Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CELA3A	10136	broad.mit.edu	37	1	22336337	22336337	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22336337A>G	uc001bfl.2	+	7	801	c.782A>G	c.(781-783)GAC>GGC	p.D261G		NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein	261	Peptidase S1.				cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						GCCTTCATCGACTGGATTGAG	0.602													15	84	---	---	---	---	PASS
RAD54L	8438	broad.mit.edu	37	1	46743873	46743873	+	Silent	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46743873G>A	uc009vye.2	+	19	2277	c.2163G>A	c.(2161-2163)CAG>CAA	p.Q721Q	RAD54L_uc001cpl.2_Silent_p.Q721Q|RAD54L_uc001cpm.1_Silent_p.Q504Q	NM_001142548	NP_001136020	Q92698	RAD54_HUMAN	RAD54-like protein	721					meiosis	nucleus	ATP binding|DNA binding|helicase activity			ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		AGGTACTCCAGGCTGCCTGGG	0.617								Direct_reversal_of_damage|Homologous_recombination					11	19	---	---	---	---	PASS
LHX8	431707	broad.mit.edu	37	1	75622627	75622627	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75622627A>G	uc001dgo.2	+	9	1524	c.860A>G	c.(859-861)AAT>AGT	p.N287S	LHX8_uc001dgq.2_Missense_Mutation_p.N226S	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8	287						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						GTCAGTCCTAATCACTCATCC	0.512													12	237	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155307347	155307347	+	3'UTR	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155307347G>C	uc009wqq.2	-	28					RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_3'UTR	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CATTCCCCTTGCCCAGATGGA	0.507													4	81	---	---	---	---	PASS
ATP1B1	481	broad.mit.edu	37	1	169100845	169100845	+	RNA	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169100845C>G	uc001gfs.1	+	6		c.1089C>G						P05026	AT1B1_HUMAN	Synthetic construct DNA, clone: pF1KB8186, Homo sapiens ATP1B1 gene for ATPase, Na+/K+ transporting, beta 1 polypeptide, without stop codon, in Flexi system.						ATP biosynthetic process|blood coagulation|leukocyte migration	sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	all_hematologic(923;0.208)					AAAAAAGATACAAAAACAAAA	0.333													7	60	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175360502	175360502	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175360502C>G	uc001gkp.1	-	5	1510	c.1429G>C	c.(1429-1431)GGG>CGG	p.G477R	TNR_uc009wwu.1_Missense_Mutation_p.G477R	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	477	Fibronectin type-III 2.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TATTCCTCCCCAGGCTTTAGT	0.562													27	85	---	---	---	---	PASS
FMOD	2331	broad.mit.edu	37	1	203316788	203316788	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203316788G>A	uc001gzr.2	-	2	747	c.611C>T	c.(610-612)GCC>GTC	p.A204V	FMOD_uc010pqi.1_RNA	NM_002023	NP_002014	Q06828	FMOD_HUMAN	fibromodulin precursor	204	LRR 5.				transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			GAGGTACAAGGCCGTGAGGTT	0.582													51	173	---	---	---	---	PASS
PRELP	5549	broad.mit.edu	37	1	203453269	203453269	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203453269C>A	uc001gzs.2	+	2	1157	c.957C>A	c.(955-957)AAC>AAA	p.N319K	PRELP_uc001gzt.2_Missense_Mutation_p.N319K	NM_002725	NP_002716	P51888	PRELP_HUMAN	proline arginine-rich end leucine-rich repeat	319	LRR 10.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(1)|central_nervous_system(1)|pancreas(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.109)			TGTACCTCAACAACAATAGCA	0.567													14	43	---	---	---	---	PASS
OPTC	26254	broad.mit.edu	37	1	203468978	203468978	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203468978G>C	uc001gzu.1	+	5	847	c.731G>C	c.(730-732)AGG>ACG	p.R244T		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	244						proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			GCAGCCTTCAGGGTGAGTCAA	0.348													6	61	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235907322	235907322	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235907322T>C	uc001hxj.2	-	30	8283	c.8108A>G	c.(8107-8109)AAA>AGA	p.K2703R	LYST_uc009xga.1_Missense_Mutation_p.K339R	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	2703					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAAAATTTCTTTCTGAAATGG	0.313									Chediak-Higashi_syndrome				10	147	---	---	---	---	PASS
PKDCC	91461	broad.mit.edu	37	2	42275952	42275952	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42275952C>T	uc002rsg.2	+	1	792	c.613C>T	c.(613-615)CGG>TGG	p.R205W		NM_138370	NP_612379	Q504Y2	PKDCC_HUMAN	protein kinase-like protein SgK493	205	Protein kinase.				cell differentiation|embryonic digestive tract development|lung alveolus development|negative regulation of Golgi to plasma membrane protein transport|ossification|palate development|positive regulation of bone mineralization|positive regulation of chondrocyte differentiation|protein transport	Golgi apparatus	ATP binding|protein kinase activity			breast(1)	1						GCTGCTGGAGCGGCTGCGGCA	0.667													2	2	---	---	---	---	PASS
TIA1	7072	broad.mit.edu	37	2	70475611	70475611	+	5'UTR	SNP	A	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70475611A>C	uc002sgj.3	-	1					TIA1_uc002sgk.3_5'UTR|TIA1_uc002sgl.3_RNA|TIA1_uc002sgm.3_5'UTR|TIA1_uc010yqt.1_5'UTR	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding						apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						CCTGCCCTTCACTACCTCCCA	0.602													6	35	---	---	---	---	PASS
TIA1	7072	broad.mit.edu	37	2	70475612	70475612	+	Translation_Start_Site	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70475612C>T	uc002sgj.3	-	1	168	c.-49G>A	c.(-51--47)TAGTG>TAATG		TIA1_uc002sgk.3_Translation_Start_Site|TIA1_uc002sgl.3_RNA|TIA1_uc002sgm.3_Translation_Start_Site|TIA1_uc010yqt.1_Translation_Start_Site	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding						apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						CTGCCCTTCACTACCTCCCAA	0.597													6	35	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179406098	179406098	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179406098T>A	uc010zfg.1	-	299	90226	c.90002A>T	c.(90001-90003)GAA>GTA	p.E30001V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E23696V|TTN_uc010zfi.1_Missense_Mutation_p.E23629V|TTN_uc010zfj.1_Missense_Mutation_p.E23504V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30928							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGTTCATATTCTAAGCCTTC	0.488													3	18	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198949407	198949407	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198949407T>G	uc010fsp.2	+	2	1457	c.1166T>G	c.(1165-1167)TTT>TGT	p.F389C	PLCL1_uc002uuv.3_Missense_Mutation_p.F310C	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	389					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	TGTGACATTTTTGATCCTGAG	0.388													42	177	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226447525	226447525	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226447525C>A	uc002voe.2	+	4	1567	c.1392C>A	c.(1390-1392)AGC>AGA	p.S464R	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.S234R	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	464	Pro-rich.									ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		ATTCGGGCAGCCTCTCAAGGA	0.632													8	54	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226447526	226447526	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226447526C>G	uc002voe.2	+	4	1568	c.1393C>G	c.(1393-1395)CTC>GTC	p.L465V	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.L235V	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	465	Pro-rich.									ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		TTCGGGCAGCCTCTCAAGGAG	0.637													8	54	---	---	---	---	PASS
NCL	4691	broad.mit.edu	37	2	232321358	232321358	+	Silent	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232321358T>C	uc002vru.2	-	11	1830	c.1689A>G	c.(1687-1689)TCA>TCG	p.S563S	SNORA75_uc002vrv.1_5'Flank|SNORD20_uc002vrw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin	563					angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		TGGCATTAGGTGATCCCCTGG	0.458													27	136	---	---	---	---	PASS
ALPP	250	broad.mit.edu	37	2	233246044	233246044	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233246044G>T	uc002vsq.2	+	10	1441	c.1276G>T	c.(1276-1278)GGC>TGC	p.G426C	ALPP_uc002vsr.2_RNA	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	426						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GCTCAAGGACGGCGCCCGGCC	0.697													6	64	---	---	---	---	PASS
ALPPL2	251	broad.mit.edu	37	2	233274125	233274125	+	Missense_Mutation	SNP	G	T	T	rs145179673	byFrequency	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233274125G>T	uc002vss.3	+	10	1320	c.1267G>T	c.(1267-1269)GGC>TGC	p.G423C		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	423					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	GCTCAAGGACGGCGCCCGGCC	0.692													5	26	---	---	---	---	PASS
FANCD2	2177	broad.mit.edu	37	3	10083177	10083177	+	Intron	SNP	A	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10083177A>C	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc003buv.2_3'UTR	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		AACATACTATAAACGGTAACT	0.204			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				3	15	---	---	---	---	PASS
KAT2B	8850	broad.mit.edu	37	3	20153227	20153227	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20153227A>G	uc003cbq.2	+	6	1437	c.991A>G	c.(991-993)AAA>GAA	p.K331E		NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	331					cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						AAGACAGGAAAAAGATAAACT	0.453													22	66	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52393986	52393986	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52393986G>C	uc011bef.1	+	27	4723	c.4462G>C	c.(4462-4464)GTG>CTG	p.V1488L		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1488	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCAGCGGGCAGTGCTGTCAGC	0.572													47	138	---	---	---	---	PASS
GPR15	2838	broad.mit.edu	37	3	98251550	98251550	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251550C>A	uc011bgy.1	+	1	673	c.673C>A	c.(673-675)CAT>AAT	p.H225N		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	225	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		GCTGTGTGCCCATTACCAGCA	0.433													59	190	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	156979098	156979098	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156979098G>C	uc003fbj.1	-	14	2644	c.2327C>G	c.(2326-2328)GCC>GGC	p.A776G	VEPH1_uc003fbk.1_Missense_Mutation_p.A776G|VEPH1_uc010hvu.1_Missense_Mutation_p.A731G	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	776	PH.					plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GCGTTTCTTGGCCACAGCCTT	0.483													4	156	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171323102	171323102	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171323102G>T	uc003fhs.2	-	26	3103	c.2987C>A	c.(2986-2988)ACA>AAA	p.T996K	PLD1_uc003fht.2_Missense_Mutation_p.T958K	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	996					cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GTCATAAATTGTAGCATTTCG	0.413													40	166	---	---	---	---	PASS
EIF4A2	1974	broad.mit.edu	37	3	186504360	186504360	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186504360A>C	uc003fqs.2	+	7	736	c.697A>C	c.(697-699)ATT>CTT	p.I233L	EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Missense_Mutation_p.I234L|EIF4A2_uc003fqv.2_Missense_Mutation_p.I138L|EIF4A2_uc003fqw.2_Missense_Mutation_p.I138L|EIF4A2_uc011bsb.1_Missense_Mutation_p.I106L|MIR1248_hsa-mir-1248|MI0006383_5'Flank|SNORA81_uc010hyv.1_5'Flank|SNORA63_uc010hyw.1_5'Flank|SNORA4_uc010hyx.1_5'Flank	NM_001967	NP_001958	Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	233	Helicase ATP-binding.				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity			ovary(2)|breast(2)	4	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		GAGAGATCCAATTCGAATTCT	0.348			T	BCL6	NHL								41	140	---	---	---	---	PASS
KLF3	51274	broad.mit.edu	37	4	38690220	38690220	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38690220T>G	uc003gth.3	+	3	404	c.72T>G	c.(70-72)AAT>AAG	p.N24K	KLF3_uc003gtg.2_Missense_Mutation_p.N24K	NM_016531	NP_057615	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	24	Repressor domain.|Pro-rich.				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						ACCCATCTAATTACATGGAAT	0.393													31	129	---	---	---	---	PASS
GNPDA2	132789	broad.mit.edu	37	4	44705267	44705267	+	Intron	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44705267C>G	uc003gwy.2	-						GNPDA2_uc010iga.2_Intron|GNPDA2_uc011bzb.1_Intron|GNPDA2_uc003gwz.1_3'UTR	NM_138335	NP_612208	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2						N-acetylglucosamine metabolic process	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity			ovary(1)	1						CTGTTTAGTTCCCATCTTGAT	0.254													6	18	---	---	---	---	PASS
CDC23	8697	broad.mit.edu	37	5	137524758	137524758	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137524758G>C	uc003lcl.2	-	16	1734	c.1703C>G	c.(1702-1704)CCT>CGT	p.P568R		NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23	568					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAAGGGAGCAGGCACCTCGGT	0.522													25	103	---	---	---	---	PASS
CTNNA1	1495	broad.mit.edu	37	5	138269640	138269640	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138269640G>A	uc003ldh.2	+	18	2678	c.2583G>A	c.(2581-2583)ATG>ATA	p.M861I	CTNNA1_uc011cyx.1_Missense_Mutation_p.M758I|CTNNA1_uc011cyy.1_Missense_Mutation_p.M738I|CTNNA1_uc003ldi.2_Missense_Mutation_p.M559I|CTNNA1_uc003ldj.2_3'UTR|CTNNA1_uc003ldl.2_Missense_Mutation_p.M491I	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	861					adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CATGGAAGATGAAGGCACCAG	0.502													10	51	---	---	---	---	PASS
C6orf105	84830	broad.mit.edu	37	6	11778959	11778959	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11778959G>C	uc003nab.2	-	1	322	c.34C>G	c.(34-36)CTT>GTT	p.L12V	C6orf105_uc011dip.1_Missense_Mutation_p.L12V	NM_032744	NP_116133	Q96IZ2	CF105_HUMAN	hypothetical protein LOC84830 isoform 2	12	Helical; (Potential).					integral to membrane					0	Ovarian(93;0.0848)|Breast(50;0.0871)	all_hematologic(90;0.135)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.193)			CTCAGAACAAGGAAGTGGTAT	0.468													36	118	---	---	---	---	PASS
ATXN1	6310	broad.mit.edu	37	6	16328126	16328126	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16328126T>C	uc003nbt.2	-	8	1387	c.416A>G	c.(415-417)TAT>TGT	p.Y139C	ATXN1_uc010jpi.2_Missense_Mutation_p.Y139C|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	139					cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				GAAGCTGGCATAGGTTCCACT	0.657													19	102	---	---	---	---	PASS
PRSS16	10279	broad.mit.edu	37	6	27215513	27215513	+	5'UTR	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27215513C>G	uc003nja.2	+	1					PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_5'UTR|PRSS16_uc010jqq.1_5'Flank|PRSS16_uc010jqr.1_5'Flank|PRSS16_uc003njc.1_5'Flank	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor						protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						GAGTCCCGAACACCATGGCCG	0.572													2	3	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38891824	38891824	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38891824T>G	uc003ooe.1	+	71	10797	c.10197T>G	c.(10195-10197)AAT>AAG	p.N3399K	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GTCCTTTCAATCAGATATTTA	0.418													47	197	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72960946	72960946	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72960946T>A	uc003pga.2	+	15	2650	c.2573T>A	c.(2572-2574)TTA>TAA	p.L858*	RIMS1_uc011dyb.1_Nonsense_Mutation_p.L484*|RIMS1_uc003pgc.2_Nonsense_Mutation_p.L484*|RIMS1_uc010kaq.2_Nonsense_Mutation_p.L332*|RIMS1_uc011dyc.1_Nonsense_Mutation_p.L332*|RIMS1_uc010kar.2_Nonsense_Mutation_p.L251*|RIMS1_uc011dyd.1_Nonsense_Mutation_p.L317*|RIMS1_uc003pgf.2_Nonsense_Mutation_p.L75*|RIMS1_uc003pgg.2_Nonsense_Mutation_p.L75*|RIMS1_uc003pgi.2_Nonsense_Mutation_p.L75*|RIMS1_uc003pgh.2_Nonsense_Mutation_p.L75*|RIMS1_uc003pgd.2_Nonsense_Mutation_p.L75*|RIMS1_uc003pge.2_Nonsense_Mutation_p.L75*|RIMS1_uc011dye.1_5'Flank|RIMS1_uc003pgb.3_Nonsense_Mutation_p.L484*|RIMS1_uc010kas.1_Nonsense_Mutation_p.L317*	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	858					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ACAGCGCTTTTAGATGATGAA	0.368													3	19	---	---	---	---	PASS
CYTH3	9265	broad.mit.edu	37	7	6226736	6226736	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6226736T>G	uc003spt.2	-	4	298	c.194A>C	c.(193-195)CAG>CCG	p.Q65P		NM_004227	NP_004218	O43739	CYH3_HUMAN	cytohesin 3	65					regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0						TTTGTTCCTCTGAGTCGTTTT	0.443													71	221	---	---	---	---	PASS
RPA3	6119	broad.mit.edu	37	7	7680049	7680049	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7680049T>C	uc003sri.2	-	5	1173	c.1A>G	c.(1-3)ATG>GTG	p.M1V	RPA3_uc003srh.2_5'Flank	NM_002947	NP_002938	P35244	RFA3_HUMAN	replication protein A3, 14kDa	1					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	cytoplasm|DNA replication factor A complex|nucleoplasm	protein binding|single-stranded DNA binding			large_intestine(1)	1		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)		ATGTCCACCATGATTATGGTC	0.582								Direct_reversal_of_damage|NER					25	87	---	---	---	---	PASS
C7orf46	340277	broad.mit.edu	37	7	23737866	23737866	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23737866C>A	uc003swo.3	+	5	782	c.693C>A	c.(691-693)TTC>TTA	p.F231L	C7orf46_uc003swq.3_Intron|C7orf46_uc003swr.3_Intron|C7orf46_uc003swp.3_RNA|C7orf46_uc010kup.2_Intron	NM_199136	NP_954587	A4D161	CG046_HUMAN	hypothetical protein LOC340277 isoform 1	231											0						ACAGCCCATTCCTAAAAGCAT	0.338													63	218	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43503283	43503283	+	Silent	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43503283T>C	uc003tid.1	+	14	3281	c.2676T>C	c.(2674-2676)ATT>ATC	p.I892I	HECW1_uc011kbi.1_Silent_p.I858I	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	892	Potential.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	p.G892R(1)		ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						AGCGAACCATTGCAACAGAGA	0.488													32	86	---	---	---	---	PASS
MRPS17	51373	broad.mit.edu	37	7	56022693	56022693	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56022693C>T	uc003trd.2	+	3	245	c.215C>T	c.(214-216)CCA>CTA	p.P72L	MRPS17_uc003trb.2_Missense_Mutation_p.P167L	NM_015969	NP_057053	Q9Y2R5	RT17_HUMAN	mitochondrial ribosomal protein S17 precursor	72					translation	mitochondrial small ribosomal subunit	rRNA binding|structural constituent of ribosome				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TTACCTGTTCCACGAGCAAAG	0.448													109	355	---	---	---	---	PASS
LOC643955	643955	broad.mit.edu	37	7	62752443	62752443	+	3'UTR	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62752443G>C	uc011kdj.1	-	3						NR_003952				Homo sapiens cDNA clone IMAGE:30377995, containing frame-shift errors.												0						CTTATGTCTAGTAAGGTTTGA	0.438													3	19	---	---	---	---	PASS
RABGEF1	27342	broad.mit.edu	37	7	66248812	66248812	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66248812G>C	uc011kee.1	+	4	703	c.539G>C	c.(538-540)GGA>GCA	p.G180A	RABGEF1_uc003tvf.2_5'UTR|RABGEF1_uc003tvg.2_Intron|RABGEF1_uc010lag.2_Missense_Mutation_p.G166A|RABGEF1_uc003tvh.2_Missense_Mutation_p.G166A|RABGEF1_uc003tvi.2_5'UTR	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	344					endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						TTTTTGGAAGGAATGCATTAC	0.259													11	38	---	---	---	---	PASS
LMTK2	22853	broad.mit.edu	37	7	97834847	97834847	+	3'UTR	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97834847G>T	uc003upd.1	+	14						NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor						early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CTGCTCCCCTGGAGCGGCGCC	0.627													3	15	---	---	---	---	PASS
LHFPL3	375612	broad.mit.edu	37	7	103969251	103969251	+	Silent	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103969251C>T	uc003vce.2	+	1	148	c.24C>T	c.(22-24)GCC>GCT	p.A8A	LHFPL3_uc003vcf.2_Silent_p.A8A	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	Error:Variant_position_missing_in_Q86UP9_after_alignment						integral to membrane					0						ccgccgctgccgccgccgccg	0.388													2	6	---	---	---	---	PASS
LRRC4	64101	broad.mit.edu	37	7	127670011	127670011	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127670011T>C	uc003vmk.2	-	2	820	c.683A>G	c.(682-684)AAC>AGC	p.N228S	SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron	NM_022143	NP_071426	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4 precursor	228	LRR 7.|Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4				Lung(243;0.124)		AGGGAAGTGGTTCCCTGACAT	0.547													17	41	---	---	---	---	PASS
COPG2	26958	broad.mit.edu	37	7	130149549	130149549	+	Intron	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130149549C>A	uc003vqh.1	-							NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					gacatgatctctgtctctagg	0.254													12	51	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10465398	10465398	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10465398C>G	uc003wtc.2	-	4	6439	c.6210G>C	c.(6208-6210)GAG>GAC	p.E2070D		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2070					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CCTCCTGGACCTCCCCTTCAG	0.622													58	169	---	---	---	---	PASS
XKR4	114786	broad.mit.edu	37	8	56015841	56015841	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56015841G>A	uc003xsf.2	+	1	825	c.793G>A	c.(793-795)GGG>AGG	p.G265R		NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related	265	Helical; (Potential).					integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			CTTGCAGCTCGGGCAAATCTG	0.567													3	60	---	---	---	---	PASS
RPL7	6129	broad.mit.edu	37	8	74204500	74204500	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74204500T>A	uc003xzg.2	-	3	286	c.264A>T	c.(262-264)AAA>AAT	p.K88N	RPL7_uc003xzh.1_Missense_Mutation_p.K48N|RDH10_uc003xzi.2_5'Flank	NM_000971	NP_000962	P18124	RL7_HUMAN	ribosomal protein L7	88					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	DNA binding|mRNA binding|protein homodimerization activity|structural constituent of ribosome				0	Breast(64;0.0954)		Epithelial(68;0.0193)|all cancers(69;0.0766)|BRCA - Breast invasive adenocarcinoma(89;0.134)			CAAACGCCAATTTGGGTTCTG	0.418													23	99	---	---	---	---	PASS
TRAPPC9	83696	broad.mit.edu	37	8	141310714	141310714	+	Splice_Site	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141310714C>T	uc003yvj.2	-	11	1757	c.1623_splice	c.e11-1	p.R541_splice	TRAPPC9_uc003yvh.2_Splice_Site_p.R639_splice|TRAPPC9_uc003yvi.1_Splice_Site_p.R532_splice	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						TTTCACATGCCTGTTGTTTCA	0.398													35	153	---	---	---	---	PASS
FANCG	2189	broad.mit.edu	37	9	35075002	35075002	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35075002G>A	uc003zwb.1	-	12	2050	c.1558C>T	c.(1558-1560)CGT>TGT	p.R520C	VCP_uc003zvy.2_5'Flank|VCP_uc003zvz.2_5'Flank|VCP_uc010mkh.1_5'Flank|FANCG_uc003zwa.1_Missense_Mutation_p.R262C|FANCG_uc010mkj.1_Missense_Mutation_p.R262C	NM_004629	NP_004620	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	520	TPR 4.				cell cycle checkpoint|DNA repair|mitochondrion organization	mitochondrion|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|large_intestine(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TCCAGTCCACGACTAATTAGG	0.557			Mis|N|F|S			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				7	62	---	---	---	---	PASS
FANCG	2189	broad.mit.edu	37	9	35075004	35075004	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35075004C>G	uc003zwb.1	-	12	2048	c.1556G>C	c.(1555-1557)AGT>ACT	p.S519T	VCP_uc003zvy.2_5'Flank|VCP_uc003zvz.2_5'Flank|VCP_uc010mkh.1_5'Flank|FANCG_uc003zwa.1_Missense_Mutation_p.S261T|FANCG_uc010mkj.1_Missense_Mutation_p.S261T	NM_004629	NP_004620	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	519	TPR 4.				cell cycle checkpoint|DNA repair|mitochondrion organization	mitochondrion|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|large_intestine(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CAGTCCACGACTAATTAGGGC	0.557			Mis|N|F|S			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	60	---	---	---	---	PASS
GBA2	57704	broad.mit.edu	37	9	35738346	35738346	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35738346C>T	uc003zxw.2	-	14	2604	c.2080G>A	c.(2080-2082)GCA>ACA	p.A694T	GBA2_uc003zxx.1_5'UTR|GBA2_uc011lpb.1_Missense_Mutation_p.A694T|GBA2_uc011lpc.1_Missense_Mutation_p.A694T|GBA2_uc011lpd.1_Missense_Mutation_p.A700T	NM_020944	NP_065995	Q9HCG7	GBA2_HUMAN	bile acid beta-glucosidase	694	Helical; (Potential).				bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity			ovary(3)|skin(1)	4	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCCACAGCTGCCAGCCACAGC	0.562													20	45	---	---	---	---	PASS
GOLGA2	2801	broad.mit.edu	37	9	131021536	131021536	+	Silent	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131021536C>T	uc011maw.1	-	19	1939	c.1926G>A	c.(1924-1926)CTG>CTA	p.L642L	GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004buh.2_Silent_p.L115L	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2	642	Potential.					Golgi cisterna membrane	protein binding			ovary(1)	1						GCTGGGTCTGCAGCAGTAGCT	0.607													3	29	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134351306	134351306	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134351306G>C	uc004can.3	+	15	3845	c.3790G>C	c.(3790-3792)GAC>CAC	p.D1264H	BAT2L1_uc010mzj.1_Missense_Mutation_p.D847H|BAT2L1_uc004cao.3_Missense_Mutation_p.D622H	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1264							protein binding				0						CAGACACCCTGACGCATTTGG	0.557											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	38	---	---	---	---	PASS
LIPF	8513	broad.mit.edu	37	10	90438403	90438403	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90438403G>A	uc001kfg.1	+	10	1328	c.1162G>A	c.(1162-1164)GAC>AAC	p.D388N	LIPF_uc001kfh.1_Missense_Mutation_p.D365N|LIPF_uc010qmt.1_Missense_Mutation_p.D398N|LIPF_uc010qmu.1_Missense_Mutation_p.D355N	NM_004190	NP_004181	P07098	LIPG_HUMAN	lipase, gastric precursor	388					lipid catabolic process|triglyceride metabolic process	extracellular region	lipid binding|triglyceride lipase activity				0		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)		AGTTTACAATGACATTGTTTC	0.328													24	96	---	---	---	---	PASS
ZNF518A	9849	broad.mit.edu	37	10	97920224	97920224	+	Silent	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97920224A>G	uc001klp.2	+	7	5003	c.4146A>G	c.(4144-4146)AGA>AGG	p.R1382R	ZNF518A_uc001klo.1_3'UTR|ZNF518A_uc001klq.2_3'UTR|ZNF518A_uc001klr.2_3'UTR	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	1382					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TGTCAAAAAGAACTATAAATG	0.323													6	223	---	---	---	---	PASS
TMEM80	283232	broad.mit.edu	37	11	703112	703112	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:703112G>C	uc001lqr.2	+	5	606	c.469G>C	c.(469-471)GTC>CTC	p.V157L	TMEM80_uc001lqs.2_Missense_Mutation_p.V149L|TMEM80_uc010qwi.1_Missense_Mutation_p.V157L	NM_001042463	NP_001035928	Q96HE8	TMM80_HUMAN	transmembrane protein 80 isoform 2	157	Helical; (Potential).					integral to membrane					0		all_cancers(49;5.11e-06)|all_epithelial(84;0.00143)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.44e-27)|Epithelial(43;2.29e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.19e-20)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTGGAGGCCGTCCTGCAGGT	0.692													5	28	---	---	---	---	PASS
KCTD14	65987	broad.mit.edu	37	11	77727894	77727894	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77727894G>T	uc001oyw.3	-	2	538	c.513C>A	c.(511-513)TGC>TGA	p.C171*		NM_023930	NP_076419	Q9BQ13	KCD14_HUMAN	potassium channel tetramerisation domain	171						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			TTTCCACCAGGCACACAAGCA	0.527													51	231	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26839514	26839514	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26839514T>C	uc001rhg.2	-	11	1465	c.1048A>G	c.(1048-1050)ATC>GTC	p.I350V		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	350	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					GTATACATGATCTTCTCCCCT	0.433													58	352	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39730918	39730918	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39730918T>G	uc001rly.2	-	17	2544	c.2398A>C	c.(2398-2400)AAG>CAG	p.K800Q	KIF21A_uc001rlw.2_Missense_Mutation_p.K117Q|KIF21A_uc001rlx.2_Missense_Mutation_p.K787Q|KIF21A_uc001rlz.2_Missense_Mutation_p.K787Q|KIF21A_uc010skl.1_Missense_Mutation_p.K787Q	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	800					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				CGTTGATCCTTTTTCAACTGA	0.328													55	231	---	---	---	---	PASS
KRT4	3851	broad.mit.edu	37	12	53207401	53207401	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53207401A>G	uc001saz.2	-	1	935	c.664T>C	c.(664-666)TTT>CTT	p.F222L		NM_002272	NP_002263	B4DRS2	B4DRS2_HUMAN	keratin 4	148						keratin filament	structural molecule activity			ovary(4)|skin(2)	6						AAGGAGGCAAACTTGTTGTTG	0.577													16	372	---	---	---	---	PASS
STAT2	6773	broad.mit.edu	37	12	56750313	56750313	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56750313G>A	uc001slc.2	-	2	121	c.43C>T	c.(43-45)CAG>TAG	p.Q15*	STAT2_uc001sld.2_Nonsense_Mutation_p.Q15*|STAT2_uc010sqn.1_Nonsense_Mutation_p.Q15*	NM_005419	NP_005410	P52630	STAT2_HUMAN	signal transducer and activator of transcription	15					interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						AGCTGATCCTGAAAGGGGCTG	0.517													42	69	---	---	---	---	PASS
CYP27B1	1594	broad.mit.edu	37	12	58158259	58158259	+	Silent	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58158259C>T	uc001spz.1	-	6	1190	c.1038G>A	c.(1036-1038)GAG>GAA	p.E346E	CYP27B1_uc001sqa.1_Silent_p.E111E|CYP27B1_uc001sqb.1_3'UTR|CYP27B1_uc001sqc.1_3'UTR	NM_000785	NP_000776	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B,	346					bone mineralization|calcium ion homeostasis|calcium ion transport|decidualization|G1 to G0 transition|hormone biosynthetic process|negative regulation of calcidiol 1-monooxygenase activity|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of keratinocyte differentiation|positive regulation of vitamin D 24-hydroxylase activity|positive regulation of vitamin D receptor signaling pathway|regulation of bone mineralization|response to estrogen stimulus|response to interferon-gamma|response to lipopolysaccharide|response to tumor necrosis factor|response to vitamin D|vitamin D biosynthetic process|xenobiotic metabolic process	mitochondrial outer membrane	calcidiol 1-monooxygenase activity|electron carrier activity|heme binding			central_nervous_system(3)	3	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Calcidiol(DB00146)|Calcitriol(DB00136)|Ergocalciferol(DB00153)	CAGCTGTGATCTCTGAGTGGA	0.582													47	232	---	---	---	---	PASS
CCDC63	160762	broad.mit.edu	37	12	111290715	111290715	+	5'UTR	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111290715C>T	uc001trv.1	+	2					CCDC63_uc009zvt.1_Intron|CCDC63_uc010sye.1_Intron|CCDC63_uc001trw.1_Intron	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63											skin(6)|ovary(1)|pancreas(1)	8						TTTGAGCTCTCTGGGTACAGT	0.438													11	120	---	---	---	---	PASS
RXFP2	122042	broad.mit.edu	37	13	32313748	32313748	+	5'UTR	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32313748C>T	uc001utt.2	+	1					RXFP2_uc010aba.2_5'UTR	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2							integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TGCTGTAAACCTATGATTGTT	0.383													6	134	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32841377	32841377	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32841377C>A	uc001utx.2	+	55	8513	c.8017C>A	c.(8017-8019)CAG>AAG	p.Q2673K	FRY_uc010tdw.1_RNA|FRY_uc001uty.2_Missense_Mutation_p.Q228K|FRY_uc001utz.2_Missense_Mutation_p.Q198K|FRY_uc010tdx.1_Missense_Mutation_p.Q43K	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	2673					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGCCGCCTTTCAGCCCGCAGC	0.542													36	128	---	---	---	---	PASS
MAB21L1	4081	broad.mit.edu	37	13	36049398	36049398	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36049398T>A	uc001uvc.2	-	1	1435	c.878A>T	c.(877-879)GAG>GTG	p.E293V	NBEA_uc001uvb.2_Intron|NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_5'Flank|NBEA_uc010teg.1_5'Flank	NM_005584	NP_005575	Q13394	MB211_HUMAN	mab-21-like protein 1	293					anatomical structure morphogenesis	nucleus				ovary(2)	2		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CAGGCAAGACTCGTCCCAGTC	0.542													24	87	---	---	---	---	PASS
WDFY2	115825	broad.mit.edu	37	13	52293353	52293353	+	Silent	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52293353G>C	uc001vfp.2	+	5	694	c.354G>C	c.(352-354)ACG>ACC	p.T118T	WDFY2_uc010ads.1_Silent_p.T118T|WDFY2_uc010adt.1_Intron	NM_052950	NP_443182	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	118	WD 3.						metal ion binding				0		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		GCAGAGTGACGATGATCCTGT	0.517													16	89	---	---	---	---	PASS
RBM26	64062	broad.mit.edu	37	13	79928637	79928637	+	Silent	SNP	A	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79928637A>C	uc001vkz.2	-	13	1943	c.1929T>G	c.(1927-1929)GGT>GGG	p.G643G	RBM26_uc001vky.2_Silent_p.G638G|RBM26_uc001vla.2_Silent_p.G641G|RBM26_uc010tia.1_Silent_p.G22G|RBM26_uc001vkx.2_Silent_p.G353G	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	641					mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		AAGGTACTGGACCCAGCCGCT	0.468													8	72	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23891451	23891451	+	Silent	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23891451C>A	uc001wjx.2	-	25	3289	c.3183G>T	c.(3181-3183)CTG>CTT	p.L1061L		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1061	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCTCCTGGGTCAGCTTCAGGT	0.592													18	80	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107062402	107062402	+	RNA	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107062402G>C	uc010tyt.1	-	131		c.6193C>G								Parts of antibodies, mostly variable regions.												0						TCCTGGGCCCGACTCCTGCAG	0.597													3	42	---	---	---	---	PASS
PLA2G4D	283748	broad.mit.edu	37	15	42375975	42375975	+	Silent	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42375975G>A	uc001zox.2	-	7	569	c.474C>T	c.(472-474)GCC>GCT	p.A158A		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	158					phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)|skin(1)	2		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		ACAGCTCTCGGGCCTGGGGAA	0.602													8	116	---	---	---	---	PASS
SPSB3	90864	broad.mit.edu	37	16	1827748	1827748	+	Missense_Mutation	SNP	C	G	G	rs147512809		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1827748C>G	uc002cmr.2	-	5	754	c.721G>C	c.(721-723)GGT>CGT	p.G241R	SPSB3_uc002cms.2_Missense_Mutation_p.G113R|SPSB3_uc002cmt.2_Missense_Mutation_p.G113R|SPSB3_uc002cmu.2_Missense_Mutation_p.G241R|SPSB3_uc002cmv.2_Missense_Mutation_p.G113R	NM_080861	NP_543137	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box	241	B30.2/SPRY.				intracellular signal transduction						0						ACGGCCTCACCTATACACTTC	0.602													21	49	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4953994	4953994	+	Silent	SNP	C	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4953994C>A	uc002cyd.1	-	3	300	c.210G>T	c.(208-210)GTG>GTT	p.V70V		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	70	Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						TCTGCAGGGTCACGTCCCGGT	0.622													8	41	---	---	---	---	PASS
ZP2	7783	broad.mit.edu	37	16	21209164	21209164	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21209164C>T	uc002dii.2	-	18	2018	c.2018G>A	c.(2017-2019)GGC>GAC	p.G673D	ZP2_uc010bwn.1_Missense_Mutation_p.G703D	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	673	Extracellular (Potential).				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)		ATCAGATGAGCCGACACCTGG	0.478													5	163	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47699737	47699737	+	Intron	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47699737A>G	uc002eev.3	+						PHKB_uc002eeu.3_Intron|PHKB_uc002eew.3_5'UTR	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GTTTCCTCCAAATGATGATGT	0.468													4	14	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61761044	61761044	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61761044G>A	uc002eog.1	-	9	1742	c.1490C>T	c.(1489-1491)GCA>GTA	p.A497V	CDH8_uc002eoh.2_Missense_Mutation_p.A266V	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	497	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATATTCGGATGCGAATTCAGG	0.388													29	356	---	---	---	---	PASS
TMEM208	29100	broad.mit.edu	37	16	67262757	67262757	+	Silent	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67262757T>A	uc002esi.2	+	5	463	c.357T>A	c.(355-357)TCT>TCA	p.S119S	LRRC29_uc002ese.2_5'Flank|LRRC29_uc002esf.2_5'Flank|LRRC29_uc002esg.2_5'Flank|LRRC29_uc010vjg.1_5'Flank|TMEM208_uc002esj.2_RNA	NM_014187	NP_054906	Q9BTX3	TM208_HUMAN	HSPC171 protein	119	Helical; (Potential).					integral to membrane					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		GCTGCTTCTCTCTCTATGTCT	0.522													32	189	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268081	70268081	+	RNA	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268081G>A	uc010cfp.1	-	3		c.334C>T								Homo sapiens cDNA, FLJ98908.																		TCTTACTGTTGGCTAAAAGGC	0.373													3	10	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11648206	11648206	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11648206G>T	uc002gne.2	+	31	6272	c.6204G>T	c.(6202-6204)CAG>CAT	p.Q2068H	DNAH9_uc010coo.2_Missense_Mutation_p.Q1362H	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2068					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTGAGGACCAGGTCCTGATGC	0.607													11	63	---	---	---	---	PASS
TMUB2	79089	broad.mit.edu	37	17	42266747	42266747	+	Silent	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42266747G>A	uc002ifo.2	+	3	550	c.393G>A	c.(391-393)GAG>GAA	p.E131E	C17orf65_uc002ifn.2_5'Flank|TMUB2_uc002ifp.2_Silent_p.E111E|TMUB2_uc010wiu.1_Intron|TMUB2_uc002ifq.2_Silent_p.E131E|TMUB2_uc002ifr.2_Intron|TMUB2_uc002ifs.2_Intron|TMUB2_uc002ift.2_Silent_p.E111E|TMUB2_uc002ifu.2_Intron|TMUB2_uc002ifv.2_Silent_p.E111E|TMUB2_uc002ifw.1_Silent_p.E111E|TMUB2_uc002ifx.2_Intron|TMUB2_uc002ify.2_Intron	NM_001076674	NP_001070142	Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain	131						integral to membrane				lung(1)	1		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GTGGTGTTGAGCCCAGCCTTG	0.597													14	69	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48703477	48703477	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48703477T>A	uc002irk.1	+	38	6871	c.6499T>A	c.(6499-6501)TAC>AAC	p.Y2167N	CACNA1G_uc002irj.1_Intron|CACNA1G_uc002irl.1_Missense_Mutation_p.Y2051N|CACNA1G_uc002irm.1_Missense_Mutation_p.Y2088N|CACNA1G_uc002irn.1_Missense_Mutation_p.Y2033N|CACNA1G_uc002iro.1_Missense_Mutation_p.Y2040N|CACNA1G_uc002irp.1_Missense_Mutation_p.Y2122N|CACNA1G_uc002irq.1_Missense_Mutation_p.Y2144N|CACNA1G_uc002irr.1_Missense_Mutation_p.Y2074N|CACNA1G_uc002irs.1_Missense_Mutation_p.Y2111N|CACNA1G_uc002irt.1_Missense_Mutation_p.Y2056N|CACNA1G_uc002irv.1_Missense_Mutation_p.Y2063N|CACNA1G_uc002irw.1_Missense_Mutation_p.Y2096N|CACNA1G_uc002iru.1_Missense_Mutation_p.Y2133N|CACNA1G_uc002irx.1_Intron|CACNA1G_uc002iry.1_Intron|CACNA1G_uc002irz.1_Missense_Mutation_p.Y1980N|CACNA1G_uc002isa.1_Missense_Mutation_p.Y1953N|CACNA1G_uc002isb.1_Missense_Mutation_p.Y1994N|CACNA1G_uc002isc.1_Missense_Mutation_p.Y2069N|CACNA1G_uc002isd.1_Missense_Mutation_p.Y1962N|CACNA1G_uc002ise.1_Missense_Mutation_p.Y1990N|CACNA1G_uc002isf.1_Missense_Mutation_p.Y2017N|CACNA1G_uc002isg.1_Missense_Mutation_p.Y1935N|CACNA1G_uc002ish.1_Missense_Mutation_p.Y1942N|CACNA1G_uc002isi.1_Missense_Mutation_p.Y1930N	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	2167	Cytoplasmic (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GGCCCGGGCCTACTCTTTCTG	0.662											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	16	---	---	---	---	PASS
UNK	85451	broad.mit.edu	37	17	73814863	73814863	+	Silent	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73814863C>T	uc002jpm.2	+	12	1740	c.1740C>T	c.(1738-1740)TTC>TTT	p.F580F		NM_001080419	NP_001073888	Q9C0B0	UNK_HUMAN	zinc finger CCCH-type domain containing 5	504							nucleic acid binding|zinc ion binding				0			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTCTGCCCTTCTACCCCACCA	0.587													3	28	---	---	---	---	PASS
QRICH2	84074	broad.mit.edu	37	17	74276934	74276934	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74276934C>T	uc002jrd.1	-	9	4046	c.3866G>A	c.(3865-3867)CGG>CAG	p.R1289Q	QRICH2_uc010wsz.1_Missense_Mutation_p.R1215Q|QRICH2_uc010dgw.1_Missense_Mutation_p.R133Q	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1289	Potential.						protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						CTGTTTCTGCCGATGGTCCTC	0.622													23	84	---	---	---	---	PASS
CCBE1	147372	broad.mit.edu	37	18	57103088	57103088	+	3'UTR	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57103088C>T	uc002lib.2	-	11					CCBE1_uc010dpq.2_3'UTR|CCBE1_uc002lia.2_3'UTR	NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				GATGGTTTAACTGCAGGTGAG	0.353													91	267	---	---	---	---	PASS
APC2	10297	broad.mit.edu	37	19	1461048	1461048	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1461048A>G	uc002lsr.1	+	13	1742	c.1534A>G	c.(1534-1536)ATC>GTC	p.I512V	APC2_uc002lss.1_Missense_Mutation_p.I94V|APC2_uc002lst.1_Missense_Mutation_p.I512V|APC2_uc002lsu.1_Missense_Mutation_p.I511V|uc002lsv.2_5'Flank	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	512	ARM 2.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGTCCAGCATCCTTCGGAA	0.642													34	152	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17010350	17010350	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17010350T>G	uc002nfb.2	-	37	4957	c.4925A>C	c.(4924-4926)GAC>GCC	p.D1642A	CPAMD8_uc010xpj.1_5'Flank|CPAMD8_uc002nfd.1_Missense_Mutation_p.D107A	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1595						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						CATGTGCTTGTCAAGGAGCAG	0.577													13	41	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35837707	35837707	+	3'UTR	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35837707A>G	uc010edt.2	+	14					CD22_uc010xst.1_3'UTR|CD22_uc010edu.2_3'UTR|CD22_uc010edv.2_3'UTR|CD22_uc002nzb.3_3'UTR|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor						cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	ATGTGCGcacacacacacaca	0.507													2	11	---	---	---	---	PASS
TMEM143	55260	broad.mit.edu	37	19	48845836	48845836	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48845836G>T	uc002pix.1	-	6	935	c.926C>A	c.(925-927)TCC>TAC	p.S309Y	TMEM143_uc002piw.1_Intron|TMEM143_uc002piy.1_Missense_Mutation_p.S274Y|TMEM143_uc010xzn.1_Missense_Mutation_p.S244Y|TMEM143_uc010elw.1_Missense_Mutation_p.S209Y|TMEM143_uc010xzo.1_Missense_Mutation_p.S99Y	NM_018273	NP_060743	Q96AN5	TM143_HUMAN	transmembrane protein 143	309	Helical; (Potential).					integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		CAGCAGCAGGGAGGTGGCCAC	0.667													3	30	---	---	---	---	PASS
MED25	81857	broad.mit.edu	37	19	50322487	50322487	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50322487C>G	uc002ppw.1	+	3	292	c.239C>G	c.(238-240)TCC>TGC	p.S80C	MED25_uc010ybe.1_Intron|MED25_uc010enl.1_Missense_Mutation_p.S80C	NM_030973	NP_112235	Q71SY5	MED25_HUMAN	mediator complex subunit 25	80	Interaction with the Mediator complex.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm				ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		GCTCCCGAGTCCTACGTACAA	0.537													14	80	---	---	---	---	PASS
ZNF17	7565	broad.mit.edu	37	19	57931180	57931180	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57931180C>G	uc002qoo.1	+	3	551	c.320C>G	c.(319-321)CCC>CGC	p.P107R	ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Missense_Mutation_p.P109R	NM_006959	NP_008890	P17021	ZNF17_HUMAN	zinc finger protein 17	107					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		GGAACACACCCCAAGCGTACA	0.507													23	126	---	---	---	---	PASS
CD93	22918	broad.mit.edu	37	20	23066499	23066499	+	Silent	SNP	G	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23066499G>A	uc002wsv.2	-	1	479	c.331C>T	c.(331-333)CTG>TTG	p.L111L		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	111	Extracellular (Potential).|C-type lectin.				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					AAGCCCTTCAGCGGCAGACTA	0.632													5	15	---	---	---	---	PASS
EDEM2	55741	broad.mit.edu	37	20	33703229	33703229	+	3'UTR	SNP	C	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33703229C>T	uc002xbo.2	-	11					EDEM2_uc010zus.1_3'UTR|EDEM2_uc002xbq.2_3'UTR|EDEM2_uc010zut.1_3'UTR|EDEM2_uc002xbp.2_3'UTR|EDEM2_uc002xbn.2_3'UTR|EDEM2_uc002xbr.2_RNA|EDEM2_uc010zuu.1_3'UTR	NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)			aaaaaattatCCAGTGGTTAT	0.333													31	118	---	---	---	---	PASS
RBM39	9584	broad.mit.edu	37	20	34292611	34292611	+	Silent	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34292611A>G	uc002xeb.2	-	16	1815	c.1471T>C	c.(1471-1473)TTG>CTG	p.L491L	RBM39_uc002xdz.2_Silent_p.L467L|RBM39_uc002xea.2_Silent_p.L334L|RBM39_uc010gfn.2_Silent_p.L334L|RBM39_uc010zvm.1_Silent_p.L463L|RBM39_uc002xeg.2_Silent_p.L469L|RBM39_uc002xec.2_Silent_p.L485L|RBM39_uc002xed.2_Silent_p.L209L|RBM39_uc002xee.2_Silent_p.L334L|RBM39_uc002xef.2_Silent_p.L328L|RBM39_uc010zvn.1_Silent_p.L334L	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a	491	Interaction with NCOA6 (By similarity).|RRM 3.				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					CTGCCATGCAATGCATTGACA	0.378													45	184	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40568316	40568316	+	Intron	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40568316T>C	uc002yxk.1	-						BRWD1_uc010goc.1_Intron|BRWD1_uc002yxl.2_Missense_Mutation_p.K2227E	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTTTTAGATTTTGCATAGTCC	0.378													7	385	---	---	---	---	PASS
SH3BGR	6450	broad.mit.edu	37	21	40834425	40834425	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40834425A>G	uc002yya.2	+	2	413	c.359A>G	c.(358-360)AAA>AGA	p.K120R	SH3BGR_uc002yxz.2_Missense_Mutation_p.K9R	NM_007341	NP_031367	P55822	SH3BG_HUMAN	SH3-binding domain and glutamic acid-rich	120					protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		CCTGGAGAGAAAAAACCTCAA	0.423													26	74	---	---	---	---	PASS
RIPK4	54101	broad.mit.edu	37	21	43164104	43164104	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43164104T>A	uc002yzn.1	-	7	1181	c.1133A>T	c.(1132-1134)GAC>GTC	p.D378V		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	378						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						GAAGGCGGAGTCCACCGAGGA	0.647													9	54	---	---	---	---	PASS
PRAME	23532	broad.mit.edu	37	22	22890580	22890580	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22890580A>G	uc002zwf.2	-	5	1595	c.1439T>C	c.(1438-1440)GTC>GCC	p.V480A	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.V464A|PRAME_uc010gtr.2_Missense_Mutation_p.V480A|PRAME_uc002zwg.2_Missense_Mutation_p.V480A|PRAME_uc002zwh.2_Missense_Mutation_p.V480A|PRAME_uc002zwi.2_Missense_Mutation_p.V480A|PRAME_uc002zwj.2_Missense_Mutation_p.V480A|PRAME_uc002zwk.2_Missense_Mutation_p.V480A	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	480	Mediates interaction with RARA.				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		ACTAAGCCAGACCATGCTGGG	0.582													44	96	---	---	---	---	PASS
PVALB	5816	broad.mit.edu	37	22	37196902	37196902	+	3'UTR	SNP	A	G	G			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37196902A>G	uc010gwz.2	-	4					PVALB_uc003apx.2_3'UTR	NM_002854	NP_002845	P20472	PRVA_HUMAN	parvalbumin								calcium ion binding			skin(1)	1						TTCAGGGCAGAGAGGTGGAAG	0.527													14	69	---	---	---	---	PASS
APOBEC3B	9582	broad.mit.edu	37	22	39381885	39381885	+	Silent	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39381885T>A	uc003awo.1	+	3	297	c.243T>A	c.(241-243)CCT>CCA	p.P81P	APOBEC3A_uc011aoc.1_Intron|APOBEC3B_uc003awp.1_Silent_p.P81P|APOBEC3B_uc003awq.1_RNA|APOBEC3D_uc011aod.1_Intron|APOBEC3D_uc011aoe.1_Intron|APOBEC3D_uc011aof.1_Intron	NM_004900	NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	81					negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					ACCAGCTGCCTGCTTACAAGT	0.458													10	185	---	---	---	---	PASS
APOBEC3F	200316	broad.mit.edu	37	22	39441014	39441014	+	Silent	SNP	T	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39441014T>A	uc003aww.2	+	3	533	c.240T>A	c.(238-240)CCT>CCA	p.P80P	APOBEC3F_uc011aog.1_Silent_p.P80P	NM_145298	NP_660341	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)					ACCAGCTGCCTGCTTACAAGT	0.478													23	65	---	---	---	---	PASS
CDKL5	6792	broad.mit.edu	37	X	18622979	18622979	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18622979G>C	uc004cym.2	+	12	2188	c.1935G>C	c.(1933-1935)TTG>TTC	p.L645F	CDKL5_uc004cyn.2_Missense_Mutation_p.L645F	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	645					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					TGCAACTCTTGTCACCCCAGG	0.532													30	169	---	---	---	---	PASS
CASK	8573	broad.mit.edu	37	X	41448933	41448933	+	Intron	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41448933T>C	uc004dfl.3	-						CASK_uc004dfj.3_5'UTR|CASK_uc004dfk.3_Intron|CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein						cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6						CTAAACAATATTTTTCTTTTA	0.313													4	16	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71359245	71359245	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71359245A>C	uc011mqa.1	+	6	1847	c.1847A>C	c.(1846-1848)GAT>GCT	p.D616A	NHSL2_uc004eak.1_Missense_Mutation_p.D250A|NHSL2_uc010nli.2_Missense_Mutation_p.D385A	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2	616											0	Renal(35;0.156)					TCCCACCCAGATGCTCAGGGT	0.532													24	67	---	---	---	---	PASS
FAM46D	169966	broad.mit.edu	37	X	79698411	79698411	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79698411A>T	uc004edl.1	+	5	707	c.373A>T	c.(373-375)ATC>TTC	p.I125F	FAM46D_uc004edm.1_Missense_Mutation_p.I125F	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN	hypothetical protein LOC169966	125										lung(2)	2						CTCCCCAGATATCATGAAAGA	0.383													26	310	---	---	---	---	PASS
ALG13	79868	broad.mit.edu	37	X	111003299	111003299	+	3'UTR	SNP	T	C	C			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111003299T>C	uc011msy.1	+	27					ALG13_uc011msx.1_3'UTR|ALG13_uc011msz.1_3'UTR|ALG13_uc011mta.1_3'UTR|ALG13_uc011mtb.1_3'UTR			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);						dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						TATTTTATGTTAGTGGTTAAA	0.269													6	25	---	---	---	---	PASS
NKAP	79576	broad.mit.edu	37	X	119077352	119077352	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119077352G>T	uc004esh.2	-	1	384	c.217C>A	c.(217-219)CGC>AGC	p.R73S		NM_024528	NP_078804	Q8N5F7	NKAP_HUMAN	NFKB activating protein	73	Ser-rich.				negative regulation of transcription, DNA-dependent|Notch signaling pathway|positive regulation of alpha-beta T cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|protein binding			ovary(2)	2						GAGCGTGAGCGGTAGGACTGG	0.667													9	28	---	---	---	---	PASS
CUL4B	8450	broad.mit.edu	37	X	119694026	119694026	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119694026G>T	uc004esw.2	-	3	959	c.522C>A	c.(520-522)AAC>AAA	p.N174K	CUL4B_uc004esv.2_Missense_Mutation_p.N156K	NM_003588	NP_003579	Q13620	CUL4B_HUMAN	cullin 4B isoform 1	174	Ser-rich.				cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3						TGGCTAGGCCGTTTGCATGAT	0.413													38	149	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11077259	11077259	+	Intron	DEL	C	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11077259delC	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		TGTTACCtttctttttttttt	0.025													6	3	---	---	---	---	
EPB41	2035	broad.mit.edu	37	1	29435711	29435711	+	Intron	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29435711delA	uc001brm.1	+						EPB41_uc001brg.1_Intron|EPB41_uc001brh.1_Intron|EPB41_uc001bri.1_Intron|EPB41_uc001brj.1_Intron|EPB41_uc001brl.1_Intron|EPB41_uc009vtl.1_Intron|EPB41_uc009vtm.1_Intron|EPB41_uc009vtn.1_Intron	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		actccgtctcaaaaaaaaaaa	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	43756637	43756637	+	IGR	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43756637delT								C1orf210 (5387 upstream) : TIE1 (10027 downstream)																							gaaagacgggtttcaccaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203723077	203723084	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203723077_203723084delGAAGGAAG								ATP2B4 (9870 upstream) : LAX1 (11200 downstream)																							agaaaagaaagaaggaaggaaggaagga	0.000													4	3	---	---	---	---	
MARK1	4139	broad.mit.edu	37	1	220749378	220749379	+	Intron	DEL	CT	-	-	rs76839238		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220749378_220749379delCT	uc001hmn.3	+						MARK1_uc001hml.2_Intron|MARK1_uc009xdw.2_Intron|MARK1_uc010pun.1_Intron|MARK1_uc001hmm.3_Intron	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1						intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		TCTTTTCAGACTCTGCTAAAAT	0.347													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2798369	2798370	+	IGR	INS	-	AC	AC	rs139503768	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2798369_2798370insAC								MYT1L (463324 upstream) : TSSC1 (394371 downstream)																							tcactgtctgtacacacacaca	0.000													4	2	---	---	---	---	
APLF	200558	broad.mit.edu	37	2	68812754	68812755	+	Intron	DEL	AC	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68812754_68812755delAC	uc002seq.1	+									Q8IW19	APLF_HUMAN	Homo sapiens cDNA FLJ16593 fis, clone TESTI4004722, highly  similar to Mus musculus G protein-coupled receptor 73 (Gpr73).						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						gtattAAAATacacacacacac	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	98248129	98248130	+	IGR	INS	-	GAAG	GAAG	rs141641657	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98248129_98248130insGAAG								ANKRD36B (41701 upstream) : COX5B (14391 downstream)																							tcAgaaagaaagaaggaaggaa	0.000													4	2	---	---	---	---	
PNKD	25953	broad.mit.edu	37	2	219179818	219179821	+	Intron	DEL	TCCT	-	-	rs148964558		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219179818_219179821delTCCT	uc002vhn.2	+							NM_015488	NP_056303	Q8N490	PNKD_HUMAN	myofibrillogenesis regulator 1 isoform 1							membrane|mitochondrion|nucleus	hydroxyacylglutathione hydrolase activity|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		tctctctctctccttccttccttc	0.000													4	2	---	---	---	---	
RQCD1	9125	broad.mit.edu	37	2	219447953	219447978	+	Intron	DEL	TGTGTCTCTCTCTCTCTCTCTCTCTC	-	-	rs36210927	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447953_219447978delTGTGTCTCTCTCTCTCTCTCTCTCTC	uc010zkh.1	+						RQCD1_uc002vih.1_Intron|RQCD1_uc010zki.1_Intron	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		tgtgtgtgtgtgtgtctctctctctctctctctctctctctctctc	0.226													6	4	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113167135	113167135	+	Intron	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113167135delT	uc003eag.3	-						CCDC52_uc003eaf.3_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						CTTGAAAGACTTTTTTTTTTT	0.323													4	2	---	---	---	---	
NCK1	4690	broad.mit.edu	37	3	136586021	136586022	+	Intron	DEL	TC	-	-	rs55659307		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136586021_136586022delTC	uc003erh.2	+							NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1						axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						cttccttccttctttctttctt	0.030													4	2	---	---	---	---	
ZDHHC19	131540	broad.mit.edu	37	3	195937314	195937315	+	Intron	INS	-	TAAAG	TAAAG	rs59406858		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937314_195937315insTAAAG	uc003fwc.2	-						ZDHHC19_uc010hzz.2_Intron|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_Intron	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19							integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		agagaaagaaagaaagaaaaga	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	46725772	46725772	+	IGR	DEL	G	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46725772delG								GABRA2 (333351 upstream) : COX7B2 (11077 downstream)																							tttttttcttggttttttttt	0.338													6	3	---	---	---	---	
UGT2B4	7363	broad.mit.edu	37	4	70361792	70361792	+	5'Flank	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70361792delT	uc003hek.3	-						UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_5'Flank	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor						estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						TCTTTTTGGATTTTTTTTTTT	0.174													6	3	---	---	---	---	
BMP2K	55589	broad.mit.edu	37	4	79707560	79707563	+	Intron	DEL	TGTG	-	-	rs140899218		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79707560_79707563delTGTG	uc003hlk.2	+						BMP2K_uc010ijl.1_Intron|BMP2K_uc003hlj.2_Intron	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a							nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						agccacccaAtgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
SPATA5	166378	broad.mit.edu	37	4	123856627	123856628	+	Intron	INS	-	T	T			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123856627_123856628insT	uc003iez.3	+						SPATA5_uc003iey.2_Intron	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						TGGGTGTCCAGTTTTTTTTTTT	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	146249499	146249500	+	IGR	INS	-	AGGA	AGGA	rs71915350		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146249499_146249500insAGGA								OTUD4 (148667 upstream) : SMAD1 (153451 downstream)																							aACACTATTTGaggaaggaagg	0.015													4	2	---	---	---	---	
DCLK2	166614	broad.mit.edu	37	4	151056318	151056319	+	Intron	DEL	AC	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151056318_151056319delAC	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)					ATACACGTGTacacacacacac	0.243													5	4	---	---	---	---	
GUCY1A3	2982	broad.mit.edu	37	4	156651536	156651539	+	3'UTR	DEL	ATGT	-	-	rs146677644		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156651536_156651539delATGT	uc003iov.2	+	11					GUCY1A3_uc003iow.2_3'UTR|GUCY1A3_uc010iqd.2_3'UTR|GUCY1A3_uc003iox.2_3'UTR|GUCY1A3_uc003ioz.2_3'UTR|GUCY1A3_uc003ioy.2_3'UTR|GUCY1A3_uc010iqe.2_3'UTR|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_3'UTR	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		ACATGACAAAATGTATGTACTCAC	0.338													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3276462	3276462	+	IGR	DEL	G	-	-	rs140838536	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3276462delG								C5orf38 (520950 upstream) : IRX1 (319706 downstream)																							ggaggaaggagggaggggagg	0.000													4	2	---	---	---	---	
NNT	23530	broad.mit.edu	37	5	43628105	43628105	+	Intron	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43628105delT	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	GTTTTTTTTCTTTCAGAAAAG	0.303													7	4	---	---	---	---	
IPO11	51194	broad.mit.edu	37	5	61783458	61783459	+	Intron	INS	-	T	T	rs34280718		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61783458_61783459insT	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtb.1_Intron	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		GGTAACCTTACTTTTTTTTTTT	0.213													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	91218548	91218551	+	IGR	DEL	ACAC	-	-	rs5869551		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91218548_91218551delACAC								LOC100129716 (502017 upstream) : None (None downstream)																							AGCACATATTacacacacacacac	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	128452341	128452342	+	IGR	DEL	CA	-	-	rs72121436		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128452341_128452342delCA								ISOC1 (2624 upstream) : ADAMTS19 (343761 downstream)																							aatgttcatgcacacacacaca	0.119													4	2	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154287016	154287017	+	Intron	INS	-	GAAAAAAAA	GAAAAAAAA	rs145860358	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154287016_154287017insGAAAAAAAA	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAATAAAGCTTAACAAAAAAAA	0.356													4	2	---	---	---	---	
NUP153	9972	broad.mit.edu	37	6	17669074	17669074	+	Intron	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17669074delA	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			actgagactcaaaaaaaaaaa	0.114													6	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51854697	51854699	+	Intron	DEL	GGG	-	-	rs72417168	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51854697_51854699delGGG	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					gaaggaaggagggaggaaggaag	0.123													4	2	---	---	---	---	
CDC40	51362	broad.mit.edu	37	6	110534092	110534092	+	Intron	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110534092delA	uc003pua.2	+							NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ATTAAAGGTTAAAAAAAAAAT	0.348													4	2	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40192302	40192302	+	Intron	DEL	G	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40192302delG	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						AAATTAAGGTGtttttttttt	0.159													4	2	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89929478	89929479	+	Intron	INS	-	T	T	rs35447757		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89929478_89929479insT	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_Intron	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						TTTGTCTAAAGTTTTTTTTTTT	0.252													4	3	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													4	2	---	---	---	---	
WASL	8976	broad.mit.edu	37	7	123336466	123336467	+	Intron	INS	-	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123336466_123336467insA	uc003vkz.2	-							NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein						actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						GCAGCTGCCTTAAAAAAAAAAA	0.287													3	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3216949	3216949	+	Intron	DEL	A	-	-	rs34858861		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3216949delA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCTATTACTAAAAAAAAAAA	0.308													6	3	---	---	---	---	
CHRAC1	54108	broad.mit.edu	37	8	141521619	141521619	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141521619delT	uc003yvl.2	+	1	219	c.21delT	c.(19-21)GGTfs	p.G7fs	CHRAC1_uc010mem.1_RNA	NM_017444	NP_059140	Q9NRG0	CHRC1_HUMAN	chromatin accessibility complex 1	7					chromatin remodeling	chromatin accessibility complex|epsilon DNA polymerase complex	DNA-directed DNA polymerase activity|sequence-specific DNA binding			ovary(1)	1	all_cancers(97;5.52e-16)|all_epithelial(106;1.22e-13)|Lung NSC(106;4.09e-06)|all_lung(105;6e-06)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.107)			TGGTCGTGGGTAAAGACAAGG	0.697													5	3	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	710630	710630	+	Intron	DEL	C	-	-	rs68161748		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:710630delC	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		aaaaaaaaaacaaaaaaaaac	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68344315	68344316	+	IGR	INS	-	AAGAAAGA	AAGAAAGA	rs62547679		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68344315_68344316insAAGAAAGA								FAM27B (550126 upstream) : MIR1299 (657923 downstream)																							aggaaggaaggaaAATACAATA	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	78007877	78007878	+	IGR	DEL	CA	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78007877_78007878delCA								OSTF1 (245764 upstream) : PCSK5 (497682 downstream)																							TGGGAGATATcacacacacaca	0.267													3	3	---	---	---	---	
BICC1	80114	broad.mit.edu	37	10	60548865	60548865	+	Intron	DEL	A	-	-	rs75442527		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60548865delA	uc001jki.1	+							NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						aacagaaaggaaaaaaaaaaa	0.119													4	2	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94268316	94268317	+	Intron	INS	-	A	A	rs144722232		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268316_94268317insA	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	atctaaaaaagaaaaaaaaAAA	0.188													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	100531316	100531317	+	IGR	INS	-	GT	GT	rs138956273	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100531316_100531317insGT								CNTN5 (303844 upstream) : ARHGAP42 (27090 downstream)																							acacaaaactcgtgtgtgtgtg	0.000													1	5	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12317063	12317063	+	Intron	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317063delA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				gacaccgtttaaaaaaaaaaa	0.179													8	5	---	---	---	---	
CPNE8	144402	broad.mit.edu	37	12	39268231	39268231	+	Intron	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39268231delA	uc001rls.1	-							NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII											pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				CAACTTTTGCAAAATCAAATG	0.343													67	59	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		agactctcttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	54592074	54592094	+	IGR	DEL	AAAGGAAGGAAGGAAGGCAAG	-	-	rs140720075		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54592074_54592094delAAAGGAAGGAAGGAAGGCAAG								OLFM4 (965888 upstream) : MIR1297 (294013 downstream)																							gaaggaaagaaaaggaaggaaggaaggcaagaaaggaagag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79766088	79766089	+	IGR	DEL	AG	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79766088_79766089delAG								RNF219 (531388 upstream) : RBM26 (128011 downstream)																							cacgtgggaaagagagtagcca	0.153													9	8	---	---	---	---	
C14orf179	112752	broad.mit.edu	37	14	76527155	76527156	+	Intron	INS	-	CCTCCCTC	CCTCCCTC	rs142190540	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76527155_76527156insCCTCCCTC	uc010asm.1	+						C14orf179_uc001xsf.2_Intron|C14orf179_uc010asl.1_Intron|C14orf179_uc001xsg.2_Intron|C14orf179_uc010tve.1_Intron	NM_001102564	NP_001096034	Q96FT9	IFT43_HUMAN	hypothetical protein LOC112752 isoform 2						cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)		ttccctcccttcctccctccct	0.000													4	2	---	---	---	---	
C14orf159	80017	broad.mit.edu	37	14	91662917	91662917	+	Intron	DEL	G	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91662917delG	uc001xzb.2	+						C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Intron|C14orf159_uc001xzc.2_Intron|C14orf159_uc001xza.2_Intron|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Intron|C14orf159_uc001xze.2_Intron	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a							mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		GCCCTTCAGAGGGAGCGAAGC	0.527													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28913367	28913367	+	Intron	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28913367delT	uc010azc.2	+						uc010uao.1_Intron					Homo sapiens I.M.A.G.E. clone 321824, mRNA sequence.																		TGAGTTCTCCTTTTTTTTTTT	0.308													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92011695	92011696	+	Intron	DEL	AC	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92011695_92011696delAC	uc002bqw.2	+											Homo sapiens cDNA clone IMAGE:5273631.																		caataggaagacacacacacac	0.104													4	2	---	---	---	---	
OTOA	146183	broad.mit.edu	37	16	21725621	21725622	+	Intron	INS	-	CTTCCTTC	CTTCCTTC	rs34598445		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21725621_21725622insCTTCCTTC	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron|OTOA_uc002dji.2_Intron|OTOA_uc010vbk.1_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		tcttttcctttcttccttcctt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27072748	27072749	+	IGR	INS	-	AC	AC	rs138466872	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27072748_27072749insAC								HS3ST4 (923740 upstream) : C16orf82 (5470 downstream)																							TCCCTGTGGGTacacacacaca	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	57454612	57454615	+	IGR	DEL	AAGG	-	-	rs113613565		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57454612_57454615delAAGG								CCL17 (4638 upstream) : CIAPIN1 (7472 downstream)																							aagaaaaagaaaggaaggaaggaa	0.000													6	8	---	---	---	---	
LOC283867	283867	broad.mit.edu	37	16	65446066	65446069	+	Intron	DEL	GGAA	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65446066_65446069delGGAA	uc010cdp.1	-						LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)		agggagggagggaaggaaggaagg	0.093													5	3	---	---	---	---	
DYNC1LI2	1783	broad.mit.edu	37	16	66757488	66757488	+	3'UTR	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66757488delT	uc002eqb.1	-	13					DYNC1LI2_uc010vis.1_3'UTR	NM_006141	NP_006132	O43237	DC1L2_HUMAN	dynein, cytoplasmic, light intermediate						transport	centrosome|cytoplasmic dynein complex|microtubule	ATP binding|motor activity			central_nervous_system(3)|skin(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		GCCAATGAAGTTTTTTTTTTT	0.393													6	4	---	---	---	---	
CLEC18C	283971	broad.mit.edu	37	16	70072984	70072984	+	Intron	DEL	T	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70072984delT	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_Intron	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						TTGCTTCAAGTTTTTTTTTTT	0.378													3	4	---	---	---	---	
SLFN12	55106	broad.mit.edu	37	17	33761383	33761383	+	5'Flank	DEL	A	-	-	rs71375409		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33761383delA	uc002hji.3	-						SLFN12_uc002hjj.3_5'Flank|SLFN12_uc010cts.2_5'Flank	NM_018042	NP_060512	Q8IYM2	SLN12_HUMAN	schlafen family member 12								ATP binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		agagagagagaaaggaaggaa	0.000													4	3	---	---	---	---	
COG1	9382	broad.mit.edu	37	17	71202123	71202126	+	Intron	DEL	AGAC	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71202123_71202126delAGAC	uc002jjg.2	+						COG1_uc002jjh.2_Intron|COG1_uc002jjf.1_Intron	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1						Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			GACTTCACTTAGACATCATGCTTG	0.456													4	2	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626918	73626919	+	Splice_Site	INS	-	TG	TG	rs142406301	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626918_73626919insTG	uc010dgl.2	-	12	1742	c.1586_splice	c.e12-1	p.D529_splice	RECQL5_uc010dgk.2_Splice_Site_p.D502_splice|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGTTCTCATCTGTGGGGGGGG	0.644								Other_identified_genes_with_known_or_suspected_DNA_repair_function					8	5	---	---	---	---	
SLC38A10	124565	broad.mit.edu	37	17	79257417	79257418	+	Intron	INS	-	T	T	rs111438281		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79257417_79257418insT	uc002jzz.1	-						SLC38A10_uc002jzy.1_Intron|SLC38A10_uc002kab.2_Intron	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a						amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			tttcttttttcttttttttttt	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47038245	47038246	+	Intron	DEL	AA	-	-	rs12461106		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47038245_47038246delAA	uc002pev.1	-											SubName: Full=cDNA FLJ37185 fis, clone BRALZ2001743, moderately similar to Serine/threonine-protein phosphatase 5;          EC=3.1.3.16;																		agactccatcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NOP56	10528	broad.mit.edu	37	20	2633326	2633331	+	Intron	DEL	GGGCGC	-	-	rs28970277	byFrequency	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2633326_2633331delGGGCGC	uc002wgh.2	+						NOP56_uc010zpy.1_Intron|MIR1292_hsa-mir-1292|MI0006433_5'Flank|NOP56_uc002wgi.2_5'Flank|SNORD110_uc002wgj.2_5'Flank|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A						rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						AGTGGTTGCGGGGCGCGGGCGACGCG	0.573													9	4	---	---	---	---	
ATRN	8455	broad.mit.edu	37	20	3557326	3557327	+	Intron	INS	-	TCTG	TCTG	rs4989370	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3557326_3557327insTCTG	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						Ttatctatctatctgtctgtct	0.272													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19831702	19831705	+	IGR	DEL	AAGG	-	-	rs145309073	by1000genomes	TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19831702_19831705delAAGG								SLC24A3 (128162 upstream) : RIN2 (38505 downstream)																							aggagaaagaaaggaaggaaggaa	0.098													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44621893	44621893	+	IGR	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44621893delA								ZNF335 (21060 upstream) : MMP9 (15654 downstream)																							ctttctatttaaaaaaaaaag	0.020													4	2	---	---	---	---	
USP25	29761	broad.mit.edu	37	21	17236478	17236478	+	Intron	DEL	A	-	-	rs72445627		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17236478delA	uc002yjy.1	+						USP25_uc011aby.1_Intron|USP25_uc002yjz.1_Intron|USP25_uc010gla.1_Intron	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25						protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TTTAAAAGCCAAAAAAAAAAA	0.299													8	4	---	---	---	---	
SETD4	54093	broad.mit.edu	37	21	37414024	37414024	+	Intron	DEL	C	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37414024delC	uc002yuw.1	-						SETD4_uc002yux.1_Intron|SETD4_uc002yuu.2_Intron|SETD4_uc002yuv.2_Intron	NM_017438	NP_059134	Q9NVD3	SETD4_HUMAN	SET domain containing 4 isoform a											large_intestine(1)|ovary(1)	2						AGGGGTCTCACCCCCATGGAA	0.418													3	3	---	---	---	---	
CACNA1I	8911	broad.mit.edu	37	22	39966252	39966259	+	5'Flank	DEL	CCTTCCTT	-	-	rs10528897		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39966252_39966259delCCTTCCTT	uc003ayc.2	+						CACNA1I_uc003ayd.2_5'Flank	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	AGTTAAGATCccttccttccttccttcc	0.144													4	2	---	---	---	---	
TBC1D22A	25771	broad.mit.edu	37	22	47307814	47307815	+	Intron	INS	-	A	A			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47307814_47307815insA	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		gaccctgtctcaaaaaaaaaaa	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	54898080	54898081	+	IGR	INS	-	GT	GT	rs72503953		TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54898080_54898081insGT								MAGED2 (55635 upstream) : TRO (49168 downstream)																							tgtgtgtgtgcgtgtgtgtgtg	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	150162649	150162649	+	IGR	DEL	A	-	-			TCGA-BP-4782-01A-02D-1421-08	TCGA-BP-4782-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150162649delA								HMGB3 (3403 upstream) : GPR50 (182410 downstream)																							TCTGCTTGCCAAAAAAAAAAA	0.204													10	5	---	---	---	---	
