Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	970662	970662	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:970662C>A	uc001ack.1	+	3	519	c.469C>A	c.(469-471)CCC>ACC	p.P157T		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	157	NtA.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TCCAGATAAACCCGGGACCCA	0.612													44	204	---	---	---	---	PASS
ACOT7	11332	broad.mit.edu	37	1	6387379	6387379	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6387379A>G	uc001ams.2	-	5	792	c.635T>C	c.(634-636)GTC>GCC	p.V212A	ACOT7_uc010nzq.1_Missense_Mutation_p.V97A|ACOT7_uc001amt.2_Missense_Mutation_p.V202A|ACOT7_uc001amu.2_RNA|ACOT7_uc001amv.2_RNA|ACOT7_uc001amq.2_Missense_Mutation_p.V161A|ACOT7_uc001amr.2_Missense_Mutation_p.V182A	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb	212						mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		GACTGGCTGGACGATGTCCCC	0.652													4	22	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918717	16918717	+	5'UTR	SNP	C	T	T	rs3872321	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918717C>T	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AAACAAGGTTCGAGGTGCCTG	0.478													5	19	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36202022	36202022	+	3'UTR	SNP	A	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36202022A>G	uc001bzi.2	-	25					CLSPN_uc009vux.2_3'UTR	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin						activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CATTGGCTGGAGTGTCAATTC	0.393													6	23	---	---	---	---	PASS
ACADM	34	broad.mit.edu	37	1	76205772	76205772	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76205772A>G	uc001dgw.3	+	7	1006	c.576A>G	c.(574-576)ATA>ATG	p.I192M	ACADM_uc010orc.1_3'UTR|ACADM_uc010ord.1_Missense_Mutation_p.I106M|ACADM_uc009wbp.2_Missense_Mutation_p.I196M|ACADM_uc009wbr.2_Missense_Mutation_p.I225M|ACADM_uc010ore.1_Missense_Mutation_p.I156M|ACADM_uc010orf.1_Missense_Mutation_p.I3M|ACADM_uc001dgx.3_Missense_Mutation_p.I106M|ACADM_uc010org.1_Missense_Mutation_p.I62M	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a	192	FAD.				carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						AGATGTGGATAACCAACGGAG	0.333													24	112	---	---	---	---	PASS
CLCC1	23155	broad.mit.edu	37	1	109482394	109482394	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109482394A>T	uc001dwe.1	-	9	997	c.905T>A	c.(904-906)GTT>GAT	p.V302D	AKNAD1_uc010ovb.1_Intron|CLCC1_uc001dwf.1_Missense_Mutation_p.V302D|CLCC1_uc001dwg.1_Missense_Mutation_p.V252D|CLCC1_uc009wes.1_Missense_Mutation_p.V181D|CLCC1_uc009wet.1_Missense_Mutation_p.V117D	NM_001048210	NP_001041675	Q96S66	CLCC1_HUMAN	Mid-1-related chloride channel 1 isoform 1	302						endoplasmic reticulum|Golgi apparatus|integral to membrane|nucleus				liver(1)	1		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		GGTGAATGTAACTGCAAGTGC	0.388													15	76	---	---	---	---	PASS
UBL4B	164153	broad.mit.edu	37	1	110655193	110655193	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110655193T>A	uc001dzc.2	+	1	132	c.37T>A	c.(37-39)TGC>AGC	p.C13S		NM_203412	NP_981957	Q8N7F7	UBL4B_HUMAN	ubiquitin-like 4B	13	Ubiquitin-like.					cytoplasm				ovary(1)	1		all_cancers(81;1.14e-05)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0236)|all cancers(265;0.0823)|Epithelial(280;0.0917)|Colorectal(144;0.109)|LUSC - Lung squamous cell carcinoma(189;0.134)		GGGCCAGAGATGCAGTCTGAA	0.592													22	101	---	---	---	---	PASS
AP4B1	10717	broad.mit.edu	37	1	114439000	114439000	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114439000C>A	uc001eeb.2	-	8	1533	c.1390G>T	c.(1390-1392)GTG>TTG	p.V464L	uc001edv.1_Intron|AP4B1_uc001eec.2_Missense_Mutation_p.V296L|AP4B1_uc001eed.2_Missense_Mutation_p.V464L|AP4B1_uc010owp.1_Missense_Mutation_p.V365L|AP4B1_uc001eea.1_Missense_Mutation_p.V258L|AP4B1_uc001eee.1_5'UTR	NM_006594	NP_006585	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1	464					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|soluble fraction|trans-Golgi network	protein binding|protein transporter activity			ovary(3)|central_nervous_system(1)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCGACTTCACATTCTCAACA	0.478													43	245	---	---	---	---	PASS
C1orf65	164127	broad.mit.edu	37	1	223568377	223568377	+	Silent	SNP	C	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223568377C>T	uc001hoa.2	+	1	1663	c.1560C>T	c.(1558-1560)CAC>CAT	p.H520H		NM_152610	NP_689823	Q8N715	CA065_HUMAN	hypothetical protein LOC164127	520										central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0704)		CCAGGAGTCACGTGCACAAGA	0.577													18	87	---	---	---	---	PASS
PARP1	142	broad.mit.edu	37	1	226564845	226564845	+	Silent	SNP	G	C	C			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226564845G>C	uc001hqd.3	-	13	2076	c.1905C>G	c.(1903-1905)CCC>CCG	p.P635P		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	635					cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		AGAACTTTTTGGGATACTTCG	0.433								Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					91	326	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28752200	28752200	+	Silent	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28752200C>A	uc002rmb.1	+	7	342	c.342C>A	c.(340-342)ATC>ATA	p.I114I	PLB1_uc010ezj.1_Silent_p.I114I	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	114	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					CAGACATCATCAGATATTTCA	0.463													13	84	---	---	---	---	PASS
TNFAIP6	7130	broad.mit.edu	37	2	152236144	152236144	+	3'UTR	SNP	T	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152236144T>G	uc002txk.2	+	6						NM_007115	NP_009046	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6						cell adhesion|cell-cell signaling|inflammatory response|signal transduction		hyaluronic acid binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		TATTTAttatttttctaaatg	0.119													6	6	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	202003145	202003145	+	Intron	SNP	T	C	C			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202003145T>C	uc002uxb.3	+						CFLAR_uc002uwy.2_3'UTR|CFLAR_uc002uwz.2_Intron|CFLAR_uc002uxa.3_Intron|CFLAR_uc010zhk.1_Intron|CFLAR_uc002uxc.3_Intron|CFLAR_uc010zhl.1_Intron|CFLAR_uc010fsw.1_Intron|CFLAR_uc002uxd.3_Intron|CFLAR_uc002uxe.2_Intron|CFLAR_uc002uxf.2_Intron|CFLAR_uc010fsy.2_Intron|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_Intron|CFLAR_uc010fsz.2_Intron|CFLAR_uc002uxg.2_5'Flank	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						ATCGCGATCATTGACGATAGG	0.547													8	45	---	---	---	---	PASS
CRYGA	1418	broad.mit.edu	37	2	209025590	209025590	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209025590G>A	uc002vcq.3	-	3	480	c.463C>T	c.(463-465)CAC>TAC	p.H155Y		NM_014617	NP_055432	P11844	CRGA_HUMAN	crystallin, gamma A	155	Beta/gamma crystallin 'Greek key' 4.				visual perception		structural constituent of eye lens				0				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		CCCCAGTCGTGGTACCTTCTG	0.557													8	186	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183794	10183794	+	Nonsense_Mutation	SNP	G	A	A	rs119103277		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183794G>A	uc003bvc.2	+	1	476	c.263G>A	c.(262-264)TGG>TAG	p.W88*	VHL_uc003bvd.2_Nonsense_Mutation_p.W88*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	88			W -> R (in VHLD; type I).|W -> S (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.W88R(5)|p.W88*(4)|p.V87_W88del(2)|p.W88C(2)|p.W88fs*71(2)|p.W88S(2)|p.W88L(1)|p.V87_W88>G(1)|p.R60fs*35(1)|p.V84_E94>E(1)|p.W88fs*43(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CTGCCCGTATGGCTCAACTTC	0.726		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				3	10	---	---	---	---	PASS
XPC	7508	broad.mit.edu	37	3	14188848	14188848	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14188848T>G	uc011ave.1	-	15	2650	c.2546A>C	c.(2545-2547)AAG>ACG	p.K849T	XPC_uc011avf.1_Missense_Mutation_p.K656T|XPC_uc011avg.1_Missense_Mutation_p.K812T	NM_004628	NP_004619	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	849	Interaction with CETN2.|Interaction with ERCC2 and GTF2H1.				nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal	cytoplasm|nucleoplasm|XPC complex	bubble DNA binding|damaged DNA binding|loop DNA binding|protein binding|single-stranded DNA binding			ovary(2)|breast(1)	3						GGCCAGCAACTTCCAGTTCCC	0.493			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				10	13	---	---	---	---	PASS
SCAP	22937	broad.mit.edu	37	3	47455554	47455554	+	Silent	SNP	T	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47455554T>A	uc003crh.1	-	23	3885	c.3630A>T	c.(3628-3630)TCA>TCT	p.S1210S	SCAP_uc011baz.1_Silent_p.S954S|SCAP_uc003crg.2_Silent_p.S817S|uc003cri.2_5'Flank	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	1210	Interaction with SREBF2 (By similarity).|Cytoplasmic (By similarity).|WD 7.				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GCAGGTTGTCTGAGATGACAC	0.542													20	42	---	---	---	---	PASS
NDUFAF3	25915	broad.mit.edu	37	3	49059885	49059885	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49059885A>G	uc003cvq.2	+	2	688	c.184A>G	c.(184-186)AGC>GGC	p.S62G	DALRD3_uc003cvm.1_5'Flank|DALRD3_uc010hko.1_5'Flank|uc011bcb.1_5'Flank|MIR425_hsa-mir-425|MI0001448_5'Flank|NDUFAF3_uc003cvn.2_Missense_Mutation_p.S5G|uc003cvo.1_5'Flank|MIR191_hsa-mir-191|MI0000465_5'Flank|NDUFAF3_uc003cvp.2_Missense_Mutation_p.S5G|NDUFAF3_uc003cvr.2_Missense_Mutation_p.S5G|NDUFAF3_uc003cvs.2_Missense_Mutation_p.S5G	NM_199069	NP_951032	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	62					mitochondrial respiratory chain complex I assembly	mitochondrial inner membrane|nucleus	protein binding				0						GTACATCGACAGCTACAACAG	0.652													7	7	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52702612	52702612	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52702612T>A	uc003des.2	-	3	298	c.286A>T	c.(286-288)AAA>TAA	p.K96*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.K96*|PBRM1_uc003der.2_Nonsense_Mutation_p.K96*|PBRM1_uc003det.2_Nonsense_Mutation_p.K96*|PBRM1_uc003deu.2_Nonsense_Mutation_p.K96*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.K96*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.K96*|PBRM1_uc003dey.2_Nonsense_Mutation_p.K96*|PBRM1_uc003dez.1_Nonsense_Mutation_p.K96*|PBRM1_uc003dfb.1_5'UTR	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	96	Bromo 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGTTGGATTTTCATCAAGTCA	0.308			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								25	45	---	---	---	---	PASS
NIT2	56954	broad.mit.edu	37	3	100059917	100059917	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100059917G>T	uc003dtv.2	+	4	322	c.248G>T	c.(247-249)GGC>GTC	p.G83V	NIT2_uc011bha.1_Missense_Mutation_p.G83V	NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	83	CN hydrolase.				nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						TCAATGAAAGGCTCTATCCCT	0.373													17	72	---	---	---	---	PASS
NIT2	56954	broad.mit.edu	37	3	100059918	100059918	+	Silent	SNP	C	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100059918C>T	uc003dtv.2	+	4	323	c.249C>T	c.(247-249)GGC>GGT	p.G83G	NIT2_uc011bha.1_Silent_p.G83G	NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	83	CN hydrolase.				nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						CAATGAAAGGCTCTATCCCTG	0.373													17	72	---	---	---	---	PASS
C3orf17	25871	broad.mit.edu	37	3	112732116	112732116	+	Intron	SNP	T	C	C			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112732116T>C	uc003dzr.2	-						GTPBP8_uc011bhy.1_Intron|C3orf17_uc011bhz.1_Intron|C3orf17_uc010hqh.2_Intron|C3orf17_uc003dzt.2_Intron|C3orf17_uc003dzs.2_Intron|C3orf17_uc010hqg.2_5'UTR|C3orf17_uc011bia.1_Intron|C3orf17_uc003dzu.2_Intron|C3orf17_uc011bib.1_Intron|C3orf17_uc011bic.1_Intron|C3orf17_uc011bid.1_Intron	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871							integral to membrane					0						TATTCAAGGATACAGAAAAGT	0.398													23	86	---	---	---	---	PASS
SKIV2L2	23517	broad.mit.edu	37	5	54618206	54618206	+	Silent	SNP	T	C	C			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54618206T>C	uc003jpy.3	+	2	452	c.186T>C	c.(184-186)AAT>AAC	p.N62N	SKIV2L2_uc011cqi.1_Intron	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2	62					maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				ATGGAAAAAATAAGAGAGATG	0.318													84	207	---	---	---	---	PASS
OR2H2	7932	broad.mit.edu	37	6	29556320	29556320	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29556320C>T	uc003nmr.1	+	1	638	c.599C>T	c.(598-600)GCC>GTC	p.A200V	GABBR1_uc003nmp.3_Intron	NM_007160	NP_009091	O95918	OR2H2_HUMAN	olfactory receptor, family 2, subfamily H,	200	Helical; Name=5; (Potential).				defense response|mating|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GTGGCTGTTGCCAGTGTCTTC	0.532													37	128	---	---	---	---	PASS
TCP11	6954	broad.mit.edu	37	6	35086135	35086135	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35086135G>T	uc003okd.2	-	10	1643	c.1462C>A	c.(1462-1464)CAG>AAG	p.Q488K	TCP11_uc003ojz.1_Missense_Mutation_p.Q413K|TCP11_uc003oka.2_Missense_Mutation_p.Q413K|TCP11_uc003okb.2_Missense_Mutation_p.Q412K|TCP11_uc003okc.2_Missense_Mutation_p.Q412K|TCP11_uc011dsu.1_Missense_Mutation_p.Q470K|TCP11_uc011dsv.1_Missense_Mutation_p.Q437K|TCP11_uc011dsw.1_Missense_Mutation_p.Q442K	NM_001093728	NP_001087197	Q8WWU5	TCP11_HUMAN	t-complex 11 isoform 1	475					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(3)|skin(2)	5						AACACCTGCTGATTGTGATGT	0.488													35	117	---	---	---	---	PASS
ARMC2	84071	broad.mit.edu	37	6	109294817	109294817	+	3'UTR	SNP	A	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109294817A>T	uc003pss.3	+	18					ARMC2_uc011eao.1_3'UTR	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2								binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		ACAAATGTGGAAAGTTTTTCA	0.308													17	45	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137322636	137322636	+	3'UTR	SNP	A	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137322636A>G	uc003qhj.2	-	7					IL20RA_uc011edl.1_3'UTR|IL20RA_uc003qhk.2_3'UTR|IL20RA_uc003qhi.2_3'UTR	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor							integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TATGGCTGGGATCAAAGGGGT	0.413													10	85	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101813771	101813771	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101813771C>A	uc003uyx.3	+	10	807	c.769C>A	c.(769-771)CTC>ATC	p.L257I	CUX1_uc003uys.3_Missense_Mutation_p.L268I|CUX1_uc003uyt.2_Missense_Mutation_p.L268I|CUX1_uc011kkn.1_Missense_Mutation_p.L231I|CUX1_uc003uyw.2_Missense_Mutation_p.L222I|CUX1_uc003uyv.2_Missense_Mutation_p.L252I|CUX1_uc003uyu.2_Missense_Mutation_p.L268I	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	257	Potential.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						AAGGGAACAGCTCTCATCGGC	0.577													5	8	---	---	---	---	PASS
UBE2H	7328	broad.mit.edu	37	7	129592346	129592346	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129592346T>A	uc003vpf.1	-	1	444	c.50A>T	c.(49-51)AAG>ATG	p.K17M	UBE2H_uc003vpg.1_Missense_Mutation_p.K17M	NM_003344	NP_003335	P62256	UBE2H_HUMAN	ubiquitin-conjugating enzyme E2H isoform 1	17					protein K11-linked ubiquitination|protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin-protein ligase activity			skin(1)	1	Melanoma(18;0.0435)					AGGATACAGCTTGACCACGTC	0.687													24	129	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38173525	38173525	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38173525T>C	uc003xli.2	-	10	2409	c.1891A>G	c.(1891-1893)AAG>GAG	p.K631E	WHSC1L1_uc011lbm.1_Missense_Mutation_p.K631E|WHSC1L1_uc010lwe.2_Missense_Mutation_p.K631E	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	631					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CTCCTTTTCTTTAGAGGTTTA	0.383			T	NUP98	AML								30	123	---	---	---	---	PASS
SPAG8	26206	broad.mit.edu	37	9	35810979	35810979	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35810979G>A	uc003zye.2	-	3	1055	c.940C>T	c.(940-942)CGG>TGG	p.R314W	SPAG8_uc003zyf.2_Missense_Mutation_p.R231W|SPAG8_uc003zyg.2_Missense_Mutation_p.R314W	NM_172312	NP_758516	Q99932	SPAG8_HUMAN	sperm associated antigen 8 isoform 2	314						acrosomal vesicle|membrane				ovary(1)	1	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			AGCAGTCCCCGGTGTCCGTGT	0.537													41	149	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90497800	90497800	+	5'UTR	SNP	G	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90497800G>T	uc004app.3	+	1					C9orf79_uc004apo.1_5'UTR	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79							integral to membrane				ovary(3)	3						TCAGTTGCTTGAAGGCGATGG	0.617													9	50	---	---	---	---	PASS
SYT15	83849	broad.mit.edu	37	10	46968685	46968685	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46968685T>G	uc001jea.2	-	3	404	c.251A>C	c.(250-252)CAA>CCA	p.Q84P	SYT15_uc001jdz.2_Missense_Mutation_p.Q84P|SYT15_uc001jeb.2_5'UTR|SYT15_uc010qfp.1_5'Flank	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a	84	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0						ATCTCGGCCTTGAAGGGTTGG	0.642													10	116	---	---	---	---	PASS
SUPV3L1	6832	broad.mit.edu	37	10	70967647	70967647	+	Silent	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70967647C>A	uc001jpe.1	+	14	1930	c.1875C>A	c.(1873-1875)CTC>CTA	p.L625L	SUPV3L1_uc010qjd.1_Silent_p.L494L	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor	625					DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						TTAAAGACCTCATGGATCTTG	0.418													66	205	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100481428	100481428	+	Silent	SNP	G	A	A	rs142810016		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100481428G>A	uc001kpn.1	-	5	1002	c.942C>T	c.(940-942)ATC>ATT	p.I314I	HPSE2_uc009xwc.1_Silent_p.I304I|HPSE2_uc001kpo.1_Silent_p.I246I|HPSE2_uc009xwd.1_Silent_p.I192I	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	314					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CTAGGAGGGCGATGACATTCT	0.398													25	72	---	---	---	---	PASS
HINFP	25988	broad.mit.edu	37	11	119004822	119004822	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119004822C>T	uc001pvp.2	+	11	1357	c.1168C>T	c.(1168-1170)CGG>TGG	p.R390W	HINFP_uc001pvq.2_Missense_Mutation_p.R390W|HINFP_uc001pvr.2_Missense_Mutation_p.R143W	NM_015517	NP_056332	Q9BQA5	HINFP_HUMAN	MBD2 (methyl-CpG-binding protein)-interacting	390	Interaction with NPAT.|Required for activation of histone H4 transcription and contributes to DNA- binding.				DNA damage checkpoint|DNA repair|establishment of protein localization|in utero embryonic development|myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	enzyme binding|histone binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						TGGCTATATGCGGCTGCAGCT	0.567											OREG0021397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	70	---	---	---	---	PASS
ACIN1	22985	broad.mit.edu	37	14	23549183	23549183	+	Missense_Mutation	SNP	T	A	A	rs112438189		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23549183T>A	uc001wit.3	-	6	1863	c.1535A>T	c.(1534-1536)TAC>TTC	p.Y512F	ACIN1_uc001wis.3_Missense_Mutation_p.Y194F|ACIN1_uc010akg.2_Missense_Mutation_p.Y512F|ACIN1_uc010tnj.1_Missense_Mutation_p.Y472F	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	512					apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CTGGGCTGAGTAGTCAGCCAG	0.493													47	196	---	---	---	---	PASS
GLDN	342035	broad.mit.edu	37	15	51696755	51696755	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51696755C>A	uc002aba.2	+	10	1629	c.1460C>A	c.(1459-1461)ACC>AAC	p.T487N	GLDN_uc002abb.2_Missense_Mutation_p.T363N	NM_181789	NP_861454	Q6ZMI3	GLDN_HUMAN	gliomedin	487	Extracellular (Potential).|Olfactomedin-like.				cell differentiation|nervous system development	collagen|integral to membrane|plasma membrane				ovary(2)	2				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		GTCACAGACACCAAAGATATG	0.448													48	208	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102292829	102292829	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102292829C>G	uc010usj.1	+	4	476	c.417C>G	c.(415-417)CAC>CAG	p.H139Q	uc002bxo.2_5'Flank|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		CGAGAAGACACTCGTGGAGGC	0.597													2	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	15457701	15457701	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15457701G>A	uc010bvf.1	-	9	812	c.812C>T	c.(811-813)GCT>GTT	p.A271V						RecName: Full=NPIP-like protein 1;																		AGGGGAGTGAGCAGACACTCG	0.562													5	124	---	---	---	---	PASS
NDE1	54820	broad.mit.edu	37	16	15761201	15761201	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15761201G>A	uc002ddt.1	+	2	185	c.142G>A	c.(142-144)GCT>ACT	p.A48T	NDE1_uc010uzy.1_Missense_Mutation_p.A48T|NDE1_uc002dds.2_Missense_Mutation_p.A48T	NM_017668	NP_060138	Q9NXR1	NDE1_HUMAN	nuclear distribution gene E homolog 1	48	Self-association (By similarity).|Potential.				cell differentiation|cell division|centrosome duplication|establishment of chromosome localization|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|mitotic prometaphase|nervous system development	cleavage furrow|condensed chromosome kinetochore|cytosol|microtubule|spindle pole centrosome	microtubule binding			ovary(1)	1						AGAATATGAAGCTGAATTGGA	0.443													29	72	---	---	---	---	PASS
NDE1	54820	broad.mit.edu	37	16	15761202	15761202	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15761202C>G	uc002ddt.1	+	2	186	c.143C>G	c.(142-144)GCT>GGT	p.A48G	NDE1_uc010uzy.1_Missense_Mutation_p.A48G|NDE1_uc002dds.2_Missense_Mutation_p.A48G	NM_017668	NP_060138	Q9NXR1	NDE1_HUMAN	nuclear distribution gene E homolog 1	48	Self-association (By similarity).|Potential.				cell differentiation|cell division|centrosome duplication|establishment of chromosome localization|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|mitotic prometaphase|nervous system development	cleavage furrow|condensed chromosome kinetochore|cytosol|microtubule|spindle pole centrosome	microtubule binding			ovary(1)	1						GAATATGAAGCTGAATTGGAG	0.448													28	72	---	---	---	---	PASS
ENO3	2027	broad.mit.edu	37	17	4859135	4859135	+	Intron	SNP	C	T	T	rs1983153		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4859135C>T	uc002gab.3	+						ENO3_uc010vsr.1_3'UTR|ENO3_uc002gac.3_Intron|ENO3_uc010vss.1_Intron|ENO3_uc010vst.1_Intron	NM_053013	NP_443739	P13929	ENOB_HUMAN	enolase 3						gluconeogenesis|glycolysis	phosphopyruvate hydratase complex	magnesium ion binding|phosphopyruvate hydratase activity			ovary(1)	1						tgtctctgccctgtctctgcc	0.179													5	32	---	---	---	---	PASS
SCRN2	90507	broad.mit.edu	37	17	45916363	45916363	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45916363C>T	uc002imd.2	-	5	692	c.566G>A	c.(565-567)CGC>CAC	p.R189H	SCRN2_uc002imc.2_Missense_Mutation_p.R197H|SCRN2_uc002imf.2_Missense_Mutation_p.R189H|SCRN2_uc002ime.2_RNA	NM_138355	NP_612364	Q96FV2	SCRN2_HUMAN	secernin 2 isoform 1	189					proteolysis		dipeptidase activity			ovary(1)	1						GGAGATGTTGCGGGCCCCCTC	0.438													5	113	---	---	---	---	PASS
LUC7L3	51747	broad.mit.edu	37	17	48818534	48818534	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48818534T>G	uc002isr.2	+	4	395	c.278T>G	c.(277-279)CTT>CGT	p.L93R	LUC7L3_uc002isp.1_Missense_Mutation_p.L17R|LUC7L3_uc010wmw.1_Missense_Mutation_p.L17R|LUC7L3_uc002isq.2_Missense_Mutation_p.L93R|LUC7L3_uc002iss.2_Missense_Mutation_p.L93R	NM_006107	NP_006098	O95232	LC7L3_HUMAN	LUC7-like 3	93					apoptosis|mRNA processing|response to stress|RNA splicing	focal adhesion|nuclear speck	DNA binding|mRNA binding|protein binding				0						CAGAGCTTACTTGCAGAAGTA	0.408													46	208	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42531862	42531862	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42531862C>A	uc010dni.2	+	4	2853	c.2557C>A	c.(2557-2559)CTG>ATG	p.L853M		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	853						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GGAAATCACGCTGTCCCCTGT	0.562									Schinzel-Giedion_syndrome				17	50	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55020256	55020256	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55020256G>T	uc002lgn.2	+	1	536	c.179G>T	c.(178-180)CGG>CTG	p.R60L		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	60	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GCGGGATTCCGGTGAGTGCGG	0.597													11	64	---	---	---	---	PASS
AZU1	566	broad.mit.edu	37	19	830861	830861	+	Missense_Mutation	SNP	G	A	A	rs145363133		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:830861G>A	uc002lpz.1	+	4	530	c.514G>A	c.(514-516)GTG>ATG	p.V172M		NM_001700	NP_001691	P20160	CAP7_HUMAN	azurocidin 1 preproprotein	172	Peptidase S1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cellular extravasation|defense response to Gram-negative bacterium|glial cell migration|induction of positive chemotaxis|inflammatory response|macrophage chemotaxis|microglial cell activation|monocyte activation|positive regulation of cell adhesion|positive regulation of fractalkine biosynthetic process|positive regulation of interleukin-1 beta biosynthetic process|positive regulation of MHC class II biosynthetic process|positive regulation of phagocytosis|positive regulation of tumor necrosis factor biosynthetic process|proteolysis|regulation of vascular permeability	azurophil granule|extracellular region	heparin binding|serine-type endopeptidase activity|toxin binding			pancreas(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTTGTCAACGTGACTGTGAC	0.672													18	44	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44352476	44352476	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44352476G>T	uc002oxr.3	+	7	1991	c.1723G>T	c.(1723-1725)GAA>TAA	p.E575*	ZNF283_uc002oxp.3_Nonsense_Mutation_p.E436*	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	575	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				CAAATGTAAGGAATGTGGGAA	0.418													20	68	---	---	---	---	PASS
FTL	2512	broad.mit.edu	37	19	49468842	49468842	+	Silent	SNP	G	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49468842G>A	uc002plo.2	+	1	277	c.78G>A	c.(76-78)CAG>CAA	p.Q26Q	FTL_uc002pln.1_Silent_p.Q26Q	NM_000146	NP_000137	P02792	FRIL_HUMAN	ferritin, light polypeptide	26	Ferritin-like diiron.				cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	TGTACCTGCAGGCCTCCTACA	0.592													14	59	---	---	---	---	PASS
SIGLEC7	27036	broad.mit.edu	37	19	51645712	51645712	+	Missense_Mutation	SNP	C	A	A	rs140841032		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51645712C>A	uc002pvv.1	+	1	155	c.86C>A	c.(85-87)ACG>AAG	p.T29K	SIGLEC7_uc002pvw.1_Missense_Mutation_p.T29K|SIGLEC7_uc010eoq.1_RNA|SIGLEC7_uc010eor.1_Missense_Mutation_p.T29K	NM_014385	NP_055200	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7 isoform 1	29	Extracellular (Potential).				cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		TACTCGCTGACGATGCAGAGT	0.493													4	47	---	---	---	---	PASS
PSMF1	9491	broad.mit.edu	37	20	1144992	1144992	+	Silent	SNP	C	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1144992C>T	uc002wel.3	+	7	804	c.636C>T	c.(634-636)CCC>CCT	p.P212P	PSMF1_uc010zpo.1_Silent_p.P124P|PSMF1_uc002wem.3_Silent_p.P212P|PSMF1_uc010zpp.1_Silent_p.P150P|PSMF1_uc002wen.3_Silent_p.P212P|PSMF1_uc002wep.3_Silent_p.P163P	NM_178578	NP_848693	Q92530	PSMF1_HUMAN	proteasome inhibitor subunit 1	212	Pro-rich.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome core complex	endopeptidase inhibitor activity|protein binding				0						TTGTGGATCCCCTGAGATCTG	0.582													85	344	---	---	---	---	PASS
BPI	671	broad.mit.edu	37	20	36946865	36946865	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36946865C>A	uc002xib.2	+	6	725	c.663C>A	c.(661-663)TTC>TTA	p.F221L		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	221					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				AACCTTATTTCCAGACTCTGC	0.478													50	180	---	---	---	---	PASS
KRTAP10-3	386682	broad.mit.edu	37	21	45978577	45978577	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45978577C>A	uc002zfj.1	-	1	67	c.22G>T	c.(22-24)GTC>TTC	p.V8F	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	8						keratin filament				skin(1)	1						CTGGAGCAGACGGACATGGTA	0.542													8	44	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22664141	22664141	+	RNA	SNP	G	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22664141G>A	uc011aim.1	+	30		c.1998G>A			LOC96610_uc011aiq.1_RNA					Parts of antibodies, mostly variable regions.												0						AAATTTGAAGGTGCTGTGATT	0.448													6	146	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	26282101	26282102	+	IGR	INS	-	AAGG	AAGG	rs10653543		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26282101_26282102insAAGG								STMN1 (48733 upstream) : PAFAH2 (4158 downstream)																							aggaaggaagaaaggaaggaag	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38733363	38733364	+	IGR	INS	-	CCTTCCTCCTT	CCTTCCTCCTT	rs142813208	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38733363_38733364insCCTTCCTCCTT								POU3F1 (220913 upstream) : RRAGC (571651 downstream)																							tttcctccctcctctctcttcc	0.000													4	2	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487408	67487409	+	Intron	DEL	AC	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487408_67487409delAC	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	acagacacagacacacacacac	0.252													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	112689763	112689766	+	IGR	DEL	TTCT	-	-	rs11800744	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112689763_112689766delTTCT								KCND3 (157986 upstream) : CTTNBP2NL (249034 downstream)																							ccttccttccttctttccttcctt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116891725	116891725	+	IGR	DEL	A	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116891725delA								C1orf161 (213864 upstream) : ATP1A1 (23279 downstream)																							taaggagcttaaaaaaaaaaa	0.000													6	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145352461	145352462	+	Intron	INS	-	GC	GC			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145352461_145352462insGC	uc001end.3	+						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oyq.1_Intron|NBPF10_uc010oyr.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyp.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		tgtgtgtgtgtgtgtgtgtgtg	0.243													3	4	---	---	---	---	
LYSMD1	388695	broad.mit.edu	37	1	151133973	151133973	+	Intron	DEL	A	-	-	rs33999172		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151133973delA	uc001ewy.2	-						LYSMD1_uc010pcr.1_Intron	NM_212551	NP_997716	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain						cell wall macromolecule catabolic process						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			accccgtctcaaaaaaaaaaa	0.209													6	3	---	---	---	---	
TOR3A	64222	broad.mit.edu	37	1	179064560	179064561	+	3'UTR	INS	-	AGAT	AGAT	rs145389283	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179064560_179064561insAGAT	uc001gmd.2	+	6					TOR3A_uc010pnd.1_3'UTR	NM_022371	NP_071766	Q9H497	TOR3A_HUMAN	torsin family 3, member A precursor						chaperone mediated protein folding requiring cofactor	endoplasmic reticulum	ATP binding			pancreas(1)	1						aggtcccaccgagatagatagg	0.327													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189961345	189961346	+	IGR	DEL	GG	-	-	rs112920414		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189961345_189961346delGG								None (None upstream) : FAM5C (105451 downstream)																							ttttttttttggtttttttttt	0.292													4	3	---	---	---	---	
ZNF124	7678	broad.mit.edu	37	1	247323280	247323281	+	Intron	DEL	TC	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247323280_247323281delTC	uc001ick.2	-						ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_Intron	NM_003431	NP_003422	Q15973	ZN124_HUMAN	zinc finger protein 124						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			ACATAGCAGttctttttttttt	0.183													3	5	---	---	---	---	
HADHA	3030	broad.mit.edu	37	2	26454836	26454837	+	Intron	INS	-	A	A	rs71399374		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26454836_26454837insA	uc002rgy.2	-						HADHA_uc010yks.1_Intron|HADHA_uc010ykt.1_Intron	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha						fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)	gattttgtctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
PTCD3	55037	broad.mit.edu	37	2	86335250	86335250	+	Intron	DEL	A	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86335250delA	uc002sqw.2	+						POLR1A_uc002sqs.2_5'Flank|POLR1A_uc002sqv.2_5'Flank|PTCD3_uc010ytc.1_Intron	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor							mitochondrion	protein binding			ovary(1)	1						ccctgtctctaaaaaaaaaaa	0.154													5	3	---	---	---	---	
PDK1	5163	broad.mit.edu	37	2	173431422	173431423	+	Intron	DEL	AA	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173431422_173431423delAA	uc002uhr.2	+						PDK1_uc010zdz.1_Intron|PDK1_uc010zea.1_Intron|PDK1_uc002uhq.1_Intron|PDK1_uc002uhs.2_Intron|PDK1_uc010zeb.1_Intron	NM_002610	NP_002601	Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)			tgtctctaccaaaaaaaaaaaa	0.139									Autosomal_Dominant_Polycystic_Kidney_Disease				4	2	---	---	---	---	
RQCD1	9125	broad.mit.edu	37	2	219447953	219447978	+	Intron	DEL	TGTGTCTCTCTCTCTCTCTCTCTCTC	-	-	rs36210927	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447953_219447978delTGTGTCTCTCTCTCTCTCTCTCTCTC	uc010zkh.1	+						RQCD1_uc002vih.1_Intron|RQCD1_uc010zki.1_Intron	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		tgtgtgtgtgtgtgtctctctctctctctctctctctctctctctc	0.226													4	2	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235810787	235810788	+	IGR	INS	-	GAAA	GAAA	rs79698014	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235810787_235810788insGAAA								ARL4C (405094 upstream) : SH3BP4 (49840 downstream)																							aaggaaggaaggaaagaaaTTC	0.238													3	3	---	---	---	---	
HDLBP	3069	broad.mit.edu	37	2	242176393	242176396	+	Intron	DEL	GGGG	-	-	rs72214250	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242176393_242176396delGGGG	uc002waz.2	-						HDLBP_uc002wba.2_Intron|HDLBP_uc002wbb.2_Intron	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CCCAGACCTTgggggggggggggg	0.201													4	2	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10088533	10088536	+	Intron	DEL	AATC	-	-	rs148201951		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10088533_10088536delAATC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		tttttgcattaatcattttaattg	0.005			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				9	4	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGTGTGGAGTTTTATAACTC	0.589													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72326993	72327000	+	IGR	DEL	TTTCTGTC	-	-	rs139598514		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72326993_72327000delTTTCTGTC								PROK2 (492636 upstream) : RYBP (96751 downstream)																							tttctttctttttctgtctttctttctt	0.111													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26217023	26217023	+	IGR	DEL	G	-	-	rs112269466		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26217023delG								C4orf52 (285523 upstream) : RBPJ (104309 downstream)																							gaggaaggaaggggggggaag	0.134													4	2	---	---	---	---	
ADAMTS3	9508	broad.mit.edu	37	4	73280847	73280850	+	Intron	DEL	TAAT	-	-	rs146478222		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73280847_73280850delTAAT	uc003hgk.1	-							NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TAACTATCAATAATTAATTCATAT	0.260													7	4	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79371639	79371640	+	Intron	INS	-	T	T	rs138438777	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79371639_79371640insT	uc003hlb.2	+							NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ttgttttcttattttttttttc	0.277													8	4	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243419	120243420	+	5'Flank	INS	-	TT	TT	rs151066719	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243419_120243420insTT	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						AATTCTTATTAATTAATTCTTA	0.287													4	2	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21344713	21344713	+	Intron	DEL	T	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21344713delT	uc011cnn.1	+											Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						ccttccttcctttccttcctt	0.000													5	3	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37349361	37349361	+	Intron	DEL	A	-	-	rs74712044		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37349361delA	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAAGTAAGACAAAAAAAAAAA	0.279													6	3	---	---	---	---	
C5orf35	133383	broad.mit.edu	37	5	56209591	56209591	+	Intron	DEL	T	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56209591delT	uc003jqx.2	+						C5orf35_uc003jqy.2_Intron	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383											ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		TACTAAAGTCTTTTTTTTTTT	0.259													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77965309	77965310	+	IGR	DEL	GA	-	-	rs57667593		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77965309_77965310delGA								LHFPL2 (20661 upstream) : ARSB (107729 downstream)																							ggaagggggggagagagagaga	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152808113	152808120	+	IGR	DEL	GAAAGAAA	-	-	rs4958648	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152808113_152808120delGAAAGAAA								None (None upstream) : GRIA1 (61055 downstream)																							aggaaggaaggaaagaaagaaagaaaga	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	834433	834435	+	IGR	DEL	CTT	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:834433_834435delCTT								EXOC2 (141324 upstream) : LOC285768 (126807 downstream)																							tccttccttccttcttcccacct	0.182													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9661051	9661051	+	IGR	DEL	A	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9661051delA								None (None upstream) : TFAP2A (735866 downstream)																							GTGTTACAGCAAAAAAAAAAA	0.299													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	41275845	41275845	+	IGR	DEL	T	-	-	rs71702533		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41275845delT								TREM1 (21388 upstream) : NCR2 (27683 downstream)																							GATGTGGTTCTTTTTTTTTTT	0.423													6	3	---	---	---	---	
NCOA7	135112	broad.mit.edu	37	6	126203376	126203377	+	Intron	INS	-	A	A	rs142264838	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126203376_126203377insA	uc010kes.2	+						NCOA7_uc003qae.3_Intron|NCOA7_uc003qah.2_Intron|NCOA7_uc003qai.2_Intron|NCOA7_uc010ket.2_Intron|NCOA7_uc003qaf.2_Intron|NCOA7_uc003qag.2_Intron	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1						cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		TTTTTTAAAAGAAAAAAAAAAC	0.238													4	2	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38543103	38543103	+	Intron	DEL	T	-	-	rs10225047		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38543103delT	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						GGCGGGGGGGTGGGTGGTGGA	0.423													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142448200	142448207	+	Intron	DEL	GGTGGAAA	-	-	rs112413030	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142448200_142448207delGGTGGAAA	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc011ksl.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		GTTAACACTGGGTGGAAAGGTGGAAAGA	0.457													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40265902	40265903	+	IGR	INS	-	TTTTCTTTCCTG	TTTTCTTTCCTG	rs58628296		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40265902_40265903insTTTTCTTTCCTG								C8orf4 (253081 upstream) : ZMAT4 (122213 downstream)																							ctttctttcttccttcctttct	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	62726248	62726251	+	IGR	DEL	TCTT	-	-	rs67610362	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62726248_62726251delTCTT								ASPH (99049 upstream) : NKAIN3 (435250 downstream)																							tctttctttctcttccttccttcc	0.000													2	4	---	---	---	---	
CSPP1	79848	broad.mit.edu	37	8	68066152	68066152	+	Intron	DEL	T	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68066152delT	uc003xxi.2	+						CSPP1_uc003xxg.1_Intron|CSPP1_uc003xxh.1_Intron|CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ATCTTTGGACttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81651252	81651253	+	IGR	INS	-	T	T			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81651252_81651253insT								PSAT1 (706245 upstream) : TLE4 (535625 downstream)																							atacaCTAGACTTTTTTTTTTT	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	118885560	118885561	+	IGR	INS	-	TTCC	TTCC			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118885560_118885561insTTCC								C9orf27 (198183 upstream) : PAPPA (30510 downstream)																							TTCTTTATCATttccttccttc	0.257													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24722235	24722241	+	Intron	DEL	TTTTTTG	-	-	rs10582246		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24722235_24722241delTTTTTTG	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						TTTAGAGTGtttttttgttttttgttt	0.246													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115745808	115745808	+	IGR	DEL	G	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115745808delG								NHLRC2 (77356 upstream) : ADRB1 (57998 downstream)																							aaggaaggaaggaaggaagga	0.109													5	3	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133961636	133961637	+	Intron	INS	-	TGAACA	TGAACA	rs141683861	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133961636_133961637insTGAACA	uc001lkx.3	+						JAKMIP3_uc009yba.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACACAAAGCCCtgaacatgaac	0.495													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110073418	110073420	+	IGR	DEL	CTG	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110073418_110073420delCTG								MVK (38348 upstream) : C12orf34 (78770 downstream)																							accatcatcactgccaccaccat	0.000													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965106	117965107	+	Intron	DEL	AG	-	-	rs68177299		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965106_117965107delAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					acacacacacagacacacacac	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145754	119145756	+	IGR	DEL	TGG	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145754_119145756delTGG								SUDS3 (289915 upstream) : SRRM4 (273640 downstream)																							gtgatggtgatggtggtggtggt	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	125396165	125396166	+	IGR	INS	-	AAAAAAAAA	AAAAAAAAA	rs68000265		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125396165_125396166insAAAAAAAAA								SCARB1 (47646 upstream) : UBC (28 downstream)																							AAAATAAACTTaaaaaaaaaaa	0.361													10	6	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	129821987	129821988	+	Intron	DEL	CA	-	-	rs34583805		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129821987_129821988delCA	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		Tacacacacgcacacacacaca	0.272													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850262	112850267	+	IGR	DEL	CCTCTC	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850262_112850267delCCTCTC								SOX1 (124242 upstream) : C13orf28 (180402 downstream)																							atttcttcctcctctctcctcccttc	0.000													4	2	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89647259	89647260	+	Intron	INS	-	GCAGAGAACATGCATGGA	GCAGAGAACATGCATGGA	rs140257053	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89647259_89647260insGCAGAGAACATGCATGGA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						agagacagagggcagagacaga	0.173													8	4	---	---	---	---	
MTA1	9112	broad.mit.edu	37	14	105905492	105905493	+	Intron	INS	-	T	T	rs140601392	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105905492_105905493insT	uc001yqx.2	+						MTA1_uc001yqy.2_Intron|MTA1_uc001yqz.1_Intron|MTA1_uc001yra.1_Intron	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein						signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		GAGCTCTGCCCCCACCCCTGAG	0.644													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22448173	22448174	+	IGR	INS	-	A	A	rs35721005		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22448173_22448174insA								OR4N3P (33788 upstream) : MIR1268 (65055 downstream)																							acaaacaaaccaaaaaaaaaaa	0.094													4	2	---	---	---	---	
SCAMP2	10066	broad.mit.edu	37	15	75158292	75158319	+	Intron	DEL	GAAGGAAGGAAGGAAGGAAGGAAGGAAG	-	-	rs67717107		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75158292_75158319delGAAGGAAGGAAGGAAGGAAGGAAGGAAG	uc002azb.1	-						SCAMP2_uc010bkg.1_Intron	NM_005697	NP_005688	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|nucleus|recycling endosome membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						actctgtctcgaaggaaggaaggaaggaaggaaggaaggaaggaagga	0.009													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25303281	25303304	+	IGR	DEL	CTTCCTTCCTTCCTTCCTTCCTTT	-	-	rs71158909		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25303281_25303304delCTTCCTTCCTTCCTTCCTTCCTTT								ZKSCAN2 (34426 upstream) : HS3ST4 (400043 downstream)																							tccttccttccttccttccttccttccttcctttcttttcttct	0.009													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55482644	55482645	+	IGR	INS	-	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55482644_55482645insA								IRX6 (117973 upstream) : MMP2 (30436 downstream)																							aggaaggaaggagggagggagg	0.050													4	2	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58572304	58572305	+	Intron	INS	-	C	C	rs146715386	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58572304_58572305insC	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc010vik.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AAATTTAAAAACAGCCAGTAAT	0.347													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	45865365	45865365	+	IGR	DEL	G	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45865365delG								TBX21 (41880 upstream) : OSBPL7 (19368 downstream)																							aaggaaggaaggaaggaagga	0.005													4	3	---	---	---	---	
INTS2	57508	broad.mit.edu	37	17	59946936	59946936	+	Intron	DEL	A	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59946936delA	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						TCATTAGGTTAAAAAAAAAAA	0.328													10	5	---	---	---	---	
TWSG1	57045	broad.mit.edu	37	18	9396146	9396147	+	Intron	DEL	AA	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9396146_9396147delAA	uc002knz.2	+						TWSG1_uc002koa.2_Intron	NM_020648	NP_065699	Q9GZX9	TWSG1_HUMAN	twisted gastrulation precursor											ovary(1)|pancreas(1)	2						CTCACCCAGCaaaaaaaaaaaa	0.193													4	2	---	---	---	---	
ABHD3	171586	broad.mit.edu	37	18	19284677	19284678	+	5'UTR	INS	-	GAGCGGGCGA	GAGCGGGCGA	rs150746310	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19284677_19284678insGAGCGGGCGA	uc002ktl.2	-	1					ABHD3_uc002ktm.2_5'UTR|ABHD3_uc010xao.1_RNA|MIB1_uc002ktp.2_5'Flank|ABHD3_uc002kto.2_5'UTR	NM_138340	NP_612213	Q8WU67	ABHD3_HUMAN	alpha/beta hydrolase domain containing protein							integral to membrane	carboxylesterase activity			central_nervous_system(1)	1						AGCCGGCTGGCgagcgggcgag	0.658													4	2	---	---	---	---	
ZNF521	25925	broad.mit.edu	37	18	22642387	22642387	+	3'UTR	DEL	T	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22642387delT	uc002kvk.2	-	8					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_3'UTR|ZNF521_uc002kvl.2_3'UTR	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGTCATAGTCTTTTTTTTTTT	0.308			T	PAX5	ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57429218	57429218	+	IGR	DEL	G	-	-	rs66686103		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57429218delG								CCBE1 (64574 upstream) : PMAIP1 (137974 downstream)																							AAAAAAAAAAGAGGAAGACAG	0.239													5	5	---	---	---	---	
TLE6	79816	broad.mit.edu	37	19	2995055	2995055	+	3'UTR	DEL	C	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2995055delC	uc002lwu.2	+	16					TLE6_uc002lwt.2_3'UTR|TLE6_uc010dtg.2_3'UTR|TLE6_uc002lwv.2_3'UTR	NM_024760	NP_079036	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6 isoform 2						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCCCCCTTCCCCCCCCCCA	0.627													4	2	---	---	---	---	
ZSWIM4	65249	broad.mit.edu	37	19	13915461	13915461	+	Intron	DEL	A	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13915461delA	uc002mxh.1	+						ZSWIM4_uc010xng.1_5'Flank	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4								zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			attttgtttcaaaaaaaaaaa	0.234													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47075898	47075899	+	Intron	INS	-	GA	GA	rs8109843		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47075898_47075899insGA	uc002pev.1	-											SubName: Full=cDNA FLJ37185 fis, clone BRALZ2001743, moderately similar to Serine/threonine-protein phosphatase 5;          EC=3.1.3.16;																		gagagagagagaggaaggaagg	0.000													4	2	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1332941	1332942	+	Intron	INS	-	T	T	rs35712372		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332941_1332942insT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	tccttccttccttccttccttc	0.005													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29647428	29647429	+	Intron	INS	-	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29647428_29647429insA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						tatccagtGGCAAAAAAATGAG	0.045													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41306344	41306344	+	Intron	DEL	C	-	-	rs2425514	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41306344delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AACAAACAAACAAAAAAAACC	0.408													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11042402	11042406	+	Intron	DEL	AAAAC	-	-	rs112117444		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11042402_11042406delAAAAC	uc002yit.1	-						TPTE_uc002yis.1_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aaaaaaaaaaaaaacacctcataat	0.000													7	4	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43226389	43226390	+	Intron	INS	-	AT	AT			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43226389_43226390insAT	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ccatcaccaccatcactaccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23943333	23943334	+	IGR	INS	-	CA	CA	rs35047901		TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23943333_23943334insCA								IGLL1 (20838 upstream) : C22orf43 (7306 downstream)																							acgcacgcgcgcacacacacac	0.000													4	2	---	---	---	---	
TRIOBP	11078	broad.mit.edu	37	22	38161835	38161836	+	Intron	INS	-	G	G	rs138412450	by1000genomes	TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38161835_38161836insG	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atw.2_Intron|TRIOBP_uc003atx.1_Intron|TRIOBP_uc010gxh.2_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GTATGGACCCTGGGGGGGGCAC	0.629													6	6	---	---	---	---	
PPARA	5465	broad.mit.edu	37	22	46570088	46570089	+	Intron	DEL	AG	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46570088_46570089delAG	uc003bgw.1	+						PPARA_uc003bgx.1_Intron|PPARA_uc010hab.1_Intron|PPARA_uc003bgy.1_Intron|PPARA_uc003bgz.1_Intron|PPARA_uc003bha.2_5'Flank|PPARA_uc003bhb.1_5'Flank	NM_005036	NP_005027	Q07869	PPARA_HUMAN	peroxisome proliferative activated receptor,						fatty acid metabolic process|fatty acid transport|negative regulation of appetite|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fatty acid beta-oxidation|regulation of cellular ketone metabolic process by positive regulation of transcription from an RNA polymerase II promoter|regulation of glycolysis by positive regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|ligand-regulated transcription factor activity|lipid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|ubiquitin conjugating enzyme binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Simvastatin(DB00641)	gaaggaagaaagagagagagag	0.000													4	2	---	---	---	---	
REPS2	9185	broad.mit.edu	37	X	17086437	17086437	+	Intron	DEL	A	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17086437delA	uc004cxv.1	+						REPS2_uc004cxw.1_Intron|REPS2_uc011miw.1_Intron	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2						epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					actctgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
COL4A6	1288	broad.mit.edu	37	X	107415595	107415596	+	Intron	INS	-	A	A			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107415595_107415596insA	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						gcctaaaaaagaaaaaaaaaaa	0.144									Alport_syndrome_with_Diffuse_Leiomyomatosis				8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	138549493	138549494	+	IGR	DEL	TG	-	-			TCGA-BP-4982-01A-01D-1462-08	TCGA-BP-4982-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138549493_138549494delTG								FGF13 (262308 upstream) : F9 (63401 downstream)																							tagttactgttgtgtgtgtgtg	0.000													4	5	---	---	---	---	
