)CGG>TGG	p.R482W	LMNA_uc001fnf.1_Missense_Mutation_p.R482W|LMNA_uc001fng.2_Missense_Mutation_p.R482W|LMNA_uc001fnh.2_Missense_Mutation_p.R482W|LMNA_uc009wro.1_Missense_Mutation_p.R482W|LMNA_uc010pgz.1_Missense_Mutation_p.R370W|LMNA_uc001fnj.2_Missense_Mutation_p.R401W|LMNA_uc001fnk.2_Missense_Mutation_p.R383W|LMNA_uc009wrp.2_3'UTR|LMNA_uc010pha.1_Missense_Mutation_p.R138W|LMNA_uc010phb.1_5'Flank	NM_170707	NP_733821	P02545	LMNA_HUMAN	lamin A/C isoform 1 precursor	482	Tail.		R -> L (in FPLD2).|R -> W (in FPLD2; interacts with itself and with wild-type LMNA and LMNB1; no decrease in the stability compared with wild-type).		cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)					GCTGACTTACCGGTTCCCACC	0.617									Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				3	49	---	---	---	---	PASS
NDUFS2	4720	broad.mit.edu	37	1	161179063	161179063	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161179063G>T	uc001fyv.2	+	5	922	c.474G>T	c.(472-474)TTG>TTT	p.L158F	NDUFS2_uc010pki.1_Missense_Mutation_p.L60F|NDUFS2_uc001fyw.2_Missense_Mutation_p.L158F|NDUFS2_uc010pkj.1_Missense_Mutation_p.L107F|NDUFS2_uc001fyx.2_Missense_Mutation_p.L158F|NDUFS2_uc001fyy.1_3'UTR	NM_004550	NP_004541	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2	158					mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity|protein binding|quinone binding			skin(1)	1	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		NADH(DB00157)	TGGAGAAGTTGCTAAACATCC	0.527											OREG0013941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	147	---	---	---	---	PASS
HSPA7	3311	broad.mit.edu	37	1	161576641	161576641	+	Silent	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161576641G>T	uc010pkp.1	+	1	793	c.561G>T	c.(559-561)CTG>CTT	p.L187L		NR_024151				RecName: Full=Putative heat shock 70 kDa protein 7; AltName: Full=Heat shock 70 kDa protein B;												0						CCTATGGGCTGGACCGGCGGG	0.652													6	11	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250548	177250548	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250548C>T	uc001glf.2	+	8	2548	c.2236C>T	c.(2236-2238)CGG>TGG	p.R746W	FAM5B_uc001glg.2_Missense_Mutation_p.R641W	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	746						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						CTGCTTGCTCCGGCATCGGCT	0.557													35	68	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232538143	232538143	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232538143G>A	uc001hvg.2	-	20	5175	c.5017C>T	c.(5017-5019)CGG>TGG	p.R1673W	SIPA1L2_uc001hvf.2_Missense_Mutation_p.R729W	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1673	Potential.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ATTACCTTCCGAAGGTCGGTC	0.393													26	93	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32631593	32631593	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32631593G>A	uc010ezu.2	+	9	1579	c.1445G>A	c.(1444-1446)AGT>AAT	p.S482N		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	482					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GATTCAGACAGTGAAGAGCAT	0.289													24	98	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50850622	50850622	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50850622G>A	uc010fbq.2	-	6	2540	c.1063C>T	c.(1063-1065)CTT>TTT	p.L355F	NRXN1_uc002rxb.3_Missense_Mutation_p.L2F|NRXN1_uc002rxe.3_Missense_Mutation_p.L322F|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CCAGTGTGAAGCATCAGTCCA	0.428													21	254	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63101527	63101527	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63101527T>A	uc002sby.2	+	11	1632	c.1150T>A	c.(1150-1152)TTG>ATG	p.L384M	EHBP1_uc010fcp.2_Missense_Mutation_p.L349M|EHBP1_uc002sbz.2_Missense_Mutation_p.L349M|EHBP1_uc002scb.2_Missense_Mutation_p.L349M	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	384						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TCCAAATAATTTGGTAAATCC	0.353									Hereditary_Prostate_Cancer				62	166	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86712976	86712976	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86712976G>A	uc002sri.3	+	21	3634	c.3307G>A	c.(3307-3309)GCT>ACT	p.A1103T	KDM3A_uc010ytj.1_Missense_Mutation_p.A1103T|KDM3A_uc010ytk.1_Missense_Mutation_p.A1051T	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	1103	JmjC.				androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						GATGTATAATGCTTATGGTAA	0.418													25	100	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90249398	90249398	+	Splice_Site	SNP	C	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90249398C>G	uc010fhm.2	+	28		c.3939_splice	c.e28+2							Parts of antibodies, mostly variable regions.																		GTACCCCTCCCACAGTGTTAC	0.517													6	228	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832786	130832786	+	Silent	SNP	A	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832786A>G	uc010fmh.2	-	17	2659	c.2259T>C	c.(2257-2259)TAT>TAC	p.Y753Y		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	753	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5						CCTTGCCCACATAGGACTCTT	0.607													8	169	---	---	---	---	PASS
GLB1	2720	broad.mit.edu	37	3	33093265	33093265	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33093265A>C	uc003cfi.1	-	9	1057	c.940T>G	c.(940-942)TTT>GTT	p.F314V	GLB1_uc003cfh.1_Missense_Mutation_p.F284V|GLB1_uc003cfj.1_Missense_Mutation_p.F183V|GLB1_uc011axk.1_Missense_Mutation_p.F362V	NM_000404	NP_000395	P16278	BGAL_HUMAN	galactosidase, beta 1 isoform a preproprotein	314					carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)				CAATAGGCAAAATTGGTCCCA	0.433													43	91	---	---	---	---	PASS
KLHL6	89857	broad.mit.edu	37	3	183211912	183211912	+	Silent	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183211912G>T	uc003flr.2	-	5	1363	c.1305C>A	c.(1303-1305)ATC>ATA	p.I435I	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_3'UTR|KLHL6_uc010hxk.1_RNA	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	435	Kelch 3.									haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CCACATTGTTGATTCTCTGTA	0.453													106	331	---	---	---	---	PASS
MAN2B2	23324	broad.mit.edu	37	4	6611625	6611625	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6611625G>C	uc003gjf.1	+	13	2143	c.2107G>C	c.(2107-2109)GAG>CAG	p.E703Q	MAN2B2_uc003gje.1_Missense_Mutation_p.E703Q|MAN2B2_uc011bwf.1_Missense_Mutation_p.E652Q	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	703					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						GATAGAGCAGGAGTACCAAGC	0.592													9	33	---	---	---	---	PASS
KCTD8	386617	broad.mit.edu	37	4	44450161	44450161	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44450161T>C	uc003gwu.2	-	1	664	c.380A>G	c.(379-381)AAG>AGG	p.K127R		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	127						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3						CAGCCGCTCCTTCTCGGGGAA	0.617										HNSCC(17;0.042)			10	27	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146063450	146063450	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146063450G>A	uc003ika.3	-	18	1663	c.1525C>T	c.(1525-1527)CCC>TCC	p.P509S	OTUD4_uc003ijz.3_Missense_Mutation_p.P508S	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	573							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					ACTAGAAGGGGAGCTGGATTT	0.478													67	198	---	---	---	---	PASS
CCNC	892	broad.mit.edu	37	6	100009547	100009547	+	Silent	SNP	T	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100009547T>A	uc003pqe.2	-	3	437	c.150A>T	c.(148-150)GCA>GCT	p.A50A	uc003pqc.2_Intron|CCNC_uc003pqd.2_5'UTR|CCNC_uc010kcr.2_RNA|CCNC_uc010kcs.2_Silent_p.A50A|CCNC_uc011eah.1_5'UTR|CCNC_uc003pqf.2_Silent_p.A50A	NM_005190	NP_005181	P24863	CCNC_HUMAN	cyclin C isoform a	50	Cyclin N-terminal.				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	DNA-directed RNA polymerase II, holoenzyme	protein kinase binding				0		all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		GTTCACCTAATGCTTGGATAA	0.279													54	153	---	---	---	---	PASS
KATNA1	11104	broad.mit.edu	37	6	149944376	149944376	+	Missense_Mutation	SNP	C	A	A	rs142263647		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149944376C>A	uc003qmr.1	-	3	409	c.364G>T	c.(364-366)GAC>TAC	p.D122Y	KATNA1_uc003qms.2_Missense_Mutation_p.D122Y|KATNA1_uc003qmt.2_Missense_Mutation_p.D122Y|KATNA1_uc011eed.1_Missense_Mutation_p.D122Y	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1	122	Interaction with microtubule.				cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		GATTTAGGGTCACTGTACTGA	0.418													65	206	---	---	---	---	PASS
TAGAP	117289	broad.mit.edu	37	6	159460046	159460046	+	Intron	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159460046G>T	uc003qrz.2	-						TAGAP_uc011eft.1_Intron|TAGAP_uc003qsa.2_Intron|TAGAP_uc003qsb.2_3'UTR	NM_054114	NP_473455	Q8N103	TAGAP_HUMAN	T-cell activation Rho GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTGTGATTCTGAGTCAGTTGG	0.373													3	39	---	---	---	---	PASS
SOX7	83595	broad.mit.edu	37	8	10583337	10583337	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10583337C>A	uc003wtf.2	-	2	1157	c.1078G>T	c.(1078-1080)GTG>TTG	p.V360L	SOX7_uc011kwz.1_Missense_Mutation_p.V412L	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	360	Sox C-terminal.				endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)		GTTGGTGTCACCTGGGAGACC	0.592													13	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	11873857	11873857	+	3'UTR	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11873857G>A	uc003wuy.1	+	1										Homo sapiens cDNA FLJ33940 fis, clone CTONG2018069.																		gagaggccagggaagcagagg	0.264													2	1	---	---	---	---	PASS
HR	55806	broad.mit.edu	37	8	21985225	21985225	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21985225C>A	uc003xas.2	-	3	1395	c.730G>T	c.(730-732)GAA>TAA	p.E244*	HR_uc003xat.2_Nonsense_Mutation_p.E244*	NM_005144	NP_005135	O43593	HAIR_HUMAN	hairless protein isoform a	244							DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GAAGGGCGTTCGGCCTCCCCG	0.632													38	138	---	---	---	---	PASS
PURG	29942	broad.mit.edu	37	8	30889379	30889379	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30889379C>G	uc003xin.2	-	1	939	c.920G>C	c.(919-921)TGG>TCG	p.W307S	WRN_uc003xio.3_5'Flank|PURG_uc003xim.1_Intron	NM_013357	NP_037489	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G isoform A	307						nucleus	DNA binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		AAACCTTGTCCAAGCTTTGAA	0.388													13	28	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86047101	86047101	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86047101A>G	uc003ycw.2	+	13	2142	c.1988A>G	c.(1987-1989)AAT>AGT	p.N663S	LRRCC1_uc010maa.1_Missense_Mutation_p.N364S|LRRCC1_uc003ycx.2_Missense_Mutation_p.N570S|LRRCC1_uc003ycy.2_Missense_Mutation_p.N643S	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	663					cell division|mitosis	centriole|nucleus					0						GGTTTTGAAAATGTTGCAACT	0.308													26	99	---	---	---	---	PASS
BSPRY	54836	broad.mit.edu	37	9	116132237	116132237	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116132237C>A	uc004bhg.3	+	6	1072	c.1024C>A	c.(1024-1026)CAC>AAC	p.H342N	BSPRY_uc010muw.2_3'UTR	NM_017688	NP_060158	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	342	B30.2/SPRY.				calcium ion transport	cytoplasm|membrane	zinc ion binding			breast(1)	1						CAATGGGCAGCACGAGCCCCT	0.612													18	51	---	---	---	---	PASS
NDUFA8	4702	broad.mit.edu	37	9	124906457	124906457	+	3'UTR	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124906457G>A	uc004blv.2	-	4						NM_014222	NP_055037	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1					NADH(DB00157)	GATGCAAACCGCATGGGCGTT	0.458													3	45	---	---	---	---	PASS
WDR38	401551	broad.mit.edu	37	9	127619963	127619963	+	3'UTR	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127619963G>T	uc004box.2	+	9					WDR38_uc011lzn.1_3'UTR|WDR38_uc011lzo.1_3'UTR|WDR38_uc011lzp.1_3'UTR	NM_001045476	NP_001038941	Q5JTN6	WDR38_HUMAN	WD repeat domain 38												0						GTGGCGCACAGGCATGCCGCT	0.602													5	18	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95076526	95076526	+	Silent	SNP	G	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95076526G>C	uc001kin.2	-	50	5766	c.5643C>G	c.(5641-5643)CCC>CCG	p.P1881P	MYOF_uc001kio.2_Silent_p.P1868P|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1881	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						TGATCAGCCTGGGTGGGATTC	0.408													55	171	---	---	---	---	PASS
PIK3AP1	118788	broad.mit.edu	37	10	98405300	98405300	+	Silent	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98405300G>A	uc001kmq.2	-	8	1433	c.1305C>T	c.(1303-1305)CTC>CTT	p.L435L	PIK3AP1_uc001kmp.2_Silent_p.L257L	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	435						cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		AGCCGGGGTTGAGCGAGCATT	0.537													28	72	---	---	---	---	PASS
C10orf62	414157	broad.mit.edu	37	10	99350271	99350271	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99350271G>C	uc001koa.2	+	1	788	c.617G>C	c.(616-618)AGT>ACT	p.S206T	DHDPSL_uc001knx.2_Intron|DHDPSL_uc001kny.2_Intron|DHDPSL_uc001knz.2_Intron|PI4K2A_uc010qoy.1_Intron	NM_001009997	NP_001009997	Q5T681	CJ062_HUMAN	hypothetical protein LOC414157	206	His-rich.						protein binding				0		Colorectal(252;0.162)		Epithelial(162;9.58e-11)|all cancers(201;8.62e-09)		AGTCACCACAGTCACCATGGC	0.537													19	39	---	---	---	---	PASS
ADD3	120	broad.mit.edu	37	10	111877147	111877147	+	Silent	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111877147C>T	uc001kyt.3	+	6	848	c.534C>T	c.(532-534)GGC>GGT	p.G178G	ADD3_uc001kys.3_Silent_p.G178G|ADD3_uc001kyu.2_Silent_p.G178G|ADD3_uc001kyv.2_Silent_p.G178G|ADD3_uc001kyw.2_Silent_p.G178G	NM_016824	NP_058432	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma) isoform a	178						cytoskeleton	actin binding|calmodulin binding|metal ion binding|structural constituent of cytoskeleton			ovary(2)|skin(2)|large_intestine(1)	5		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		TTCCCAGAGGCCTATCTTTTT	0.363													26	100	---	---	---	---	PASS
ZDHHC6	64429	broad.mit.edu	37	10	114190471	114190471	+	3'UTR	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114190471C>A	uc001kzv.2	-	11					ZDHHC6_uc001kzw.2_3'UTR	NM_022494	NP_071939	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6							integral to membrane	acyltransferase activity|zinc ion binding				0		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		AACATCTTAACCAGAGTAGGC	0.308													5	27	---	---	---	---	PASS
OR5D14	219436	broad.mit.edu	37	11	55563209	55563209	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55563209C>A	uc010rim.1	+	1	178	c.178C>A	c.(178-180)CCT>ACT	p.P60T		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	60	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				ATTTCACACTCCTATGTACTT	0.383													67	229	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	55999686	55999686	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55999686G>T	uc010rjc.1	-	1	976	c.976C>A	c.(976-978)CCC>ACC	p.P326T		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	326	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					TAGATGACGGGATTCAGCAAG	0.348													58	211	---	---	---	---	PASS
ZFPL1	7542	broad.mit.edu	37	11	64854837	64854837	+	Silent	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64854837C>A	uc001ocq.1	+	7	843	c.678C>A	c.(676-678)CTC>CTA	p.L226L		NM_006782	NP_006773	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	226	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|vesicle-mediated transport	Golgi apparatus|integral to membrane|nucleus	DNA binding|zinc ion binding			ovary(1)	1						CACCAGGCCTCCATGGAGACT	0.597													31	102	---	---	---	---	PASS
OAF	220323	broad.mit.edu	37	11	120096481	120096481	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120096481G>T	uc001pxb.2	+	2	584	c.343G>T	c.(343-345)GAG>TAG	p.E115*		NM_178507	NP_848602	Q86UD1	OAF_HUMAN	OAF homolog precursor	115											0		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		CATCCCCAGTGAGGCCATGGC	0.662													24	80	---	---	---	---	PASS
FGF6	2251	broad.mit.edu	37	12	4554409	4554409	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4554409G>T	uc001qmr.1	-	1	372	c.328C>A	c.(328-330)CAC>AAC	p.H110N		NM_020996	NP_066276	P10767	FGF6_HUMAN	fibroblast growth factor 6 precursor	110					angiogenesis|cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	growth factor activity			lung(2)|ovary(1)	3			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			TTCTCCTCGTGGGTCCCGCTG	0.637													3	11	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21968702	21968702	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21968702G>T	uc001rfi.1	-	32	4038	c.4018C>A	c.(4018-4020)CAA>AAA	p.Q1340K	ABCC9_uc001rfh.2_Missense_Mutation_p.Q1340K|ABCC9_uc001rfj.1_Missense_Mutation_p.Q1304K	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1340	Cytoplasmic (Potential).|ABC transporter 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CATACCTTTTGTCCAGGTTTG	0.393													42	160	---	---	---	---	PASS
BCDIN3D	144233	broad.mit.edu	37	12	50236870	50236870	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50236870T>A	uc001rvh.2	-	1	43	c.1A>T	c.(1-3)ATG>TTG	p.M1L		NM_181708	NP_859059	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	1							methyltransferase activity			ovary(1)	1						GGCACCGCCATTAGCCTCAAC	0.662													2	2	---	---	---	---	PASS
KRT82	3888	broad.mit.edu	37	12	52799753	52799753	+	Silent	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52799753G>A	uc001sai.1	-	1	424	c.309C>T	c.(307-309)GTC>GTT	p.V103V		NM_033033	NP_149022	Q9NSB4	KRT82_HUMAN	keratin 82	103	Head.					keratin filament	protein binding|structural constituent of epidermis			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.193)		GTGCCAGTGGGACCAGCAGGC	0.572													11	231	---	---	---	---	PASS
KRT6A	3853	broad.mit.edu	37	12	52881498	52881498	+	3'UTR	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52881498C>T	uc001sam.2	-	9						NM_005554	NP_005545	P02538	K2C6A_HUMAN	keratin 6A						cell differentiation|ectoderm development|positive regulation of cell proliferation	keratin filament	protein binding|structural constituent of cytoskeleton			ovary(4)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCTAGCAGACGCACTTTAGT	0.607													21	66	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95676229	95676229	+	Silent	SNP	A	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95676229A>G	uc001tdz.2	+	8	1242	c.1137A>G	c.(1135-1137)CAA>CAG	p.Q379Q	VEZT_uc009ztb.1_RNA|VEZT_uc009ztc.1_Intron|VEZT_uc001tdy.2_RNA	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	379						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						ATGTGACTCAAGGTCTACCTC	0.473													114	384	---	---	---	---	PASS
OAS3	4940	broad.mit.edu	37	12	113379477	113379477	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113379477C>T	uc001tug.2	+	2	367	c.280C>T	c.(280-282)CGT>TGT	p.R94C	OAS3_uc001tue.2_Missense_Mutation_p.R94C|OAS3_uc001tuf.2_Missense_Mutation_p.R94C	NM_006187	NP_006178	Q9Y6K5	OAS3_HUMAN	2'-5'oligoadenylate synthetase 3	94	OAS domain 1.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	microsome	ATP binding|nucleotidyltransferase activity|RNA binding			central_nervous_system(1)	1						GAGGGCCCGCCGTGCAGAGAT	0.602													31	89	---	---	---	---	PASS
ANAPC5	51433	broad.mit.edu	37	12	121758187	121758187	+	Splice_Site	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121758187C>A	uc001uag.2	-	12	1637	c.1515_splice	c.e12+1	p.Q505_splice	ANAPC5_uc010szu.1_Splice_Site_p.Q171_splice|ANAPC5_uc001uae.2_Splice_Site_p.Q69_splice|ANAPC5_uc010szv.1_Splice_Site_p.Q107_splice|ANAPC5_uc001uaf.2_Splice_Site|ANAPC5_uc001uah.2_Splice_Site_p.Q393_splice|ANAPC5_uc001uai.1_Splice_Site_p.Q107_splice	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGGCAGATTACCTGGGCGTGC	0.338													38	104	---	---	---	---	PASS
HIP1R	9026	broad.mit.edu	37	12	123343990	123343990	+	Silent	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123343990C>T	uc001udj.1	+	23	2372	c.2313C>T	c.(2311-2313)AGC>AGT	p.S771S	HIP1R_uc001udk.1_Silent_p.S36S	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	771	I/LWEQ.				receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		AACCCAAGAGCCTAGATGTGC	0.632													25	63	---	---	---	---	PASS
SLC7A1	6541	broad.mit.edu	37	13	30098300	30098300	+	Silent	SNP	G	A	A	rs138795948	byFrequency	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30098300G>A	uc001uso.2	-	6	1182	c.795C>T	c.(793-795)GCC>GCT	p.A265A		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	265	Helical; (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	AGCCCACGAAGGCATAGAAGC	0.572													9	25	---	---	---	---	PASS
C13orf23	80209	broad.mit.edu	37	13	39587314	39587314	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39587314G>A	uc001uwy.2	-	11	2948	c.2075C>T	c.(2074-2076)CCA>CTA	p.P692L	C13orf23_uc001uwz.2_Missense_Mutation_p.P670L	NM_025138	NP_079414	Q86XN7	CM023_HUMAN	hypothetical protein LOC80209 isoform 1	692	Ser-rich.									ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)		AGTGAATACTGGTGCAATGGG	0.438													30	118	---	---	---	---	PASS
KBTBD7	84078	broad.mit.edu	37	13	41767262	41767262	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41767262G>T	uc001uxw.1	-	1	1441	c.1132C>A	c.(1132-1134)CAC>AAC	p.H378N	uc001uxv.1_Intron	NM_032138	NP_115514	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	378							protein binding			ovary(1)	1		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GTCTTAGTGTGAGCAAAGCTG	0.502													36	108	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109672228	109672228	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109672228C>T	uc001vqt.1	+	23	2825	c.2699C>T	c.(2698-2700)ACA>ATA	p.T900I	MYO16_uc010agk.1_Missense_Mutation_p.T922I|MYO16_uc001vqu.1_Missense_Mutation_p.T700I|MYO16_uc010tjh.1_Missense_Mutation_p.T412I	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	900	Myosin head-like 2.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GACCACGGTACAGCCTTCACC	0.463													26	96	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22466360	22466360	+	Intron	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22466360C>T	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Missense_Mutation_p.T97M|uc001wcp.2_Missense_Mutation_p.T97M|uc001wcr.1_Missense_Mutation_p.T57M|uc001wcs.1_Missense_Mutation_p.T57M|uc010ajf.1_Missense_Mutation_p.T57M|uc001wcq.2_Missense_Mutation_p.T97M|uc010ajd.1_Missense_Mutation_p.T97M					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTGTTGATCACGGCTTCCCGG	0.488													19	58	---	---	---	---	PASS
EIF5	1983	broad.mit.edu	37	14	103802419	103802419	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103802419T>C	uc001ymq.2	+	4	641	c.119T>C	c.(118-120)GTT>GCT	p.V40A	EIF5_uc001ymr.2_Missense_Mutation_p.V40A|EIF5_uc001yms.2_Missense_Mutation_p.V40A|EIF5_uc001ymt.2_Missense_Mutation_p.V40A|EIF5_uc001ymu.2_Missense_Mutation_p.V40A|SNORA28_uc001ymv.1_5'Flank	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	40					regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			GTCAACATGGTTGACGTTGCA	0.418													22	80	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	86838616	86838616	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86838616G>C	uc002blz.1	+	16	2293	c.2213G>C	c.(2212-2214)AGT>ACT	p.S738T	AGBL1_uc002bma.1_Missense_Mutation_p.S469T|AGBL1_uc002bmb.1_Missense_Mutation_p.S432T	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	738					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						GAGTCCAACAGTGATGAGCAT	0.493													32	151	---	---	---	---	PASS
ERI2	112479	broad.mit.edu	37	16	20802204	20802204	+	Silent	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20802204C>A	uc002dhs.2	-	9	826	c.783G>T	c.(781-783)GGG>GGT	p.G261G	ACSM3_uc002dhr.2_Intron|ACSM3_uc010vba.1_Intron	NM_080663	NP_542394	A8K979	ERI2_HUMAN	exoribonuclease 2 isoform 2	Error:Variant_position_missing_in_A8K979_after_alignment						intracellular	exonuclease activity|nucleic acid binding|zinc ion binding			large_intestine(1)	1						CATGCTGGTCCCCTGAGGCCA	0.448													28	91	---	---	---	---	PASS
HS3ST2	9956	broad.mit.edu	37	16	22926609	22926609	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22926609T>A	uc002dli.2	+	2	902	c.830T>A	c.(829-831)CTC>CAC	p.L277H	HS3ST2_uc002dlj.2_RNA	NM_006043	NP_006034	Q9Y278	HS3S2_HUMAN	heparan sulfate D-glucosaminyl	277	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)		GGCGAGCGACTCATCACTGAC	0.557													9	165	---	---	---	---	PASS
SBK1	388228	broad.mit.edu	37	16	28331871	28331871	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28331871C>T	uc002dpd.2	+	4	1693	c.904C>T	c.(904-906)CGC>TGC	p.R302C		NM_001024401	NP_001019572	Q52WX2	SBK1_HUMAN	SH3-binding kinase 1	302	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|kidney(1)	2						GGAGCCCGAGCGCCGCGGCCC	0.572													4	2	---	---	---	---	PASS
SLC5A2	6524	broad.mit.edu	37	16	31496212	31496212	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31496212A>G	uc002ecf.3	+	3	290	c.271A>G	c.(271-273)AGT>GGT	p.S91G	SLC5A2_uc010car.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	91	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						TGGCGCTGCAAGTGGCTTGGC	0.597													13	33	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61687392	61687392	+	3'UTR	SNP	T	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61687392T>C	uc002eog.1	-	12						NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TGGTTGAGTTTATAGATGACT	0.333													5	45	---	---	---	---	PASS
AMAC1L3	643664	broad.mit.edu	37	17	7385621	7385621	+	Silent	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7385621C>T	uc010cmj.1	+	2	433	c.318C>T	c.(316-318)TTC>TTT	p.F106F	ZBTB4_uc002ghc.3_5'Flank|ZBTB4_uc002ghd.3_Intron|POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.3_5'Flank	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3	106	DUF6 1.|Helical; (Potential).					integral to membrane					0		Prostate(122;0.173)				GGGCCTACTTCTATGCCCTGC	0.592													93	268	---	---	---	---	PASS
CACNB1	782	broad.mit.edu	37	17	37333729	37333729	+	Silent	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37333729C>T	uc002hrm.1	-	13	1359	c.1206G>A	c.(1204-1206)GCG>GCA	p.A402A	CACNB1_uc002hrl.1_Silent_p.A174A|CACNB1_uc002hrn.2_Silent_p.A402A|CACNB1_uc002hro.2_Silent_p.A447A	NM_000723	NP_000714	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1	402					axon guidance	voltage-gated calcium channel complex				large_intestine(1)|ovary(1)	2					Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Verapamil(DB00661)	CCAAGTACTCCGCCAGATGCT	0.607													12	38	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37866350	37866350	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37866350G>A	uc002hso.2	+	6	893	c.655G>A	c.(655-657)GTC>ATC	p.V219I	ERBB2_uc002hsm.2_Missense_Mutation_p.V189I|ERBB2_uc010cwa.2_Missense_Mutation_p.V204I|ERBB2_uc002hsp.2_Missense_Mutation_p.V22I|ERBB2_uc010cwb.2_Missense_Mutation_p.V219I|ERBB2_uc010wek.1_Intron|ERBB2_uc002hsl.2_Missense_Mutation_p.V189I|ERBB2_uc002hsn.1_Missense_Mutation_p.V219I	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	219	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	GACGCGCACTGTCTGTGCCGG	0.657		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			29	65	---	---	---	---	PASS
KRT20	54474	broad.mit.edu	37	17	39032535	39032535	+	3'UTR	SNP	A	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39032535A>G	uc002hvl.2	-	8						NM_019010	NP_061883	P35900	K1C20_HUMAN	keratin 20						apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)				CTTATGGCTGATTTCTTGCAG	0.373													9	52	---	---	---	---	PASS
HOXB4	3214	broad.mit.edu	37	17	46654154	46654154	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46654154C>T	uc002inp.2	-	2	748	c.686G>A	c.(685-687)CGC>CAC	p.R229H	HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_Intron|HOXB3_uc010dbg.2_Intron|HOXB3_uc002ino.2_5'Flank|HOXB3_uc010wlk.1_5'Flank|HOXB3_uc010wll.1_Intron	NM_024015	NP_076920	P17483	HXB4_HUMAN	homeobox B4	229						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ACCACCCGAGCGGATCTTGGT	0.677													31	103	---	---	---	---	PASS
ACOX1	51	broad.mit.edu	37	17	73975031	73975031	+	Intron	SNP	G	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73975031G>A	uc002jqf.2	-						ACOX1_uc010wsq.1_5'UTR|ACOX1_uc002jqe.2_Intron|ACOX1_uc010wsr.1_Intron|C17orf106_uc010dgs.1_5'Flank|CDK3_uc002jqg.3_5'Flank	NM_007292	NP_009223	Q15067	ACOX1_HUMAN	acyl-Coenzyme A oxidase 1 isoform b						fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|prostaglandin metabolic process|very long-chain fatty acid metabolic process	peroxisomal matrix	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity|flavin adenine dinucleotide binding|protein N-terminus binding			ovary(1)	1						GGGAGGTCTCGCCCGCCGCCC	0.682													15	60	---	---	---	---	PASS
CCBE1	147372	broad.mit.edu	37	18	57136800	57136800	+	Missense_Mutation	SNP	C	T	T	rs121908251		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57136800C>T	uc002lib.2	-	4	375	c.305G>A	c.(304-306)TGC>TAC	p.C102Y		NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	102					lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				GTTGTCCGTGCACTGCTGTTC	0.547													72	191	---	---	---	---	PASS
ZNF439	90594	broad.mit.edu	37	19	11959618	11959618	+	5'UTR	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11959618C>A	uc002msr.2	+	1						NM_152262	NP_689475	Q8NDP4	ZN439_HUMAN	zinc finger protein 439						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TGGGATCTGGCCTTTCCAGCC	0.622													4	17	---	---	---	---	PASS
OR7A10	390892	broad.mit.edu	37	19	14952067	14952067	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14952067C>G	uc002mzx.1	-	1	623	c.623G>C	c.(622-624)GGT>GCT	p.G208A		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	208	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					GAGGGGACCACCGCCCAGCAG	0.458													23	92	---	---	---	---	PASS
ILVBL	10994	broad.mit.edu	37	19	15227242	15227242	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15227242G>T	uc002nam.2	-	11	1399	c.1278C>A	c.(1276-1278)GAC>GAA	p.D426E	ILVBL_uc010xof.1_Missense_Mutation_p.D67E|ILVBL_uc010dzw.2_Missense_Mutation_p.D319E	NM_006844	NP_006835	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	426						integral to membrane	magnesium ion binding|thiamine pyrophosphate binding|transferase activity			ovary(2)	2						CCTTCTGCCGGTCGGCTTCCC	0.652													7	89	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56732944	56732944	+	Nonstop_Mutation	SNP	T	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56732944T>C	uc002qmq.2	-	5	1657	c.1491A>G	c.(1489-1491)TGA>TGG	p.*497W	ZSCAN5A_uc010ygi.1_Nonstop_Mutation_p.*380W|ZSCAN5A_uc002qmr.2_Nonstop_Mutation_p.*497W|ZSCAN5A_uc002qms.1_Nonstop_Mutation_p.*496W	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	497					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						GATTATGCAATCACTGAGAAG	0.428													64	155	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	11014987	11014987	+	RNA	SNP	A	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11014987A>G	uc002yis.1	-	7		c.1459T>C						P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTATAGTTTCAATAGCAGACT	0.388													4	54	---	---	---	---	PASS
HUNK	30811	broad.mit.edu	37	21	33296878	33296878	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33296878C>A	uc002yph.2	+	2	720	c.360C>A	c.(358-360)CAC>CAA	p.H120Q		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	120	Protein kinase.				multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						TGATCCGCCACCCCAATATCA	0.488													5	93	---	---	---	---	PASS
SLC7A4	6545	broad.mit.edu	37	22	21385823	21385823	+	Silent	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21385823C>T	uc002zud.2	-	2	347	c.279G>A	c.(277-279)GGG>GGA	p.G93G	SLC7A4_uc002zue.2_Silent_p.G93G	NM_004173	NP_004164	O43246	CTR4_HUMAN	solute carrier family 7 (cationic amino acid	93					cellular amino acid metabolic process	integral to membrane	basic amino acid transmembrane transporter activity			ovary(1)|lung(1)	2	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GCACACGTGCCCCAAATTCTG	0.617													6	31	---	---	---	---	PASS
TLR7	51284	broad.mit.edu	37	X	12885687	12885687	+	5'UTR	SNP	G	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12885687G>C	uc004cvc.2	+	2						NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor						cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	CATTTTGGAAGAAGACTAAAA	0.413													14	693	---	---	---	---	PASS
BEND2	139105	broad.mit.edu	37	X	18219956	18219956	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18219956C>G	uc004cyj.3	-	6	1166	c.1012G>C	c.(1012-1014)GTC>CTC	p.V338L	BEND2_uc010nfb.2_Intron	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	338										ovary(3)|kidney(1)|central_nervous_system(1)	5						GGGATGAAGACAGATAAAGAG	0.279													29	303	---	---	---	---	PASS
PABPC5	140886	broad.mit.edu	37	X	90691350	90691350	+	Silent	SNP	C	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90691350C>T	uc004efg.2	+	2	1214	c.774C>T	c.(772-774)GAC>GAT	p.D258D	PABPC5_uc004eff.1_Silent_p.D94D	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	258	RRM 3.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						CTGTGCTAGACTTGCATGGAA	0.468													60	169	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151818948	151818948	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151818948T>C	uc004ffp.1	+	7	826	c.806T>C	c.(805-807)CTT>CCT	p.L269P		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	269	Helical; (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AACAGCTACCTTGTGCAAGTC	0.498													177	629	---	---	---	---	PASS
SLC6A8	6535	broad.mit.edu	37	X	152954167	152954167	+	Silent	SNP	C	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152954167C>A	uc004fib.3	+	1	416	c.138C>A	c.(136-138)CGC>CGA	p.R46R	SLC6A8_uc004fic.3_Silent_p.R46R|SLC6A8_uc011myx.1_5'Flank|PNCK_uc011myw.1_5'Flank|SLC6A8_uc010nui.1_5'Flank	NM_005629	NP_005620	P48029	SC6A8_HUMAN	solute carrier family 6 member 8 isoform 1	46	Cytoplasmic (Potential).				creatine metabolic process|muscle contraction	integral to plasma membrane	creatine:sodium symporter activity|neurotransmitter:sodium symporter activity			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	CCGGCGGCCGCCTGGCCGTGC	0.617													3	18	---	---	---	---	PASS
AGRN	375790	broad.mit.edu	37	1	985094	985094	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:985094delC	uc001ack.1	+	26	4713	c.4663delC	c.(4663-4665)CCCfs	p.P1555fs		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	1555	EGF-like 2.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCCCTGCCTGCCCAACCCCTG	0.721													4	2	---	---	---	---	
PLEKHG5	57449	broad.mit.edu	37	1	6530742	6530743	+	Intron	INS	-	CGGAG	CGGAG			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6530742_6530743insCGGAG	uc001ano.1	-						PLEKHG5_uc001ann.1_Intron|PLEKHG5_uc001anq.1_Intron|PLEKHG5_uc001anp.1_Intron|PLEKHG5_uc001anj.1_Intron|PLEKHG5_uc009vma.1_Intron|PLEKHG5_uc010nzr.1_Intron|PLEKHG5_uc001ank.1_Intron|PLEKHG5_uc009vmb.1_Intron|PLEKHG5_uc001anl.1_Intron|PLEKHG5_uc001anm.1_Intron|PLEKHG5_uc001anr.1_5'Flank	NM_001042663	NP_001036128	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		CAGGGTCATGACGGAGCAGAGA	0.688													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26282101	26282102	+	IGR	INS	-	AAGG	AAGG	rs10653543		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26282101_26282102insAAGG								STMN1 (48733 upstream) : PAFAH2 (4158 downstream)																							aggaaggaagaaaggaaggaag	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34880286	34880287	+	IGR	DEL	AC	-	-	rs141159713		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34880286_34880287delAC								C1orf94 (195557 upstream) : MIR552 (254913 downstream)																							ATGATAAAATacacacacacac	0.371													3	3	---	---	---	---	
ZMYM4	9202	broad.mit.edu	37	1	35835939	35835940	+	Intron	INS	-	TT	TT	rs35122134		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35835939_35835940insTT	uc001byt.2	+						ZMYM4_uc009vuu.2_Intron|ZMYM4_uc001byu.2_Intron|ZMYM4_uc009vuv.2_Intron|uc001byv.2_5'Flank	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN	zinc finger protein 262						multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ttttctttcaattttttttttt	0.292													4	3	---	---	---	---	
TAF13	6884	broad.mit.edu	37	1	109617401	109617402	+	Intron	INS	-	A	A	rs35227534		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109617401_109617402insA	uc001dwm.1	-							NM_005645	NP_005636	Q15543	TAF13_HUMAN	TBP-associated factor 13						transcription elongation from RNA polymerase II promoter|viral reproduction	transcription factor TFIID complex	protein C-terminus binding|sequence-specific DNA binding transcription factor activity				0		all_epithelial(167;0.000102)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0138)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.166)|all cancers(265;0.191)|LUSC - Lung squamous cell carcinoma(189;0.228)		gactccgtctcaaaaaaaaaaa	0.153													6	3	---	---	---	---	
KRTCAP2	200185	broad.mit.edu	37	1	155145769	155145771	+	In_Frame_Del	DEL	CTA	-	-	rs145673508		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155145769_155145771delCTA	uc001fho.2	-	1	34_36	c.8_10delTAG	c.(7-12)ATAGCT>ACT	p.3_4IA>T	RAG1AP1_uc010pey.1_Intron|KRTCAP2_uc001fhp.1_In_Frame_Del_p.3_4IA>T|TRIM46_uc009wpe.1_Intron|TRIM46_uc010pez.1_5'Flank|TRIM46_uc001fhq.2_5'Flank|TRIM46_uc001fhr.2_5'Flank|TRIM46_uc001fhs.1_5'Flank|TRIM46_uc001fht.1_5'Flank|TRIM46_uc010pfa.1_5'Flank|TRIM46_uc001fhu.1_5'Flank|TRIM46_uc009wpg.1_5'Flank|TRIM46_uc009wpf.2_5'Flank|TRIM46_uc001fhv.3_5'Flank|TRIM46_uc001fhw.1_5'Flank	NM_173852	NP_776251	Q8N6L1	KTAP2_HUMAN	keratinocyte associated protein 2	3_4						integral to membrane					0	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.18e-10)|all cancers(21;8.39e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTGCGGTTAGCTATGCGCATGCG	0.635											OREG0013854	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	13	---	---	---	---	
DENND1B	163486	broad.mit.edu	37	1	197520240	197520243	+	Intron	DEL	CACC	-	-	rs148336943	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197520240_197520243delCACC	uc010ppe.1	-						DENND1B_uc010ppf.1_Intron	NM_001142795	NP_001136267	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 1							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						cacacacacacacCCCCTAGATAG	0.255													4	2	---	---	---	---	
OBSCN	84033	broad.mit.edu	37	1	228522630	228522630	+	Intron	DEL	C	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228522630delC	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsr.1_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCGTTTCCTGCCCGCAGCTAT	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	236261686	236261688	+	IGR	DEL	GAA	-	-	rs72765500	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236261686_236261688delGAA								NID1 (33205 upstream) : GPR137B (44144 downstream)																							ggaagggaaggaaggaaaggaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	236832393	236832396	+	IGR	DEL	CTTA	-	-	rs71993544	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236832393_236832396delCTTA								HEATR1 (64579 upstream) : ACTN2 (17374 downstream)																							tccttccttccttacttccttcct	0.108													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242995203	242995204	+	IGR	INS	-	GAAA	GAAA	rs10926878	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242995203_242995204insGAAA								PLD5 (307205 upstream) : CEP170 (292527 downstream)																							aaggaaggaaggaaggaaggag	0.000													4	2	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	1872229	1872232	+	Intron	DEL	AAGA	-	-	rs113794671		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1872229_1872232delAAGA	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ggaaggaaggaagaaaCCCTTGAT	0.338													6	3	---	---	---	---	
MATN3	4148	broad.mit.edu	37	2	20205423	20205424	+	Intron	INS	-	AAAG	AAAG	rs140894448	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20205423_20205424insAAAG	uc002rdl.2	-						MATN3_uc010exu.1_Intron	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCACCAAAAAAGAATAATACT	0.267													7	6	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73830582	73830582	+	Intron	DEL	A	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73830582delA	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjh.1_3'UTR	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TATGGCACTGAAAAAAAAAAA	0.353													5	3	---	---	---	---	
ACTG2	72	broad.mit.edu	37	2	74142165	74142165	+	Intron	DEL	A	-	-	rs71406844		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74142165delA	uc002sjw.2	+						ACTG2_uc010fey.2_Intron|ACTG2_uc010yrn.1_Intron	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide						muscle contraction	cytoskeleton|cytosol	ATP binding				0						AAAATTAGGGAAAAATCTCAT	0.323													4	2	---	---	---	---	
PLEKHB2	55041	broad.mit.edu	37	2	132109433	132109434	+	Intron	INS	-	TTTC	TTTC	rs143305633	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132109433_132109434insTTTC	uc002tsh.2	+									Q96CS7	PKHB2_HUMAN	SubName: Full=Putative uncharacterized protein PLEKHB2;							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		acgtgccacattttcttTCTTT	0.193													3	3	---	---	---	---	
RBM44	375316	broad.mit.edu	37	2	238742788	238742788	+	Intron	DEL	A	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238742788delA	uc002vxi.3	+							NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44								nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GTCAGCAGGTAATAACCAAAA	0.323													17	9	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131256124	131256127	+	Intron	DEL	TCTG	-	-	rs74985864		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131256124_131256127delTCTG	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron|CPNE4_uc003eoj.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TTttttcttttctgtttttttttt	0.167													6	3	---	---	---	---	
HGFAC	3083	broad.mit.edu	37	4	3446996	3446996	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3446996delC	uc003ghc.2	+	9	1024	c.1021delC	c.(1021-1023)CCGfs	p.P341fs	HGFAC_uc010icw.2_Frame_Shift_Del_p.P341fs	NM_001528	NP_001519	Q04756	HGFA_HUMAN	HGF activator preproprotein	341	Kringle.				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCGCAGGAATCCGGACAATGA	0.697													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53661678	53661679	+	IGR	INS	-	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53661678_53661679insG								KIAA0114 (81373 upstream) : RASL11B (66816 downstream)																							gaaggaaggaagaagaagaaga	0.000													6	3	---	---	---	---	
GRSF1	2926	broad.mit.edu	37	4	71697073	71697073	+	Intron	DEL	A	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71697073delA	uc010iia.1	-						GRSF1_uc011caz.1_Intron|GRSF1_uc003hfs.2_Intron	NM_002092	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1 isoform 1						mRNA polyadenylation		mRNA binding|nucleotide binding				0		all_hematologic(202;0.21)	Lung(101;0.235)			actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CDKL2	8999	broad.mit.edu	37	4	76521157	76521160	+	Intron	DEL	GAAA	-	-	rs35420285	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76521157_76521160delGAAA	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			aggaaggaaggaaagaaggaagga	0.034													8	4	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	100002443	100002444	+	Intron	DEL	CC	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100002443_100002444delCC	uc003hui.2	-						ADH5_uc003huk.1_Intron|ADH5_uc003huj.2_Intron	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	tcctcctcaacccctcggtctc	0.119													3	4	---	---	---	---	
FRG1	2483	broad.mit.edu	37	4	190874371	190874372	+	Intron	DEL	AG	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190874371_190874372delAG	uc003izs.2	+							NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TTAAGCCCACAGGGTAATTTTG	0.252													5	3	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11589425	11589425	+	Intron	DEL	G	-	-	rs147045294	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11589425delG	uc003jfa.1	-						CTNND2_uc010itt.2_5'Flank|CTNND2_uc011cmy.1_5'Flank|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						acacacacacGACAACAACAA	0.259													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	50571607	50571607	+	IGR	DEL	A	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50571607delA								PARP8 (433438 upstream) : ISL1 (107351 downstream)																							AAACTTACAGAAAAAAAAAAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103978776	103978787	+	IGR	DEL	GAAGGAAGGAAG	-	-	rs68188764		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103978776_103978787delGAAGGAAGGAAG								None (None upstream) : RAB9BP1 (456388 downstream)																							agagagaaaagaaggaaggaaggaaggaagga	0.104													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	119505869	119505870	+	IGR	DEL	AC	-	-	rs72185249		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119505869_119505870delAC								FAM170A (534353 upstream) : PRR16 (294149 downstream)																							TTATTGGTGTacacacacacac	0.257													2	4	---	---	---	---	
SH3RF2	153769	broad.mit.edu	37	5	145343835	145343836	+	Intron	INS	-	TTCC	TTCC			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145343835_145343836insTTCC	uc003lnt.2	+						SH3RF2_uc011dbl.1_Intron	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2								ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			tttcccttcttttccttccttc	0.000													6	5	---	---	---	---	
TAP1	6890	broad.mit.edu	37	6	32819684	32819685	+	Intron	INS	-	TG	TG	rs141273059	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32819684_32819685insTG	uc003ocg.2	-						TAP1_uc011dqi.1_Intron|PSMB9_uc011dqj.1_5'Flank|PSMB9_uc003sga.2_5'Flank	NM_000593	NP_000584	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family						antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding			skin(1)	1						AGAAAAACAATTGTGTGTGTGT	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138156122	138156123	+	Intron	INS	-	AGGC	AGGC	rs56232106	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138156122_138156123insAGGC	uc003qhq.1	-											Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796.																		ggaaggaaggaaggcaggctct	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41223053	41223056	+	IGR	DEL	TCCT	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41223053_41223056delTCCT								C7orf10 (322696 upstream) : INHBA (505547 downstream)																							tttccccttctccttccttccttc	0.049													6	3	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89908833	89908833	+	Intron	DEL	G	-	-	rs71526681		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89908833delG	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_5'Flank	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						AATTTTTGGTGTTTTTTTTTT	0.219											OREG0003793	type=REGULATORY REGION|Gene=AK024715|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104719584	104719584	+	Intron	DEL	T	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104719584delT	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron|MLL5_uc003vco.1_Intron|MLL5_uc010ljd.1_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						CTATGAAGTCttttttttttt	0.204													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								3	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3432693	3432694	+	Intron	DEL	AA	-	-	rs71850597		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3432693_3432694delAA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAATCACAGTAAAAAAAAAAAA	0.381													6	3	---	---	---	---	
PSD3	23362	broad.mit.edu	37	8	18698977	18698978	+	Intron	INS	-	AC	AC	rs139457887	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18698977_18698978insAC	uc003wza.2	-							NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CTGCTATTTAAacacacacaca	0.342													4	4	---	---	---	---	
DPYSL2	1808	broad.mit.edu	37	8	26479671	26479672	+	Intron	INS	-	TCCC	TCCC	rs146599564	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26479671_26479672insTCCC	uc003xfb.1	+						DPYSL2_uc003xfa.2_Intron|DPYSL2_uc011lag.1_Intron|DPYSL2_uc010luk.1_Intron|DPYSL2_uc011lah.1_Intron	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		ccttccttccttccctctctct	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	67328399	67328402	+	IGR	DEL	GAAG	-	-	rs150500788		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67328399_67328402delGAAG								CRH (237701 upstream) : RRS1 (12861 downstream)																							aggaaggaaagaaggaaggaagga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	70928585	70928588	+	IGR	DEL	AAGG	-	-	rs28549004	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70928585_70928588delAAGG								SLCO5A1 (181286 upstream) : PRDM14 (35437 downstream)																							ggaaggaagaaaggaaggaaggaa	0.000													6	4	---	---	---	---	
UHRF2	115426	broad.mit.edu	37	9	6475179	6475180	+	Intron	INS	-	T	T			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6475179_6475180insT	uc003zjy.2	+						UHRF2_uc003zjz.2_Intron|UHRF2_uc003zka.1_Intron	NM_152896	NP_690856	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains						cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		TGAAGTCTGTATTTTTTTTCTC	0.272													4	2	---	---	---	---	
FAM189A2	9413	broad.mit.edu	37	9	72000680	72000683	+	Intron	DEL	TTTT	-	-	rs67899498		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72000680_72000683delTTTT	uc010mon.1	+						FAM189A2_uc004ahg.2_Intron|FAM189A2_uc010moo.1_Intron	NM_001127608	NP_001121080	Q15884	F1892_HUMAN	chromosome 9 open reading frame 61 precursor							integral to membrane					0						GTTTCGCCTCtttttttttttttt	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90097458	90097469	+	IGR	DEL	AGGAAGGAAGGA	-	-	rs28433935		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90097458_90097469delAGGAAGGAAGGA								C9orf170 (322817 upstream) : DAPK1 (15189 downstream)																							ggagggagggaggaaggaaggaaggaaggaag	0.108													4	2	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131598582	131598582	+	Intron	DEL	T	-	-	rs71497420		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598582delT	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	tctttctttgttttttttttt	0.090													8	8	---	---	---	---	
ARHGAP22	58504	broad.mit.edu	37	10	49862894	49862895	+	Intron	INS	-	C	C			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49862894_49862895insC	uc001jgv.2	-						ARHGAP22_uc010qgm.1_5'Flank			Q7Z5H3	RHG22_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP22;						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						ttcctctctcttttctttctct	0.054													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81784444	81784445	+	IGR	INS	-	AA	AA	rs150128041	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81784444_81784445insAA								MBL1P (73661 upstream) : LOC219347 (21546 downstream)																							ACTTTGTGGGGAAAAAAAATGA	0.297													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	111000355	111000358	+	IGR	DEL	GAAG	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111000355_111000358delGAAG								None (None upstream) : XPNPEP1 (624166 downstream)																							agggaggaaagaaggaaggaagga	0.020													3	3	---	---	---	---	
RRM1	6240	broad.mit.edu	37	11	4159297	4159298	+	Intron	INS	-	G	G			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4159297_4159298insG	uc001lyw.3	+						RRM1_uc009yej.2_Intron|RRM1_uc009yei.2_Intron|RRM1_uc010qyc.1_Intron|RRM1_uc010qyd.1_Intron	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	gctggccgggcgggggctgacc	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50138227	50138228	+	IGR	DEL	TG	-	-	rs74214329		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50138227_50138228delTG								OR4C12 (134190 upstream) : LOC441601 (100772 downstream)																							tgtgtgtgtttgtgtgtgtgtg	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	57390664	57390691	+	IGR	DEL	AGGAAGGAAGGAAGGAAGGAAGGAAGGG	-	-	rs71470280	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57390664_57390691delAGGAAGGAAGGAAGGAAGGAAGGAAGGG								SERPING1 (8338 upstream) : MIR130A (17980 downstream)																							gaaggaaggaaggaaggaaggaaggaaggaaggaagggagggagggag	0.000													4	6	---	---	---	---	
FOLH1B	219595	broad.mit.edu	37	11	89405323	89405326	+	Intron	DEL	TTTA	-	-	rs34562444		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89405323_89405326delTTTA	uc001pda.2	+							NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B						proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						aattatattgtttatttatttttg	0.142													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89702616	89702616	+	IGR	DEL	A	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89702616delA								KITLG (728378 upstream) : DUSP6 (39223 downstream)																							tctgaaaaataaaaaaaaaag	0.000													9	5	---	---	---	---	
RNF34	80196	broad.mit.edu	37	12	121840360	121840361	+	Intron	INS	-	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121840360_121840361insA	uc001ual.1	+						RNF34_uc010szw.1_Intron|RNF34_uc001uak.1_Intron|RNF34_uc001uam.1_Intron	NM_025126	NP_079402	Q969K3	RNF34_HUMAN	ring finger protein 34 isoform 2						apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		TATAAGGGATTAAAAAAAAAAA	0.302													5	7	---	---	---	---	
TMEM120B	144404	broad.mit.edu	37	12	122186093	122186094	+	Intron	INS	-	CA	CA			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122186093_122186094insCA	uc001ubc.3	+						TMEM120B_uc009zxh.2_Intron	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B							integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		aaggtgggaggctggggtagaa	0.203													4	2	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95848800	95848801	+	Intron	INS	-	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95848800_95848801insA	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	aagaccctgtcaaaaaaaataa	0.000													6	3	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92176036	92176041	+	Intron	DEL	AAAAAC	-	-	rs12882622		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92176036_92176041delAAAAAC	uc001xzs.1	-							NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				tccatctcaaaaaaacaaaaaaaaag	0.141													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31490972	31490987	+	IGR	DEL	CTTTCTTTCTTTCTTT	-	-	rs4041983	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31490972_31490987delCTTTCTTTCTTTCTTT								TRPM1 (97048 upstream) : KLF13 (128096 downstream)																							tccttccttcctttctttctttctttctttctttct	0.000													7	4	---	---	---	---	
DUOX1	53905	broad.mit.edu	37	15	45434984	45434987	+	Intron	DEL	AGGG	-	-	rs67057268		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45434984_45434987delAGGG	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		gaaggaaggaagggagggaggaag	0.225													1	6	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48052328	48052329	+	Intron	INS	-	AAAAG	AAAAG	rs75506472		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48052328_48052329insAAAAG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TATTTTGAGTTAAAAAGACCAT	0.337													4	2	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85443199	85443202	+	Intron	DEL	GAAG	-	-	rs112514136		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85443199_85443202delGAAG	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			aggaaggaaagaaggaaggaagga	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21598985	21598985	+	Intron	DEL	T	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21598985delT	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																		cagcagcCCATTTTTTTTTTC	0.194													4	2	---	---	---	---	
ITGAM	3684	broad.mit.edu	37	16	31281406	31281408	+	Intron	DEL	CTT	-	-	rs66864485		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31281406_31281408delCTT	uc002ebq.2	+						ITGAM_uc002ebr.2_Intron	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						GAATCTACTCCTTTTGTATATCT	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51462122	51462145	+	IGR	DEL	CTTTCTTTCTTTCTTTCTTTCTTT	-	-	rs13339367	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51462122_51462145delCTTTCTTTCTTTCTTTCTTTCTTT								SALL1 (276939 upstream) : None (None downstream)																							tccttccttcctttctttctttctttctttctttctttctttct	0.000													4	2	---	---	---	---	
PRPF8	10594	broad.mit.edu	37	17	1555190	1555190	+	Intron	DEL	T	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1555190delT	uc002fte.2	-						RILP_uc002ftd.2_5'Flank	NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein							catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		ACAGAgtttcttaaaacgtga	0.249													34	15	---	---	---	---	
USP43	124739	broad.mit.edu	37	17	9583331	9583331	+	Intron	DEL	T	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9583331delT	uc010cod.2	+						USP43_uc002gma.3_Intron|USP43_uc010vva.1_Intron|USP43_uc010coe.2_Intron	NM_153210	NP_694942	Q70EL4	UBP43_HUMAN	ubiquitin specific protease 43						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						AAAACTTAGATTTTTTTTTTT	0.303													3	3	---	---	---	---	
MYH8	4626	broad.mit.edu	37	17	10308044	10308045	+	Intron	DEL	AC	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10308044_10308045delAC	uc002gmm.2	-						uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,						muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TGCAGGCTTTacacacacacac	0.307									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19774746	19774751	+	IGR	DEL	CACACA	-	-	rs141832730	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19774746_19774751delCACACA								ULK2 (3507 upstream) : AKAP10 (34001 downstream)																							cacacacatgcacacacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35144162	35144162	+	IGR	DEL	G	-	-	rs71375425		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35144162delG								MRM1 (178756 upstream) : LHX1 (150337 downstream)																							gagggagggagggaagaagga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75921980	75921987	+	IGR	DEL	AAGGAAGA	-	-	rs67051242		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75921980_75921987delAAGGAAGA								FLJ45079 (41811 upstream) : TNRC6C (78331 downstream)																							ggaaggaaggaaggaagaaagaaagaaa	0.231													5	3	---	---	---	---	
EIF4A3	9775	broad.mit.edu	37	17	78120808	78120809	+	Intron	INS	-	TG	TG			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78120808_78120809insTG	uc010wuc.1	-						EIF4A3_uc002jxs.2_5'UTR	NM_014740	NP_055555	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A,						mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			gccgacctcgctgccgctgccg	0.282													4	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544180	80544180	+	Intron	DEL	C	-	-	rs66791901		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544180delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			caaaggtgggccgggggggaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	6556984	6556985	+	IGR	DEL	GT	-	-	rs72209180		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6556984_6556985delGT								L3MBTL4 (142074 upstream) : ARHGAP28 (231508 downstream)																							GTAGGAgtgcgtgtgtgtgtgt	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	66172072	66172073	+	IGR	INS	-	AGAA	AGAA	rs67144549		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66172072_66172073insAGAA								DSEL (988105 upstream) : TMX3 (168854 downstream)																							aggaaggaGAGAGAAAAAAGag	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76346100	76346101	+	IGR	DEL	AG	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76346100_76346101delAG								None (None upstream) : SALL3 (394174 downstream)																							aaagaaagaaagagagagagag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32668613	32668614	+	IGR	INS	-	GAAA	GAAA	rs78373305	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32668613_32668614insGAAA								TSHZ3 (828423 upstream) : ZNF507 (167900 downstream)																							aaggaaggaaggaaAATGATCT	0.104													5	6	---	---	---	---	
HNRNPUL1	11100	broad.mit.edu	37	19	41797899	41797899	+	Intron	DEL	C	-	-	rs66916970		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41797899delC	uc002oqb.3	+						CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Intron|HNRNPUL1_uc002oqa.3_Intron|HNRNPUL1_uc010ehm.2_Intron|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Intron|HNRNPUL1_uc010ehn.2_Intron|HNRNPUL1_uc010eho.2_Intron|HNRNPUL1_uc010xvy.1_Intron|HNRNPUL1_uc010ehp.2_Intron|HNRNPUL1_uc010ehl.1_Intron	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1						nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						aaaaaaaaaacaaaaaaaaaa	0.204													7	4	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49407784	49407784	+	Intron	DEL	C	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49407784delC	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GGACTGGtttctttttttttt	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39535643	39535644	+	IGR	DEL	AC	-	-	rs113163404		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39535643_39535644delAC								MAFB (217767 upstream) : TOP1 (121818 downstream)																							CCCTCCCcatacacacacacac	0.416													3	3	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	52086153	52086154	+	Intron	INS	-	AAAG	AAAG	rs116779353	by1000genomes	TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52086153_52086154insAAAG	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			gaaagatagatagagagggagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6444668	6444678	+	IGR	DEL	AGGAAGGAAGG	-	-	rs60232507		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6444668_6444678delAGGAAGGAAGG								NLGN4X (297962 upstream) : VCX3A (6982 downstream)																							gaaggaaggaaggaaggaaggaaaagaaaag	0.152													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	10327528	10327529	+	IGR	DEL	GT	-	-	rs143535318		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10327528_10327529delGT								CLCN4 (121831 upstream) : MID1 (86068 downstream)																							CTAGCCCAGCgtgtgtgtgtgt	0.208													4	2	---	---	---	---	
FUNDC1	139341	broad.mit.edu	37	X	44391012	44391015	+	Intron	DEL	ACAC	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44391012_44391015delACAC	uc004dgc.2	-							NM_173794	NP_776155	Q8IVP5	FUND1_HUMAN	FUN14 domain containing 1												0						gaagcttaaaacacacacacacac	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	82130968	82130969	+	IGR	INS	-	A	A			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82130968_82130969insA								None (None upstream) : POU3F4 (632300 downstream)																							CATTATAAACTAAAAAAAAAAa	0.139													6	5	---	---	---	---	
SYTL4	94121	broad.mit.edu	37	X	99930891	99930892	+	3'UTR	DEL	AT	-	-	rs67841104		TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99930891_99930892delAT	uc004egd.3	-	19					SYTL4_uc004egc.2_3'UTR|SYTL4_uc010nnb.2_3'UTR|SYTL4_uc010nnc.2_3'UTR|SYTL4_uc004ege.3_3'UTR|SYTL4_uc004egf.3_3'UTR	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4						exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GTTTGTacacatacacacacac	0.257													4	2	---	---	---	---	
KLHL13	90293	broad.mit.edu	37	X	117064254	117064257	+	Intron	DEL	AGGC	-	-			TCGA-B0-5110-01A-01D-1421-08	TCGA-B0-5110-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117064254_117064257delAGGC	uc004eql.2	-						KLHL13_uc004eqk.2_Intron|KLHL13_uc011mtn.1_Intron|KLHL13_uc011mto.1_Intron|KLHL13_uc011mtp.1_Intron|KLHL13_uc004eqm.2_Intron|KLHL13_uc011mtq.1_Intron	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13						cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						gaaggaaggaaggcaggcaggcag	0.000													6	4	---	---	---	---	
