Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16974972	16974972	+	RNA	SNP	C	T	T	rs58464479	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974972C>T	uc010och.1	+	7		c.1432C>T			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						GGACCAGAGCCTGGAAATGGT	0.637													3	40	---	---	---	---	PASS
MTF1	4520	broad.mit.edu	37	1	38300878	38300878	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38300878G>T	uc001cce.1	-	6	1004	c.863C>A	c.(862-864)CCC>CAC	p.P288H	MTF1_uc009vvj.1_5'UTR	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	288						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GCAGAAGAAGGGTCTTTCACC	0.363													25	166	---	---	---	---	PASS
ZYG11B	79699	broad.mit.edu	37	1	53245585	53245585	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53245585G>A	uc001cuj.2	+	4	1207	c.1012G>A	c.(1012-1014)GCA>ACA	p.A338T	ZYG11B_uc009vzg.2_RNA|ZYG11B_uc010onj.1_Missense_Mutation_p.A329T	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B	338							protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						CAGTGAACGGGCATTCTTTGT	0.388													5	223	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86591208	86591208	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86591208G>A	uc001dlj.2	-	3	853	c.811C>T	c.(811-813)CCC>TCC	p.P271S	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.P271S	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	271					cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		AATAGTTTGGGCGGGGGAGAG	0.398													24	221	---	---	---	---	PASS
AGL	178	broad.mit.edu	37	1	100336085	100336085	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100336085A>T	uc001dsi.1	+	6	1194	c.794A>T	c.(793-795)AAA>ATA	p.K265I	AGL_uc001dsj.1_Missense_Mutation_p.K265I|AGL_uc001dsk.1_Missense_Mutation_p.K265I|AGL_uc001dsl.1_Missense_Mutation_p.K265I|AGL_uc001dsm.1_Missense_Mutation_p.K249I|AGL_uc001dsn.1_Missense_Mutation_p.K248I	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	265	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GCAGAAGGGAAATACAAAGAA	0.383													22	133	---	---	---	---	PASS
VCAM1	7412	broad.mit.edu	37	1	101186246	101186246	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101186246C>A	uc001dti.2	+	2	399	c.279C>A	c.(277-279)TAC>TAA	p.Y93*	VCAM1_uc001dtj.2_Nonsense_Mutation_p.Y93*|VCAM1_uc010ouj.1_Intron	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a	93	Ig-like C2-type 1.|Extracellular (Potential).				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AACACTCTTACCTGTGCACAG	0.418													3	97	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145293269	145293269	+	5'Flank	SNP	G	A	A	rs61350760	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145293269G>A	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc010oyh.1_Intron|NBPF10_uc001emq.1_5'UTR	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TTTCACAACAGTAAGTTAAGA	0.423													8	70	---	---	---	---	PASS
OTUD7B	56957	broad.mit.edu	37	1	149920966	149920966	+	Silent	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149920966A>G	uc001etn.2	-	10	1499	c.1143T>C	c.(1141-1143)GAT>GAC	p.D381D		NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne	381	Catalytic.|TRAF-binding.				negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TATACTCTGAATCTGTAAGTG	0.453													8	64	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	167974003	167974003	+	Silent	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167974003A>G	uc001gew.2	+	10	1592	c.1350A>G	c.(1348-1350)GCA>GCG	p.A450A	DCAF6_uc001gev.2_Silent_p.A450A|DCAF6_uc001gex.2_Silent_p.A450A|DCAF6_uc010plk.1_Silent_p.A419A|DCAF6_uc001gey.2_Silent_p.A303A	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	450					positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						CTGTTGAGGCATCTGGACACC	0.378													17	79	---	---	---	---	PASS
C4BPA	722	broad.mit.edu	37	1	207300079	207300079	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207300079A>C	uc001hfo.2	+	7	922	c.728A>C	c.(727-729)GAT>GCT	p.D243A		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	243	Sushi 4.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						CGCAAGCCAGATGTTTCACAT	0.383													35	178	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234582578	234582578	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234582578C>T	uc001hwd.2	-	12	2105	c.2105G>A	c.(2104-2106)TGC>TAC	p.C702Y		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	702					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TTTCAACCTGCATGTGTTCAA	0.443													27	130	---	---	---	---	PASS
SCCPDH	51097	broad.mit.edu	37	1	246927551	246927551	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246927551G>T	uc001ibr.2	+	10	1341	c.994G>T	c.(994-996)GAT>TAT	p.D332Y		NM_016002	NP_057086	Q8NBX0	SCPDH_HUMAN	saccharopine dehydrogenase (putative)	332						midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity			ovary(1)	1	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		TTCACAGATTGATGCTGCCTC	0.403													4	152	---	---	---	---	PASS
TTC15	51112	broad.mit.edu	37	2	3392356	3392356	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3392356G>A	uc002qxm.1	+	2	1168	c.962G>A	c.(961-963)CGG>CAG	p.R321Q	TTC15_uc002qxn.1_Missense_Mutation_p.R321Q|TTC15_uc010ewm.1_Missense_Mutation_p.R321Q|TTC15_uc002qxl.1_Missense_Mutation_p.R321Q	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15	321							binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)		GGAGTCCTGCGGGCCGTGGCC	0.682													9	14	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29420425	29420425	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29420425C>G	uc002rmy.2	-	27	4963	c.4056G>C	c.(4054-4056)AAG>AAC	p.K1352N	ALK_uc010ymo.1_Missense_Mutation_p.K284N	NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	1352	Protein kinase.|Cytoplasmic (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	CAGGGCAGTTCTTGGGTGGGT	0.443			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				37	124	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32640925	32640925	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32640925A>G	uc010ezu.2	+	10	2700	c.2566A>G	c.(2566-2568)ATT>GTT	p.I856V		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	856					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CCAGGACACAATTACCTCGCT	0.383													15	65	---	---	---	---	PASS
KLRAQ1	129285	broad.mit.edu	37	2	48698316	48698316	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48698316G>A	uc002rwm.2	+	10	1173	c.988G>A	c.(988-990)GTG>ATG	p.V330M	KLRAQ1_uc002rwi.1_Missense_Mutation_p.V330M|KLRAQ1_uc002rwj.2_Missense_Mutation_p.V330M|KLRAQ1_uc002rwl.2_Missense_Mutation_p.V284M|KLRAQ1_uc002rwk.2_Missense_Mutation_p.V330M|KLRAQ1_uc010yok.1_Missense_Mutation_p.V330M	NM_001135629	NP_001129101	Q6ZMI0	KLRAQ_HUMAN	KLRAQ motif containing 1 isoform 1	330										ovary(1)	1						TGAGGATACTGTGACTGTCTT	0.383													30	156	---	---	---	---	PASS
SUCLG1	8802	broad.mit.edu	37	2	84668507	84668507	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84668507G>T	uc002son.2	-	4	588	c.395C>A	c.(394-396)GCT>GAT	p.A132D	SUCLG1_uc010ysk.1_Missense_Mutation_p.A119D	NM_003849	NP_003840	P53597	SUCA_HUMAN	succinate-CoA ligase, GDP-forming alpha subunit	132					tricarboxylic acid cycle		ATP citrate synthase activity|GTP binding|succinate-CoA ligase (GDP-forming) activity				0					Succinic acid(DB00139)	TGCCTCAATAGCTTCATTAAT	0.483													22	92	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103068649	103068649	+	3'UTR	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103068649C>T	uc002tbx.2	+	12					IL18RAP_uc010fiz.2_3'UTR	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein						cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						TGAAATGAGCCCTGGAGCCCC	0.498													18	84	---	---	---	---	PASS
PCDP1	200373	broad.mit.edu	37	2	120362275	120362275	+	5'UTR	SNP	C	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120362275C>G	uc002tmb.2	+	10					PCDP1_uc010yyq.1_Silent_p.T117T	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1							cilium	calmodulin binding				0	Colorectal(110;0.196)					GGTTGAATACCCTTTCTAAGA	0.373													8	33	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155265712	155265712	+	Intron	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155265712C>A	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_3'UTR|GALNT13_uc010fod.2_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						AATAAATGTACACTCAAATCT	0.318													4	7	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179590293	179590293	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590293C>A	uc010zfg.1	-	68	17130	c.16906G>T	c.(16906-16908)GCC>TCC	p.A5636S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A2297S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6563							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAGGCTGGGCGCCTTCTATG	0.428													3	103	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210905056	210905056	+	Intron	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210905056T>C	uc002vds.2	-						C2orf67_uc002vdt.2_Intron|C2orf67_uc002vdw.2_Silent_p.*706*|uc002vdu.1_Intron|C2orf67_uc002vdv.2_Silent_p.*706*	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		attcttttctTAGATTTTATT	0.144													4	12	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188218	10188218	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188218G>T	uc003bvc.2	+	2	574	c.361G>T	c.(361-363)GAT>TAT	p.D121Y	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	121	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.D121Y(2)|p.D121E(2)|p.D121G(2)|p.R120fs*38(1)|p.?(1)|p.D121_A122del(1)|p.R120fs*34(1)|p.D121*(1)|p.A122fs*7(1)|p.D121D(1)|p.D121fs*11(1)|p.D121fs*10(1)|p.D121fs*12(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GCTCTTCAGAGATGCAGGGAC	0.378		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				43	182	---	---	---	---	PASS
AZI2	64343	broad.mit.edu	37	3	28368357	28368357	+	Silent	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28368357T>C	uc003ceb.2	-	7	1264	c.732A>G	c.(730-732)CTA>CTG	p.L244L	AZI2_uc003cec.2_Silent_p.L132L|AZI2_uc003ced.2_Silent_p.L244L|AZI2_uc003cee.3_Silent_p.L244L	NM_022461	NP_071906	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2 isoform a	244	Interaction with TBK1.					mitochondrion|plasma membrane				ovary(2)	2						TCAGTTTTCTTAGTAGTTCAG	0.388													42	157	---	---	---	---	PASS
C3orf67	200844	broad.mit.edu	37	3	58899557	58899557	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58899557T>A	uc003dkt.1	-	6	461	c.52A>T	c.(52-54)ACC>TCC	p.T18S	uc003dku.1_Intron|C3orf67_uc003dkv.1_5'UTR|C3orf67_uc003dkw.2_Intron|C3orf67_uc011bfg.1_RNA	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	18											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		ATTTCACTGGTGAATGCTACT	0.383													21	90	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138413736	138413736	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138413736A>G	uc011bmq.1	-	12	1784	c.1784T>C	c.(1783-1785)CTT>CCT	p.L595P	PIK3CB_uc011bmn.1_Missense_Mutation_p.L107P|PIK3CB_uc011bmo.1_Missense_Mutation_p.L41P|PIK3CB_uc011bmp.1_Missense_Mutation_p.L182P	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	595	PI3K helical.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						CCAAATCTGAAGCAGCGCCTG	0.473													13	97	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505859	195505859	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505859T>C	uc011bto.1	-	3	12668	c.12208A>G	c.(12208-12210)ACT>GCT	p.T4070A	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	961	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGTCGGTGACA	0.602													2	2	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197348674	197348674	+	RNA	SNP	A	G	G	rs144273946	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197348674A>G	uc011bug.1	-	4		c.417T>C			LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						GGCTCTGTCCACCAAATGCAC	0.478													4	161	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30725802	30725802	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30725802G>C	uc003gsk.1	+	1	3766	c.2758G>C	c.(2758-2760)GAA>CAA	p.E920Q	PCDH7_uc011bxw.1_Missense_Mutation_p.E873Q|PCDH7_uc011bxx.1_Missense_Mutation_p.E920Q	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	920	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						AAAAGATCACGAAGACTTTTT	0.383													13	109	---	---	---	---	PASS
UGT2B15	7366	broad.mit.edu	37	4	69519852	69519852	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69519852G>T	uc011cal.1	-	5	1254	c.1216C>A	c.(1216-1218)CAC>AAC	p.H406N		NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor	406					steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						GCTTTCATGTGAGCAATGTTA	0.468													65	395	---	---	---	---	PASS
ZFP42	132625	broad.mit.edu	37	4	188924839	188924839	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188924839A>G	uc003izg.1	+	3	1123	c.878A>G	c.(877-879)AAA>AGA	p.K293R	ZFP42_uc003izh.1_Missense_Mutation_p.K293R|ZFP42_uc003izi.1_Missense_Mutation_p.K293R	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	293	C2H2-type 4.				female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		AATAACCTGAAAGCCCACATC	0.458													12	55	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572397	1572397	+	Intron	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572397C>T	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						TTGTCGATTACGGGTCTATAT	0.433													8	146	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21751733	21751733	+	3'UTR	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21751733G>T	uc010iuc.2	-	12					CDH12_uc011cno.1_3'UTR|CDH12_uc003jgk.2_3'UTR|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						gtgtgtgtgtgtgtgtgtttg	0.244										HNSCC(59;0.17)			4	29	---	---	---	---	PASS
GHR	2690	broad.mit.edu	37	5	42719044	42719044	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42719044A>C	uc003jmt.2	+	10	1478	c.1435A>C	c.(1435-1437)AGT>CGT	p.S479R	GHR_uc011cpq.1_Missense_Mutation_p.S292R	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	479	Cytoplasmic (Potential).				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	AAGCAATCCAAGTTCACTGTC	0.488													26	91	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98204294	98204294	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98204294A>C	uc003knf.2	-	30	4301	c.4153T>G	c.(4153-4155)TCA>GCA	p.S1385A	CHD1_uc010jbn.2_Missense_Mutation_p.S111A	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1385					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TCTGACACTGAAGATTTCTTG	0.398													36	137	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127642858	127642858	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127642858G>T	uc003kuu.2	-	42	5830	c.5391C>A	c.(5389-5391)TTC>TTA	p.F1797L		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1797					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGTCAAAGGTGAATCCAGGAA	0.289													44	271	---	---	---	---	PASS
ITK	3702	broad.mit.edu	37	5	156670646	156670646	+	Silent	SNP	C	A	A	rs142689933		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156670646C>A	uc003lwo.1	+	12	1156	c.1074C>A	c.(1072-1074)ATC>ATA	p.I358I		NM_005546	NP_005537	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	358					cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AATGGGTGATCGACCCCTCAG	0.493			T	SYK	peripheral T-cell lymphoma								55	174	---	---	---	---	PASS
PGBD1	84547	broad.mit.edu	37	6	28268767	28268767	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28268767A>G	uc003nky.2	+	7	1506	c.1136A>G	c.(1135-1137)AAG>AGG	p.K379R	PGBD1_uc003nkz.2_Missense_Mutation_p.K379R	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	379					viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity			ovary(4)	4						GCTCAAAAGAAGTTAAAGGTA	0.438													47	124	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28294515	28294515	+	Silent	SNP	T	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28294515T>G	uc003nla.2	-	4	1049	c.649A>C	c.(649-651)AGA>CGA	p.R217R	ZNF323_uc003nld.2_Silent_p.R217R|ZNF323_uc010jra.2_Silent_p.R217R|ZNF323_uc003nlb.2_Silent_p.R58R|ZNF323_uc010jrb.2_Silent_p.R58R|ZNF323_uc003nlc.2_Silent_p.R217R	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	217					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CAAGTTTCTCTGTACTTAGAA	0.428													71	124	---	---	---	---	PASS
HLA-H	3136	broad.mit.edu	37	6	29856961	29856961	+	3'UTR	SNP	G	A	A	rs113178503	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29856961G>A	uc010jro.2	+	3					HLA-G_uc011dmb.1_Intron|HLA-H_uc003nod.2_Intron					SubName: Full=cDNA FLJ52667, highly similar to HLA class I histocompatibility antigen, alpha chain H;												0						TATCCCAGGTGCCTGTGTCCA	0.562													3	18	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43153719	43153719	+	Silent	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43153719G>A	uc003ouk.2	+	4	852	c.777G>A	c.(775-777)TTG>TTA	p.L259L	CUL9_uc003ouj.1_Silent_p.L259L|CUL9_uc003oul.2_Silent_p.L259L|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_5'Flank	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	259					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						TTTTCTCCTTGGTGAAGCGCT	0.532													12	81	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495215	134495215	+	Silent	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495215A>G	uc003qen.3	-	3	245	c.156T>C	c.(154-156)CCT>CCC	p.P52P	SGK1_uc003qeo.3_Silent_p.P147P|SGK1_uc011ect.1_Silent_p.P42P|SGK1_uc011ecu.1_Silent_p.P52P|SGK1_uc011ecv.1_Silent_p.P66P|SGK1_uc011ecw.1_Silent_p.P80P	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	52	Necessary for localization to the cytoplasm.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ACTGAACTTCAGGGCTGCAGG	0.507													3	130	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148544374	148544374	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148544374T>A	uc003wfd.1	-	2	183	c.17A>T	c.(16-18)AAG>ATG	p.K6M	EZH2_uc011kug.1_Missense_Mutation_p.K6M|EZH2_uc003wfb.1_Missense_Mutation_p.K6M|EZH2_uc003wfc.1_Missense_Mutation_p.K6M|EZH2_uc011kuh.1_Missense_Mutation_p.K6M|EZH2_uc011kui.1_Missense_Mutation_p.K6M|EZH2_uc011kuj.1_RNA	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	6	Interaction with DNMT1, DNMT3A and DNMT3B.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CTCAGATTTCTTCCCAGTCTG	0.423			Mis		DLBCL								61	422	---	---	---	---	PASS
UBE2W	55284	broad.mit.edu	37	8	74742665	74742665	+	Missense_Mutation	SNP	G	T	T	rs17855421		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74742665G>T	uc003xzv.2	-	2	111	c.58C>A	c.(58-60)CCT>ACT	p.P20T	UBE2W_uc003xzt.2_Missense_Mutation_p.P20T|UBE2W_uc003xzu.2_Missense_Mutation_p.P31T|UBE2W_uc003xzw.2_RNA	NM_018299	NP_060769	Q96B02	UBE2W_HUMAN	ubiquitin-conjugating enzyme E2W (putative)	20					protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)			ATTCCAGGAGGTGGGTCATTT	0.274													36	221	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145697356	145697356	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145697356C>G	uc003zcz.2	+	13	1477	c.1412C>G	c.(1411-1413)TCC>TGC	p.S471C	KIFC2_uc003zda.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	471	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GCGGTGCTGTCCTGCCTCCGA	0.602													33	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	69440193	69440193	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69440193C>A	uc010mnx.1	+	3	446	c.277C>A	c.(277-279)CTT>ATT	p.L93I		NM_001098806	NP_001092276			coiled-coil domain containing 29																		AATATTAAATCTTAAGACACA	0.299													5	66	---	---	---	---	PASS
DHTKD1	55526	broad.mit.edu	37	10	12142206	12142206	+	Silent	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12142206C>A	uc001ild.3	+	9	1800	c.1701C>A	c.(1699-1701)ATC>ATA	p.I567I		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain	567					glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TGGACGGAATCAAGCTAGACT	0.343													99	238	---	---	---	---	PASS
FAM13C	220965	broad.mit.edu	37	10	61083812	61083812	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61083812G>C	uc001jkn.2	-	5	513	c.379C>G	c.(379-381)CCA>GCA	p.P127A	FAM13C_uc001jko.2_Missense_Mutation_p.P127A|FAM13C_uc010qid.1_Missense_Mutation_p.P44A|FAM13C_uc010qie.1_Missense_Mutation_p.P44A|FAM13C_uc010qif.1_Missense_Mutation_p.P149A|FAM13C_uc001jkp.2_Missense_Mutation_p.P44A	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1	127										ovary(2)	2						TCATGAGCTGGTGTTCCTGCT	0.478													119	261	---	---	---	---	PASS
SEMA4G	57715	broad.mit.edu	37	10	102732548	102732548	+	5'UTR	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102732548T>C	uc010qpt.1	+	2					SEMA4G_uc001krv.2_RNA|SEMA4G_uc001krw.1_5'UTR|SEMA4G_uc001krx.2_5'UTR|MIR608_hsa-mir-608|MI0003621_5'Flank	NM_017893	NP_060363	Q9NTN9	SEM4G_HUMAN	semaphorin 4G						cell differentiation|nervous system development	integral to membrane	receptor activity			breast(1)	1		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		TTATGACCCCTGACCTTCCAA	0.577													5	22	---	---	---	---	PASS
ZNF511	118472	broad.mit.edu	37	10	135125256	135125256	+	Silent	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135125256G>A	uc001lml.1	+	5	616	c.591G>A	c.(589-591)GAG>GAA	p.E197E	TUBGCP2_uc001lmg.1_5'Flank|TUBGCP2_uc010qvc.1_5'Flank|TUBGCP2_uc009ybk.1_5'Flank|TUBGCP2_uc010qvd.1_5'Flank|TUBGCP2_uc001lmh.1_RNA|ZNF511_uc001lmj.1_Silent_p.E197E|ZNF511_uc001lmk.1_Missense_Mutation_p.A178T|ZNF511_uc001lmm.1_RNA			Q8NB15	ZN511_HUMAN	SubName: Full=cDNA FLJ78327; SubName: Full=Zinc finger protein 511, isoform CRA_d;	197					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		ACAGTGGAGAGCGGTCAGAAG	0.632													6	121	---	---	---	---	PASS
TCN1	6947	broad.mit.edu	37	11	59622280	59622280	+	Silent	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59622280A>G	uc001noj.2	-	7	1064	c.966T>C	c.(964-966)CCT>CCC	p.P322P		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	322					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCACAGTTATAGGCTCATCAG	0.388													24	135	---	---	---	---	PASS
GPR137	56834	broad.mit.edu	37	11	64055547	64055547	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64055547T>C	uc001nzg.1	+	5	952	c.644T>C	c.(643-645)GTG>GCG	p.V215A	GPR137_uc009ypj.1_Missense_Mutation_p.V221A|GPR137_uc010rni.1_Missense_Mutation_p.V273A|GPR137_uc001nze.1_Missense_Mutation_p.V215A|GPR137_uc001nzf.2_Intron|GPR137_uc001nzi.2_Missense_Mutation_p.V215A|GPR137_uc010rnj.1_Missense_Mutation_p.V215A	NM_020155	NP_064540	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	215	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(1)	1						GGGACCAGTGTGTGCCAGGCG	0.647													25	96	---	---	---	---	PASS
C11orf24	53838	broad.mit.edu	37	11	68031203	68031203	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68031203G>T	uc001onr.3	-	3	475	c.33C>A	c.(31-33)TTC>TTA	p.F11L	C11orf24_uc001ons.2_Missense_Mutation_p.F11L	NM_022338	NP_071733	Q96F05	CK024_HUMAN	hypothetical protein LOC53838 precursor	11						integral to membrane					0						AGGACAAGGAGAAAATCCAAA	0.577													5	34	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92531125	92531125	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92531125C>T	uc001pdj.3	+	9	4963	c.4946C>T	c.(4945-4947)CCG>CTG	p.P1649L		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1649	Cadherin 15.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGGGATCCCCGCCAATGTCT	0.468										TCGA Ovarian(4;0.039)			21	79	---	---	---	---	PASS
GLB1L2	89944	broad.mit.edu	37	11	134240284	134240284	+	Silent	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134240284C>T	uc001qhp.2	+	12	1394	c.1206C>T	c.(1204-1206)TAC>TAT	p.Y402Y	GLB1L2_uc009zdg.1_RNA	NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2 precursor	402					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		CCCTCAAGTACCTGGGGGAGG	0.637													26	130	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2566764	2566764	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2566764A>T	uc009zdu.1	+	5	962	c.649A>T	c.(649-651)AAA>TAA	p.K217*	CACNA1C_uc009zdv.1_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkb.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkc.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qke.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkf.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qjz.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkd.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkg.2_Nonsense_Mutation_p.K217*|CACNA1C_uc009zdw.1_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkh.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkl.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkn.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qko.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkp.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkr.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qku.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkq.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qks.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qkt.2_Nonsense_Mutation_p.K217*|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	217	Extracellular (Potential).|I.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	ACAAGCAACCAAAGCAGATGG	0.567													42	195	---	---	---	---	PASS
STAT6	6778	broad.mit.edu	37	12	57493192	57493192	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57493192G>T	uc009zpe.2	-	16	2027	c.1776C>A	c.(1774-1776)TTC>TTA	p.F592L	STAT6_uc009zpf.2_Missense_Mutation_p.F592L|STAT6_uc001sna.2_Missense_Mutation_p.F592L|STAT6_uc010srb.1_Missense_Mutation_p.F482L|STAT6_uc010src.1_Missense_Mutation_p.F482L|STAT6_uc010srd.1_Missense_Mutation_p.F482L|STAT6_uc009zpg.2_Missense_Mutation_p.F641L	NM_003153	NP_003144	P42226	STAT6_HUMAN	signal transducer and activator of transcription	592	SH2.				regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4						CTTTGGCAGAGAATGGCTGGA	0.532													31	92	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	100378000	100378000	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100378000C>G	uc001tge.1	-	1	433	c.16G>C	c.(16-18)GAG>CAG	p.E6Q	ANKS1B_uc001tgf.1_5'UTR|ANKS1B_uc009ztt.1_Missense_Mutation_p.E6Q	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	6	ANK 1.					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TCCAGCAGCTCCTGGTCCTTC	0.647													9	31	---	---	---	---	PASS
PRDM4	11108	broad.mit.edu	37	12	108145591	108145591	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108145591T>A	uc001tmp.2	-	5	1164	c.727A>T	c.(727-729)AAC>TAC	p.N243Y	PRDM4_uc001tmq.2_RNA	NM_012406	NP_036538	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	243					cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GCTGCAAGGTTGTTGCTCACA	0.542													21	86	---	---	---	---	PASS
ISCU	23479	broad.mit.edu	37	12	108961053	108961053	+	Intron	SNP	C	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108961053C>G	uc010sxc.1	+						ISCU_uc010sxa.1_Missense_Mutation_p.L143V|ISCU_uc010sxb.1_Intron|ISCU_uc001tnc.3_Intron|ISCU_uc009zuy.2_Intron|ISCU_uc010sxd.1_Intron	NM_213595	NP_998760	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme isoform						iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold				0						CAGTAAGTCTCTGCTCTCCAT	0.478													14	122	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19413025	19413025	+	RNA	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19413025A>G	uc010tcj.1	-	1		c.33085T>C				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						AATAACCTGCACATCCATGCA	0.299													3	47	---	---	---	---	PASS
NUDT15	55270	broad.mit.edu	37	13	48619890	48619890	+	Silent	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48619890A>G	uc001vbw.1	+	3	630	c.450A>G	c.(448-450)AAA>AAG	p.K150K		NM_018283	NP_060753	Q9NV35	NUD15_HUMAN	nudix-type motif 15	150	Interaction with PCNA.						hydrolase activity|metal ion binding				0		all_cancers(8;3.75e-25)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|all_hematologic(8;0.000219)|Lung NSC(96;0.000226)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;4.83e-07)		ATCCATTTAAAGAAGATCTGA	0.433													37	164	---	---	---	---	PASS
DCT	1638	broad.mit.edu	37	13	95114377	95114377	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95114377A>C	uc001vlv.3	-	5	1357	c.930T>G	c.(928-930)AAT>AAG	p.N310K	DCT_uc010afh.2_Missense_Mutation_p.N310K	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	310	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TTCCCATTTGATTTCTTCTCA	0.383													17	79	---	---	---	---	PASS
BRMS1L	84312	broad.mit.edu	37	14	36304068	36304068	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36304068G>T	uc001wtl.2	+	4	506	c.380G>T	c.(379-381)TGC>TTC	p.C127F	BRMS1L_uc010tpx.1_Missense_Mutation_p.C79F	NM_032352	NP_115728	Q5PSV4	BRM1L_HUMAN	breast cancer metastasis-suppressor 1-like	127					regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				skin(1)	1	Breast(36;0.137)|Hepatocellular(127;0.158)		Lung(8;1.7e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.00467)|all cancers(34;0.0157)|BRCA - Breast invasive adenocarcinoma(188;0.158)	GBM - Glioblastoma multiforme(112;0.0333)		AGAGAGCTCTGCTTAGAATCT	0.363													12	79	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68270845	68270845	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68270845G>A	uc001xka.2	-	9	1547	c.1408C>T	c.(1408-1410)CCA>TCA	p.P470S	ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkc.3_Missense_Mutation_p.P470S|ZFYVE26_uc010tta.1_Missense_Mutation_p.P470S	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	470					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCCTTGGCTGGCACTTTCTGT	0.512													4	158	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73685985	73685985	+	Silent	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73685985A>G	uc001xnr.2	+	12	1676	c.1392A>G	c.(1390-1392)CAA>CAG	p.Q464Q	PSEN1_uc001xnv.2_Silent_p.Q460Q|PSEN1_uc010ark.2_Silent_p.Q460Q|PSEN1_uc001xnu.2_RNA	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	464	Cytoplasmic (Potential).|Interaction with MTCH1.				amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		CATTCCATCAATTTTATATCT	0.393													67	300	---	---	---	---	PASS
ACOT6	641372	broad.mit.edu	37	14	74086150	74086150	+	Silent	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74086150T>C	uc001xop.2	+	2	562	c.231T>C	c.(229-231)ACT>ACC	p.T77T		NM_001037162	NP_001032239	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6	77						cytosol	carboxylesterase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		GATTTCTCACTTTTATGGACA	0.408													23	181	---	---	---	---	PASS
SPPL2A	84888	broad.mit.edu	37	15	51028841	51028841	+	Missense_Mutation	SNP	G	T	T	rs147266738		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51028841G>T	uc001zyv.2	-	7	1010	c.830C>A	c.(829-831)ACG>AAG	p.T277K		NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A	277						integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		AGATACGTACGTGCATTGTCC	0.318													4	111	---	---	---	---	PASS
ADAM10	102	broad.mit.edu	37	15	58925400	58925400	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58925400A>G	uc002afd.1	-	9	1615	c.1171T>C	c.(1171-1173)TCC>CCC	p.S391P	ADAM10_uc010bgc.1_RNA|ADAM10_uc010ugz.1_Missense_Mutation_p.S90P|ADAM10_uc002afe.1_Intron	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor	391	Peptidase M12B.|Extracellular (Potential).				cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		CTTACTGGGGATCCAAAGTTA	0.318													10	98	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59464119	59464119	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59464119T>A	uc002aga.2	-	22	2829	c.2457A>T	c.(2455-2457)GAA>GAT	p.E819D	MIR2116_hsa-mir-2116|MI0010635_5'Flank	NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	819					actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		ACAAGATCCGTTCTATCTCGA	0.532													19	105	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102304772	102304772	+	5'Flank	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102304772T>C	uc002cbx.1	-						uc002ccc.1_5'Flank|uc002ccf.3_RNA|uc002ccg.3_5'Flank|uc010uth.1_5'Flank|uc002cci.2_5'Flank|uc002ccj.2_5'Flank|uc002cck.2_5'Flank|uc002ccl.1_5'Flank|uc002ccm.1_5'Flank					DQ582460																		CACAGCGGCGTGACGAGACTC	0.587													3	3	---	---	---	---	PASS
ELMO3	79767	broad.mit.edu	37	16	67236114	67236114	+	Silent	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67236114C>T	uc002esa.2	+	13	1390	c.1347C>T	c.(1345-1347)CAC>CAT	p.H449H	ELMO3_uc002esb.2_Silent_p.H432H|ELMO3_uc002esc.2_Silent_p.H283H	NM_024712	NP_078988	Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	396	ELMO.				apoptosis|phagocytosis	cytoplasm|cytoskeleton	SH3 domain binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		AGGACAAGCACGAGTGCCCCT	0.642													65	198	---	---	---	---	PASS
TRPV3	162514	broad.mit.edu	37	17	3419752	3419752	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3419752G>A	uc002fvt.1	-	16	2519	c.2197C>T	c.(2197-2199)CGG>TGG	p.R733W	SPATA22_uc010vrg.1_5'Flank|TRPV3_uc002fvs.1_RNA|TRPV3_uc010vrh.1_Missense_Mutation_p.R717W|TRPV3_uc010vri.1_Missense_Mutation_p.R688W|TRPV3_uc010vrj.1_Missense_Mutation_p.R717W|TRPV3_uc010vrk.1_RNA|TRPV3_uc010vrl.1_Missense_Mutation_p.R717W|TRPV3_uc010vrm.1_RNA|TRPV3_uc002fvr.2_Missense_Mutation_p.R733W|TRPV3_uc002fvu.2_Missense_Mutation_p.R733W	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,	733	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	CTTTGTTACCGCAAACACAGT	0.537													4	141	---	---	---	---	PASS
KRBA2	124751	broad.mit.edu	37	17	8274814	8274814	+	Silent	SNP	T	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8274814T>G	uc002glf.1	-	1	45	c.39A>C	c.(37-39)CCA>CCC	p.P13P	KRBA2_uc002glg.1_Intron	NM_213597	NP_998762	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	13					DNA integration|regulation of transcription, DNA-dependent	intracellular	DNA binding				0						TCAGCAGGACTGGGGAAGAGA	0.468													10	63	---	---	---	---	PASS
TBC1D29	26083	broad.mit.edu	37	17	28887640	28887640	+	Silent	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28887640T>C	uc002hfh.2	+	3	233	c.84T>C	c.(82-84)TCT>TCC	p.S28S	TBC1D29_uc002hfi.2_RNA|uc002hfj.1_5'Flank	NM_015594	NP_056409	Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	28	Rab-GAP TBC; truncated.					intracellular	Rab GTPase activator activity				0		Myeloproliferative disorder(56;0.0255)				CACAGATCTCTCTCGGGCTCA	0.547													25	108	---	---	---	---	PASS
ATAD5	79915	broad.mit.edu	37	17	29220506	29220506	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29220506T>A	uc002hfs.1	+	21	4981	c.4635T>A	c.(4633-4635)AAT>AAA	p.N1545K		NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1545					response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAAGTATGAATTGTCTTGCTA	0.353													15	96	---	---	---	---	PASS
STARD3	10948	broad.mit.edu	37	17	37809762	37809762	+	5'UTR	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37809762C>T	uc002hsd.2	+	2					STARD3_uc010weg.1_5'UTR|STARD3_uc010weh.1_RNA|STARD3_uc002hse.2_5'UTR|STARD3_uc010wei.1_5'UTR|STARD3_uc002hsf.2_5'UTR	NM_006804	NP_006795	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain						cholesterol metabolic process|mitochondrial transport|steroid biosynthetic process	integral to membrane|late endosome membrane	cholesterol binding|cholesterol transporter activity				0	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCCCTCCCCGCCCTGAGGTGG	0.706													4	31	---	---	---	---	PASS
STARD3	10948	broad.mit.edu	37	17	37815807	37815807	+	Splice_Site	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37815807G>A	uc002hsd.2	+	9	919	c.795_splice	c.e9+1	p.N265_splice	STARD3_uc010weh.1_Splice_Site|STARD3_uc002hse.2_Splice_Site_p.N247_splice|STARD3_uc010wei.1_Splice_Site_p.N265_splice|STARD3_uc002hsf.2_Splice_Site_p.N131_splice|STARD3_uc002hsg.2_Splice_Site_p.N98_splice	NM_006804	NP_006795	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain						cholesterol metabolic process|mitochondrial transport|steroid biosynthetic process	integral to membrane|late endosome membrane	cholesterol binding|cholesterol transporter activity				0	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GAAGAATAATGTAAGAAGCCC	0.532													10	62	---	---	---	---	PASS
KRT28	162605	broad.mit.edu	37	17	38953169	38953169	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38953169G>T	uc002hvh.1	-	5	1043	c.977C>A	c.(976-978)ACG>AAG	p.T326K		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	326	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				GTCACCTACCGTGGCCATCAG	0.572													30	127	---	---	---	---	PASS
KRTAP4-1	85285	broad.mit.edu	37	17	39340703	39340703	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39340703G>C	uc002hwe.3	-	2	388	c.347C>G	c.(346-348)ACT>AGT	p.T116S		NM_033060	NP_149049	Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	135	16.|18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCGGCAGCAAGTTGCACGGCA	0.557													8	108	---	---	---	---	PASS
KRT35	3886	broad.mit.edu	37	17	39633889	39633889	+	Silent	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39633889G>A	uc002hws.2	-	6	1144	c.1101C>T	c.(1099-1101)GCC>GCT	p.A367A		NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35	367	Rod.|Coil 2.				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				CCCGGATCTCGGCCAGCTGGG	0.647													3	83	---	---	---	---	PASS
TMEM106A	113277	broad.mit.edu	37	17	41370020	41370020	+	3'UTR	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41370020C>T	uc002idn.1	+	9					TMEM106A_uc010why.1_3'UTR|TMEM106A_uc010cze.1_3'UTR|TMEM106A_uc010whz.1_3'UTR	NM_145041	NP_659478	Q96A25	T106A_HUMAN	transmembrane protein 106A							integral to membrane					0		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		CCTCCAGTTTCCCCCAGATTC	0.378													4	6	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630848	44630848	+	3'UTR	SNP	C	T	T	rs139733485	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630848C>T	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						tttttttcttctcttttgaga	0.154													5	177	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630855	44630855	+	3'UTR	SNP	G	C	C	rs144516284	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630855G>C	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						cttctcttttgagacggagtt	0.139													5	159	---	---	---	---	PASS
ACE	1636	broad.mit.edu	37	17	61559983	61559983	+	Silent	SNP	G	A	A	rs143321044	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61559983G>A	uc002jau.1	+	8	1297	c.1275G>A	c.(1273-1275)GCG>GCA	p.A425A	ACE_uc010wpi.1_Silent_p.A425A|ACE_uc010ddu.1_Silent_p.A242A|ACE_uc002jav.1_5'Flank|ACE_uc010ddv.1_5'Flank|ACE_uc010wpj.1_5'Flank|ACE_uc002jaw.1_5'Flank|ACE_uc010wpk.1_5'Flank	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	425	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	ACGTGCTGGCGCTCTCGGTCT	0.622													7	194	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67101822	67101822	+	Intron	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67101822A>G	uc002jhw.1	-						ABCA6_uc002jhx.1_3'UTR	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TTATTTATTTAGTAAGAcatt	0.179													9	26	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67101823	67101823	+	Intron	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67101823G>T	uc002jhw.1	-						ABCA6_uc002jhx.1_3'UTR	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TATTTATTTAGTAAGAcattc	0.184													9	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76475699	76475699	+	IGR	SNP	A	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76475699A>T								DNAH17 (6843 upstream) : CYTH1 (194432 downstream)																							CTCACAGCAAACACGCAGAAA	0.622													14	140	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76803099	76803099	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76803099T>A	uc002jvz.1	-	14	2352	c.2027A>T	c.(2026-2028)GAG>GTG	p.E676V	USP36_uc002jwa.1_Missense_Mutation_p.E676V|USP36_uc002jwb.1_Missense_Mutation_p.E313V|USP36_uc002jwc.1_Missense_Mutation_p.E376V	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	676					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GCTTGCAGGCTCAGTGGTGGT	0.577													6	112	---	---	---	---	PASS
C18orf22	79863	broad.mit.edu	37	18	77797401	77797401	+	Silent	SNP	G	A	A	rs142434986		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77797401G>A	uc002lns.2	+	3	411	c.273G>A	c.(271-273)GCG>GCA	p.A91A	C18orf22_uc010drh.2_Silent_p.A91A|C18orf22_uc010dri.1_Intron	NM_024805	NP_079081	Q8N0V3	RBFA_HUMAN	hypothetical protein LOC79863 precursor	91					rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)		AAGACCATGCGCGCCTGAGGG	0.527													34	112	---	---	---	---	PASS
ZNF833	401898	broad.mit.edu	37	19	11795989	11795989	+	5'UTR	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11795989C>A	uc010dyg.2	+	3					ZNF833_uc002msl.3_RNA	NM_001013691	NP_001013713			zinc finger protein 833												0						AAAGAAACTCCATGTAAGAAA	0.388													3	53	---	---	---	---	PASS
CIB3	117286	broad.mit.edu	37	19	16279070	16279070	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16279070G>T	uc002nds.2	-	4	224	c.224C>A	c.(223-225)GCC>GAC	p.A75D	CIB3_uc010eae.2_Missense_Mutation_p.A14D|CIB3_uc010eaf.2_Intron|CIB3_uc010eag.2_Missense_Mutation_p.A26D	NM_054113	NP_473454	Q96Q77	CIB3_HUMAN	DNA-dependent protein kinase catalytic	75	EF-hand 1.						calcium ion binding			ovary(1)	1						GAATACCTGGGCAATCCTCTG	0.562													3	29	---	---	---	---	PASS
CEACAM5	1048	broad.mit.edu	37	19	42219626	42219626	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42219626A>T	uc002ork.2	+	4	882	c.761A>T	c.(760-762)AAT>ATT	p.N254I	CEACAM5_uc010ehz.1_3'UTR|CEACAM5_uc002orj.1_Missense_Mutation_p.N254I|CEACAM5_uc002orl.2_Missense_Mutation_p.N254I	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	254	Ig-like 3.					anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		TCAGGGGAAAATCTGAACCTC	0.507													7	53	---	---	---	---	PASS
IRF2BP1	26145	broad.mit.edu	37	19	46388204	46388204	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46388204C>A	uc002pds.1	-	1	1173	c.829G>T	c.(829-831)GAA>TAA	p.E277*		NM_015649	NP_056464	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein	277					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		CAGGGGTATTCGGTGAAGAGC	0.617													13	63	---	---	---	---	PASS
CYTH2	9266	broad.mit.edu	37	19	48975728	48975728	+	Intron	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48975728G>A	uc002pjj.3	+						uc002pjg.2_5'Flank|CYTH2_uc010xzr.1_Silent_p.G127G|CYTH2_uc002pji.2_Intron	NM_017457	NP_059431	Q99418	CYH2_HUMAN	cytohesin 2 isoform 1						actin cytoskeleton organization|endocytosis|regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|membrane fraction|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						CTCCTGTGGGGCCCCTCCCTC	0.672													6	17	---	---	---	---	PASS
ZNF350	59348	broad.mit.edu	37	19	52468840	52468840	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52468840G>T	uc002pyd.2	-	5	1094	c.866C>A	c.(865-867)CCC>CAC	p.P289H	uc002pyb.2_Intron|uc002pyc.2_Intron	NM_021632	NP_067645	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	289					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|transcriptional repressor complex	DNA binding|protein binding|zinc ion binding			breast(1)	1		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		GCATATATAGGGTTTCTCTCC	0.398													11	259	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52942411	52942411	+	Silent	SNP	G	A	A	rs113700997		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52942411G>A	uc002pzk.2	+	4	1798	c.1737G>A	c.(1735-1737)GCG>GCA	p.A579A	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Silent_p.A566A	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	579	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACACCTTGCGCGACATAGGA	0.443													5	16	---	---	---	---	PASS
ZNF611	81856	broad.mit.edu	37	19	53208689	53208689	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53208689C>A	uc002pzz.2	-	7	1936	c.1619G>T	c.(1618-1620)TGT>TTT	p.C540F	ZNF611_uc010eqc.2_Missense_Mutation_p.C470F|ZNF611_uc010ydo.1_Missense_Mutation_p.C470F|ZNF611_uc010ydr.1_Missense_Mutation_p.C471F|ZNF611_uc010ydp.1_Missense_Mutation_p.C540F|ZNF611_uc010ydq.1_Missense_Mutation_p.C540F|ZNF611_uc002qaa.3_Missense_Mutation_p.C470F	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a	540	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		ACAAACCTTACATTTGTATGG	0.388													13	396	---	---	---	---	PASS
ZNF702P	79986	broad.mit.edu	37	19	53472914	53472914	+	RNA	SNP	A	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53472914A>G	uc002qan.3	-	4		c.1587T>C				NR_003578				Synthetic construct DNA, clone: pF1KB9679, Homo sapiens ZNF702 gene for zinc finger protein 702, without stop codon, in Flexi system.												0						TTTGATTTTCAATTAAAAACC	0.338													4	41	---	---	---	---	PASS
ZNF418	147686	broad.mit.edu	37	19	58439174	58439174	+	Silent	SNP	A	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58439174A>T	uc002qqs.1	-	4	667	c.375T>A	c.(373-375)CGT>CGA	p.R125R	ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Silent_p.R40R	NM_133460	NP_597717	Q8TF45	ZN418_HUMAN	zinc finger protein 418	125					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		TCTGGTGCGGACGGTTTGAAC	0.458													38	225	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33337368	33337368	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33337368T>A	uc002xav.2	-	10	5201	c.2630A>T	c.(2629-2631)AAT>ATT	p.N877I	NCOA6_uc002xaw.2_Missense_Mutation_p.N877I	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	877	TBP/GTF2A-binding region.|NCOA1-binding region.|NCOA6IP-binding region.|CREBBP-binding region.|Gln-rich.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						GACATCCTTATTGACTGGGAA	0.448													50	146	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33337408	33337408	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33337408T>A	uc002xav.2	-	10	5161	c.2590A>T	c.(2590-2592)AAT>TAT	p.N864Y	NCOA6_uc002xaw.2_Missense_Mutation_p.N864Y	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	864	TBP/GTF2A-binding region.|NCOA1-binding region.|NCOA6IP-binding region.|CREBBP-binding region.|Gln-rich.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						GACATCTGATTTCCATTGGGA	0.502													53	151	---	---	---	---	PASS
SRMS	6725	broad.mit.edu	37	20	62174694	62174694	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62174694G>T	uc002yfi.1	-	3	659	c.618C>A	c.(616-618)AAC>AAA	p.N206K		NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory	206	SH2.						ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|lung(1)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			GCAGCAGGGGGTTCTGGATCA	0.652													44	97	---	---	---	---	PASS
HPS4	89781	broad.mit.edu	37	22	26864514	26864514	+	Intron	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26864514T>C	uc003acl.2	-						HPS4_uc003aci.2_Intron|HPS4_uc003acj.2_Intron|HPS4_uc003ack.2_5'UTR|HPS4_uc003acn.2_Intron|HPS4_uc010gvd.1_Intron|HPS4_uc003ach.2_Intron	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a						lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						GACTTTACAATACCTGCTCCT	0.592									Hermansky-Pudlak_syndrome				8	40	---	---	---	---	PASS
APOL2	23780	broad.mit.edu	37	22	36623378	36623378	+	3'UTR	SNP	A	T	T	rs71747603		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36623378A>T	uc003aoz.2	-	5					APOL2_uc011amm.1_3'UTR|APOL2_uc003apa.2_3'UTR	NM_030882	NP_112092	Q9BQE5	APOL2_HUMAN	apolipoprotein L2						acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0						aaaaaaaaaaaaaaaaaaaaG	0.274													3	32	---	---	---	---	PASS
MKL1	57591	broad.mit.edu	37	22	40859228	40859228	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40859228G>A	uc003ayv.1	-	1	211	c.4C>T	c.(4-6)CCG>TCG	p.P2S	MKL1_uc003ayw.1_Missense_Mutation_p.P2S|MKL1_uc010gye.1_Missense_Mutation_p.P2S|MKL1_uc010gyf.1_Missense_Mutation_p.P2S|MKL1_uc003ayy.1_RNA	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	2	Mediates interaction with SCAI and ACTB (By similarity).				positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CACTTACGCGGCATGATCCCT	0.527			T	RBM15	acute megakaryocytic leukemia								5	237	---	---	---	---	PASS
ZRSR2	8233	broad.mit.edu	37	X	15827361	15827361	+	Silent	SNP	C	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15827361C>T	uc004cxg.3	+	7	522	c.477C>T	c.(475-477)CCC>CCT	p.P159P		NM_005089	NP_005080	Q15696	U2AFM_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 2	159					spliceosome assembly	U12-type spliceosomal complex	nucleotide binding|pre-mRNA 3'-splice site binding|protein binding|zinc ion binding			breast(3)	3	Hepatocellular(33;0.183)					CAGAACCACCCGTGGATTTCA	0.393													4	241	---	---	---	---	PASS
CXorf59	286464	broad.mit.edu	37	X	36083809	36083809	+	5'UTR	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36083809T>C	uc004ddk.1	+	2						NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464							integral to membrane				central_nervous_system(1)	1						TCTTACTATTTACCCATATAT	0.318													6	112	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028075	37028075	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028075T>A	uc004ddl.1	+	1	1606	c.1592T>A	c.(1591-1593)GTG>GAG	p.V531E		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	531										ovary(3)	3						AAGATTCTGGTGTCCAGTCTC	0.617													6	169	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66764972	66764972	+	5'UTR	SNP	T	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66764972T>C	uc004dwu.1	+	1					AR_uc011mpd.1_5'UTR|AR_uc011mpe.1_RNA|AR_uc011mpf.1_5'UTR	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1						cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	AGGTGGAAGATTCAGCCAAGC	0.572									Androgen_Insensitivity_Syndrome				5	26	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69595153	69595153	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69595153G>C	uc004dyg.2	+	17	2005	c.1878G>C	c.(1876-1878)AAG>AAC	p.K626N	KIF4A_uc010nkw.2_Missense_Mutation_p.K626N|KIF4A_uc004dyf.1_Missense_Mutation_p.K626N	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	626	Potential.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						TGAAACTAAAGGAATCCACAG	0.453													24	122	---	---	---	---	PASS
TDGF3	6998	broad.mit.edu	37	X	109764826	109764826	+	RNA	SNP	C	G	G			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109764826C>G	uc004eos.1	+	1		c.1287C>G				NR_002718				Human (clone CR-3) teratocarcinoma-derived growth factor 3 (TDGF3) mRNA, complete cds.												0						GATGGATGAGCACCTCGTGGC	0.517													25	95	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12464220	12464220	+	Intron	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12464220delA	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ATTTGTCTTTAAAAAAAAAAA	0.313													4	2	---	---	---	---	
IGSF21	84966	broad.mit.edu	37	1	18445413	18445416	+	Intron	DEL	CCTT	-	-	rs72069989		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18445413_18445416delCCTT	uc001bau.1	+							NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		tccctccctcccttcctttcttcc	0.225													4	2	---	---	---	---	
COL24A1	255631	broad.mit.edu	37	1	86324304	86324305	+	Intron	INS	-	TCCCTCCTTCCTTCCTTCCT	TCCCTCCTTCCTTCCTTCCT	rs61785060		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86324304_86324305insTCCCTCCTTCCTTCCTTCCT	uc001dlj.2	-						COL24A1_uc001dli.2_Intron|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TATTTTCtccctccttccttcc	0.025													4	6	---	---	---	---	
SEMA4A	64218	broad.mit.edu	37	1	156146087	156146087	+	Intron	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156146087delA	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					aacctgcctcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	208428858	208428858	+	IGR	DEL	T	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208428858delT								PLXNA2 (11193 upstream) : None (None downstream)																							tttctttttcttttttttttt	0.149													4	3	---	---	---	---	
OBSCN	84033	broad.mit.edu	37	1	228423718	228423719	+	Intron	DEL	AC	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228423718_228423719delAC	uc009xez.1	+						OBSCN_uc001hsn.2_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				tcatgattttacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240148045	240148048	+	IGR	DEL	AGGA	-	-	rs74342196		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240148045_240148048delAGGA								CHRM3 (75330 upstream) : FMN2 (107137 downstream)																							ggagggagggaggaaggaaggaag	0.142													4	2	---	---	---	---	
PUM2	23369	broad.mit.edu	37	2	20453929	20453929	+	Intron	DEL	T	-	-	rs149877577		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20453929delT	uc002rds.1	-						PUM2_uc002rdq.1_Intron|PUM2_uc002rdt.1_Intron|PUM2_uc002rdr.2_Intron|PUM2_uc010yjy.1_Intron|PUM2_uc002rdu.1_Intron|PUM2_uc010yjz.1_Intron	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2						regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					tattttgttcttttttttttt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114052062	114052062	+	IGR	DEL	T	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114052062delT								PAX8 (15564 upstream) : CBWD2 (143206 downstream)																							ccttccttccttccttccttc	0.179													4	2	---	---	---	---	
NOP58	51602	broad.mit.edu	37	2	203157339	203157339	+	Intron	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203157339delA	uc002uzb.2	+						SNORD11_uc002uzd.1_5'Flank	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						ccagcctggGAAAAAAAAAAA	0.204													4	2	---	---	---	---	
MST1	4485	broad.mit.edu	37	3	49724049	49724049	+	Intron	DEL	C	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49724049delC	uc003cxg.2	-						MST1_uc011bcs.1_Intron|MST1_uc010hkx.2_Intron|MST1_uc011bct.1_Intron|MST1_uc011bcu.1_Intron|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth						proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCTCTTACCTCCCCGGCCAAG	0.672													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	100820133	100820136	+	IGR	DEL	ACAC	-	-	rs67176426		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100820133_100820136delACAC								ABI3BP (107799 upstream) : IMPG2 (125152 downstream)																							ATGTATGTGTacacacacacacac	0.279													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180863907	180863907	+	IGR	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180863907delA								DNAJC19 (156377 upstream) : SOX2OT (417602 downstream)																							tagaaaatccaaaaaaaaaaa	0.005													3	3	---	---	---	---	
STAP1	26228	broad.mit.edu	37	4	68424356	68424357	+	5'Flank	DEL	GT	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68424356_68424357delGT	uc003hde.3	+						STAP1_uc003hdf.2_5'Flank	NM_012108	NP_036240	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1						cellular membrane fusion|intracellular protein transport	cytoplasm					0						GGAAAAAAAAgtgtgtgtgtgt	0.327													13	8	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	93806086	93806087	+	Intron	INS	-	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93806086_93806087insA	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TTGGTCTCCCCAAAAAAAAAAA	0.342													4	3	---	---	---	---	
DAPP1	27071	broad.mit.edu	37	4	100787924	100787924	+	Intron	DEL	T	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100787924delT	uc003hvf.3	+						DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		Tttttttctattttttttttt	0.139													4	3	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123159136	123159137	+	Intron	INS	-	A	A	rs11455945		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123159136_123159137insA	uc003ieh.2	+						KIAA1109_uc003iei.1_Intron|KIAA1109_uc010ins.1_Intron|KIAA1109_uc003iek.2_5'Flank	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						gactccatctcaaaaaaaaaaa	0.124													5	4	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	38959023	38959023	+	Intron	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38959023delA	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CTGCTACTTGAAAAGGGAAGA	0.338													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44716806	44716809	+	IGR	DEL	GAAG	-	-	rs70997501	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44716806_44716809delGAAG								FGF10 (328022 upstream) : MRPS30 (92218 downstream)																							aggaaggaaagaaggaaggaagga	0.064													3	3	---	---	---	---	
SV2C	22987	broad.mit.edu	37	5	75577222	75577223	+	Intron	INS	-	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75577222_75577223insA	uc003kei.1	+							NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TTATGCAAAGTAAAAAAAAAAA	0.317													4	2	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	499431	499434	+	Intron	DEL	ACAC	-	-	rs4061197		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:499431_499434delACAC	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TCACAGTTAAacacacacacacac	0.270													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9661051	9661051	+	IGR	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9661051delA								None (None upstream) : TFAP2A (735866 downstream)																							GTGTTACAGCAAAAAAAAAAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	19997486	19997489	+	IGR	DEL	AAGA	-	-	rs68035898	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19997486_19997489delAAGA								ID4 (156572 upstream) : MBOAT1 (103446 downstream)																							ggaaggaaggaagaaagaaagaaa	0.000													4	2	---	---	---	---	
HLA-B	3106	broad.mit.edu	37	6	31324372	31324373	+	Intron	DEL	GA	-	-	rs71955092		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31324372_31324373delGA	uc003nth.2	-						HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_5'UTR|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_5'Flank|HLA-B_uc010jso.2_Intron	NM_005514	NP_005505	P01889	1B07_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						CGGCCTCAGGGAGGCGGATCTC	0.718									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	155028499	155028499	+	IGR	DEL	A	-	-	rs147940473		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155028499delA								CNKSR3 (196746 upstream) : RBM16 (26013 downstream)																							gactccatctaaaaaaaaaaa	0.169													4	2	---	---	---	---	
RPS2P32	256355	broad.mit.edu	37	7	23531029	23531030	+	3'UTR	INS	-	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23531029_23531030insA	uc011jza.1	+	1						NR_026676				Homo sapiens ribosomal protein S2 pseudogene, mRNA (cDNA clone IMAGE:4671259).												0						CTATTACTGTCAAAAAAAAAAA	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98408983	98408984	+	IGR	INS	-	TGG	TGG			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98408983_98408984insTGG								NPTX2 (149802 upstream) : TMEM130 (35128 downstream)																							agtggtggtgatggtggtggtg	0.000													4	2	---	---	---	---	
FBXO25	26260	broad.mit.edu	37	8	363407	363407	+	Intron	DEL	T	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:363407delT	uc003wox.2	+						FBXO25_uc003woy.2_Intron|FBXO25_uc003woz.2_Intron	NM_183421	NP_904357	Q8TCJ0	FBX25_HUMAN	F-box only protein 25 isoform 1							nucleus|SCF ubiquitin ligase complex	actin binding|ubiquitin-protein ligase activity			lung(1)	1		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		TGCTTTCGTCTTTTTTTTTTT	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40794245	40794248	+	IGR	DEL	AGGA	-	-	rs59411721		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40794245_40794248delAGGA								ZMAT4 (38902 upstream) : SFRP1 (325231 downstream)																							gaagggagggaggaagggagggag	0.127													4	2	---	---	---	---	
SFRP1	6422	broad.mit.edu	37	8	41166638	41166640	+	In_Frame_Del	DEL	GCT	-	-	rs3055861		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41166638_41166640delGCT	uc003xnt.2	-	1	341_343	c.39_41delAGC	c.(37-42)GCAGCC>GCC	p.13_14AA>A		NM_003012	NP_003003	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1 precursor	13_14				Missing (in Ref. 1 and 3).	brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			CACGCCCAGGGCTGCCCCGCGGC	0.764													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	70928585	70928588	+	IGR	DEL	AAGG	-	-	rs28549004	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70928585_70928588delAAGG								SLCO5A1 (181286 upstream) : PRDM14 (35437 downstream)																							ggaaggaagaaaggaaggaaggaa	0.000													4	5	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77427483	77427483	+	Intron	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77427483delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GTGGGTACAGAAAAAAAAAAA	0.159													5	4	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78790207	78790208	+	Intron	INS	-	GAATA	GAATA	rs10124596		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790207_78790208insGAATA	uc004ajz.2	+						PCSK5_uc004ajy.2_Frame_Shift_Ins_p.R688fs|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						cgaatcgaatcgaatagaatag	0.099													4	2	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131597418	131597418	+	Intron	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131597418delA	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	catctcaaccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
STK32C	282974	broad.mit.edu	37	10	134145398	134145399	+	Intron	INS	-	C	C			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134145398_134145399insC	uc009ybd.1	-						STK32C_uc010quu.1_5'Flank|STK32C_uc009ybc.1_5'Flank|LRRC27_uc001llf.2_5'Flank|LRRC27_uc010quv.1_5'Flank|LRRC27_uc010quw.1_5'Flank|LRRC27_uc001llg.2_5'Flank|LRRC27_uc001lli.2_5'Flank			Q86UX6	ST32C_HUMAN	Homo sapiens cDNA FLJ25120 fis, clone CBR06020.								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		ACCCCCTGCCACCCCCGCGCAG	0.748													6	4	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79279097	79279098	+	Intron	INS	-	AAGAAGGAAGGA	AAGAAGGAAGGA	rs138355803	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79279097_79279098insAAGAAGGAAGGA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						gagagggagggaagaaggaagg	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80632597	80632598	+	IGR	DEL	TG	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80632597_80632598delTG								PPP1R12A (303362 upstream) : PTPRQ (205528 downstream)																							TACACCTATTtgtgtgtgtgtg	0.302													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	108972389	108972391	+	IGR	DEL	CAT	-	-	rs112046826		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108972389_108972391delCAT								ISCU (9231 upstream) : TMEM119 (11233 downstream)																							tcaccaccaccatcaccatcacc	0.000													4	3	---	---	---	---	
DCLK1	9201	broad.mit.edu	37	13	36559035	36559036	+	Intron	DEL	CA	-	-	rs146313847		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36559035_36559036delCA	uc001uvf.2	-							NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CGTGCGCATGcacacacacaca	0.530													4	2	---	---	---	---	
LHFP	10186	broad.mit.edu	37	13	39943736	39943737	+	Intron	INS	-	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39943736_39943737insT	uc001uxf.2	-							NM_005780	NP_005771	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		tccttccttcctccctctctcc	0.243			T	HMGA2	lipoma								6	3	---	---	---	---	
NOVA1	4857	broad.mit.edu	37	14	27066713	27066714	+	5'UTR	INS	-	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27066713_27066714insT	uc001wpy.2	-	1					NOVA1_uc001wpz.2_5'UTR|NOVA1_uc001wqa.2_5'UTR|NOVA1_uc001wqb.2_5'UTR	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		tttcttttttcttttttttttt	0.356													4	2	---	---	---	---	
BAIAP3	8938	broad.mit.edu	37	16	1396789	1396806	+	Intron	DEL	GCAGGTGGGGCCAGCGGG	-	-	rs3215518		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1396789_1396806delGCAGGTGGGGCCAGCGGG	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				AGGCCATTCTGCAGGTGGGGCCAGCGGGGCAGGTGGGG	0.716													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33030488	33030489	+	IGR	INS	-	GAAG	GAAG			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33030488_33030489insGAAG								SLC6A10P (134025 upstream) : MIR1826 (935019 downstream)																							aaggaaggaaagaaggaaggaa	0.010													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518762	21518763	+	IGR	DEL	AT	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518762_21518763delAT								C17orf51 (41031 upstream) : FAM27L (306607 downstream)																							TCTCTGTCACATATTTTTTTCT	0.307													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35144117	35144152	+	IGR	DEL	AGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGG	-	-	rs146381166	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35144117_35144152delAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGG								MRM1 (178711 upstream) : LHX1 (150347 downstream)																							gaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaagggagggagggag	0.000													3	5	---	---	---	---	
LRRC37A	9884	broad.mit.edu	37	17	44383045	44383045	+	Intron	DEL	A	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44383045delA	uc002ikg.2	+						ARL17A_uc002iki.3_Intron|ARL17A_uc002ikh.3_Intron|ARL17B_uc002ikf.2_Intron	NM_014834	NP_055649	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A precursor							integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TTTTACCAGTAGAAAGCTACT	0.249													10	5	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626918	73626919	+	Splice_Site	INS	-	TG	TG	rs142406301	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626918_73626919insTG	uc010dgl.2	-	12	1742	c.1586_splice	c.e12-1	p.D529_splice	RECQL5_uc010dgk.2_Splice_Site_p.D502_splice|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGTTCTCATCTGTGGGGGGGG	0.644								Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	2	---	---	---	---	
DNAH17	8632	broad.mit.edu	37	17	76548595	76548595	+	Intron	DEL	T	-	-	rs35637364		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76548595delT	uc002jvv.1	-											RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ACAGATGGGCTTTTTTTTTTT	0.498													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15198309	15198310	+	IGR	INS	-	T	T			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15198309_15198310insT								ANKRD30B (345572 upstream) : LOC644669 (115245 downstream)																							CCGCGGCGGCGGGGGCAAAATA	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	63778788	63778791	+	IGR	DEL	GAAG	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63778788_63778791delGAAG								CDH7 (230614 upstream) : CDH19 (392530 downstream)																							aaggaaggaagaaggaaggaagga	0.000													6	3	---	---	---	---	
C19orf35	374872	broad.mit.edu	37	19	2276528	2276528	+	Intron	DEL	C	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2276528delC	uc002lvn.2	-						SPPL2B_uc010dsw.1_Intron	NM_198532	NP_940934	Q6ZS72	CS035_HUMAN	hypothetical protein LOC374872											pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GATCACTGGGCCCCCCACAAG	0.721													3	3	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013987	3013987	+	Intron	DEL	T	-	-	rs67060467		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013987delT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gtaaaatgtattttttttttt	0.124													4	2	---	---	---	---	
CELF5	60680	broad.mit.edu	37	19	3290562	3290563	+	Intron	DEL	TT	-	-	rs72150655		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3290562_3290563delTT	uc002lxm.2	+						CELF5_uc002lxl.1_Intron|CELF5_uc010dtj.1_Intron|CELF5_uc010xhg.1_Intron|CELF5_uc002lxn.2_Intron	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein						mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(2)	2						tttgggtttctttttttttttt	0.089													4	3	---	---	---	---	
ZNF626	199777	broad.mit.edu	37	19	20806648	20806649	+	3'UTR	DEL	CA	-	-	rs71893877		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20806648_20806649delCA	uc002npb.1	-	4					ZNF626_uc002npc.1_3'UTR	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TATGCTTTGCCACATTCTTCAC	0.203													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43060069	43060069	+	Intron	DEL	T	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43060069delT	uc010eif.1	+						uc010eig.1_Intron|uc010eih.1_Intron					Homo sapiens cDNA FLJ39530 fis, clone PUAEN2004400.																		GCCTGGGGCATTTTTTTCTGC	0.617													18	8	---	---	---	---	
TMC4	147798	broad.mit.edu	37	19	54667021	54667022	+	Intron	INS	-	TTTC	TTTC			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54667021_54667022insTTTC	uc010erf.2	-						TMC4_uc002qdn.2_Intron|TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CAGAATCAGGATTTCTTTCTtt	0.297													5	3	---	---	---	---	
EPS8L1	54869	broad.mit.edu	37	19	55598003	55598004	+	Intron	INS	-	C	C	rs143222343	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55598003_55598004insC	uc002qis.3	+						EPS8L1_uc010yfr.1_Intron|EPS8L1_uc002qiu.2_Intron|EPS8L1_uc002qiv.2_Intron|EPS8L1_uc002qiw.2_Intron	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		ACGCTGGAGCGCCCCCCCGCCC	0.470													7	5	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37182420	37182421	+	Intron	INS	-	AA	AA	rs11472819		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37182420_37182421insAA	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						agcccagtctcaaaaaaaaaaa	0.104													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57159887	57159888	+	Intron	INS	-	CTTC	CTTC	rs142796198	by1000genomes	TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57159887_57159888insCTTC	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																		ctcccttctttcttccttcctt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14745440	14745440	+	IGR	DEL	C	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14745440delC								C21orf99 (254871 upstream) : POTED (237058 downstream)																							actgctccagcccccctccta	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	26020893	26020896	+	IGR	DEL	TTCC	-	-	rs67729072		TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26020893_26020896delTTCC								None (None upstream) : NCRNA00158 (737238 downstream)																							GATAAtttttttccttccttcctt	0.172													6	5	---	---	---	---	
DYRK1A	1859	broad.mit.edu	37	21	38868258	38868262	+	Intron	DEL	GGTAG	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38868258_38868262delGGTAG	uc002ywk.2	+						DYRK1A_uc002ywi.2_Intron|DYRK1A_uc002ywj.2_Intron|DYRK1A_uc002ywl.2_Intron|DYRK1A_uc002ywm.2_Intron|DYRK1A_uc011aei.1_Intron	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation						nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4						actcaaggaaggtagggcctttctt	0.015													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	51692371	51692374	+	IGR	DEL	CTTC	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51692371_51692374delCTTC								MAGED1 (46923 upstream) : MAGED4 (112551 downstream)																							ttcttcctttcttccttccttcct	0.044													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	82130968	82130969	+	IGR	INS	-	A	A			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82130968_82130969insA								None (None upstream) : POU3F4 (632300 downstream)																							CATTATAAACTAAAAAAAAAAa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	82197601	82197602	+	IGR	DEL	TG	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82197601_82197602delTG								None (None upstream) : POU3F4 (565667 downstream)																							tcctaggtattgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128176036	128176036	+	IGR	DEL	G	-	-			TCGA-B8-5163-01A-01D-1421-08	TCGA-B8-5163-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128176036delG								ACTRT1 (989654 upstream) : SMARCA1 (404444 downstream)																							GTGGTTGAGTGAGGCCTAGGC	0.632													4	2	---	---	---	---	
