Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PTPN14	5784	broad.mit.edu	37	1	214656740	214656740	+	Intron	SNP	A	G	G	rs78564084		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214656740A>G	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|uc010ptz.1_RNA	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TGGCTGTGCCAGGCCGACCGG	0.607													6	25	---	---	---	---	PASS
GPN1	11321	broad.mit.edu	37	2	27851883	27851883	+	5'UTR	SNP	C	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27851883C>A	uc010ymc.1	+	1					ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_5'Flank|CCDC121_uc002rld.2_5'Flank|CCDC121_uc002rle.2_5'Flank|GPN1_uc010ezf.2_Intron|GPN1_uc010yma.1_Intron|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_5'UTR|GPN1_uc010yme.1_5'UTR|GPN1_uc010ezg.1_5'Flank	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a							cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						TTTCTCTACCCATGCGGTGTC	0.647													17	49	---	---	---	---	PASS
FABP1	2168	broad.mit.edu	37	2	88425757	88425757	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88425757G>C	uc002sst.1	-	2	220	c.178C>G	c.(178-180)CAA>GAA	p.Q60E	FABP1_uc002ssu.2_Missense_Mutation_p.Q60E	NM_001443	NP_001434	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	60					organ morphogenesis						0						AATTCGTTTTGGATCACTTTG	0.517													116	363	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179185056	179185056	+	Intron	SNP	A	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179185056A>G	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_5'UTR	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			GCTACAGTGAAATATGTGTTC	0.418													35	98	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183788	10183788	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183788C>T	uc003bvc.2	+	1	470	c.257C>T	c.(256-258)CCC>CTC	p.P86L	VHL_uc003bvd.2_Missense_Mutation_p.P86L	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	86			P -> R (in VHLD; type I).|P -> S (in VHLD).|P -> L (in VHLD; type I).|P -> H (in VHLD).|P -> A (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.P86H(3)|p.P86L(2)|p.P86fs*72(2)|p.P86S(2)|p.S72_V87>L(1)|p.R60fs*35(1)|p.P86A(1)|p.V84_E94>E(1)|p.P86R(1)|p.V84fs*72(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCGTGCTGCCCGTATGGCTC	0.716		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	8	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47161671	47161671	+	Splice_Site	SNP	C	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47161671C>G	uc003cqs.2	-	3	4507	c.4454_splice	c.e3+1	p.R1485_splice	SETD2_uc003cqv.2_Splice_Site_p.R1474_splice	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATTAGACTTACCTTTCTGTTA	0.323			N|F|S|Mis		clear cell renal carcinoma								29	92	---	---	---	---	PASS
SEC61A1	29927	broad.mit.edu	37	3	127785928	127785928	+	Silent	SNP	C	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127785928C>T	uc003ekb.2	+	9	1093	c.909C>T	c.(907-909)GTC>GTT	p.V303V	RUVBL1_uc003eke.2_Intron|RUVBL1_uc003ekf.2_Intron|SEC61A1_uc003ekc.2_Silent_p.V250V|SEC61A1_uc003ekd.2_Silent_p.V183V|SEC61A1_uc003ekg.2_5'UTR	NM_013336	NP_037468	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit	303	Helical; (Potential).				protein targeting to ER	integral to endoplasmic reticulum membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|protein binding|ribosome binding			ovary(1)	1						ACCTTTATGTCATCTCCCAAA	0.537													32	170	---	---	---	---	PASS
P2RY14	9934	broad.mit.edu	37	3	150931635	150931635	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150931635A>G	uc003eyr.1	-	3	948	c.470T>C	c.(469-471)ATT>ACT	p.I157T	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron|P2RY14_uc003eys.1_Missense_Mutation_p.I157T	NM_001081455	NP_001074924	Q15391	P2Y14_HUMAN	P2Y14 receptor	157	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled|UDP-activated nucleotide receptor activity			large_intestine(2)|ovary(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GGTGAGAATAATATTTGGAAC	0.413													32	111	---	---	---	---	PASS
ARHGAP10	79658	broad.mit.edu	37	4	148861016	148861016	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148861016T>A	uc003ilf.2	+	14	1269	c.1269T>A	c.(1267-1269)AGT>AGA	p.S423R	ARHGAP10_uc003ilg.2_Missense_Mutation_p.S72R	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10	423	Rho-GAP.				apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TGGGGGTGAGTTCAAAGGTCC	0.353													66	204	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158257620	158257620	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158257620C>G	uc003ipm.3	+	11	2024	c.1565C>G	c.(1564-1566)TCT>TGT	p.S522C	GRIA2_uc011cit.1_Missense_Mutation_p.S475C|GRIA2_uc003ipl.3_Missense_Mutation_p.S522C|GRIA2_uc003ipk.3_Missense_Mutation_p.S475C|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	522	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	CTCGGGATATCTATCATGATC	0.418													88	281	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35876615	35876615	+	3'UTR	SNP	C	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35876615C>T	uc003jjs.2	+	8					IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor						immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			ACTGAACTTACCGTGAGCGAC	0.438													4	53	---	---	---	---	PASS
IL31RA	133396	broad.mit.edu	37	5	55203210	55203210	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55203210T>C	uc003jql.2	+	10	1341	c.1276T>C	c.(1276-1278)TAT>CAT	p.Y426H	IL31RA_uc003jqk.2_Missense_Mutation_p.Y426H|IL31RA_uc011cqj.1_Missense_Mutation_p.Y284H|IL31RA_uc003jqm.2_Missense_Mutation_p.Y394H|IL31RA_uc003jqn.2_Missense_Mutation_p.Y426H|IL31RA_uc010iwa.1_Missense_Mutation_p.Y394H|IL31RA_uc003jqo.2_Missense_Mutation_p.Y284H	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	394	Extracellular (Potential).|Fibronectin type-III 4.				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TTTCTGGTGCTATAACATCTC	0.423													24	67	---	---	---	---	PASS
GALNT10	55568	broad.mit.edu	37	5	153796478	153796478	+	Silent	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153796478G>A	uc003lvh.2	+	12	1890	c.1758G>A	c.(1756-1758)CAG>CAA	p.Q586Q	GALNT10_uc010jic.2_RNA|GALNT10_uc010jid.2_Silent_p.Q427Q|uc003lvi.2_Intron|GALNT10_uc003lvj.2_Silent_p.Q257Q	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a	586	Lumenal (Potential).|Ricin B-type lectin.					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TCACCCAGCAGTGGCTGTTTG	0.537													62	161	---	---	---	---	PASS
SYCP2L	221711	broad.mit.edu	37	6	10898272	10898272	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10898272G>A	uc003mzo.2	+	5	661	c.365G>A	c.(364-366)GGA>GAA	p.G122E	SYCP2L_uc011din.1_5'UTR|SYCP2L_uc010jow.2_5'UTR	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	122						nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			AGAACAACAGGAATTCTGACC	0.418													30	113	---	---	---	---	PASS
GTPBP2	54676	broad.mit.edu	37	6	43592645	43592645	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43592645A>T	uc003ovs.2	-	6	897	c.860T>A	c.(859-861)GTC>GAC	p.V287D	GTPBP2_uc010jyv.2_Missense_Mutation_p.V199D|GTPBP2_uc003ovt.1_Missense_Mutation_p.V287D	NM_019096	NP_061969	Q9BX10	GTPB2_HUMAN	GTP binding protein 2	287							GTP binding|GTPase activity			liver(1)|skin(1)	2	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GTTGGCACTGACGAGGAGCAG	0.572													27	124	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	107009363	107009363	+	Silent	SNP	T	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107009363T>C	uc003prh.2	+	18	5389	c.4902T>C	c.(4900-4902)TGT>TGC	p.C1634C	AIM1_uc003pri.2_Silent_p.C438C	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1634	Ricin B-type lectin.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AAGAAGGATGTATCAAATGCA	0.453													23	84	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66703498	66703498	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66703498G>T	uc003tvn.2	+	16	2330	c.2181G>T	c.(2179-2181)AAG>AAT	p.K727N	TYW1_uc010lai.2_RNA|TYW1_uc011kef.1_Missense_Mutation_p.K341N|PMS2L4_uc003tvo.2_Intron	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	727					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				ACAAATCAAAGGCTATTTCTG	0.423													19	71	---	---	---	---	PASS
KLHDC10	23008	broad.mit.edu	37	7	129761893	129761893	+	Splice_Site	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129761893G>A	uc003vpj.1	+	5	766	c.631_splice	c.e5-1	p.A211_splice	KLHDC10_uc003vpk.1_Splice_Site_p.A182_splice|KLHDC10_uc010lmb.1_Splice_Site_p.A108_splice	NM_014997	NP_055812	Q6PID8	KLD10_HUMAN	kelch domain containing 10												0						TTGTTATCCAGGCTATGGCCA	0.393													14	53	---	---	---	---	PASS
MFHAS1	9258	broad.mit.edu	37	8	8747924	8747924	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8747924A>G	uc003wsj.1	-	1	3208	c.2645T>C	c.(2644-2646)ATT>ACT	p.I882T		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	882											0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCTATATTCAATCTGCAACTG	0.483													31	76	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61768568	61768568	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61768568G>A	uc003xue.2	+	33	7448	c.6971G>A	c.(6970-6972)TGT>TAT	p.C2324Y		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2324					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GACAACATCTGTGAAGCAGTG	0.433													4	16	---	---	---	---	PASS
LOC554202	554202	broad.mit.edu	37	9	21455929	21455929	+	RNA	SNP	G	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21455929G>T	uc003zpe.2	-	4		c.486C>A			LOC554202_uc003zpf.2_RNA	NR_027054				Homo sapiens cDNA FLJ42400 fis, clone ASTRO2003581.												0						GGTATTTCCAGGAATCCATCT	0.483													3	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	90746840	90746840	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90746840G>A	uc011lti.1	-	4	1141	c.1112C>T	c.(1111-1113)CCG>CTG	p.P371L						SubName: Full=cDNA FLJ59639;																		GTTCTTCATCGGGGATAGAAA	0.522													28	383	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123292386	123292386	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123292386C>G	uc004bkf.2	-	8	876	c.695G>C	c.(694-696)AGC>ACC	p.S232T	CDK5RAP2_uc004bkg.2_Missense_Mutation_p.S232T|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.S232T|CDK5RAP2_uc004bki.2_Missense_Mutation_p.S31T	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	232					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						AGCTTCTTTGCTCTTCAAAGA	0.413													44	149	---	---	---	---	PASS
PLXDC2	84898	broad.mit.edu	37	10	20465933	20465933	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20465933C>G	uc001iqg.1	+	8	1526	c.889C>G	c.(889-891)CGA>GGA	p.R297G	PLXDC2_uc001iqh.1_Missense_Mutation_p.R248G|PLXDC2_uc009xkc.1_RNA	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor	297	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						TCTAGATGTTCGAAGAAGAAC	0.323													17	158	---	---	---	---	PASS
H2AFY2	55506	broad.mit.edu	37	10	71868913	71868913	+	Silent	SNP	G	A	A	rs41277966	byFrequency	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71868913G>A	uc001jqm.2	+	8	1362	c.903G>A	c.(901-903)GCG>GCA	p.A301A	H2AFY2_uc001jqn.2_RNA|AIFM2_uc010qjg.1_Intron	NM_018649	NP_061119	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	301	Macro.				chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding			skin(1)	1						TGTCAGCGGCGGAGGACAAGA	0.532													26	71	---	---	---	---	PASS
PCGF6	84108	broad.mit.edu	37	10	105110747	105110747	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105110747G>T	uc001kwt.2	-	1	145	c.77C>A	c.(76-78)CCG>CAG	p.P26Q	PCGF6_uc001kwu.2_Missense_Mutation_p.P26Q|PCGF6_uc009xxk.2_RNA|PCGF6_uc009xxl.2_RNA|PCGF6_uc009xxm.2_RNA	NM_001011663	NP_001011663	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6 isoform a	26	Pro-rich.				negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		gacaggaggcggaggcggCAA	0.552													2	2	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17190234	17190234	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17190234T>C	uc001mmq.3	-	1	1121	c.1055A>G	c.(1054-1056)CAT>CGT	p.H352R	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_RNA|PIK3C2A_uc010rcx.1_Missense_Mutation_p.H352R|PIK3C2A_uc009ygv.1_Missense_Mutation_p.H352R	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	352					cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	CTGAGATATATGGCCCTGGGC	0.328													7	209	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17515855	17515855	+	3'UTR	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17515855G>A	uc001mnf.2	-	21					USH1C_uc001mne.2_3'UTR|USH1C_uc009yhb.2_3'UTR|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_3'UTR	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a						equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						GTGTTCACGAGGTGGGGCCGG	0.522													3	21	---	---	---	---	PASS
SESN3	143686	broad.mit.edu	37	11	94906296	94906296	+	3'UTR	SNP	C	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94906296C>A	uc001pfk.1	-	10					uc001pfj.2_5'Flank|SESN3_uc010rug.1_3'UTR	NM_144665	NP_653266	P58005	SESN3_HUMAN	sestrin 3						cell cycle arrest	nucleus					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.234)		AAAAAAAAAACAAACGGCTAA	0.294													4	11	---	---	---	---	PASS
DPPA3	359787	broad.mit.edu	37	12	7869602	7869602	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7869602G>A	uc001qtf.2	+	4	487	c.409G>A	c.(409-411)GTG>ATG	p.V137M		NM_199286	NP_954980	Q6W0C5	DPPA3_HUMAN	stella	137						cytoplasm|nucleus					0				Kidney(36;0.0887)		CAGTTTCTGCGTGTCTAATGG	0.378													39	140	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53662902	53662902	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53662902A>G	uc001sck.2	+	3	267	c.176A>G	c.(175-177)CAG>CGG	p.Q59R	ESPL1_uc001scj.2_5'UTR	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	59					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						GCTTGCAACCAGCAGCTGACT	0.577													28	101	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80650146	80650146	+	IGR	SNP	A	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80650146A>C								PPP1R12A (320911 upstream) : PTPRQ (187980 downstream)																							TTCAGTCTATAACTCTGATTC	0.338													9	35	---	---	---	---	PASS
HSPH1	10808	broad.mit.edu	37	13	31712675	31712675	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31712675C>T	uc001utj.2	-	17	2637	c.2239G>A	c.(2239-2241)GAA>AAA	p.E747K	HSPH1_uc001utk.2_Missense_Mutation_p.E703K|HSPH1_uc010aaw.2_Missense_Mutation_p.E706K|HSPH1_uc001utl.2_Missense_Mutation_p.E749K|HSPH1_uc010tds.1_Missense_Mutation_p.E671K	NM_006644	NP_006635	Q92598	HS105_HUMAN	heat shock 105kD	747					positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding				0		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TTTTTCATTTCAGACTCATCA	0.343													18	192	---	---	---	---	PASS
FNDC3A	22862	broad.mit.edu	37	13	49776041	49776041	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49776041A>T	uc001vcm.2	+	24	3398	c.3093A>T	c.(3091-3093)GAA>GAT	p.E1031D	FNDC3A_uc001vcn.2_Missense_Mutation_p.E1031D|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcq.2_Missense_Mutation_p.E975D	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1031	Fibronectin type-III 8.					Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AAGCTGGGGAAGGTCCCCTCT	0.358													28	112	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101720364	101720364	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101720364G>A	uc001vox.1	-	39	4541	c.4352C>T	c.(4351-4353)TCC>TTC	p.S1451F		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1451	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATAAAACAAGGAGAAATTCTC	0.318													25	76	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45644583	45644583	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45644583G>C	uc001wwd.3	+	14	2725	c.2626G>C	c.(2626-2628)GAT>CAT	p.D876H	FANCM_uc010anf.2_Missense_Mutation_p.D850H|FANCM_uc001wwe.3_Missense_Mutation_p.D412H|FANCM_uc010ang.2_Missense_Mutation_p.D90H	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	876					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						CGGTATTATAGATTCTGTAGA	0.279								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				14	169	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52508821	52508821	+	Splice_Site	SNP	A	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52508821A>T	uc001wzo.2	-	7	2059	c.1825_splice	c.e7+1	p.G609_splice	NID2_uc010tqs.1_Splice_Site_p.G609_splice|NID2_uc010tqt.1_Splice_Site_p.G609_splice|NID2_uc001wzp.2_Splice_Site_p.G609_splice	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor							basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					GGCCCTACTCACCTGCGAGGC	0.567													8	112	---	---	---	---	PASS
CDC42BPB	9578	broad.mit.edu	37	14	103418834	103418834	+	Splice_Site	SNP	C	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103418834C>A	uc001ymi.1	-	24	3404	c.3172_splice	c.e24+1	p.V1058_splice	CDC42BPB_uc001ymj.1_Splice_Site_p.V160_splice	NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta						actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		ACGACACTCACCCTCGCAGGC	0.637													3	31	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106234219	106234219	+	Intron	SNP	C	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106234219C>G	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						TGGTGATGGTCGTCCACAGCC	0.607													4	19	---	---	---	---	PASS
SCNN1B	6338	broad.mit.edu	37	16	23359975	23359975	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23359975G>A	uc002dln.2	+	2	231	c.55G>A	c.(55-57)GGC>AGC	p.G19S		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	19	Cytoplasmic (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GAAGGGCCCCGGCTACACGTA	0.602													4	21	---	---	---	---	PASS
ABCA5	23461	broad.mit.edu	37	17	67310664	67310664	+	5'UTR	SNP	C	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67310664C>T	uc002jif.2	-	1					ABCA5_uc002jig.2_Intron|ABCA5_uc002jih.2_Intron|ABCA5_uc010dfe.2_Intron	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5						cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					gtttcagtcccaggtaagatg	0.144													8	22	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80039936	80039936	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80039936T>G	uc002kdu.2	-	36	6229	c.6112A>C	c.(6112-6114)AAT>CAT	p.N2038H	FASN_uc002kdv.1_RNA	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	2038	Beta-ketoacyl reductase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	ATGGCGGAATTGGCAAAGCCG	0.483													16	65	---	---	---	---	PASS
METTL4	64863	broad.mit.edu	37	18	2547514	2547514	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2547514G>C	uc002klh.3	-	6	1694	c.914C>G	c.(913-915)TCA>TGA	p.S305*	METTL4_uc010dkj.2_Nonsense_Mutation_p.S102*	NM_022840	NP_073751	Q8N3J2	METL4_HUMAN	methyltransferase like 4	305					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		methyltransferase activity|nucleic acid binding			kidney(1)|skin(1)	2						TTGCAGGGGTGACAAATAACT	0.383													17	62	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17760372	17760372	+	Silent	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17760372G>A	uc002nhd.2	-	14	1728	c.1728C>T	c.(1726-1728)ATC>ATT	p.I576I		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	488					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						GCATGCTGTCGATGATGATGA	0.507													30	122	---	---	---	---	PASS
RINL	126432	broad.mit.edu	37	19	39360226	39360226	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39360226C>G	uc002ojq.2	-	10	1507	c.1119G>C	c.(1117-1119)GAG>GAC	p.E373D	RINL_uc002ojr.1_Missense_Mutation_p.E8D|RINL_uc010xuo.1_Missense_Mutation_p.E487D	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	373	VPS9.						GTPase activator activity			pancreas(1)	1						CTCCCCGCAGCTCATCTGGAT	0.627											OREG0025454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	77	---	---	---	---	PASS
ZNF428	126299	broad.mit.edu	37	19	44112165	44112165	+	Missense_Mutation	SNP	G	T	T	rs151333697		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44112165G>T	uc002oxa.2	-	3	606	c.171C>A	c.(169-171)GAC>GAA	p.D57E	SRRM5_uc002oxb.2_Intron	NM_182498	NP_872304	Q96B54	ZN428_HUMAN	zinc finger protein 428	57	Glu-rich.					intracellular	zinc ion binding				0		Prostate(69;0.0153)				ATTCAGGATCGTCAGTGGTct	0.542													17	36	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29624070	29624070	+	Missense_Mutation	SNP	G	A	A	rs79198850		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29624070G>A	uc010ztl.1	+	1	36	c.4G>A	c.(4-6)GCT>ACT	p.A2T	FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GCAGTTTATGGCTGTCAAATT	0.269													3	21	---	---	---	---	PASS
C20orf185	359710	broad.mit.edu	37	20	31657707	31657707	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31657707G>A	uc002wym.1	+	11	1163	c.1163G>A	c.(1162-1164)CGT>CAT	p.R388H		NM_182658	NP_872599	P59826	LPLC3_HUMAN	antimicrobial peptide RYA3 precursor	388					innate immune response	cytoplasm|extracellular region	lipid binding|protein binding			ovary(4)	4						ATGACTGTGCGTGCCCAGCTG	0.537													86	338	---	---	---	---	PASS
NDUFA1	4694	broad.mit.edu	37	X	119005873	119005873	+	5'UTR	SNP	A	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119005873A>C	uc004esc.3	+	1					RNF113A_uc004esb.2_5'Flank	NM_004541	NP_004532	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			large_intestine(1)	1					NADH(DB00157)	AACGGGGCAGAGATGTGGTTC	0.498													55	68	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153594983	153594983	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153594983T>G	uc004fkk.2	-	7	1261	c.1012A>C	c.(1012-1014)AAG>CAG	p.K338Q	FLNA_uc010nuu.1_Missense_Mutation_p.K338Q	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	338	Filamin 1.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTGCGGTTCTTGTCGTTATTG	0.622													34	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7407	7407	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7407T>C	uc011mfh.1	+	1	1554	c.506T>C	c.(505-507)CTA>CCA	p.L169P	uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		GCCCCCCACCCTACCACACAT	0.299													2	0	---	---	---	---	PASS
MFN2	9927	broad.mit.edu	37	1	12058607	12058611	+	Intron	DEL	AAAAC	-	-	rs113209787		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12058607_12058611delAAAAC	uc001atn.3	+						MFN2_uc009vni.2_Intron	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2						blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		tcTATATCCAaaaacaaaacaaaac	0.195													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18895161	18895164	+	IGR	DEL	AAGA	-	-	rs12746398		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18895161_18895164delAAGA								KLHDC7A (82622 upstream) : PAX7 (62336 downstream)																							ggaaggaaggaagaaagaaagaaa	0.098													4	2	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43011397	43011398	+	Intron	DEL	CG	-	-	rs112575083		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43011397_43011398delCG	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						gcaggcagatcgcttgagctca	0.045													3	3	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45444293	45444293	+	Intron	DEL	C	-	-	rs57964686		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45444293delC	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCAATAAATTCtttttttttt	0.144													6	3	---	---	---	---	
TRIM45	80263	broad.mit.edu	37	1	117659023	117659023	+	Intron	DEL	T	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117659023delT	uc001egz.2	-						TRIM45_uc009whe.2_Intron|TRIM45_uc001eha.2_Intron	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		tcccggctaattttttttttt	0.000													4	2	---	---	---	---	
GDAP2	54834	broad.mit.edu	37	1	118429438	118429439	+	Intron	INS	-	ACA	ACA	rs143592216	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118429438_118429439insACA	uc001ehf.2	-						GDAP2_uc001ehg.2_Intron	NM_017686	NP_060156	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated											ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CTACTCTGCAGACAACACCTAT	0.307													4	4	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	154100028	154100029	+	Intron	DEL	TC	-	-	rs10531787		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154100028_154100029delTC	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CAAAGTAGGttctttttttttt	0.149													4	2	---	---	---	---	
NME7	29922	broad.mit.edu	37	1	169256356	169256357	+	Intron	INS	-	A	A	rs146291925	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169256356_169256357insA	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron|NME7_uc001gfv.1_3'UTR	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					AATCCACAAAGAAAAGACAAAT	0.342													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	171793915	171793915	+	IGR	DEL	C	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171793915delC								METTL13 (27060 upstream) : DNM3 (16706 downstream)																							CTGGCCCCTTCAGTGCAGATG	0.537													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2910768	2910769	+	Intron	INS	-	T	T	rs142585959	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2910768_2910769insT	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																		tccaccccctctcccCAGCCCA	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764886	91764893	+	IGR	DEL	TATGTGTG	-	-	rs4005074		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764886_91764893delTATGTGTG								None (None upstream) : LOC654342 (40299 downstream)																							gatgtacgtatatgtgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132767962	132767962	+	IGR	DEL	A	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132767962delA								C2orf27B (208728 upstream) : NCRNA00164 (137202 downstream)																							GAAATGGGGTAGAAGGCCAGC	0.562													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	188123007	188123008	+	IGR	INS	-	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188123007_188123008insT								ZSWIM2 (409110 upstream) : CALCRL (84843 downstream)																							tccttccttccttccttccttc	0.163													4	2	---	---	---	---	
RFTN2	130132	broad.mit.edu	37	2	198540353	198540354	+	5'UTR	DEL	AC	-	-	rs148812496		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540353_198540354delAC	uc002uuo.3	-	1						NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						aaaaaaaaaaacccaaaaaaaa	0.248													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	109648950	109648953	+	IGR	DEL	TCCC	-	-	rs113948167		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109648950_109648953delTCCC								FLJ25363 (434936 upstream) : None (None downstream)																							cttccctccttccctccttccttc	0.000													6	3	---	---	---	---	
PHLDB2	90102	broad.mit.edu	37	3	111574358	111574359	+	Intron	INS	-	CTTT	CTTT	rs143529595	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111574358_111574359insCTTT	uc003dyc.2	+							NM_001134437	NP_001127909	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						tcttttctttcctttctttctt	0.109													1	5	---	---	---	---	
TM4SF18	116441	broad.mit.edu	37	3	149051270	149051271	+	Intron	INS	-	C	C	rs4048749		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149051270_149051271insC	uc003exa.2	-							NM_138786	NP_620141	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18							integral to membrane				ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			tctctctctctttttttttttt	0.381													3	6	---	---	---	---	
UGT2B4	7363	broad.mit.edu	37	4	70361792	70361792	+	5'Flank	DEL	T	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70361792delT	uc003hek.3	-						UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_5'Flank	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor						estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						TCTTTTTGGATTTTTTTTTTT	0.174													7	4	---	---	---	---	
FBXW7	55294	broad.mit.edu	37	4	153247487	153247487	+	Intron	DEL	T	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247487delT	uc003ims.2	-						FBXW7_uc011cii.1_Intron|FBXW7_uc003imt.2_Intron|FBXW7_uc011cih.1_Intron|FBXW7_uc003imq.2_Intron|FBXW7_uc003imr.2_Intron	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform						interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GTTTTTTAGCTTTTTTTTTTT	0.289			Mis|N|D|F		colorectal|endometrial|T-ALL								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6422742	6422743	+	IGR	INS	-	AAAAG	AAAAG	rs139047977	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6422742_6422743insAAAAG								MED10 (44103 upstream) : UBE2QL1 (25993 downstream)																							gggaagaaaacaaaagaaaaga	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56326880	56326881	+	IGR	INS	-	TC	TC			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56326880_56326881insTC								MIER3 (59379 upstream) : GPBP1 (142894 downstream)																							ctttctttctttctttctttct	0.089													6	3	---	---	---	---	
RGNEF	64283	broad.mit.edu	37	5	73142411	73142412	+	Intron	INS	-	T	T	rs142259999	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73142411_73142412insT	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		CATATGAACTATTTTTTTGAGA	0.287													8	4	---	---	---	---	
CYFIP2	26999	broad.mit.edu	37	5	156734664	156734665	+	Intron	DEL	TA	-	-	rs57764989		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156734664_156734665delTA	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			tgtgtgtgtgtatgtgtgtgtg	0.277													4	3	---	---	---	---	
RASGEF1C	255426	broad.mit.edu	37	5	179528352	179528352	+	3'UTR	DEL	G	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179528352delG	uc003mlq.2	-	13					RASGEF1C_uc003mlr.2_3'UTR|RASGEF1C_uc003mlp.3_3'UTR	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCCACTGTGGGGGGGGGGG	0.672													2	12	---	---	---	---	
MYO6	4646	broad.mit.edu	37	6	76558432	76558432	+	Intron	DEL	T	-	-	rs11343853		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76558432delT	uc003pih.1	+						MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TTCTGAGCTCTGTTTTGAACA	0.274													3	3	---	---	---	---	
C6orf204	387119	broad.mit.edu	37	6	119017841	119017843	+	Intron	DEL	TTT	-	-	rs1771757		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119017841_119017843delTTT	uc003pya.1	-						C6orf204_uc003pyc.2_Intron	NM_206921	NP_996804	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform b							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		ctccACAGAGTTTTttgttgttg	0.020													4	2	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6840334	6840334	+	Intron	DEL	T	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6840334delT	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TATAAAGTCATTTTTTTTTTT	0.204													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62915937	62915938	+	IGR	DEL	AT	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62915937_62915938delAT								LOC100287704 (103786 upstream) : ZNF727 (589883 downstream)																							AAGTTAACCAATGTTTGTCAAC	0.312													5	3	---	---	---	---	
TAF6	6878	broad.mit.edu	37	7	99708603	99708603	+	Intron	DEL	A	-	-	rs112139162		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99708603delA	uc003uti.2	-						TAF6_uc003utg.2_Intron|TAF6_uc003uth.2_Intron|TAF6_uc003utk.2_Intron|TAF6_uc011kji.1_Intron|TAF6_uc003utj.2_Intron|TAF6_uc003utl.2_Intron|TAF6_uc003utm.2_Intron|TAF6_uc003utn.1_Intron	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha						negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					actccatctcaaaaaaaaaaa	0.224													3	4	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6390140	6390141	+	Intron	INS	-	C	C	rs141106218	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6390140_6390141insC	uc003wqi.2	+						ANGPT2_uc003wqj.3_Intron|ANGPT2_uc003wqk.3_Intron|ANGPT2_uc010lri.2_Intron|ANGPT2_uc003wql.3_Intron	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TACCTTGCCTTCCTTTTGGAAT	0.312													3	3	---	---	---	---	
C8orf80	389643	broad.mit.edu	37	8	27884280	27884282	+	Intron	DEL	TCA	-	-	rs142016219		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27884280_27884282delTCA	uc003xgm.3	-							NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center							nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)		gctgttgttTtcatcatcatcat	0.094													3	4	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53077958	53077958	+	Intron	DEL	T	-	-	rs58660248		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53077958delT	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron|ST18_uc003xrb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AGAAATTAAATCCAGCAAGCT	0.363													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125850042	125850043	+	IGR	INS	-	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125850042_125850043insT								MTSS1 (109312 upstream) : LOC157381 (101841 downstream)																							tccttccttccttccttccttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67038679	67038681	+	IGR	DEL	ATG	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67038679_67038681delATG								LOC442421 (535652 upstream) : AQP7P1 (215586 downstream)																							GGCCAAGTTCATGAGCACATATG	0.562													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68455229	68455230	+	IGR	INS	-	AC	AC			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68455229_68455230insAC								FAM27B (661040 upstream) : MIR1299 (547009 downstream)																							GGGAGACTTCTGTGCAGAGGCT	0.584													7	5	---	---	---	---	
PGM5P2	595135	broad.mit.edu	37	9	69128420	69128422	+	Intron	DEL	AGG	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69128420_69128422delAGG	uc004aff.3	-							NR_002836				Homo sapiens phosphoglucomutase 5 pseudogene 2, mRNA (cDNA clone IMAGE:4121651), with apparent retained intron.												0						gaaggaaggaaggaaggaaggaa	0.000													4	3	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	91978182	91978183	+	Intron	INS	-	C	C	rs139774075	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91978182_91978183insC	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aql.2_Intron|SEMA4D_uc004aqm.2_Intron	NM_001142287	NP_001135759	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						ACGTGGGATTTCCCCCCCCAGT	0.554													5	4	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7248006	7248011	+	Intron	DEL	AAAAAC	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7248006_7248011delAAAAAC	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TTATACATTAaaaaacaaaaacaaaa	0.296													4	2	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7249383	7249386	+	Intron	DEL	GAAA	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7249383_7249386delGAAA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						aagaaagaaggaaagaaagaaaga	0.000													3	3	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	17875520	17875520	+	Intron	DEL	A	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17875520delA	uc001ipk.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						actctgtctcaaaaaaaaaaa	0.085													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467360	52467361	+	IGR	DEL	CA	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467360_52467361delCA								SGMS1 (82437 upstream) : ASAH2B (32335 downstream)																							AGCTGATATCcacacacacaca	0.342													8	5	---	---	---	---	
CALHM2	51063	broad.mit.edu	37	10	105208932	105208932	+	Intron	DEL	A	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105208932delA	uc001kwz.2	-						CALHM2_uc001kxa.2_Intron|CALHM2_uc001kxc.2_Intron|CALHM2_uc001kxb.2_Intron|CALHM2_uc001kxd.1_3'UTR	NM_015916	NP_057000	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2							integral to membrane				skin(1)	1						GATTTACAGTAAAAAAAAAAA	0.398													4	2	---	---	---	---	
FAM45A	404636	broad.mit.edu	37	10	120879759	120879760	+	Intron	INS	-	A	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120879759_120879760insA	uc001ldw.2	+						FAM45A_uc010qsv.1_Intron|FAM45A_uc010qsw.1_Intron|FAM45A_uc010qsx.1_Intron|FAM45A_uc010qsy.1_Intron|FAM45A_uc010qsz.1_Intron	NM_207009	NP_996892	Q8TCE6	FA45A_HUMAN	hypothetical protein LOC404636											ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		gactcggtctcaaaaaaaaaag	0.089													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59066312	59066312	+	IGR	DEL	G	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066312delG								MPEG1 (85818 upstream) : OR5AN1 (65620 downstream)																							aggaaagaaaggaaagaaaga	0.000													4	2	---	---	---	---	
MMP13	4322	broad.mit.edu	37	11	102820015	102820015	+	Intron	DEL	A	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102820015delA	uc001phl.2	-							NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein						collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		CTGTGAAGGGAAAAAAAATTC	0.408													2	7	---	---	---	---	
KRT6C	286887	broad.mit.edu	37	12	52865378	52865379	+	Intron	INS	-	CTC	CTC	rs138783314		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52865378_52865379insCTC	uc001sal.3	-							NM_173086	NP_775109	P48668	K2C6C_HUMAN	keratin 6C						cytoskeleton organization	keratin filament	structural molecule activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0828)		TCCTGCCAATTCTCTCCCAGGG	0.495													5	6	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78224950	78224957	+	5'Flank	DEL	AGAGAGAG	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224950_78224957delAGAGAGAG	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						agagagagacagagagagagagagagag	0.226										HNSCC(70;0.22)			5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106420386	106420387	+	IGR	DEL	GA	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106420386_106420387delGA								C12orf75 (655091 upstream) : NUAK1 (36738 downstream)																							caaagagatggagagagagaga	0.000													6	3	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881128	109881131	+	Intron	DEL	TGTA	-	-	rs10545295		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881128_109881131delTGTA	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						tatatatgtgtgtatgtatgtgta	0.029													3	3	---	---	---	---	
RNF10	9921	broad.mit.edu	37	12	120994905	120994905	+	Intron	DEL	G	-	-	rs9706503		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120994905delG	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					aaaaaaaaaagaaaaaaaTGA	0.199													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	58465522	58465523	+	IGR	INS	-	CTTC	CTTC	rs150352160	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58465522_58465523insCTTC								SLC35F4 (401907 upstream) : C14orf37 (5286 downstream)																							TTCCTTAATTActtccttcctt	0.282													8	5	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105710843	105710844	+	Intron	INS	-	GGA	GGA	rs146094520	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105710843_105710844insGGA	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axj.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GTGACTAGGGTGGAGGAGGAAG	0.386													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													4	3	---	---	---	---	
UMOD	7369	broad.mit.edu	37	16	20356762	20356764	+	Intron	DEL	TTC	-	-	rs10568780		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20356762_20356764delTTC	uc002dgz.2	-						UMOD_uc002dha.2_Intron|UMOD_uc002dhb.2_Intron	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor						cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						ctttctttctttcttcctttctt	0.000													4	2	---	---	---	---	
AQP8	343	broad.mit.edu	37	16	25239587	25239588	+	Intron	INS	-	A	A	rs73551053	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25239587_25239588insA	uc002doc.2	+							NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8						cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		ctgtctcaattaaaaaaaaaaa	0.218													4	3	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													4	3	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925054	47925055	+	Intron	INS	-	AC	AC	rs150685532	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925054_47925055insAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						cacacacacagacacacacaca	0.183													4	2	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80525803	80525807	+	Intron	DEL	TTTTT	-	-	rs5822539		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80525803_80525807delTTTTT	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			ATTCTCTTCCttttttttttttttt	0.327													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	9636758	9636759	+	IGR	DEL	AG	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9636758_9636759delAG								PPP4R1 (22158 upstream) : RAB31 (71469 downstream)																							gaaggaaggaagagagagagag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29440040	29440051	+	IGR	DEL	CTTCCTTCCTTG	-	-	rs4990208		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29440040_29440051delCTTCCTTCCTTG								None (None upstream) : LOC148145 (15989 downstream)																							tccttccttccttccttccttgcttccttcct	0.142													4	3	---	---	---	---	
TARM1	441864	broad.mit.edu	37	19	54583735	54583735	+	Intron	DEL	A	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54583735delA	uc010yei.1	-							NM_001135686	NP_001129158	B6A8C7	TARM1_HUMAN	OSCAR-like transcript-2							integral to membrane					0						actccatctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33232992	33232992	+	Intron	DEL	A	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33232992delA	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron|PIGU_uc010gev.1_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						accccatctcaaaaaaaaaaa	0.095													4	2	---	---	---	---	
EDN3	1908	broad.mit.edu	37	20	57899654	57899654	+	Intron	DEL	C	-	-	rs111992101		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57899654delC	uc002yap.2	+						EDN3_uc002yaq.2_3'UTR|EDN3_uc002yar.2_3'UTR|EDN3_uc002yas.2_3'UTR	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					CTTAACAATACCCCCCCCCCA	0.507													9	4	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074331	62074333	+	Intron	DEL	CAC	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074331_62074333delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaccaccatcaccaccattacc	0.000													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074452	62074453	+	Intron	INS	-	CAC	CAC	rs139636562	by1000genomes	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074452_62074453insCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	atcaccaccatcaccatcacca	0.000													4	2	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29745509	29745510	+	Intron	INS	-	T	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29745509_29745510insT	uc003afj.2	-						AP1B1_uc003afi.2_Intron|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron|AP1B1_uc011ako.1_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						TCTGAGttttgttttttttttt	0.292													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	380987	380987	+	IGR	DEL	C	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:380987delC								PPP2R3B (33360 upstream) : SHOX (204092 downstream)																							ttccttccttcccttccttcc	0.010													7	4	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2683418	2683421	+	Intron	DEL	GGAA	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2683418_2683421delGGAA	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				agggagggagggaaggaaggaagg	0.132													4	2	---	---	---	---	
SPIN3	169981	broad.mit.edu	37	X	57020792	57020794	+	In_Frame_Del	DEL	GAG	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57020792_57020794delGAG	uc010nkj.2	-	2	873_875	c.587_589delCTC	c.(586-591)CCTCTG>CTG	p.P196del	SPIN3_uc004duu.3_Intron|SPIN3_uc004duw.3_Intron|SPIN3_uc004duv.3_Intron|SPIN3_uc004dux.1_In_Frame_Del_p.P196del	NM_001010862	NP_001010862	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	196					gamete generation					ovary(1)|central_nervous_system(1)	2						CTCTCTGCCAGAGGAGAATCATT	0.448													30	22	---	---	---	---	
COL4A5	1287	broad.mit.edu	37	X	107938338	107938338	+	Intron	DEL	T	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107938338delT	uc004enz.1	+						COL4A5_uc011mso.1_Intron|COL4A5_uc011msp.1_Intron	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor						axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						TGCCTATTACTTTTTTTTGAC	0.378									Alport_syndrome_with_Diffuse_Leiomyomatosis				4	2	---	---	---	---	
GPR112	139378	broad.mit.edu	37	X	135441605	135441605	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135441605delA	uc004ezu.1	+	11	7426	c.7135delA	c.(7135-7137)AAAfs	p.K2379fs	GPR112_uc010nsb.1_Frame_Shift_Del_p.K2174fs|GPR112_uc010nsc.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2379	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					CGTTGCAGTGAAAAAACTAGG	0.333													56	40	---	---	---	---	
