Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16974391	16974391	+	RNA	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974391T>C	uc009vow.2	+	5		c.1201T>C			MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_RNA|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						CTTGCCAGCGTTGGGACGCGC	0.652													6	197	---	---	---	---	PASS
C1orf128	57095	broad.mit.edu	37	1	24106410	24106410	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24106410C>G	uc001bhq.2	+	3	429	c.299C>G	c.(298-300)TCA>TGA	p.S100*	uc001bhp.1_5'Flank|C1orf128_uc010oeb.1_Nonsense_Mutation_p.S7*	NM_020362	NP_065095	Q9GZP4	PITH1_HUMAN	chromosome 1 open reading frame 128	100	PITH.										0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.0034)|all_lung(284;0.00519)|Breast(348;0.0222)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.97e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		GATGATGACTCACACCCCTCT	0.393													28	80	---	---	---	---	PASS
LRRC8B	23507	broad.mit.edu	37	1	90048980	90048980	+	Silent	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90048980A>G	uc001dni.2	+	7	1278	c.771A>G	c.(769-771)GTA>GTG	p.V257V	LRRC8B_uc001dnh.2_Silent_p.V257V|LRRC8B_uc001dnj.2_Silent_p.V257V	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	257						integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TTTATAGAGTATATCTGAAAC	0.383													61	139	---	---	---	---	PASS
PHGDH	26227	broad.mit.edu	37	1	120277423	120277423	+	Intron	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120277423G>A	uc001ehz.2	+						PHGDH_uc009whl.2_Missense_Mutation_p.R128K|PHGDH_uc009whm.2_Intron|PHGDH_uc001eia.2_Intron|PHGDH_uc009whn.2_Intron|PHGDH_uc001eib.2_Intron	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase						brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	ATTGGTCACAGAAGCCACAGA	0.567													8	115	---	---	---	---	PASS
LOC645166	645166	broad.mit.edu	37	1	148933289	148933289	+	Splice_Site	SNP	A	G	G	rs9729175	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148933289A>G	uc010pbc.1	+	3		c.236_splice	c.e3-2		LOC645166_uc010pbd.1_Intron|LOC645166_uc009wkw.1_Splice_Site	NR_027355				Homo sapiens cDNA, FLJ18771.												0						TGCTGCCCGCAGGATATTGTG	0.562													4	18	---	---	---	---	PASS
SCNM1	79005	broad.mit.edu	37	1	151138591	151138591	+	5'UTR	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151138591G>A	uc001ewz.2	+	1					LYSMD1_uc001ewy.2_5'Flank|LYSMD1_uc010pcr.1_5'Flank|SCNM1_uc010pcs.1_5'UTR|SCNM1_uc009wmn.2_RNA	NM_024041	NP_076946	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1						mRNA processing|RNA splicing	nucleus	metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGCGAAACCGGAACAGAGAAT	0.532													8	17	---	---	---	---	PASS
SHE	126669	broad.mit.edu	37	1	154461550	154461550	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154461550T>C	uc001ffb.2	-	3	1088	c.1001A>G	c.(1000-1002)GAG>GGG	p.E334G	SHE_uc001ffc.2_RNA	NM_001010846	NP_001010846	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	334										breast(3)|ovary(2)|central_nervous_system(1)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CACGATCTGCTCCTTCTTCCA	0.662													3	143	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159163457	159163457	+	Intron	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159163457G>T	uc001ftl.2	+						CADM3_uc009wsx.1_Silent_p.G243G|CADM3_uc009wsy.1_Intron|CADM3_uc001ftk.2_Intron	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2						adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					GAGAAAAGGGGAATGACATAT	0.478													3	11	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186151399	186151399	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186151399A>T	uc001grq.1	+	105	16623	c.16394A>T	c.(16393-16395)CAC>CTC	p.H5465L	HMCN1_uc001grs.1_Missense_Mutation_p.H917L	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5465	EGF-like 7; calcium-binding (Potential).				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAACTCACACACAATGGAAAG	0.383													41	121	---	---	---	---	PASS
CHI3L1	1116	broad.mit.edu	37	1	203155750	203155750	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203155750A>G	uc001gzi.2	-	1	173	c.2T>C	c.(1-3)ATG>ACG	p.M1T	FMOD_uc010pqi.1_Intron|CHI3L1_uc001gzj.2_Missense_Mutation_p.M1T	NM_001276	NP_001267	P36222	CH3L1_HUMAN	chitinase 3-like 1 precursor	1					chitin catabolic process	extracellular space|proteinaceous extracellular matrix	cation binding|chitinase activity|extracellular matrix structural constituent|sugar binding			pancreas(1)	1						CTTCACACCCATTCTGGCTGC	0.602													53	147	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214656576	214656576	+	Intron	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214656576C>A	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|uc010ptz.1_RNA	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TAATAATCCCCCTTCTAGGAA	0.368													9	169	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214830539	214830539	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214830539A>T	uc001hkm.2	+	18	8923	c.8749A>T	c.(8749-8751)ACT>TCT	p.T2917S		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	3013	Sufficient for nuclear localization.|Sufficient for centromere localization.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CCCTTCTGTTACTGAAAAGAG	0.478													8	290	---	---	---	---	PASS
TAF1A	9015	broad.mit.edu	37	1	222750908	222750908	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222750908C>G	uc009xdz.1	-	5	672	c.483G>C	c.(481-483)GAG>GAC	p.E161D	TAF1A_uc001hni.1_Missense_Mutation_p.E47D|TAF1A_uc001hnj.2_Missense_Mutation_p.E161D|TAF1A_uc001hnk.2_Missense_Mutation_p.E47D|TAF1A_uc010pur.1_Missense_Mutation_p.E161D	NM_139352	NP_647603	Q15573	TAF1A_HUMAN	TBP-associated factor 1A isoform 2	161					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)		GTCTCCATGTCTCTGCCTCAC	0.383													75	194	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228559759	228559759	+	Silent	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228559759T>C	uc009xez.1	+	94	21324	c.21280T>C	c.(21280-21282)TTG>CTG	p.L7094L	OBSCN_uc001hsr.1_Silent_p.L1723L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7094	Pro-rich.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				AAGCCCCCCATTGGACTCTAA	0.632													6	23	---	---	---	---	PASS
RRM2	6241	broad.mit.edu	37	2	10269379	10269379	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10269379C>T	uc002rah.2	+	10	1227	c.1036C>T	c.(1036-1038)CCA>TCA	p.P346S		NM_001034	NP_001025	P31350	RIR2_HUMAN	ribonucleotide reductase M2 polypeptide isoform	346					deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)		AGTAGAGAACCCATTTGACTT	0.383													55	102	---	---	---	---	PASS
TTC32	130502	broad.mit.edu	37	2	20097698	20097698	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20097698G>T	uc002rdg.2	-	2	380	c.248C>A	c.(247-249)TCT>TAT	p.S83Y		NM_001008237	NP_001008238	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32	83	TPR 2.						identical protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTATGGCAGATGTGTAGTC	0.393													5	213	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24535240	24535240	+	Silent	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24535240A>G	uc002rfe.2	-	5	451	c.193T>C	c.(193-195)TTA>CTA	p.L65L	ITSN2_uc002rff.2_Silent_p.L65L|ITSN2_uc002rfg.2_Silent_p.L65L|ITSN2_uc010eyd.2_Silent_p.L65L	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	65	EH 1.|EF-hand 1.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGTCTGATAAAGCCCTAAAA	0.423													92	229	---	---	---	---	PASS
KHK	3795	broad.mit.edu	37	2	27320383	27320383	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27320383T>C	uc002ril.2	+	5	947	c.430T>C	c.(430-432)TCG>CCG	p.S144P	KHK_uc002rim.2_Missense_Mutation_p.S144P|KHK_uc002rin.2_Missense_Mutation_p.S145P|KHK_uc002rio.2_Missense_Mutation_p.S60P	NM_000221	NP_000212	P50053	KHK_HUMAN	ketohexokinase isoform a	144					fructose catabolic process	cytosol	ATP binding|ketohexokinase activity|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGGAACGCATCGGAGCAGGT	0.622													32	87	---	---	---	---	PASS
ABCG5	64240	broad.mit.edu	37	2	44065039	44065039	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44065039G>C	uc002rtn.2	-	2	339	c.199C>G	c.(199-201)CAG>GAG	p.Q67E	ABCG5_uc002rto.2_5'UTR|ABCG5_uc002rtp.2_5'UTR|ABCG8_uc002rtq.2_5'Flank|ABCG8_uc010yoa.1_5'Flank	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	67	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TTGAGGATCTGCCTGGTCCAC	0.552													55	133	---	---	---	---	PASS
CNRIP1	25927	broad.mit.edu	37	2	68546472	68546472	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68546472C>A	uc002sek.3	-	1	712	c.61G>T	c.(61-63)GGC>TGC	p.G21C	CNRIP1_uc002sej.3_Missense_Mutation_p.G21C|CNRIP1_uc002sel.3_Intron|CNRIP1_uc010fdd.1_Missense_Mutation_p.G21C	NM_015463	NP_056278	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	21							protein binding			liver(1)	1						AAGACCGGGCCGTCATTAGGC	0.662													4	17	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86709771	86709771	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86709771A>G	uc002sri.3	+	18	3203	c.2876A>G	c.(2875-2877)AAT>AGT	p.N959S	KDM3A_uc010ytj.1_Missense_Mutation_p.N959S|KDM3A_uc010ytk.1_Missense_Mutation_p.N907S	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	959					androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						GACCCCAACAATAAGAGCAAC	0.338													7	295	---	---	---	---	PASS
NCAPH	23397	broad.mit.edu	37	2	97024901	97024901	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97024901G>C	uc002svz.1	+	10	1411	c.1327G>C	c.(1327-1329)GAT>CAT	p.D443H	NCAPH_uc010fhu.1_Missense_Mutation_p.D419H|NCAPH_uc010fhv.1_Missense_Mutation_p.D432H|NCAPH_uc010yum.1_Missense_Mutation_p.D419H|NCAPH_uc010fhw.1_Missense_Mutation_p.D432H|NCAPH_uc010yun.1_Missense_Mutation_p.D307H|NCAPH_uc002swa.1_Missense_Mutation_p.D38H	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	443					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				GGCTGGCCCGGATCACTGGCG	0.488													52	136	---	---	---	---	PASS
STRADB	55437	broad.mit.edu	37	2	202344965	202344965	+	3'UTR	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202344965T>G	uc002uyd.3	+	12						NM_018571	NP_061041	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta						activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|protein binding|protein kinase activity			skin(2)|stomach(1)|lung(1)	4						CTTCTGTATTTCTAGGTACAA	0.368													5	226	---	---	---	---	PASS
FASTKD2	22868	broad.mit.edu	37	2	207639092	207639092	+	Silent	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207639092C>A	uc002vbu.2	+	7	1808	c.1398C>A	c.(1396-1398)CTC>CTA	p.L466L	FASTKD2_uc002vbv.2_Silent_p.L466L|FASTKD2_uc002vbx.2_Silent_p.L466L|FASTKD2_uc002vbw.1_Silent_p.L466L	NM_001136193	NP_001129665	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	466					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|skin(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		ACTCTTCTCTCAATCATGTCT	0.244													62	155	---	---	---	---	PASS
ASB1	51665	broad.mit.edu	37	2	239353054	239353054	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239353054C>T	uc002vyg.2	+	4	652	c.566C>T	c.(565-567)ACC>ATC	p.T189I		NM_001040445	NP_001035535	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box-containing protein	189					intracellular signal transduction|negative regulation of cytokine biosynthetic process						0		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		CGGCGGCTCACCTCCTTGGTG	0.602													31	54	---	---	---	---	PASS
PLCD1	5333	broad.mit.edu	37	3	38061700	38061700	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38061700G>A	uc003chn.2	-	2	302	c.178C>T	c.(178-180)CGG>TGG	p.R60W	PLCD1_uc003chm.2_Missense_Mutation_p.R81W	NM_006225	NP_006216	P51178	PLCD1_HUMAN	phospholipase C, delta 1 isoform 2	60	PH.				intracellular signal transduction|lipid catabolic process|phospholipid metabolic process	cytoplasm	calcium ion binding|GTPase activating protein binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TCCGGGGTCCGCATGACCTTG	0.582													4	154	---	---	---	---	PASS
CADM2	253559	broad.mit.edu	37	3	85851226	85851226	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85851226A>G	uc003dqj.2	+	2	717	c.91A>G	c.(91-93)AAT>GAT	p.N31D	CADM2_uc003dqk.2_Missense_Mutation_p.N40D|CADM2_uc003dql.2_Missense_Mutation_p.N33D	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	31	Ig-like V-type.|Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		ACTAACACAGAATGTAACCGT	0.403													35	65	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107474483	107474483	+	Silent	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107474483T>C	uc010hpr.2	+	10	1191	c.864T>C	c.(862-864)CCT>CCC	p.P288P	BBX_uc003dwk.3_Silent_p.P288P|BBX_uc003dwl.3_Silent_p.P288P|BBX_uc010hps.1_Silent_p.P309P|BBX_uc003dwm.3_Silent_p.P288P	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	288					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			GTGCTGAGCCTGTAAAACGCT	0.378													3	157	---	---	---	---	PASS
PVRL3	25945	broad.mit.edu	37	3	110837735	110837735	+	Silent	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110837735T>A	uc003dxt.1	+	3	735	c.735T>A	c.(733-735)ACT>ACA	p.T245T	PVRL3_uc003dxu.1_Silent_p.T222T	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3 precursor	245	Extracellular (Potential).|Ig-like C2-type 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity			upper_aerodigestive_tract(2)	2						GGCGAATTACTTGTGTTGTAA	0.353													38	94	---	---	---	---	PASS
DRD3	1814	broad.mit.edu	37	3	113858392	113858392	+	Silent	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113858392T>A	uc003ebd.2	-	6	1101	c.678A>T	c.(676-678)CGA>CGT	p.R226R	DRD3_uc010hqn.1_Silent_p.R226R|DRD3_uc003ebb.1_Silent_p.R226R|DRD3_uc003ebc.1_Silent_p.R226R	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	226	Cytoplasmic.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	GACTGTTCTGTCGAGTGAGGA	0.527													119	259	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155571512	155571512	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155571512G>A	uc003fan.3	-	1	656	c.275C>T	c.(274-276)GCG>GTG	p.A92V	SLC33A1_uc003fao.1_Missense_Mutation_p.A92V	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	92	Helical; (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GATGCTTCCCGCCAAGCCCAG	0.468													6	152	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169555371	169555371	+	Silent	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169555371A>G	uc003fgb.2	+	5	1635	c.1635A>G	c.(1633-1635)AAA>AAG	p.K545K		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	545											0						AAGATAAGAAAGGAAAGAAGG	0.373													7	16	---	---	---	---	PASS
DCUN1D1	54165	broad.mit.edu	37	3	182662880	182662880	+	3'UTR	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182662880T>G	uc003fld.1	-	7					DCUN1D1_uc011bqn.1_3'UTR	NM_020640	NP_065691	Q96GG9	DCNL1_HUMAN	RP42 homolog							ubiquitin ligase complex	protein binding			ovary(1)	1	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			GTTCCTTTAGTGCTACACTGT	0.383													32	79	---	---	---	---	PASS
OSTalpha	200931	broad.mit.edu	37	3	195954474	195954474	+	Intron	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195954474A>G	uc003fwd.2	+						OSTalpha_uc010iac.1_5'UTR|OSTalpha_uc003fwe.2_5'Flank	NM_152672	NP_689885	Q86UW1	OSTA_HUMAN	organic solute transporter alpha							integral to membrane|plasma membrane	transporter activity			ovary(1)	1	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;8.83e-25)|all cancers(36;8.38e-23)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;7.51e-07)|Lung(62;1.06e-06)	GBM - Glioblastoma multiforme(46;0.00202)		TTGCCGCAAAAGGCTTCCGGA	0.557													4	74	---	---	---	---	PASS
WDR19	57728	broad.mit.edu	37	4	39206807	39206807	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39206807T>A	uc003gtv.2	+	8	791	c.637T>A	c.(637-639)TTT>ATT	p.F213I	WDR19_uc010ifl.1_Missense_Mutation_p.F30I|WDR19_uc003gtu.1_Missense_Mutation_p.F213I|WDR19_uc011byi.1_Missense_Mutation_p.F53I	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	213					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding	p.L213F(1)		large_intestine(1)	1						AACTTTGTTTTTTTTAAATCT	0.358													14	23	---	---	---	---	PASS
TMPRSS11D	9407	broad.mit.edu	37	4	68692994	68692994	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68692994C>T	uc003hdq.2	-	8	1002	c.937G>A	c.(937-939)GCT>ACT	p.A313T	LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc003hdp.2_Missense_Mutation_p.A94T|TMPRSS11D_uc011caj.1_Missense_Mutation_p.A196T	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	313	Peptidase S1.|Extracellular (Potential).				proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						TATTCTTGAGCGCCCCATCCT	0.378													96	250	---	---	---	---	PASS
EREG	2069	broad.mit.edu	37	4	75246929	75246929	+	Intron	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75246929G>T	uc003hie.1	+						EREG_uc003hid.2_3'UTR	NM_001432	NP_001423	O14944	EREG_HUMAN	epiregulin preproprotein						angiogenesis|cell-cell signaling|cytokine-mediated signaling pathway|epidermal growth factor receptor signaling pathway|female meiosis|keratinocyte differentiation|keratinocyte proliferation|luteinizing hormone signaling pathway|mRNA transcription|negative regulation of epithelial cell proliferation|negative regulation of smooth muscle cell differentiation|negative regulation of transcription, DNA-dependent|oocyte maturation|organ morphogenesis|ovarian cumulus expansion|ovulation|positive regulation of cell division|positive regulation of cytokine production|positive regulation of DNA replication|positive regulation of epidermal growth factor receptor activity|positive regulation of fibroblast proliferation|positive regulation of innate immune response|positive regulation of interleukin-6 biosynthetic process|positive regulation of mitosis|positive regulation of phosphorylation|positive regulation of smooth muscle cell proliferation|primary follicle stage|wound healing	extracellular space|integral to plasma membrane	epidermal growth factor receptor binding|growth factor activity			breast(1)|skin(1)	2			Lung(101;0.196)			gtgcagatttgctagtggata	0.109													23	31	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87679432	87679432	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87679432G>A	uc003hpz.2	+	21	3723	c.3243G>A	c.(3241-3243)TGG>TGA	p.W1081*	PTPN13_uc003hpy.2_Nonsense_Mutation_p.W1081*|PTPN13_uc003hqa.2_Nonsense_Mutation_p.W1062*|PTPN13_uc003hqb.2_Nonsense_Mutation_p.W890*	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	1081						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ACAAAAGATGGAGCATAGTAT	0.348													6	21	---	---	---	---	PASS
NPNT	255743	broad.mit.edu	37	4	106861265	106861265	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106861265G>T	uc003hya.2	+	6	744	c.539G>T	c.(538-540)TGC>TTC	p.C180F	NPNT_uc011cfc.1_Missense_Mutation_p.C197F|NPNT_uc011cfd.1_Missense_Mutation_p.C210F|NPNT_uc011cfe.1_Missense_Mutation_p.C210F|NPNT_uc010ilt.1_Missense_Mutation_p.C180F|NPNT_uc011cff.1_Missense_Mutation_p.C180F|NPNT_uc010ilu.1_Missense_Mutation_p.C76F	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	180	EGF-like 4; calcium-binding (Potential).				cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		AGAGCCTCCTGCCCTAGATTT	0.398													15	191	---	---	---	---	PASS
MFAP3L	9848	broad.mit.edu	37	4	170913100	170913100	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170913100G>T	uc003isp.3	-	3	837	c.659C>A	c.(658-660)GCC>GAC	p.A220D	MFAP3L_uc003isn.3_Missense_Mutation_p.A117D	NM_021647	NP_067679	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like isoform	220	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		GGTGACTTTGGCAAGCTCTAG	0.527													33	103	---	---	---	---	PASS
FYB	2533	broad.mit.edu	37	5	39202847	39202847	+	Silent	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39202847T>C	uc003jls.2	-	1	283	c.216A>G	c.(214-216)GAA>GAG	p.E72E	FYB_uc003jlt.2_Silent_p.E72E|FYB_uc003jlu.2_Silent_p.E72E|FYB_uc011cpl.1_Silent_p.E82E	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	72					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			TGTCAGGCTTTTCCTCAGAAG	0.557													48	51	---	---	---	---	PASS
SKIV2L2	23517	broad.mit.edu	37	5	54701366	54701366	+	Silent	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54701366T>A	uc003jpy.3	+	22	2861	c.2595T>A	c.(2593-2595)ACT>ACA	p.T865T	SKIV2L2_uc011cqi.1_Silent_p.T764T	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2	865					maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				GATTTGCTACTTCTTCTGATG	0.348													56	246	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66396355	66396355	+	Silent	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66396355C>A	uc003jut.1	+	7	506	c.438C>A	c.(436-438)ACC>ACA	p.T146T	MAST4_uc003jus.2_Silent_p.T146T|MAST4_uc003juu.1_Silent_p.T156T|MAST4_uc011cra.1_Silent_p.T129T|MAST4_uc010ixa.2_RNA|MAST4_uc003juv.2_Silent_p.T141T|MAST4_uc003juw.2_Silent_p.T141T	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	338						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCTGTACCACCGAAAGCATCG	0.493													4	165	---	---	---	---	PASS
TTC37	9652	broad.mit.edu	37	5	94860289	94860289	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94860289C>G	uc003klb.2	-	16	1602	c.1332G>C	c.(1330-1332)CAG>CAC	p.Q444H	TTC37_uc010jbf.1_Missense_Mutation_p.Q396H	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	444	TPR 6.						binding			ovary(3)|pancreas(1)	4						CAAGAGCTCTCTGAAAACTAA	0.368													37	171	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139889656	139889656	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139889656G>A	uc003lfs.1	+	22	4118	c.3994G>A	c.(3994-3996)GCA>ACA	p.A1332T	ANKHD1_uc003lfq.1_Missense_Mutation_p.A1351T|ANKHD1_uc003lfr.2_Missense_Mutation_p.A1332T|ANKHD1_uc003lft.1_Missense_Mutation_p.A543T|ANKHD1_uc003lfu.1_Missense_Mutation_p.A812T|ANKHD1_uc003lfv.1_Missense_Mutation_p.A409T|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.A71T|ANKHD1_uc003lfw.2_5'UTR	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1332						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTTGGCTGGCATCCAATGG	0.453													4	219	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140532069	140532069	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140532069C>G	uc003lir.2	+	1	2231	c.2231C>G	c.(2230-2232)TCC>TGC	p.S744C	PCDHB6_uc011dah.1_Missense_Mutation_p.S608C	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	744	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGACCCTATCCCAGAGCTAC	0.602													6	314	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140596070	140596070	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140596070A>G	uc003lja.1	+	1	2562	c.2375A>G	c.(2374-2376)AAC>AGC	p.N792S		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	792	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCCCAATAACTTTGGGTTC	0.413													42	210	---	---	---	---	PASS
N4BP3	23138	broad.mit.edu	37	5	177549014	177549014	+	3'UTR	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177549014C>A	uc003mik.1	+	5					N4BP3_uc003mil.1_3'UTR	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3							cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCAGCAGAGCGAGCTGACAG	0.677													4	14	---	---	---	---	PASS
MAML1	9794	broad.mit.edu	37	5	179193308	179193308	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179193308A>T	uc003mkm.2	+	2	1560	c.1297A>T	c.(1297-1299)ACG>TCG	p.T433S	MAML1_uc003mkn.1_Missense_Mutation_p.T433S	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	433					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGGCAGCAGACGGGGCCCTC	0.607													50	230	---	---	---	---	PASS
BMP6	654	broad.mit.edu	37	6	7727745	7727745	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7727745G>T	uc003mxu.3	+	1	735	c.557G>T	c.(556-558)AGC>ATC	p.S186I		NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein	186					BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					AACCGCAAGAGCCTTCTGGCC	0.716													8	9	---	---	---	---	PASS
PPP1R10	5514	broad.mit.edu	37	6	30569885	30569885	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30569885G>A	uc003nqn.1	-	19	3093	c.2541C>T	c.(2539-2541)CCC>CCT	p.P847P	PPP1R10_uc010jsc.1_Silent_p.P501P	NM_002714	NP_002705	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	847	Gly-rich.				protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding			ovary(2)|lung(1)|kidney(1)	4						GGCCTTCATGGGGACGATGTC	0.677													56	121	---	---	---	---	PASS
C6orf108	10591	broad.mit.edu	37	6	43193626	43193626	+	Intron	SNP	A	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43193626A>C	uc003ouo.2	-						C6orf108_uc003oup.2_3'UTR	NM_006443	NP_006434	O43598	RCL_HUMAN	putative c-Myc-responsive isoform 1						cell proliferation|deoxyribonucleoside monophosphate catabolic process|positive regulation of cell growth	cytoplasm|nucleus	deoxyribonucleoside 5'-monophosphate N-glycosidase activity|nucleoside deoxyribosyltransferase activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0123)|OV - Ovarian serous cystadenocarcinoma(102;0.0531)			AGCACTGGAAAGGGCAGGGAA	0.622													4	123	---	---	---	---	PASS
C6orf58	352999	broad.mit.edu	37	6	127901450	127901450	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127901450G>A	uc003qbh.2	+	3	441	c.429G>A	c.(427-429)GCG>GCA	p.A143A		NM_001010905	NP_001010905	Q6P5S2	CF058_HUMAN	hypothetical protein LOC352999 precursor	143						extracellular region					0				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		TTCTTGCTGCGGTTGATTCTG	0.368													55	160	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133065439	133065439	+	Silent	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133065439C>T	uc003qdt.2	-	7	1574	c.1563G>A	c.(1561-1563)TAG>TAA	p.*521*	VNN2_uc003qds.2_Silent_p.*230*|VNN2_uc010kgb.2_Silent_p.*300*|VNN2_uc003qdv.2_Silent_p.*468*	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	521					cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		AAGAGACGCCCTATAACATTA	0.368													42	103	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152757208	152757208	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152757208G>A	uc010kiw.2	-	33	4780	c.4178C>T	c.(4177-4179)GCA>GTA	p.A1393V	SYNE1_uc003qot.3_Missense_Mutation_p.A1400V|SYNE1_uc003qou.3_Missense_Mutation_p.A1393V|SYNE1_uc010kjb.1_Missense_Mutation_p.A1376V|SYNE1_uc003qow.2_Missense_Mutation_p.A688V|SYNE1_uc003qox.1_Missense_Mutation_p.A909V	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1393	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGCCTGGACTGCAATACTTTC	0.398										HNSCC(10;0.0054)			46	136	---	---	---	---	PASS
RBAK	57786	broad.mit.edu	37	7	5104366	5104366	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5104366A>G	uc010kss.1	+	6	1603	c.1279A>G	c.(1279-1281)AAG>GAG	p.K427E	LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Missense_Mutation_p.K427E	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor	427	Interaction with AR.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		CACGGGAGAGAAGCCCTATCA	0.403													27	111	---	---	---	---	PASS
DFNA5	1687	broad.mit.edu	37	7	24738852	24738852	+	Silent	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24738852T>C	uc010kus.1	-	10	1372	c.1284A>G	c.(1282-1284)GTA>GTG	p.V428V	DFNA5_uc003swz.2_Silent_p.V264V|DFNA5_uc003sxa.1_Silent_p.V428V|DFNA5_uc010kut.1_Silent_p.V264V	NM_001127453	NP_001120925	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5 protein isoform	428					sensory perception of sound					ovary(1)	1						CAAGATCAGATACTCCATCAT	0.408													23	62	---	---	---	---	PASS
POLM	27434	broad.mit.edu	37	7	44116318	44116318	+	Intron	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44116318C>A	uc003tjt.2	-						POLM_uc003tjw.1_5'Flank|POLM_uc003tju.2_Intron|POLM_uc003tjx.2_Intron|POLM_uc003tjv.2_Intron|POLM_uc011kbt.1_Intron|POLM_uc003tka.1_RNA|POLM_uc003tjz.3_Intron	NM_013284	NP_037416	Q9NP87	DPOLM_HUMAN	DNA-directed DNA polymerase mu						DNA recombination|DNA repair	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						GCCCATGGAGCACCATGCACC	0.642								DNA_polymerases_(catalytic_subunits)					13	19	---	---	---	---	PASS
SPDYE5	442590	broad.mit.edu	37	7	75130970	75130970	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75130970T>C	uc011kfy.1	+	6	981	c.845T>C	c.(844-846)CTG>CCG	p.L282P		NM_001099435	NP_001092905	A6NIY4	SPDE5_HUMAN	speedy homolog E5	282	Arg-rich.										0						TCCATGAACCTGAGGGCCAGG	0.577													6	441	---	---	---	---	PASS
CLDN12	9069	broad.mit.edu	37	7	90041973	90041973	+	5'UTR	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90041973T>A	uc003ukp.2	+	5					CLDN12_uc003ukq.2_5'UTR|CLDN12_uc010leq.2_5'UTR|CLDN12_uc003ukr.2_5'UTR|CLDN12_uc003uks.2_5'UTR	NM_012129	NP_036261	P56749	CLD12_HUMAN	claudin 12						calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						CTGACAGTACTCCACAAGCTT	0.557													23	80	---	---	---	---	PASS
DPY19L2P2	349152	broad.mit.edu	37	7	102824463	102824463	+	Intron	SNP	A	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102824463A>C	uc003vbh.3	-						DPY19L2P2_uc003vbg.3_RNA|DPY19L2P2_uc010lit.2_RNA	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						TTCTCACAACACACCATGCCT	0.303													4	315	---	---	---	---	PASS
THAP5	168451	broad.mit.edu	37	7	108205177	108205177	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108205177G>T	uc003vfm.2	-	3	800	c.646C>A	c.(646-648)CAT>AAT	p.H216N	THAP5_uc003vfl.2_Missense_Mutation_p.H174N	NM_001130475	NP_001123947	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5 isoform 1	216					cell cycle|negative regulation of cell cycle	nucleus	DNA binding|metal ion binding|protease binding				0						AAAGATTGATGAATACTTTCT	0.333													37	84	---	---	---	---	PASS
CAPZA2	830	broad.mit.edu	37	7	116538867	116538867	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116538867A>G	uc003vil.2	+	4	300	c.197A>G	c.(196-198)AAA>AGA	p.K66R	CAPZA2_uc003vik.1_RNA|CAPZA2_uc011knk.1_RNA	NM_006136	NP_006127	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line,	66					actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex	actin binding				0	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			ACTCCAGTAAAAATTGAAGGT	0.284													46	134	---	---	---	---	PASS
KEL	3792	broad.mit.edu	37	7	142649642	142649642	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142649642C>A	uc003wcb.2	-	10	1367	c.1157G>T	c.(1156-1158)AGA>ATA	p.R386I		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	386	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GCTGAGCTTTCTGCGTGCCTC	0.532													4	140	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	157985188	157985188	+	Splice_Site	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157985188C>T	uc003wno.2	-	5	502	c.381_splice	c.e5-1	p.R127_splice	PTPRN2_uc003wnp.2_Splice_Site_p.R110_splice|PTPRN2_uc003wnq.2_Splice_Site_p.R127_splice|PTPRN2_uc003wnr.2_Splice_Site_p.R89_splice|PTPRN2_uc011kwa.1_Splice_Site_p.R150_splice	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TTTTGAGGGCCTGAAAAAGCA	0.632													29	89	---	---	---	---	PASS
FLJ10661	286042	broad.mit.edu	37	8	8096026	8096026	+	RNA	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8096026T>G	uc011kwt.1	+	8		c.1221T>G			FLJ10661_uc010lrq.2_Intron|FLJ10661_uc003wsf.3_Intron	NR_024362				Homo sapiens cDNA FLJ60033 complete cds, highly similar to Protein FAM86A.												0						TGACCCCTGATGCATAGCCCT	0.667													2	6	---	---	---	---	PASS
SCARA3	51435	broad.mit.edu	37	8	27509086	27509086	+	Silent	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27509086G>T	uc003xga.1	+	3	309	c.168G>T	c.(166-168)CGG>CGT	p.R56R	SCARA3_uc003xgb.1_Silent_p.R56R	NM_016240	NP_057324	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3 isoform 1	56	Cytoplasmic (Potential).				response to oxidative stress|UV protection	collagen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	scavenger receptor activity			skin(2)|ovary(1)|breast(1)	4		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)		CATCGGTGCGGATTCTTTACC	0.657													10	207	---	---	---	---	PASS
WRN	7486	broad.mit.edu	37	8	30921896	30921896	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30921896C>G	uc003xio.3	+	4	1089	c.301C>G	c.(301-303)CAG>GAG	p.Q101E		NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	101	Interaction with WRNIP1 (By similarity).|3'-5' exonuclease.				base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TGCACTAATTCAGTTGTGTGT	0.388			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				5	380	---	---	---	---	PASS
PLAT	5327	broad.mit.edu	37	8	42036456	42036456	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42036456G>C	uc003xos.2	-	13	1698	c.1489C>G	c.(1489-1491)CGG>GGG	p.R497G	PLAT_uc010lxf.1_Missense_Mutation_p.R414G|PLAT_uc010lxg.1_Missense_Mutation_p.R322G|PLAT_uc003xot.2_Missense_Mutation_p.R451G|PLAT_uc011lcm.1_Missense_Mutation_p.R408G|PLAT_uc011lcn.1_Missense_Mutation_p.R371G	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	497	Peptidase S1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CCGCCGCTCCGAGTGTCTCCA	0.597													36	100	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732843	52732843	+	3'UTR	SNP	C	T	T	rs116069210	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732843C>T	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTCTTTTAACTCCTAACAAA	0.284													3	28	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732871	52732871	+	3'UTR	SNP	T	C	C	rs77261625	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732871T>C	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTTTCAAGACTAAAGGAATTA	0.313													3	56	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71050557	71050557	+	Silent	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71050557T>C	uc003xyn.1	-	15	3201	c.3039A>G	c.(3037-3039)GAA>GAG	p.E1013E	NCOA2_uc011lfb.1_Silent_p.E101E	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1013					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TCATCTCTAATTCAGATGGCC	0.418			T	RUNXBP2	AML								18	30	---	---	---	---	PASS
OTUD6B	51633	broad.mit.edu	37	8	92083453	92083453	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92083453A>C	uc003yeu.3	+	2	359	c.260A>C	c.(259-261)AAA>ACA	p.K87T	uc003yet.2_5'Flank|OTUD6B_uc011lgh.1_5'UTR	NM_016023	NP_057107	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	57										ovary(2)|lung(1)	3			BRCA - Breast invasive adenocarcinoma(11;0.0187)			AAGTTGGAAAAAGAAATGGAA	0.413													29	84	---	---	---	---	PASS
TMEM67	91147	broad.mit.edu	37	8	94821184	94821184	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94821184G>A	uc011lgk.1	+	24	2627	c.2556G>A	c.(2554-2556)AGG>AGA	p.R852R	TMEM67_uc010maw.2_Silent_p.R558R|TMEM67_uc003yga.3_Silent_p.R771R|TMEM67_uc011lgl.1_Silent_p.R251R	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	852					cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			CACTAATAAGGGTTTGTATAA	0.318													26	92	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113421242	113421242	+	Silent	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113421242T>C	uc003ynu.2	-	33	5574	c.5415A>G	c.(5413-5415)GTA>GTG	p.V1805V	CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Silent_p.V1765V|CSMD3_uc011lhx.1_Silent_p.V1701V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1805	Extracellular (Potential).|CUB 10.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCTGGAAAAATACAAACTGGC	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			70	167	---	---	---	---	PASS
COLEC10	10584	broad.mit.edu	37	8	120101991	120101991	+	Splice_Site	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120101991G>A	uc003yoo.2	+	2	317	c.220_splice	c.e2+1	p.G74_splice		NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor							collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			GGGCCGAAAGGTAACTAAAAT	0.423													13	54	---	---	---	---	PASS
MYC	4609	broad.mit.edu	37	8	128753228	128753228	+	3'UTR	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128753228T>G	uc003ysi.2	+	3						NM_002467	NP_002458	P01106	MYC_HUMAN	myc proto-oncogene protein						branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)		AAACGATTCCTTCTAACAGAA	0.413		3	A|T	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@	Burkitt lymphoma| amplified in other cancers|B-CLL								23	50	---	---	---	---	PASS
FLJ43860	389690	broad.mit.edu	37	8	142445230	142445230	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142445230G>C	uc003ywi.2	-	29	3756	c.3675C>G	c.(3673-3675)TGC>TGG	p.C1225W	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	1225							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CTCTCACCAGGCAGGTCCAGA	0.682													5	24	---	---	---	---	PASS
TOP1MT	116447	broad.mit.edu	37	8	144411529	144411529	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144411529G>A	uc003yxz.2	-	3	370	c.351C>T	c.(349-351)GAC>GAT	p.D117D	TOP1MT_uc011lkd.1_Silent_p.D19D|TOP1MT_uc011lke.1_Silent_p.D19D|TOP1MT_uc010mfb.2_Silent_p.D19D|TOP1MT_uc010mfd.1_5'UTR	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor	117					DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	CCTTTCGCCAGTCATTGAAGA	0.567													45	151	---	---	---	---	PASS
SCRIB	23513	broad.mit.edu	37	8	144874929	144874929	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144874929G>A	uc003yzp.1	-	30	4133	c.4126C>T	c.(4126-4128)CGC>TGC	p.R1376C	SCRIB_uc003yzn.1_Missense_Mutation_p.R85C|SCRIB_uc003yzo.1_Missense_Mutation_p.R1376C	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	1376					activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			AGGGACACGCGCTTAGGGGGG	0.697													4	15	---	---	---	---	PASS
ACO1	48	broad.mit.edu	37	9	32425989	32425989	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32425989G>C	uc003zqw.3	+	11	1497	c.1342G>C	c.(1342-1344)GGG>CGG	p.G448R	ACO1_uc010mjh.1_Missense_Mutation_p.G282R|ACO1_uc003zqx.3_Missense_Mutation_p.G448R|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	448					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TGTGATGTTAGGGGCAGGTAA	0.483													32	82	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385532	33385532	+	Intron	SNP	T	C	C	rs115950431	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385532T>C	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CTCCCCAGGCTACCTGGGGGC	0.592													3	41	---	---	---	---	PASS
SMC2	10592	broad.mit.edu	37	9	106889660	106889660	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106889660G>A	uc004bbv.2	+	20	2977	c.2689G>A	c.(2689-2691)GCA>ACA	p.A897T	SMC2_uc004bbw.2_Missense_Mutation_p.A897T|SMC2_uc011lvl.1_Missense_Mutation_p.A897T|SMC2_uc004bbx.2_Missense_Mutation_p.A897T|SMC2_uc004bby.2_RNA	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	897	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						TGCAGAAGTGGCAAAACACAA	0.388													4	184	---	---	---	---	PASS
C9orf84	158401	broad.mit.edu	37	9	114518734	114518734	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114518734C>A	uc004bfr.2	-	6	676	c.541G>T	c.(541-543)GAA>TAA	p.E181*	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfs.1_Nonsense_Mutation_p.E245*|C9orf84_uc004bfq.2_Nonsense_Mutation_p.E142*|C9orf84_uc010mug.2_Nonsense_Mutation_p.E127*	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	181										ovary(2)	2						ATTAAGAATTCATACTCAATA	0.313													45	94	---	---	---	---	PASS
POLE3	54107	broad.mit.edu	37	9	116171064	116171064	+	3'UTR	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116171064C>T	uc011lxg.1	-	4					POLE3_uc004bhn.2_3'UTR|C9orf43_uc004bho.3_5'Flank|C9orf43_uc004bhp.2_5'Flank	NM_017443	NP_059139	Q9NRF9	DPOE3_HUMAN	DNA-directed DNA polymerase epsilon 3						DNA replication|histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex	DNA-directed DNA polymerase activity|protein binding|sequence-specific DNA binding				0						GTGGTACCTTCCAAGGTGCCA	0.318													42	81	---	---	---	---	PASS
OR1B1	347169	broad.mit.edu	37	9	125391234	125391234	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125391234G>A	uc011lyz.1	-	1	581	c.581C>T	c.(580-582)TCT>TTT	p.S194F		NM_001004450	NP_001004450	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GTCAGAACAAGAGGCTCGCAG	0.527													15	31	---	---	---	---	PASS
FPGS	2356	broad.mit.edu	37	9	130575544	130575544	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130575544C>G	uc004bsg.1	+	15	1475	c.1425C>G	c.(1423-1425)AAC>AAG	p.N475K	FPGS_uc004bsh.1_Missense_Mutation_p.N292K|FPGS_uc011mal.1_Missense_Mutation_p.N449K|FPGS_uc004bsi.1_Missense_Mutation_p.N425K|uc004bsl.1_5'Flank	NM_004957	NP_004948	Q05932	FOLC_HUMAN	folylpolyglutamate synthase isoform a precursor	475					folic acid metabolic process|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|one-carbon metabolic process	cytosol|mitochondrial matrix	ATP binding|tetrahydrofolylpolyglutamate synthase activity				0					L-Glutamic Acid(DB00142)	AGCACTGGAACCACCTGGACG	0.652													25	53	---	---	---	---	PASS
TOR1A	1861	broad.mit.edu	37	9	132584984	132584984	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132584984C>T	uc004byl.2	-	2	397	c.320G>A	c.(319-321)GGC>GAC	p.G107D	TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Missense_Mutation_p.G107D	NM_000113	NP_000104	O14656	TOR1A_HUMAN	torsin A precursor	107	ATP.				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)				GAAATTTTTGCCGGTGCCTGT	0.468													7	478	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133914405	133914405	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133914405G>A	uc004caa.1	+	5	1229	c.1131G>A	c.(1129-1131)CGG>CGA	p.R377R		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	377	Laminin EGF-like 2.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GGGACCCGCGGATGCCATGCC	0.647													16	34	---	---	---	---	PASS
C9orf98	158067	broad.mit.edu	37	9	135702270	135702270	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135702270T>G	uc004cbu.1	-	8	1284	c.728A>C	c.(727-729)GAC>GCC	p.D243A	C9orf98_uc010mzx.1_RNA|C9orf98_uc004cbv.1_Missense_Mutation_p.D39A	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98	243						cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		ACATGGCTGGTCAGCACTGAT	0.557													15	154	---	---	---	---	PASS
ADAMTS13	11093	broad.mit.edu	37	9	136290722	136290722	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136290722C>T	uc004cdv.3	+	4	848	c.404C>T	c.(403-405)ACA>ATA	p.T135I	ADAMTS13_uc004cdp.3_5'UTR|ADAMTS13_uc004cdt.1_Missense_Mutation_p.T135I|ADAMTS13_uc004cdu.1_Missense_Mutation_p.T135I|ADAMTS13_uc004cdw.3_Missense_Mutation_p.T135I|ADAMTS13_uc004cdx.3_Missense_Mutation_p.T135I|ADAMTS13_uc004cdq.1_Missense_Mutation_p.T135I|ADAMTS13_uc004cds.1_5'UTR|ADAMTS13_uc004cdr.1_RNA	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	135	Peptidase M12B.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GTCATTCTGACAGAGCCTGAG	0.572													14	47	---	---	---	---	PASS
IDI2	91734	broad.mit.edu	37	10	1066837	1066837	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1066837C>G	uc001ifv.1	-	4	301	c.236G>C	c.(235-237)GGG>GCG	p.G79A	C10orf110_uc010qaf.1_5'Flank|C10orf110_uc001ifx.3_5'Flank|C10orf110_uc001ifw.3_5'Flank|C10orf110_uc001ify.3_5'Flank	NM_033261	NP_150286	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	79	Nudix hydrolase.				carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		GGTAAAATACCCTGGAAAAAA	0.443													35	74	---	---	---	---	PASS
C10orf18	54906	broad.mit.edu	37	10	5789535	5789535	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5789535T>G	uc001iij.2	+	15	4776	c.4151T>G	c.(4150-4152)ATT>AGT	p.I1384S	C10orf18_uc001iik.2_Missense_Mutation_p.I228S	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	1384										ovary(1)|central_nervous_system(1)	2						GCAGAGGAAATTAATGTGACC	0.378													6	235	---	---	---	---	PASS
TACR2	6865	broad.mit.edu	37	10	71166878	71166878	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71166878G>A	uc001jpn.2	-	4	1495	c.900C>T	c.(898-900)ACC>ACT	p.T300T	TACR2_uc001jpm.2_Silent_p.T88T	NM_001057	NP_001048	P21452	NK2R_HUMAN	tachykinin receptor 2	300	Helical; Name=7; (Potential).				excretion|muscle contraction	integral to plasma membrane	tachykinin receptor activity			prostate(1)	1					Clonidine(DB00575)|Octreotide(DB00104)	GATTGTACATGGTAGAGCTCA	0.587													48	119	---	---	---	---	PASS
IDE	3416	broad.mit.edu	37	10	94297189	94297189	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94297189T>A	uc001kia.2	-	2	293	c.217A>T	c.(217-219)ATC>TTC	p.I73F		NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor	73					beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGTACTTTGATACCATTGGCC	0.403													69	176	---	---	---	---	PASS
ZDHHC16	84287	broad.mit.edu	37	10	99213291	99213291	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99213291G>T	uc001knj.2	+	7	910	c.561G>T	c.(559-561)TGG>TGT	p.W187C	ZDHHC16_uc001knp.2_Intron|ZDHHC16_uc001knk.2_Missense_Mutation_p.W187C|ZDHHC16_uc001knl.2_Missense_Mutation_p.W187C|ZDHHC16_uc001knm.2_Missense_Mutation_p.W122C|ZDHHC16_uc001knn.2_Intron|ZDHHC16_uc010qow.1_Missense_Mutation_p.W187C|ZDHHC16_uc009xvq.2_RNA|ZDHHC16_uc001kno.2_Missense_Mutation_p.W187C|ZDHHC16_uc009xvr.2_Missense_Mutation_p.W187C	NM_198046	NP_932163	Q969W1	ZDH16_HUMAN	Abl-philin 2 isoform 1	187	Cytoplasmic (Potential).|DHHC-type.				apoptosis	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		AACCAGCCTGGCTAAACAATT	0.478													76	256	---	---	---	---	PASS
ZDHHC16	84287	broad.mit.edu	37	10	99213292	99213292	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99213292C>A	uc001knj.2	+	7	911	c.562C>A	c.(562-564)CTA>ATA	p.L188I	ZDHHC16_uc001knp.2_Intron|ZDHHC16_uc001knk.2_Missense_Mutation_p.L188I|ZDHHC16_uc001knl.2_Missense_Mutation_p.L188I|ZDHHC16_uc001knm.2_Missense_Mutation_p.L123I|ZDHHC16_uc001knn.2_Intron|ZDHHC16_uc010qow.1_Missense_Mutation_p.L188I|ZDHHC16_uc009xvq.2_RNA|ZDHHC16_uc001kno.2_Missense_Mutation_p.L188I|ZDHHC16_uc009xvr.2_Missense_Mutation_p.L188I	NM_198046	NP_932163	Q969W1	ZDH16_HUMAN	Abl-philin 2 isoform 1	188	Cytoplasmic (Potential).|DHHC-type.				apoptosis	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		ACCAGCCTGGCTAAACAATTG	0.478													74	258	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100221509	100221509	+	Intron	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100221509T>G	uc001kpn.1	-						HPSE2_uc009xwc.1_3'UTR|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GTGCAAACCTTTCTTCTGAAG	0.259													3	19	---	---	---	---	PASS
HPS6	79803	broad.mit.edu	37	10	103827518	103827518	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103827518G>T	uc001kuj.2	+	1	2372	c.2287G>T	c.(2287-2289)GAC>TAC	p.D763Y		NM_024747	NP_079023	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome-6	763						cytosol|early endosome membrane|endoplasmic reticulum|microsome					0		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		CATCCTATGGGACCCCAGCAC	0.607									Hermansky-Pudlak_syndrome				31	108	---	---	---	---	PASS
EPS8L2	64787	broad.mit.edu	37	11	710481	710481	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:710481G>C	uc001lqt.2	+	4	407	c.160G>C	c.(160-162)GTC>CTC	p.V54L	EPS8L2_uc010qwj.1_Missense_Mutation_p.V54L|EPS8L2_uc001lqu.2_Missense_Mutation_p.V54L|EPS8L2_uc010qwk.1_Missense_Mutation_p.V54L|EPS8L2_uc001lqv.2_Missense_Mutation_p.V9L	NM_022772	NP_073609	Q9H6S3	ES8L2_HUMAN	epidermal growth factor receptor pathway	54	PID.					cytoplasm				pancreas(1)	1		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGTACCACGTCCAGGTAAG	0.542													27	125	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1017614	1017614	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017614G>A	uc001lsw.2	-	31	5238	c.5187C>T	c.(5185-5187)ACC>ACT	p.T1729T		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1729	Thr-rich.|1; truncated.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCCCACTGGTGGTCACTGTCA	0.537													80	487	---	---	---	---	PASS
OR51A2	401667	broad.mit.edu	37	11	4976107	4976107	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4976107A>C	uc010qyt.1	-	1	837	c.837T>G	c.(835-837)AAT>AAG	p.N279K		NM_001004748	NP_001004748	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A,	279	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTAGGAGAACATTTGCCATGA	0.438													73	93	---	---	---	---	PASS
HBG2	3048	broad.mit.edu	37	11	5274476	5274476	+	Intron	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5274476C>A	uc001mai.1	-						HBG2_uc001maj.1_3'UTR	NM_000559	NP_000550	P69892	HBG2_HUMAN	A-gamma globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAAAGCCTATCCTTGAAAGCT	0.428													38	89	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46880363	46880363	+	3'UTR	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46880363A>G	uc001ndn.3	-	38					uc001ndl.2_Intron|LRP4_uc001ndm.3_3'UTR	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein						endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		GTGCACAGGTAGTTATGGACT	0.522													6	5	---	---	---	---	PASS
OR10Q1	219960	broad.mit.edu	37	11	57995449	57995449	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57995449T>G	uc010rkd.1	-	1	899	c.899A>C	c.(898-900)AAG>ACG	p.K300T		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				TTTGACATCCTTGTTCCTAAG	0.542													9	341	---	---	---	---	PASS
TMEM179B	374395	broad.mit.edu	37	11	62557433	62557433	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62557433A>G	uc001nvd.3	+	5	604	c.574A>G	c.(574-576)ACC>GCC	p.T192A		NM_199337	NP_955369	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	192						integral to membrane					0						GTCTGAAGCCACCCCATACCG	0.552													73	189	---	---	---	---	PASS
B3GNT6	192134	broad.mit.edu	37	11	76751055	76751055	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76751055C>T	uc001oxw.2	+	2	548	c.460C>T	c.(460-462)CTC>TTC	p.L154F		NM_138706	NP_619651	Q6ZMB0	B3GN6_HUMAN	UDP-GlcNAc:betaGal	154	Lumenal (Potential).				O-glycan processing, core 3	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity|galactosyltransferase activity				0						AGTGCGCCGCCTCTTTCTATT	0.746													6	11	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118352713	118352713	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118352713G>A	uc001pta.2	+	7	3941	c.3918G>A	c.(3916-3918)CCG>CCA	p.P1306P	MLL_uc001ptb.2_Silent_p.P1306P|MLL_uc001pte.1_RNA|MLL_uc009zab.1_Missense_Mutation_p.R32H	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1306					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TGGTCATCCCGCCTCAGCCAC	0.562			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								28	38	---	---	---	---	PASS
OR8G2	26492	broad.mit.edu	37	11	124095984	124095984	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124095984C>T	uc010saf.1	+	1	587	c.587C>T	c.(586-588)CCT>CTT	p.P196L		NM_001007249	NP_001007250	Q15614	OR8G2_HUMAN	olfactory receptor, family 8, subfamily G,	196						integral to membrane	olfactory receptor activity				0		Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.91e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GATCTCTTCCCTCTCTTGGGG	0.428													140	347	---	---	---	---	PASS
LPCAT3	10162	broad.mit.edu	37	12	7086391	7086391	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7086391A>T	uc001qsi.2	-	12	1495	c.1381T>A	c.(1381-1383)TTC>ATC	p.F461I	EMG1_uc010sfv.1_Intron|LPCAT3_uc010sfw.1_Missense_Mutation_p.F355I|LPCAT3_uc009zfp.2_RNA	NM_005768	NP_005759	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	461	Helical; (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity			ovary(1)	1						CTCAGGAAGAAGATGTGGCCA	0.433													40	89	---	---	---	---	PASS
CLEC12A	160364	broad.mit.edu	37	12	10132016	10132016	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10132016T>C	uc001qwr.3	+	3	460	c.272T>C	c.(271-273)CTA>CCA	p.L91P	CLEC12A_uc001qwq.2_Missense_Mutation_p.L101P|CLEC12A_uc001qws.3_Missense_Mutation_p.L58P|CLEC12A_uc001qwt.2_Missense_Mutation_p.L20P	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor	91	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity|sugar binding			skin(1)	1						AATATTTCTCTACAACTGATG	0.348													22	50	---	---	---	---	PASS
CLEC12A	160364	broad.mit.edu	37	12	10132045	10132045	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10132045A>T	uc001qwr.3	+	3	489	c.301A>T	c.(301-303)AAC>TAC	p.N101Y	CLEC12A_uc001qwq.2_Missense_Mutation_p.N111Y|CLEC12A_uc001qws.3_Missense_Mutation_p.N68Y|CLEC12A_uc001qwt.2_Missense_Mutation_p.N30Y	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor	101	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity|sugar binding			skin(1)	1						GAATATCTCCAACAAGATCAG	0.358													24	57	---	---	---	---	PASS
H3F3C	440093	broad.mit.edu	37	12	31944927	31944927	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31944927G>A	uc001rkr.2	-	1	249	c.174C>T	c.(172-174)ACC>ACT	p.T58T		NM_001013699	NP_001013721	Q6NXT2	H3C_HUMAN	histone H3-like	58					nucleosome assembly	nucleosome|nucleus	DNA binding				0						TGAGCAGCTCGGTCGACTTCT	0.607										HNSCC(67;0.2)			48	96	---	---	---	---	PASS
YARS2	51067	broad.mit.edu	37	12	32908819	32908819	+	5'UTR	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32908819G>A	uc001rli.2	-	1						NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial						tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	CTTGGTAGCGGCACGAAGGGA	0.582											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	33	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40734203	40734203	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40734203G>A	uc001rmg.3	+	41	6177	c.6056G>A	c.(6055-6057)GGC>GAC	p.G2019D	LRRK2_uc009zjw.2_Missense_Mutation_p.G857D|LRRK2_uc001rmi.2_Missense_Mutation_p.G852D	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2019	Protein kinase.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCTGACTACGGCATTGCTCAG	0.453													5	295	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46322466	46322466	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46322466T>A	uc001rox.2	-	11	1305	c.1018A>T	c.(1018-1020)ATA>TTA	p.I340L	SFRS2IP_uc001row.2_Missense_Mutation_p.I25L|SFRS2IP_uc001roy.1_Missense_Mutation_p.I414L	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	340					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TTGTCTGATATTGGGGATCTC	0.458													66	157	---	---	---	---	PASS
LMBR1L	55716	broad.mit.edu	37	12	49496928	49496928	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49496928A>G	uc001rth.3	-	7	919	c.577T>C	c.(577-579)TAT>CAT	p.Y193H	LMBR1L_uc001rtg.3_Missense_Mutation_p.Y188H|LMBR1L_uc001rti.3_Missense_Mutation_p.Y193H|LMBR1L_uc001rtj.1_Missense_Mutation_p.Y37H|LMBR1L_uc009zld.1_Missense_Mutation_p.Y66H|LMBR1L_uc010smf.1_RNA	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor	193	Extracellular (Potential).				endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						TAGGGGAGATAGTACTCCCAA	0.527													26	66	---	---	---	---	PASS
SUOX	6821	broad.mit.edu	37	12	56396036	56396036	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56396036A>G	uc001six.2	+	4	357	c.31A>G	c.(31-33)AGG>GGG	p.R11G	SUOX_uc009zoh.2_Missense_Mutation_p.R11G|SUOX_uc001siy.2_Missense_Mutation_p.R11G|SUOX_uc001siz.2_Missense_Mutation_p.R11G|SUOX_uc001sja.2_Missense_Mutation_p.R11G	NM_000456	NP_000447	P51687	SUOX_HUMAN	sulfite oxidase precursor	11						mitochondrial intermembrane space	electron carrier activity|molybdenum ion binding|sulfite oxidase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			TGTGGTCCTCAGGCTCCAACA	0.542													23	73	---	---	---	---	PASS
SRGAP1	57522	broad.mit.edu	37	12	64377712	64377712	+	Intron	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64377712C>T	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron|SRGAP1_uc001srv.2_5'UTR	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CCATTGGCTTCTCTTCTCTCC	0.348													11	58	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72956769	72956769	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72956769T>A	uc001sxa.2	+	9	1886	c.1856T>A	c.(1855-1857)TTT>TAT	p.F619Y		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	619	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						CAACAGCATTTTATCTATGAT	0.318													100	268	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102067221	102067221	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102067221A>T	uc001tii.2	+	24	2711	c.2609A>T	c.(2608-2610)GAA>GTA	p.E870V	MYBPC1_uc001tig.2_Missense_Mutation_p.E877V|MYBPC1_uc010svq.1_Missense_Mutation_p.E839V|MYBPC1_uc001tih.2_Missense_Mutation_p.E877V|MYBPC1_uc001tij.2_Missense_Mutation_p.E852V|MYBPC1_uc010svr.1_Missense_Mutation_p.E852V|MYBPC1_uc010svs.1_Missense_Mutation_p.E870V|MYBPC1_uc010svt.1_Missense_Mutation_p.E840V|MYBPC1_uc010svu.1_Missense_Mutation_p.E833V|MYBPC1_uc001tik.2_Missense_Mutation_p.E826V|MYBPC1_uc001til.2_5'UTR|MYBPC1_uc001tim.2_5'UTR	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	870	Ig-like C2-type 6.				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						CCAAGACCAGAATTAACTTGG	0.358													94	207	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112167663	112167663	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112167663G>T	uc001tsq.2	+	10	1497	c.1297G>T	c.(1297-1299)GAA>TAA	p.E433*	ACAD10_uc001tsp.2_Nonsense_Mutation_p.E433*|ACAD10_uc009zvx.2_Nonsense_Mutation_p.E464*|ACAD10_uc001tss.1_RNA	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	433							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						TCGAGCTTCCGAAACTAGCAC	0.542													24	49	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113285641	113285641	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113285641G>A	uc010syl.1	+	5	586	c.224G>A	c.(223-225)CGA>CAA	p.R75Q	RPH3A_uc001ttz.2_Missense_Mutation_p.R75Q|RPH3A_uc001tty.2_Missense_Mutation_p.R71Q|RPH3A_uc009zwe.1_Missense_Mutation_p.R71Q|RPH3A_uc010sym.1_Intron	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	75	RabBD.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GAGCAGGAGCGAATCGGGTGA	0.562													25	61	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122826194	122826194	+	Silent	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122826194T>G	uc001ucg.1	-	10	1663	c.1557A>C	c.(1555-1557)CTA>CTC	p.L519L	CLIP1_uc001uch.1_Silent_p.L508L|CLIP1_uc001uci.1_Silent_p.L473L|CLIP1_uc001ucj.1_Silent_p.L209L|CLIP1_uc009zxo.1_Silent_p.L75L	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	519	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTCTCAATGCTAGGTCTTTCT	0.408													80	242	---	---	---	---	PASS
FAM101A	144347	broad.mit.edu	37	12	124798830	124798830	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124798830C>T	uc001ugd.1	+	3	410	c.167C>T	c.(166-168)ACC>ATC	p.T56I	FAM101A_uc001uge.1_Missense_Mutation_p.T56I	NM_181709	NP_859060	Q6ZTI6	F101A_HUMAN	hypothetical protein LOC144347	137											0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;2.38e-05)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-05)|all cancers(50;0.000361)|BRCA - Breast invasive adenocarcinoma(302;0.059)		TACAGCGAGACCATCGTGGCA	0.632													45	82	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23909182	23909182	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23909182G>T	uc001uon.2	-	10	9422	c.8833C>A	c.(8833-8835)CAG>AAG	p.Q2945K	SACS_uc001uoo.2_Missense_Mutation_p.Q2798K|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	2945					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GGGGTGTTCTGTAACACTGAT	0.348													96	179	---	---	---	---	PASS
TNFSF11	8600	broad.mit.edu	37	13	43175023	43175023	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43175023G>A	uc001uyu.2	+	4	587	c.438G>A	c.(436-438)ATG>ATA	p.M146I	TNFSF11_uc001uyt.2_Missense_Mutation_p.M73I	NM_003701	NP_003692	O14788	TNF11_HUMAN	tumor necrosis factor ligand superfamily, member	146	Extracellular (Potential).				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding				0		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)		CTCCAGCGATGGTGGATGGCT	0.453													4	227	---	---	---	---	PASS
HTR2A	3356	broad.mit.edu	37	13	47466612	47466612	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47466612C>T	uc001vbq.2	-	2	660	c.526G>A	c.(526-528)GCC>ACC	p.A176T	HTR2A_uc001vbr.2_Missense_Mutation_p.A76T|HTR2A_uc010acr.2_Missense_Mutation_p.A176T	NM_000621	NP_000612	P28223	5HT2A_HUMAN	5-hydroxytryptamine receptor 2A isoform 1	176	Cytoplasmic (By similarity).				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	TTCTGGATGGCGACGTAGCGG	0.527													11	458	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110835582	110835582	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110835582G>A	uc001vqw.3	-	27	2061	c.1939C>T	c.(1939-1941)CCC>TCC	p.P647S	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	647	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCTCCAGGGGGGCCTGGTAAA	0.537													24	80	---	---	---	---	PASS
TUBGCP3	10426	broad.mit.edu	37	13	113242269	113242269	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113242269G>A	uc001vse.1	-	1	213	c.26C>T	c.(25-27)CCG>CTG	p.P9L	TUBGCP3_uc010tjq.1_Missense_Mutation_p.P9L|TUBGCP3_uc001vsf.2_Missense_Mutation_p.P9L|TUBGCP3_uc001vsg.1_Missense_Mutation_p.P9L	NM_006322	NP_006313	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	9					G2/M transition of mitotic cell cycle|microtubule nucleation|single fertilization	centriole|cytosol|polar microtubule	gamma-tubulin binding|structural constituent of cytoskeleton			central_nervous_system(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CAGAACGTTCGGCGACTTCTG	0.736													6	15	---	---	---	---	PASS
RAB2B	84932	broad.mit.edu	37	14	21944786	21944786	+	Intron	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21944786C>T	uc010tlt.1	-						RAB2B_uc010tls.1_5'UTR|RAB2B_uc001wax.2_Intron|RAB2B_uc010ain.2_Intron|TOX4_uc001way.2_5'Flank|TOX4_uc001waz.2_5'Flank|TOX4_uc001wba.2_5'Flank|TOX4_uc010tlu.1_5'Flank	NM_032846	NP_116235	Q8WUD1	RAB2B_HUMAN	RAB2B protein isoform 1						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane|plasma membrane	GTP binding			ovary(1)	1	all_cancers(95;0.000858)		Epithelial(56;1.53e-06)|all cancers(55;1.44e-05)	GBM - Glioblastoma multiforme(265;0.00391)		CTCCCGGAATCACGCAGCCCT	0.458											OREG0022569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	87	---	---	---	---	PASS
DHRS4L2	317749	broad.mit.edu	37	14	24459472	24459472	+	Silent	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24459472C>T	uc001wli.3	+	2	340	c.210C>T	c.(208-210)GAC>GAT	p.D70D	DHRS4_uc001wlc.3_Intron|DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron|DHRS4L2_uc001wlg.3_RNA|DHRS4L2_uc001wlh.3_RNA|DHRS4L2_uc010tnt.1_Silent_p.D68D	NM_198083	NP_932349	D5KJA1	D5KJA1_HUMAN	dehydrogenase/reductase (SDR family) member 4	42							binding|oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)		AGAATGTGGACCAGGCGGTGG	0.677													35	70	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52534720	52534720	+	Silent	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52534720G>C	uc001wzo.2	-	2	624	c.390C>G	c.(388-390)CCC>CCG	p.P130P	NID2_uc010tqs.1_Silent_p.P130P|NID2_uc010tqt.1_Silent_p.P130P|NID2_uc001wzp.2_Silent_p.P130P	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	130	NIDO.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					CCAGCACTGCGGGGGAGGTGT	0.682													16	51	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69354687	69354687	+	Intron	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69354687C>T	uc001xkl.2	-						ACTN1_uc001xkk.2_5'UTR|ACTN1_uc010ttb.1_Intron|ACTN1_uc001xkm.2_Intron|ACTN1_uc001xkn.2_Intron|ACTN1_uc010ttc.1_5'Flank|ACTN1_uc001xko.1_Intron|ACTN1_uc010ttd.1_Intron	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b						focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TTCACTGCTGCGTTTTTCGGC	0.478													7	17	---	---	---	---	PASS
PACS2	23241	broad.mit.edu	37	14	105843253	105843253	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105843253C>G	uc001yqt.2	+	9	1125	c.950C>G	c.(949-951)CCG>CGG	p.P317R	PACS2_uc001yqs.2_Missense_Mutation_p.P242R|PACS2_uc001yqv.2_Missense_Mutation_p.P317R|PACS2_uc001yqu.2_Missense_Mutation_p.P317R	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	317					apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		ACCCCCAAGCCGAAGCTGCGG	0.662													24	46	---	---	---	---	PASS
CCNDBP1	23582	broad.mit.edu	37	15	43482264	43482264	+	Silent	SNP	A	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43482264A>C	uc001zqv.2	+	5	574	c.343A>C	c.(343-345)AGA>CGA	p.R115R	CCNDBP1_uc001zqu.2_5'UTR|CCNDBP1_uc010bdc.2_Silent_p.R115R|CCNDBP1_uc010bdb.2_5'UTR|CCNDBP1_uc010udl.1_Intron|CCNDBP1_uc001zqw.2_RNA|CCNDBP1_uc001zqx.2_5'UTR|CCNDBP1_uc010bdd.2_5'UTR|CCNDBP1_uc001zqy.2_5'UTR	NM_012142	NP_036274	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1 isoform 1	115	Required for interaction with CCND1.|Interaction with RPLP0.|Interaction with TCF3.				cell cycle	cytoplasm|nucleus	protein binding			ovary(1)|kidney(1)	2		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		GATCACCCTGAGAAAGCTGGT	0.507													22	73	---	---	---	---	PASS
FGF7	2252	broad.mit.edu	37	15	49776572	49776572	+	Silent	SNP	A	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49776572A>C	uc001zxn.2	+	4	985	c.456A>C	c.(454-456)GCA>GCC	p.A152A	C15orf33_uc001zxl.2_Intron|C15orf33_uc001zxm.2_Intron	NM_002009	NP_002000	P21781	FGF7_HUMAN	fibroblast growth factor 7 precursor	152					actin cytoskeleton reorganization|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|mesenchymal cell proliferation|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization at cell surface|secretion by lung epithelial cell involved in lung growth		chemoattractant activity|growth factor activity				0		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)	Palifermin(DB00039)	ACACATATGCATCAGCTAAAT	0.338													4	131	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52521378	52521378	+	Silent	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52521378A>T	uc010bff.2	-	25	3296	c.3159T>A	c.(3157-3159)ACT>ACA	p.T1053T	MYO5C_uc010uga.1_RNA|MYO5C_uc010ugb.1_RNA	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	1053	Potential.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		AGCCATCAGAAGTGACGTGCT	0.517													60	156	---	---	---	---	PASS
LACTB	114294	broad.mit.edu	37	15	63419762	63419762	+	Silent	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63419762C>A	uc002alw.2	+	4	865	c.826C>A	c.(826-828)CGG>AGG	p.R276R	LACTB_uc002alv.2_Silent_p.R276R	NM_032857	NP_116246	P83111	LACTB_HUMAN	lactamase, beta isoform a	276						mitochondrion	hydrolase activity				0						AGCCAAATGCCGGAATTCAAA	0.303													38	71	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16149977	16149977	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16149977G>A	uc010bvi.2	+	12	1677	c.1502G>A	c.(1501-1503)CGG>CAG	p.R501Q	ABCC1_uc010bvj.2_Missense_Mutation_p.R501Q|ABCC1_uc010bvk.2_Missense_Mutation_p.R501Q|ABCC1_uc010bvl.2_Missense_Mutation_p.R501Q|ABCC1_uc010bvm.2_Missense_Mutation_p.R501Q|ABCC1_uc002del.3_Missense_Mutation_p.R385Q|ABCC1_uc010bvn.2_Missense_Mutation_p.R364Q	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	501	Cytoplasmic.|ABC transmembrane type-1 1.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	AAAGACAATCGGATCAAGCTG	0.522													33	95	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27777758	27777758	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27777758G>A	uc002dow.2	+	20	3962	c.3938G>A	c.(3937-3939)TGG>TAG	p.W1313*		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	1313										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						CTGCGCTTCTGGAACTACAAT	0.597													3	87	---	---	---	---	PASS
EDC4	23644	broad.mit.edu	37	16	67912713	67912713	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67912713T>C	uc002eur.2	+	11	1424	c.1258T>C	c.(1258-1260)TAC>CAC	p.Y420H	EDC4_uc010cer.2_Missense_Mutation_p.Y39H|EDC4_uc010vkg.1_Missense_Mutation_p.Y352H|EDC4_uc010ces.1_Missense_Mutation_p.Y263H|EDC4_uc002eus.2_Missense_Mutation_p.Y150H	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	420					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CTCAGCAGAATACCTGATTCT	0.557													119	253	---	---	---	---	PASS
CHST4	10164	broad.mit.edu	37	16	71570821	71570821	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71570821A>G	uc002fan.2	+	2	422	c.241A>G	c.(241-243)ACC>GCC	p.T81A	CHST4_uc002fao.2_Missense_Mutation_p.T81A	NM_005769	NP_005760	Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	81	Lumenal (Potential).				cell-cell signaling|immune response|inflammatory response|N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity				0						CGTGTGGATGACCTTCAAGCA	0.567													3	132	---	---	---	---	PASS
KCNG4	93107	broad.mit.edu	37	16	84255876	84255876	+	Missense_Mutation	SNP	C	A	A	rs145735728		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84255876C>A	uc010voc.1	-	3	1628	c.1507G>T	c.(1507-1509)GAT>TAT	p.D503Y		NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	503	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3						TCATTGACATCGTTCATGAGC	0.567													5	418	---	---	---	---	PASS
WDR81	124997	broad.mit.edu	37	17	1634217	1634217	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1634217A>T	uc002fti.2	+	3	524	c.263A>T	c.(262-264)TAC>TTC	p.Y88F	WDR81_uc002fth.2_Missense_Mutation_p.Y264F|WDR81_uc010vqp.1_Missense_Mutation_p.Y112F|WDR81_uc002ftj.2_Missense_Mutation_p.Y1315F|WDR81_uc010vqq.1_Missense_Mutation_p.T10S	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN	WD repeat domain 81 isoform 4	88										skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		ACCTACCAGTACCTGCCCTAC	0.667													24	68	---	---	---	---	PASS
TRAPPC1	58485	broad.mit.edu	37	17	7835215	7835215	+	5'UTR	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7835215C>T	uc002gjo.1	-	1					KCNAB3_uc002gjm.1_5'Flank|KCNAB3_uc010vul.1_5'Flank|CNTROB_uc002gjp.2_5'Flank|CNTROB_uc002gjq.2_5'Flank|CNTROB_uc002gjr.2_5'Flank	NM_021210	NP_067033	Q9Y5R8	TPPC1_HUMAN	trafficking protein particle complex 1						ER to Golgi vesicle-mediated transport	endoplasmic reticulum					0		Prostate(122;0.173)				GTTCCCGGACCCACAGCCTTC	0.662													10	33	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10395790	10395790	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10395790G>A	uc002gmo.2	-	40	5857	c.5763C>T	c.(5761-5763)GTC>GTT	p.V1921V	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1921	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TCAGCTTGTTGACCTGGGACT	0.488													6	404	---	---	---	---	PASS
AKAP10	11216	broad.mit.edu	37	17	19809465	19809465	+	3'UTR	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19809465T>G	uc002gwo.2	-	15						NM_007202	NP_009133	O43572	AKA10_HUMAN	A-kinase anchor protein 10 precursor						blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					TCATTGGCTGTGTTGAAGAAT	0.363													10	16	---	---	---	---	PASS
MSL1	339287	broad.mit.edu	37	17	38285875	38285875	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38285875T>A	uc002hub.2	+	3	786	c.767T>A	c.(766-768)GTA>GAA	p.V256E	MSL1_uc002hua.3_Missense_Mutation_p.V194E|MSL1_uc002huc.2_Missense_Mutation_p.V194E|MSL1_uc002hud.2_5'Flank	NM_001012241	NP_001012241	Q68DK7	MSL1_HUMAN	hampin	457					histone H4-K16 acetylation	MSL complex					0						GAGGAGACTGTAGCAAGTAAG	0.463													9	13	---	---	---	---	PASS
KRTAP4-2	85291	broad.mit.edu	37	17	39334273	39334273	+	Silent	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39334273C>G	uc002hwd.2	-	1	188	c.144G>C	c.(142-144)CCG>CCC	p.P48P		NM_033062	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	48	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].|7.					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GGCAGCACTGCGGTCTGCAGC	0.672													4	61	---	---	---	---	PASS
HSF5	124535	broad.mit.edu	37	17	56499634	56499634	+	3'UTR	SNP	T	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56499634T>C	uc002iwi.1	-	6						NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTAACAGAACTGAAAAAATCC	0.348													13	40	---	---	---	---	PASS
FN3K	64122	broad.mit.edu	37	17	80708644	80708644	+	3'UTR	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80708644T>G	uc010wvs.1	+	6					TBCD_uc002kfx.1_5'Flank|TBCD_uc002kfy.1_5'Flank|TBCD_uc002kfz.2_5'Flank	NM_022158	NP_071441	Q9H479	FN3K_HUMAN	fructosamine 3 kinase						fructoselysine metabolic process		fructosamine-3-kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GCCCCTGccctcccttcccct	0.289													21	52	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40854078	40854078	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40854078G>T	uc002law.2	-	2	685	c.316C>A	c.(316-318)CCC>ACC	p.P106T	SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Missense_Mutation_p.P88T|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	106	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						TTGGTTTTGGGAAAATTGCCA	0.418													5	273	---	---	---	---	PASS
SH2D3A	10045	broad.mit.edu	37	19	6754947	6754947	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6754947G>A	uc002mft.2	-	5	1070	c.876C>T	c.(874-876)CCC>CCT	p.P292P	SH2D3A_uc010xjg.1_Silent_p.P170P	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	292					JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						GCCGATTCTGGGGGCCCAGCA	0.592													30	403	---	---	---	---	PASS
ZNF317	57693	broad.mit.edu	37	19	9270970	9270970	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9270970G>T	uc002mku.2	+	7	924	c.649G>T	c.(649-651)GAC>TAC	p.D217Y	ZNF317_uc002mkv.2_Missense_Mutation_p.D76Y|ZNF317_uc002mkw.2_Missense_Mutation_p.D185Y|ZNF317_uc002mkx.2_Missense_Mutation_p.D132Y|ZNF317_uc002mky.2_Missense_Mutation_p.D100Y	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	217					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGCATGTACGACGGGAGAAA	0.582													4	79	---	---	---	---	PASS
ZNF561	93134	broad.mit.edu	37	19	9724746	9724746	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9724746G>A	uc002mlu.2	-	5	480	c.275C>T	c.(274-276)TCA>TTA	p.S92L	ZNF561_uc010dwu.2_Missense_Mutation_p.S23L|ZNF561_uc010xkr.1_Intron	NM_152289	NP_689502	Q8N587	ZN561_HUMAN	zinc finger protein 561	92	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTGCTGAAGTGATGACCGTTT	0.318													77	215	---	---	---	---	PASS
NFIX	4784	broad.mit.edu	37	19	13192531	13192531	+	Silent	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13192531C>T	uc010xmx.1	+	8	1193	c.1140C>T	c.(1138-1140)CCC>CCT	p.P380P	NFIX_uc002mwd.2_Silent_p.P372P|NFIX_uc002mwe.2_Silent_p.P364P|NFIX_uc002mwf.2_Silent_p.P334P|NFIX_uc002mwg.1_Silent_p.P371P			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;	372					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			TGCACTTCCCCTCCACGTCCA	0.637													25	55	---	---	---	---	PASS
MAP1S	55201	broad.mit.edu	37	19	17838751	17838751	+	Missense_Mutation	SNP	C	A	A	rs138807804		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17838751C>A	uc002nhe.1	+	5	2567	c.2558C>A	c.(2557-2559)GCA>GAA	p.A853E	MAP1S_uc010eba.1_Intron|MAP1S_uc002nhf.1_Missense_Mutation_p.A101E|MAP1S_uc010xpv.1_Missense_Mutation_p.A827E	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	853	Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for association with microtubules.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						CCCAAGACAGCACGGCAAACG	0.677													3	29	---	---	---	---	PASS
ZNF492	57615	broad.mit.edu	37	19	22847963	22847963	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22847963A>T	uc002nqw.3	+	4	1736	c.1492A>T	c.(1492-1494)ATT>TTT	p.I498F		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	498	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				ACATAAGATGATTCATACTGG	0.353													21	44	---	---	---	---	PASS
SPHK2	56848	broad.mit.edu	37	19	49133100	49133100	+	3'UTR	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49133100G>A	uc002pjr.2	+	7					SPHK2_uc010xzt.1_3'UTR|SPHK2_uc002pjs.2_3'UTR|SPHK2_uc002pjt.2_3'UTR|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.2_3'UTR|SPHK2_uc002pjw.2_Intron	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		GAGCTAGGGGGTGTGGCCTGG	0.667													3	7	---	---	---	---	PASS
IZUMO1	284359	broad.mit.edu	37	19	49245205	49245205	+	Intron	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49245205C>A	uc002pkj.2	-						RASIP1_uc002pki.2_5'Flank|IZUMO1_uc010eme.2_RNA|IZUMO1_uc010emf.2_Intron	NM_182575	NP_872381	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1 precursor						fusion of sperm to egg plasma membrane	integral to membrane				ovary(1)	1		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CAAACCTAGACCCAAGCTCAA	0.597													42	113	---	---	---	---	PASS
VRK3	51231	broad.mit.edu	37	19	50512604	50512604	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50512604G>C	uc002prg.2	-	4	276	c.178C>G	c.(178-180)CCT>GCT	p.P60A	VRK3_uc002prh.1_Missense_Mutation_p.P60A|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Missense_Mutation_p.P60A|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_Intron|VRK3_uc002prk.1_Missense_Mutation_p.P60A|VRK3_uc010ent.1_5'UTR|VRK3_uc002prl.2_Missense_Mutation_p.P60A|VRK3_uc010ybn.1_Missense_Mutation_p.P60A	NM_016440	NP_057524	Q8IV63	VRK3_HUMAN	vaccinia related kinase 3 isoform 1	60	Nuclear localization signal.					nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		ACTTTCTTAGGAGAGGTTTCA	0.488													100	207	---	---	---	---	PASS
ZNF677	342926	broad.mit.edu	37	19	53740381	53740381	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53740381G>C	uc002qbf.1	-	5	1784	c.1599C>G	c.(1597-1599)CAC>CAG	p.H533Q	ZNF677_uc002qbg.1_Missense_Mutation_p.H533Q	NM_182609	NP_872415	Q86XU0	ZN677_HUMAN	zinc finger protein 677	533	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00352)		GTATTTTCTGGTGTCTAGTGA	0.318													49	128	---	---	---	---	PASS
ZNF530	348327	broad.mit.edu	37	19	58118566	58118566	+	Missense_Mutation	SNP	G	A	A	rs138050368	byFrequency	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58118566G>A	uc002qpk.2	+	3	1893	c.1673G>A	c.(1672-1674)CGC>CAC	p.R558H	ZNF547_uc002qpm.3_Intron|ZNF530_uc002qpl.2_RNA	NM_020880	NP_065931	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	558	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TCTTTTACCCGCAAAAATCAC	0.453													4	109	---	---	---	---	PASS
SCRT2	85508	broad.mit.edu	37	20	656174	656174	+	Silent	SNP	G	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:656174G>A	uc002wec.2	-	1	650	c.72C>T	c.(70-72)ACC>ACT	p.T24T	SRXN1_uc002web.2_RNA	NM_033129	NP_149120	Q9NQ03	SCRT2_HUMAN	scratch 2 protein	24					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGGGGTGGTAGGTGGGGGCCG	0.562													6	7	---	---	---	---	PASS
CPXM1	56265	broad.mit.edu	37	20	2775211	2775211	+	Silent	SNP	C	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2775211C>T	uc002wgu.2	-	13	1999	c.1935G>A	c.(1933-1935)GTG>GTA	p.V645V	CPXM1_uc010gas.2_Silent_p.V571V	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor	645					cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4						TAATCCCATCCACGGCAATGA	0.517													29	81	---	---	---	---	PASS
C20orf103	24141	broad.mit.edu	37	20	9510488	9510488	+	3'UTR	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9510488C>A	uc002wni.1	+	6					C20orf103_uc010zrc.1_3'UTR	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	chromosome 20 open reading frame 103 precursor							integral to membrane				upper_aerodigestive_tract(1)|lung(1)|breast(1)	3			COAD - Colon adenocarcinoma(9;0.194)			GCAGGCACCCCCTATTCCTGC	0.512													19	67	---	---	---	---	PASS
NKX2-2	4821	broad.mit.edu	37	20	21494259	21494259	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21494259C>G	uc002wsi.2	-	1	406	c.49G>C	c.(49-51)GAC>CAC	p.D17H		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	17					brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						TCCGGCAGGTCTAAGATGTCC	0.577													46	122	---	---	---	---	PASS
CPNE1	8904	broad.mit.edu	37	20	34219486	34219486	+	Silent	SNP	A	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34219486A>G	uc002xdf.2	-	10	1005	c.642T>C	c.(640-642)GAT>GAC	p.D214D	CPNE1_uc002xdc.2_5'Flank|CPNE1_uc010zvj.1_Silent_p.D219D|CPNE1_uc002xde.2_Silent_p.D190D|CPNE1_uc002xdg.2_Silent_p.D214D|CPNE1_uc010gfi.2_RNA|CPNE1_uc010gfj.2_RNA|CPNE1_uc002xdh.2_Silent_p.D214D|CPNE1_uc002xdi.2_Silent_p.D214D|CPNE1_uc002xdj.2_Silent_p.D214D|CPNE1_uc002xdk.2_Silent_p.D214D|CPNE1_uc002xdl.2_Silent_p.D214D|CPNE1_uc002xdm.2_Silent_p.D214D|CPNE1_uc010gfk.1_Silent_p.D214D	NM_152931	NP_690908	Q99829	CPNE1_HUMAN	copine I isoform a	214	C2 2.				lipid metabolic process|vesicle-mediated transport		calcium-dependent phospholipid binding|phosphatidylserine binding|transporter activity			upper_aerodigestive_tract(1)	1	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CACTGTCATAATCGGAGCATT	0.567													25	43	---	---	---	---	PASS
RPN2	6185	broad.mit.edu	37	20	35832332	35832332	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35832332C>G	uc002xgp.2	+	5	828	c.524C>G	c.(523-525)GCT>GGT	p.A175G	RPN2_uc002xgo.3_Missense_Mutation_p.A175G|RPN2_uc010gfw.2_Missense_Mutation_p.A18G|RPN2_uc002xgq.2_Missense_Mutation_p.A143G	NM_002951	NP_002942	P04844	RPN2_HUMAN	ribophorin II isoform 1 precursor	175	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TCCCAGCAGGCTGACCTGAGG	0.502													7	111	---	---	---	---	PASS
RPS21	6227	broad.mit.edu	37	20	60962388	60962388	+	5'UTR	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60962388C>A	uc002ycr.2	+	2					RPS21_uc002ycs.2_5'UTR|RPS21_uc002yct.2_5'UTR|RPS21_uc002ycu.2_5'UTR	NM_001024	NP_001015	P63220	RS21_HUMAN	ribosomal protein S21						endocrine pancreas development|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein N-terminus binding|structural constituent of ribosome				0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CGCAGCCCAGCCTCGAAATGC	0.647													4	6	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34925507	34925507	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34925507G>C	uc002yse.1	+	3	4019	c.3970G>C	c.(3970-3972)GAA>CAA	p.E1324Q	SON_uc002ysb.1_Missense_Mutation_p.E1324Q|SON_uc002ysc.2_Missense_Mutation_p.E1324Q|SON_uc002ysd.2_Missense_Mutation_p.E315Q|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Missense_Mutation_p.E315Q	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	1324					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						TGTTGCCTCAGAAGTATCTAC	0.502													37	100	---	---	---	---	PASS
SETD4	54093	broad.mit.edu	37	21	37418054	37418054	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37418054A>T	uc002yuw.1	-	5	1925	c.552T>A	c.(550-552)TTT>TTA	p.F184L	SETD4_uc002yux.1_Missense_Mutation_p.F160L|SETD4_uc002yuu.2_RNA|SETD4_uc002yuv.2_Missense_Mutation_p.F184L|SETD4_uc002yuy.2_Missense_Mutation_p.F184L|SETD4_uc002yuz.2_Missense_Mutation_p.F160L|SETD4_uc002yva.2_Missense_Mutation_p.F160L	NM_017438	NP_059134	Q9NVD3	SETD4_HUMAN	SET domain containing 4 isoform a	184	SET.									large_intestine(1)|ovary(1)	2						CAGCCTCCGCAAACAGAGGCT	0.542													35	87	---	---	---	---	PASS
SLC25A18	83733	broad.mit.edu	37	22	18073082	18073082	+	3'UTR	SNP	T	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18073082T>G	uc002zmp.1	+	11					SLC25A18_uc002zmq.1_3'UTR	NM_031481	NP_113669	Q9H1K4	GHC2_HUMAN	solute carrier							integral to membrane|mitochondrial inner membrane	binding|symporter activity				0				Lung(27;0.124)	L-Glutamic Acid(DB00142)	CAAGGGCAGGTGGGGCCACTC	0.542													8	45	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20861886	20861886	+	5'UTR	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20861886G>T	uc002zsp.2	+	1					MED15_uc002zsn.1_5'UTR|MED15_uc002zso.2_5'UTR|MED15_uc002zsq.2_5'UTR|MED15_uc010gso.2_5'UTR|MED15_uc002zsr.2_5'Flank|MED15_uc011ahs.1_5'Flank	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			ACGGCTTCCGGGTTTGGGCCT	0.672													7	7	---	---	---	---	PASS
CSF2RA	1438	broad.mit.edu	37	X	1422842	1422842	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1422842G>C	uc010nct.2	+	12	1295	c.973G>C	c.(973-975)GTG>CTG	p.V325L	CSF2RA_uc011mhb.1_Missense_Mutation_p.V325L|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Missense_Mutation_p.V325L|CSF2RA_uc004cpo.2_Missense_Mutation_p.V325L|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Missense_Mutation_p.V192L|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Missense_Mutation_p.V359L|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	325	Helical; (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CCTCGGCTCTGTGTACATTTA	0.463													236	436	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11204520	11204520	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11204520A>T	uc004cup.1	-	5	1982	c.1109T>A	c.(1108-1110)CTT>CAT	p.L370H	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.L370H|ARHGAP6_uc004cum.1_Missense_Mutation_p.L167H|ARHGAP6_uc004cun.1_Missense_Mutation_p.L190H|ARHGAP6_uc010neb.1_Missense_Mutation_p.L192H|ARHGAP6_uc011mif.1_Missense_Mutation_p.L167H	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	370					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						ATTGTCATCAAGATCGGTGAT	0.453													138	87	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41088595	41088595	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41088595C>A	uc004dfb.2	+	42	7784	c.7151C>A	c.(7150-7152)GCA>GAA	p.A2384E	USP9X_uc004dfc.2_Missense_Mutation_p.A2384E	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	2384					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						CAAAAAAGAGCATACCAGTGT	0.363													25	11	---	---	---	---	PASS
YIPF6	286451	broad.mit.edu	37	X	67742735	67742735	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67742735G>T	uc004dwy.2	+	6	591	c.568G>T	c.(568-570)GTG>TTG	p.V190L	YIPF6_uc011mph.1_Missense_Mutation_p.V147L	NM_173834	NP_776195	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	190	Helical; (Potential).					endoplasmic reticulum|integral to membrane					0						TGTGGTGATTGTGATGTTTGC	0.413													4	106	---	---	---	---	PASS
GPR50	9248	broad.mit.edu	37	X	150349182	150349182	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150349182C>A	uc010ntg.1	+	2	1262	c.1127C>A	c.(1126-1128)GCT>GAT	p.A376D	uc004fes.1_5'Flank	NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	376	Cytoplasmic (Potential).|Pro-rich.				cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					GATGCTGCAGCTGGCCACCCC	0.582													4	106	---	---	---	---	PASS
CHD5	26038	broad.mit.edu	37	1	6197142	6197144	+	Intron	DEL	GGA	-	-	rs71568642		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6197142_6197144delGGA	uc001amb.1	-						CHD5_uc001ama.1_Intron|CHD5_uc001amc.1_Intron|CHD5_uc009vlx.1_5'Flank	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AGGGTGGTGTGGAGGAGGAGAAG	0.438													4	2	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16894081	16894082	+	Intron	DEL	AG	-	-	rs35523431		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16894081_16894082delAG	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		acacacacacaGAGTGAGCTCA	0.347													3	5	---	---	---	---	
HSPG2	3339	broad.mit.edu	37	1	22161636	22161636	+	Intron	DEL	T	-	-	rs71569850		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22161636delT	uc001bfj.2	-						HSPG2_uc009vqd.2_Intron	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGTCCACttcttttttttttt	0.040													4	3	---	---	---	---	
MYCBP	26292	broad.mit.edu	37	1	39338699	39338700	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39338699_39338700delGC	uc001ccs.2	-	2	151_152	c.78_79delGC	c.(76-81)ACGCTGfs	p.T26fs	RRAGC_uc001ccr.2_5'UTR	NM_012333	NP_036465	Q99417	MYCBP_HUMAN	c-myc binding protein	26_27					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	mitochondrion|nucleus	protein binding|transcription coactivator activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)				CCCTTGGTCAGCGTGTCCAGCA	0.688													4	2	---	---	---	---	
ZMYND12	84217	broad.mit.edu	37	1	42905858	42905859	+	Intron	INS	-	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42905858_42905859insA	uc001chj.2	-						ZMYND12_uc010ojt.1_Intron	NM_032257	NP_115633	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12 isoform 1							intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				tttggaagagtaaaaaaaaaaa	0.079													7	4	---	---	---	---	
BTF3L4	91408	broad.mit.edu	37	1	52530737	52530738	+	Intron	DEL	TG	-	-	rs145083139		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52530737_52530738delTG	uc001ctk.2	+						BTF3L4_uc001ctl.2_Intron|BTF3L4_uc010onh.1_Intron|BTF3L4_uc001ctm.2_Intron	NM_152265	NP_689478	Q96K17	BT3L4_HUMAN	basic transcription factor 3-like 4 isoform 1											large_intestine(1)	1						TTTGAAGGACTGTGGCACTTTG	0.307													6	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58160968	58160971	+	Intron	DEL	GAAG	-	-	rs7553249		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58160968_58160971delGAAG	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						aagggagagagaaggaaagaaaga	0.005													4	2	---	---	---	---	
ODF2L	57489	broad.mit.edu	37	1	86850155	86850160	+	Intron	DEL	AAAAAT	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86850155_86850160delAAAAAT	uc001dll.1	-						ODF2L_uc001dlm.1_Intron|ODF2L_uc001dln.2_Intron|ODF2L_uc001dlo.2_Intron|ODF2L_uc001dlp.2_Intron|ODF2L_uc010osg.1_Intron|ODF2L_uc001dlq.1_Intron|ODF2L_uc009wcr.1_Intron	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform							centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)		TTTTGAGATGAAAAATAAAAATACAT	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	109646307	109646307	+	IGR	DEL	G	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109646307delG								SCARNA2 (3073 upstream) : C1orf194 (2267 downstream)																							TTGTTTGGttgtttttttttt	0.209													5	4	---	---	---	---	
DPT	1805	broad.mit.edu	37	1	168694453	168694454	+	Intron	INS	-	TTCCTTTCCT	TTCCTTTCCT	rs7365537	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168694453_168694454insTTCCTTTCCT	uc001gfp.2	-							NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor						cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					tttcctttccattcctttcctt	0.139													5	4	---	---	---	---	
ASTN1	460	broad.mit.edu	37	1	176833824	176833828	+	Intron	DEL	GTCAA	-	-	rs79858089		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176833824_176833828delGTCAA	uc001glc.2	-						ASTN1_uc001glb.1_Intron	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						AAAAATATCTGTCAAGCaaatgaat	0.156													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	186107204	186107204	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186107204delT	uc001grq.1	+						HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TAAAAAGATGTTATGGCCTCT	0.318													11	6	---	---	---	---	
LEFTY1	10637	broad.mit.edu	37	1	226075411	226075411	+	Intron	DEL	C	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226075411delC	uc001hpo.2	-						LEFTY1_uc010pvj.1_Intron|LEFTY1_uc009xej.1_3'UTR	NM_020997	NP_066277	O75610	LFTY1_HUMAN	left-right determination, factor B						cell growth|multicellular organismal development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					CCCCGCACCGCCCCCCCGCGT	0.751													8	6	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241850606	241850607	+	Intron	INS	-	A	A	rs67963688		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241850606_241850607insA	uc001hze.1	+						WDR64_uc001hzf.1_Intron			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			agactccatctaaaaaaaaaaa	0.139													5	3	---	---	---	---	
ZNF670	93474	broad.mit.edu	37	1	247202363	247202363	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247202363delT	uc001icd.1	-						ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990	Q9BS34	ZN670_HUMAN	zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			tctttctttcttttttttttt	0.144													4	2	---	---	---	---	
KIDINS220	57498	broad.mit.edu	37	2	8891387	8891387	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8891387delT	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron|KIDINS220_uc002qzb.2_5'Flank|KIDINS220_uc002qze.2_Intron	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CAGGAttttcttttttttttt	0.348													3	3	---	---	---	---	
FLJ40330	645784	broad.mit.edu	37	2	89104503	89104504	+	Intron	INS	-	C	C	rs149625899	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89104503_89104504insC	uc010fhg.2	+						FLJ40330_uc010fhh.2_Intron|FLJ40330_uc010fhi.1_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						gtagatttttttcagattttgg	0.074													4	2	---	---	---	---	
SLC16A14	151473	broad.mit.edu	37	2	230910577	230910577	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230910577delA	uc002vqd.1	-	4	1628	c.1265delT	c.(1264-1266)TTCfs	p.F422fs	FBXO36_uc010fxi.1_Intron|SLC16A14_uc002vqe.2_Frame_Shift_Del_p.F422fs|SLC16A14_uc002vqf.2_Frame_Shift_Del_p.F422fs	NM_152527	NP_689740	Q7RTX9	MOT14_HUMAN	solute carrier family 16 (monocarboxylic acid	422	Helical; (Potential).					integral to membrane|plasma membrane	symporter activity			ovary(4)|skin(2)	6		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CATTAGGGAGAAATAACCACT	0.498													67	29	---	---	---	---	
TTLL3	26140	broad.mit.edu	37	3	9859108	9859108	+	Intron	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9859108delA	uc003btg.2	+						ARPC4_uc003btc.1_Intron|TTLL3_uc003btd.3_Intron|TTLL3_uc003btf.3_Intron|TTLL3_uc010hco.1_Intron|TTLL3_uc003bth.3_Intron|TTLL3_uc011atj.1_Intron|TTLL3_uc003btj.3_5'Flank|TTLL3_uc003bti.3_5'Flank	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3						axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)					actccatctcaaaaaaaaaaa	0.219													4	2	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	51312866	51312866	+	Intron	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51312866delA	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ATCTACCCAGAAATATAGTTA	0.398													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	87543446	87543447	+	IGR	INS	-	ACGA	ACGA			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87543446_87543447insACGA								POU1F1 (217709 upstream) : HTR1F (488279 downstream)																							gagaagggaagatgaaggaagg	0.000													4	2	---	---	---	---	
GRAMD1C	54762	broad.mit.edu	37	3	113627861	113627861	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113627861delA	uc003eaq.3	+	9	922	c.846delA	c.(844-846)CCAfs	p.P282fs	GRAMD1C_uc011bil.1_RNA|GRAMD1C_uc011bim.1_RNA|GRAMD1C_uc003ear.2_Frame_Shift_Del_p.P115fs|GRAMD1C_uc003eas.2_Frame_Shift_Del_p.P77fs	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	282						integral to membrane				ovary(2)|skin(1)	3						GTCTCTTACCAACTTTGGAAA	0.363													97	42	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160958626	160958626	+	Intron	DEL	T	-	-	rs141601797		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160958626delT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			tcagccAGGATTTTTTTTTTT	0.134													6	3	---	---	---	---	
ZBBX	79740	broad.mit.edu	37	3	167086089	167086089	+	Intron	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167086089delA	uc003fep.2	-						ZBBX_uc011bpc.1_Intron|ZBBX_uc003feq.2_Intron	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2						TAAGTGGCACAAAAACAAAAA	0.294													4	3	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183465581	183465582	+	Intron	DEL	TT	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183465581_183465582delTT	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			tgtttgtttgttttgagacggg	0.158													73	38	---	---	---	---	
TMPRSS11D	9407	broad.mit.edu	37	4	68693342	68693342	+	Intron	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68693342delA	uc003hdq.2	-						LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc003hdp.2_Intron|TMPRSS11D_uc011caj.1_Intron	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D						proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						AAACTATTGGATCCACATCTC	0.343													14	8	---	---	---	---	
COL25A1	84570	broad.mit.edu	37	4	109765898	109765898	+	Intron	DEL	A	-	-	rs113033840		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109765898delA	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzd.2_Intron|COL25A1_uc003hzf.2_Intron	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TATGAGAATTAAAAAAAAAAA	0.313													5	3	---	---	---	---	
SMARCA5	8467	broad.mit.edu	37	4	144451591	144451591	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144451591delT	uc003ijg.2	+							NM_003601	NP_003592	O60264	SMCA5_HUMAN	SWI/SNF-related matrix-associated						CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding			skin(1)	1	all_hematologic(180;0.158)					TCTGAGTATATTTTTTGTTTG	0.294													127	62	---	---	---	---	
RXFP1	59350	broad.mit.edu	37	4	159494170	159494171	+	Intron	INS	-	T	T	rs149207993	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159494170_159494171insT	uc003ipz.2	+						RXFP1_uc010iqj.1_Intron|RXFP1_uc011cja.1_Intron|RXFP1_uc010iqo.2_Intron|RXFP1_uc011cjb.1_Intron|RXFP1_uc010iqk.2_Intron|RXFP1_uc011cjc.1_Intron|RXFP1_uc011cjd.1_Intron|RXFP1_uc010iql.2_Intron|RXFP1_uc011cje.1_Intron|RXFP1_uc010iqm.2_Intron|RXFP1_uc011cjf.1_Intron|RXFP1_uc010iqn.2_Intron	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		tcttgtttttgtttttttttga	0.109													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185899235	185899236	+	IGR	DEL	TA	-	-	rs10545309		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185899235_185899236delTA								ACSL1 (152020 upstream) : HELT (40759 downstream)																							tcacaaagtgtatatatatata	0.035													2	4	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13842159	13842160	+	Intron	INS	-	A	A	rs147371351	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13842159_13842160insA	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTCAAAACAATAAAAAAAAAAG	0.183									Kartagener_syndrome				3	3	---	---	---	---	
UGT3A1	133688	broad.mit.edu	37	5	35971566	35971567	+	Intron	DEL	AC	-	-	rs113160979		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35971566_35971567delAC	uc003jjv.1	-						UGT3A1_uc003jjw.1_Intron|UGT3A1_uc011coq.1_Intron|UGT3A1_uc011cor.1_Intron|UGT3A1_uc003jjy.1_Intron	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1							integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			acacacgcatacacacacacac	0.188													3	3	---	---	---	---	
C5orf33	133686	broad.mit.edu	37	5	36197929	36197930	+	Intron	INS	-	A	A	rs138853300	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36197929_36197930insA	uc003jkf.3	-						C5orf33_uc003jke.3_Intron|C5orf33_uc010iux.2_Intron|C5orf33_uc003jkg.3_Intron|C5orf33_uc011cov.1_Intron	NM_001085411	NP_001078880	Q4G0N4	NAKD1_HUMAN	hypothetical protein LOC133686 isoform 1								NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			aacacagtaacaaaaaacctta	0.005													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55028949	55028956	+	IGR	DEL	TCCTTCCT	-	-	rs7380931		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55028949_55028956delTCCTTCCT								SLC38A9 (20395 upstream) : DDX4 (4889 downstream)																							ttctctttcctccttccttccttccttc	0.000													5	5	---	---	---	---	
PLK2	10769	broad.mit.edu	37	5	57752926	57752927	+	Intron	INS	-	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57752926_57752927insT	uc003jrn.2	-							NM_006622	NP_006613	Q9NYY3	PLK2_HUMAN	polo-like kinase 2						positive regulation of I-kappaB kinase/NF-kappaB cascade		ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		AGCCCTGTGGAATATTAGAAAA	0.396													154	107	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	85703814	85703815	+	IGR	INS	-	AAGG	AAGG	rs149876942	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85703814_85703815insAAGG								NBPF22P (110452 upstream) : COX7C (209969 downstream)																							ggaaggaaggaaggaaggaagg	0.089													5	4	---	---	---	---	
ERAP1	51752	broad.mit.edu	37	5	96119559	96119560	+	Intron	DEL	AT	-	-	rs60859205		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96119559_96119560delAT	uc003kmm.2	-						ERAP1_uc003kml.2_Intron|ERAP1_uc010jbm.1_Intron|ERAP1_uc003kmn.2_Intron	NM_001040458	NP_001035548	Q9NZ08	ERAP1_HUMAN	type 1 tumor necrosis factor receptor shedding						angiogenesis|antigen processing and presentation of endogenous peptide antigen via MHC class I|fat cell differentiation|membrane protein ectodomain proteolysis|regulation of blood pressure|regulation of innate immune response|response to bacterium	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|integral to membrane	aminopeptidase activity|interleukin-1, Type II receptor binding|interleukin-6 receptor binding|metalloexopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		acacacacacatacacacacaA	0.188													6	3	---	---	---	---	
ERAP2	64167	broad.mit.edu	37	5	96219851	96219851	+	Intron	DEL	T	-	-	rs11337784		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96219851delT	uc003kmq.2	+						uc003kmo.1_Intron|ERAP2_uc003kmt.2_Intron|ERAP2_uc003kmr.2_Intron|ERAP2_uc003kms.2_Intron|ERAP2_uc003kmu.2_Intron	NM_022350	NP_071745	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2						antigen processing and presentation of endogenous peptide antigen via MHC class I|proteolysis|regulation of blood pressure	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding				0		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		CACAGGAAGCTTTTTTTTTCC	0.249													3	4	---	---	---	---	
PAM	5066	broad.mit.edu	37	5	102342897	102342898	+	Intron	DEL	AC	-	-	rs34471961		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102342897_102342898delAC	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron|PAM_uc003knz.2_5'Flank	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	acatatacatacacacacacac	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	131368611	131368612	+	IGR	INS	-	GAAA	GAAA	rs140068665	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131368611_131368612insGAAA								ACSL6 (20741 upstream) : IL3 (27735 downstream)																							aaagaaagaaggaaagaaagaa	0.000													3	3	---	---	---	---	
STK32A	202374	broad.mit.edu	37	5	146730531	146730531	+	Intron	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146730531delA	uc010jgn.1	+						STK32A_uc003lom.2_Intron|STK32A_uc011dbw.1_Intron	NM_001112724	NP_001106195	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A isoform 1								ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCTACAAGAATTAACAGAC	0.418													17	17	---	---	---	---	
LARP1	23367	broad.mit.edu	37	5	154191178	154191185	+	Frame_Shift_Del	DEL	GTCTTGAA	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154191178_154191185delGTCTTGAA	uc003lvp.2	+	18	3488_3495	c.3059_3066delGTCTTGAA	c.(3058-3066)CGTCTTGAAfs	p.R1020fs	LARP1_uc003lvo.2_Frame_Shift_Del_p.R943fs	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	1020_1022							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AAATTCCGACGTCTTGAAGACTTCCGAG	0.337											OREG0016971	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	211	101	---	---	---	---	
FABP6	2172	broad.mit.edu	37	5	159650395	159650402	+	Intron	DEL	TCCTTCCT	-	-	rs57231428		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159650395_159650402delTCCTTCCT	uc003lxx.1	+						FABP6_uc003lxz.1_Intron	NM_001130958	NP_001124430	P51161	FABP6_HUMAN	gastrotropin isoform 1						bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			cctccctctctccttccttccttccttc	0.000													4	2	---	---	---	---	
CPLX2	10814	broad.mit.edu	37	5	175287502	175287523	+	Intron	DEL	AAAGAAAGAAAGAAAGAAAAAG	-	-	rs59334477		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175287502_175287523delAAAGAAAGAAAGAAAGAAAAAG	uc003mde.1	+							NM_006650	NP_006641	Q6PUV4	CPLX2_HUMAN	complexin 2						mast cell degranulation|positive regulation of synaptic plasticity|vesicle docking involved in exocytosis	cytosol				ovary(1)	1	all_cancers(89;0.004)|Renal(175;0.000269)|Lung NSC(126;0.00441)|all_lung(126;0.00747)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			gaaagaaagaaaagaaagaaagaaagaaaaagaaagaaagaa	0.000													4	2	---	---	---	---	
COL9A1	1297	broad.mit.edu	37	6	71011908	71011908	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71011908delT	uc003pfg.3	-							NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						TTTTCAtttcttttttttttt	0.164													4	2	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	101967177	101967180	+	Intron	DEL	GTGT	-	-	rs145458737		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101967177_101967180delGTGT	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	GGAGTTAAACgtgtgtgtgtgtgt	0.245													4	2	---	---	---	---	
EYA4	2070	broad.mit.edu	37	6	133802815	133802815	+	Intron	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133802815delA	uc003qec.3	+						EYA4_uc011ecq.1_Intron|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Intron|EYA4_uc003qee.3_Intron|EYA4_uc011ecs.1_Intron|uc003qef.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TTACAGTTCCATTATGTTTCA	0.333													48	25	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145011208	145011210	+	Intron	DEL	CTG	-	-	rs7768069		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145011208_145011210delCTG	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ccaaaagtttctgtttttttttt	0.000													5	4	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152949179	152949180	+	Intron	INS	-	AAAAA	AAAAA	rs114934585	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152949179_152949180insAAAAA	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CACAAAATTACAAAAAAAAAAA	0.322										HNSCC(10;0.0054)			4	2	---	---	---	---	
PDE10A	10846	broad.mit.edu	37	6	165805973	165805974	+	Intron	INS	-	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165805973_165805974insT	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	AATATGCTAAATGTTTGGGTAC	0.302													7	4	---	---	---	---	
C7orf50	84310	broad.mit.edu	37	7	1167118	1167118	+	Intron	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1167118delA	uc003sju.2	-						C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		CTCTCCCATTAAAAAAAAAAA	0.318													8	4	---	---	---	---	
MLXIPL	51085	broad.mit.edu	37	7	73011708	73011708	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73011708delG	uc003tyn.1	-	9	1455	c.1407delC	c.(1405-1407)CCCfs	p.P469fs	MLXIPL_uc003tyj.1_5'UTR|MLXIPL_uc003tyk.1_Frame_Shift_Del_p.P469fs|MLXIPL_uc003tyl.1_Frame_Shift_Del_p.P469fs|MLXIPL_uc003tym.1_Frame_Shift_Del_p.P469fs|MLXIPL_uc003tyo.1_RNA|MLXIPL_uc003typ.1_Frame_Shift_Del_p.P376fs|MLXIPL_uc003tyq.1_Frame_Shift_Del_p.P211fs	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14	469					anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTATGGGGAAGGGGGTGGGGG	0.677													4	2	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92132412	92132414	+	In_Frame_Del	DEL	AAC	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92132412_92132414delAAC	uc003uly.2	-	13	2263_2265	c.2167_2169delGTT	c.(2167-2169)GTTdel	p.V723del	PEX1_uc011khr.1_In_Frame_Del_p.V515del|PEX1_uc010ley.2_In_Frame_Del_p.V666del|PEX1_uc011khs.1_In_Frame_Del_p.V401del|PEX1_uc011kht.1_RNA	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	723					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CTTGAGCAGAAACAAGTAAAGGA	0.384													78	38	---	---	---	---	
LAMB4	22798	broad.mit.edu	37	7	107744735	107744736	+	Intron	INS	-	A	A	rs151026650	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107744735_107744736insA	uc010ljo.1	-						LAMB4_uc003vey.2_Intron	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor						cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						CATTTTTAAAGTTAAACTTAAT	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	109516839	109516840	+	IGR	INS	-	GT	GT	rs142636619	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109516839_109516840insGT								C7orf66 (992202 upstream) : EIF3IP1 (82444 downstream)																							AATAGAATCAAgtgtgtgtgtg	0.233													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142168221	142168222	+	Intron	INS	-	TGG	TGG			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142168221_142168222insTGG	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGGGCTCTGTTTGGGAGAGCT	0.530													10	6	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3033029	3033030	+	Intron	INS	-	CCTT	CCTT	rs149583717	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3033029_3033030insCCTT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ctgcctgcctgccttttttcct	0.010													4	3	---	---	---	---	
ADCK5	203054	broad.mit.edu	37	8	145617535	145617549	+	Splice_Site	DEL	GGGGGTGCAAGGTGA	-	-	rs11270020		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145617535_145617549delGGGGGTGCAAGGTGA	uc003zch.2	+	12	1321	c.1267_splice	c.e12+1	p.D423_splice	ADCK5_uc003zcg.2_Intron|ADCK5_uc003zci.2_Splice_Site_p.D12_splice	NM_174922	NP_777582	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5							integral to membrane	protein serine/threonine kinase activity			stomach(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAGCCGCACTGGGGGTGCAAGGTGAGGGGGTGCAA	0.660													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66333430	66333430	+	IGR	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66333430delA								FAM74A4 (839044 upstream) : LOC442421 (163040 downstream)																							TGAACAGGTTAAAAAAAAAAA	0.537													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69787982	69787985	+	IGR	DEL	AACA	-	-	rs59524350		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69787982_69787985delAACA								LOC100133920 (123033 upstream) : FOXD4L5 (387724 downstream)																							AGATAGAGGTAACAAACTTAAATA	0.368													9	5	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77415535	77415536	+	Intron	INS	-	A	A	rs35311937		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77415535_77415536insA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						AGGCTTCCTTTAAAAAAAAAAA	0.203													4	2	---	---	---	---	
NOXA1	10811	broad.mit.edu	37	9	140323753	140323754	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140323753_140323754insG	uc004cmv.2	+	5	665_666	c.530_531insG	c.(529-531)CAGfs	p.Q177fs	C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Frame_Shift_Ins_p.Q177fs|NOXA1_uc010nch.2_Intron	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1	177	Mediates interaction with RAC1.				regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CCGCCACGGCAGGTCCCCAGGG	0.678													7	5	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140693520	140693521	+	Intron	INS	-	GCCAGCTCGGACCCTCCACAGCGTCCCCTCCCACACAGA	GCCAGCTCGGACCCTCCACAGCGTCCCCTCCCACACAGA	rs72405279		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140693520_140693521insGCCAGCTCGGACCCTCCACAGCGTCCCCTCCCACACAGA	uc011mfc.1	+							NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CCACACTTAGGGCCAGCTCGGA	0.668													6	3	---	---	---	---	
CAMK1D	57118	broad.mit.edu	37	10	12583887	12583887	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12583887delT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		ccttccttccttttttttttt	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16193948	16193949	+	IGR	INS	-	AGAAA	AGAAA	rs146831092	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16193948_16193949insAGAAA								FAM188A (291429 upstream) : PTER (285018 downstream)																							aagaaagaaagagaaaagaaag	0.059													5	4	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75803109	75803110	+	Intron	INS	-	T	T	rs145684984		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75803109_75803110insT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					TGACATAATAAttttttttttt	0.099													11	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535366	86535366	+	IGR	DEL	T	-	-	rs71013354		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535366delT								FAM190B (257090 upstream) : GRID1 (823946 downstream)																							tttctttttcttttttttttt	0.000													7	4	---	---	---	---	
ATAD1	84896	broad.mit.edu	37	10	89530544	89530545	+	Intron	INS	-	AA	AA	rs147937257	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89530544_89530545insAA	uc001key.1	-						ATAD1_uc010qmr.1_Intron|ATAD1_uc009xth.1_Intron|ATAD1_uc001kez.1_Intron	NM_032810	NP_116199	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1							peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		AGGATAGAAATAGAGAGTGGAA	0.347													3	5	---	---	---	---	
ATAD1	84896	broad.mit.edu	37	10	89552545	89552545	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89552545delT	uc001key.1	-						ATAD1_uc010qmr.1_5'Flank|ATAD1_uc009xth.1_Intron|ATAD1_uc001kez.1_Intron	NM_032810	NP_116199	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1							peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CCTGCTTTGATTTGATATTTA	0.333													52	24	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112355981	112355981	+	Intron	DEL	A	-	-	rs66754857		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112355981delA	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		accctgtctcaaaaaaaaaaa	0.119													5	3	---	---	---	---	
ATE1	11101	broad.mit.edu	37	10	123683652	123683653	+	Intron	INS	-	T	T			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123683652_123683653insT	uc001lfp.2	-						ATE1_uc001lfq.2_Intron|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_Intron|ATE1_uc010qtt.1_Intron|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972	O95260	ATE1_HUMAN	arginyltransferase 1 isoform 2						protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				ACAAAAAATCACTACATAAAAG	0.178													17	9	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85975481	85975482	+	Intron	INS	-	TATT	TATT	rs138959322	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85975481_85975482insTATT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGTAAAGACtatatttatttat	0.312													6	3	---	---	---	---	
PDZD3	79849	broad.mit.edu	37	11	119056746	119056746	+	Intron	DEL	C	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119056746delC	uc001pwb.2	+						PDZD3_uc001pvy.2_Intron|PDZD3_uc001pvz.2_Intron|PDZD3_uc010rzd.1_Intron|PDZD3_uc001pwa.2_Intron			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;						cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		TAAAGGAGATCCTGGGACCCA	0.532													54	28	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120807105	120807105	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120807105delT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	ATCTTTTAACTTTTTTTCTGT	0.433													13	6	---	---	---	---	
WNK1	65125	broad.mit.edu	37	12	991368	991368	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:991368delT	uc001qio.3	+						WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TGACAGATAAttttttttttt	0.080													4	2	---	---	---	---	
IL22	50616	broad.mit.edu	37	12	68646870	68646871	+	Intron	INS	-	A	A	rs34979529		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68646870_68646871insA	uc001sty.1	-						IL22_uc010stb.1_Intron	NM_020525	NP_065386	Q9GZX6	IL22_HUMAN	interleukin 22 precursor						acute-phase response	extracellular space	cytokine activity|interleukin-22 receptor binding				0		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		AGAAGTTCAAGAAAAAAAAAAA	0.356													5	4	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118517626	118517627	+	Intron	INS	-	TTTC	TTTC	rs141622446	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118517626_118517627insTTTC	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						TCACCTTTGCAtttctttcttt	0.228													9	4	---	---	---	---	
GOLGA3	2802	broad.mit.edu	37	12	133350986	133350986	+	Intron	DEL	G	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133350986delG	uc001ukz.1	-							NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TGTGGCAAACGGGCCTCCCCA	0.622													25	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22300214	22300219	+	IGR	DEL	CACCAC	-	-	rs113546243		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22300214_22300219delCACCAC								FGF9 (21574 upstream) : None (None downstream)																							ccatcaccatcaccaccaccatcacc	0.015													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	26721515	26721518	+	IGR	DEL	AGGA	-	-	rs112254355		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26721515_26721518delAGGA								None (None upstream) : NOVA1 (193572 downstream)																							gaaggaaggtaggaaggaaggaag	0.074													6	4	---	---	---	---	
FAM179B	23116	broad.mit.edu	37	14	45480988	45480989	+	Intron	INS	-	TG	TG	rs145724708	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45480988_45480989insTG	uc001wvv.2	+						FAM179B_uc001wvw.2_Intron|FAM179B_uc010anc.2_Intron	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116								binding			skin(2)|upper_aerodigestive_tract(1)	3						CAAAATATATAtgtgtgtgtgt	0.292													6	6	---	---	---	---	
SDCCAG1	9147	broad.mit.edu	37	14	50269012	50269013	+	Intron	INS	-	A	A			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50269012_50269013insA	uc001wxc.2	-						SDCCAG1_uc010anj.1_Intron|SDCCAG1_uc001wwz.2_5'Flank|SDCCAG1_uc001wxa.2_5'Flank|SDCCAG1_uc010tqi.1_Intron|SDCCAG1_uc001wxe.2_Intron|SDCCAG1_uc001wxd.1_Intron	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		TTAGCATTTCCAAAAAAAAAAA	0.203													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56184689	56184690	+	IGR	INS	-	CC	CC			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56184689_56184690insCC								KTN1 (33388 upstream) : RPL13AP3 (48273 downstream)																							cttccttccttccttccttcct	0.104													4	3	---	---	---	---	
ATP10A	57194	broad.mit.edu	37	15	25953620	25953621	+	Intron	INS	-	ATGCAA	ATGCAA	rs151256521	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25953620_25953621insATGCAA	uc010ayu.2	-							NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTCTCATCAATATGTTTGACTG	0.183													3	3	---	---	---	---	
PPIP5K1	9677	broad.mit.edu	37	15	43871581	43871582	+	Intron	INS	-	ACAC	ACAC			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43871581_43871582insACAC	uc001zrw.2	-						PPIP5K1_uc001zrx.1_Intron|PPIP5K1_uc001zru.2_Intron|PPIP5K1_uc001zry.3_Intron|PPIP5K1_uc001zrv.2_Intron|PPIP5K1_uc001zrz.1_Intron|PPIP5K1_uc010udr.1_Intron	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						ttcgattatatacacacacaca	0.074													3	3	---	---	---	---	
ACAN	176	broad.mit.edu	37	15	89403776	89403777	+	Intron	INS	-	CTCAGGCTT	CTCAGGCTT	rs147084610	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89403776_89403777insCTCAGGCTT	uc010upo.1	+						ACAN_uc010upp.1_Intron|ACAN_uc002bna.2_Intron	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor						cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTCCACTGAGGCTCAGGCTGGG	0.416													6	4	---	---	---	---	
CASKIN1	57524	broad.mit.edu	37	16	2230531	2230532	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2230531_2230532insG	uc010bsg.1	-	18	2869_2870	c.2837_2838insC	c.(2836-2838)CCGfs	p.P946fs		NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	946	Pro-rich.				signal transduction	cytoplasm				skin(2)	2						GTGGGGGCGGCGGGGGCCCCTT	0.723													10	5	---	---	---	---	
C16orf71	146562	broad.mit.edu	37	16	4797795	4797795	+	Intron	DEL	A	-	-	rs59575807		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4797795delA	uc002cxn.2	+							NM_139170	NP_631909	Q8IYS4	CP071_HUMAN	hypothetical protein LOC146562											central_nervous_system(1)	1						GCTCAGTCACAGGTGCATGAA	0.522													6	3	---	---	---	---	
TNFRSF17	608	broad.mit.edu	37	16	12061912	12061913	+	3'UTR	INS	-	T	T	rs149410582	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12061912_12061913insT	uc002dbv.2	+	3					TNFRSF17_uc010buy.2_3'UTR|TNFRSF17_uc010buz.2_3'UTR	NM_001192	NP_001183	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily,						cell proliferation|multicellular organismal development	endomembrane system|integral to membrane|plasma membrane					0						TGATTAAACTCTTTTTTTTCCT	0.386			T	IL2	intestinal T-cell lymphoma								4	3	---	---	---	---	
TMC5	79838	broad.mit.edu	37	16	19476434	19476445	+	Intron	DEL	CCTCCCTCCCTC	-	-	rs71812351		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19476434_19476445delCCTCCCTCCCTC	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron|TMC5_uc002dgd.1_Intron|TMC5_uc002dge.3_Intron|TMC5_uc002dgf.3_Intron|TMC5_uc002dgg.3_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						ttccttccttcctccctccctccctccctccc	0.014													4	3	---	---	---	---	
SLC9A5	6553	broad.mit.edu	37	16	67298732	67298732	+	Intron	DEL	C	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67298732delC	uc002esm.2	+						SLC9A5_uc010cee.2_Intron|SLC9A5_uc010vji.1_Intron	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		TCCATGAGCTCCTAAGTCAGC	0.542													4	3	---	---	---	---	
DERL2	51009	broad.mit.edu	37	17	5383569	5383569	+	Intron	DEL	T	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5383569delT	uc002gcc.1	-							NM_016041	NP_057125	Q9GZP9	DERL2_HUMAN	Der1-like domain family, member 2						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of cell growth|positive regulation of cell proliferation|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	protein binding				0						GTCAACATAATTATTAAAAAT	0.284													33	18	---	---	---	---	
PITPNM3	83394	broad.mit.edu	37	17	6365183	6365184	+	Intron	INS	-	CCTCCT	CCTCCT	rs141315241	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6365183_6365184insCCTCCT	uc002gdd.3	-						PITPNM3_uc010cln.2_Intron|PITPNM3_uc010clm.2_Intron|PITPNM3_uc002gdc.3_Intron	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1						phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GTGCCTCCCTCCCTCCTCCTCC	0.559													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20679710	20679710	+	IGR	DEL	A	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20679710delA								LGALS9B (308862 upstream) : CCDC144NL (87000 downstream)																							actccgtctcaaaaaaaaaaa	0.095													4	2	---	---	---	---	
EFCAB5	374786	broad.mit.edu	37	17	28320516	28320516	+	Intron	DEL	A	-	-	rs78216599		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28320516delA	uc002het.2	+						EFCAB5_uc010wbi.1_Intron|EFCAB5_uc010wbj.1_Intron|EFCAB5_uc010wbk.1_Intron|EFCAB5_uc010csd.2_Intron|EFCAB5_uc010cse.2_Intron|EFCAB5_uc010csf.2_Intron	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a								calcium ion binding			ovary(1)|skin(1)	2						GAGCATTACCAAAAAAAAAAA	0.343													4	2	---	---	---	---	
CASC3	22794	broad.mit.edu	37	17	38296626	38296627	+	5'UTR	DEL	AA	-	-	rs146433128		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38296626_38296627delAA	uc010cwt.1	+	1					CASC3_uc010cws.1_5'UTR|CASC3_uc002hue.2_5'UTR	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51						mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						cacacaccccaacacacacaca	0.347													4	2	---	---	---	---	
KRT9	3857	broad.mit.edu	37	17	39727346	39727346	+	Intron	DEL	T	-	-	rs77388119		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39727346delT	uc002hxe.3	-						JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9						intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				TCAGCTCACGTTAACCCAGGT	0.493													3	4	---	---	---	---	
ARL4D	379	broad.mit.edu	37	17	41476893	41476894	+	Intron	DEL	AA	-	-	rs3071190		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41476893_41476894delAA	uc002idt.2	+							NM_001661	NP_001652	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D						protein secretion|small GTPase mediated signal transduction	cytoplasm|nucleolus|plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)	1		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		GTTATGCCTTAAAAAAAAAAAA	0.470													8	4	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655768	47655768	+	Intron	DEL	T	-	-	rs67095119		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655768delT	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					GGGGGGGGGGTGACCCAACTG	0.527													7	4	---	---	---	---	
EVPL	2125	broad.mit.edu	37	17	74017493	74017501	+	Intron	DEL	CCGCCCCTG	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74017493_74017501delCCGCCCCTG	uc002jqi.2	-						EVPL_uc010wss.1_Intron|EVPL_uc010wst.1_Intron	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin						keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						TGCTGTGCTCccgcccctgccgcccctgc	0.383													4	2	---	---	---	---	
ZNF532	55205	broad.mit.edu	37	18	56646583	56646584	+	Intron	INS	-	AAAT	AAAT	rs144076086	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56646583_56646584insAAAT	uc002lho.2	+						ZNF532_uc002lhp.2_Intron|ZNF532_uc010xeg.1_Intron|ZNF532_uc002lhr.2_Intron|ZNF532_uc002lhs.2_Intron|ZNF532_uc010xeh.1_Intron	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GAAAATAAAAAAAAAAGGAGCA	0.233													3	3	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3819298	3819299	+	Intron	INS	-	GGGCAGGT	GGGCAGGT	rs146619879	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3819298_3819299insGGGCAGGT	uc002lyw.2	-							NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCTGGGCAGGCGGGCAGGTGGG	0.728													3	3	---	---	---	---	
SH2D3A	10045	broad.mit.edu	37	19	6754252	6754252	+	Intron	DEL	C	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6754252delC	uc002mft.2	-						SH2D3A_uc010xjg.1_Frame_Shift_Del_p.E306fs	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A						JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						AGTCCCTGCTCCCCACGAACC	0.687													11	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36448398	36448398	+	IGR	DEL	T	-	-	rs74172775		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36448398delT								LRFN3 (12303 upstream) : SDHAF1 (37703 downstream)																							ACCATAACCCttttttttttt	0.264													4	2	---	---	---	---	
GYS1	2997	broad.mit.edu	37	19	49478172	49478176	+	Intron	DEL	TTTCT	-	-	rs74389437		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49478172_49478176delTTTCT	uc002plp.2	-						GYS1_uc010xzy.1_Intron|GYS1_uc010emm.2_Intron|GYS1_uc010xzz.1_Intron|GYS1_uc010yaa.1_Intron	NM_002103	NP_002094	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle) isoform 1						glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding			ovary(2)	2		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		AAAGGTTTTCTttcttttcttttaa	0.254													3	3	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	14517302	14517303	+	Intron	INS	-	GTGTGA	GTGTGA	rs28757762	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14517302_14517303insGTGTGA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				tgtgtgtgtgtgtgtgtgcatg	0.233													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49068609	49068610	+	IGR	INS	-	G	G	rs4993579	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068609_49068610insG								CEBPB (259397 upstream) : PTPN1 (58281 downstream)																							agaaaaagaaagaaggaaggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58889693	58889694	+	Intron	INS	-	TATC	TATC			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58889693_58889694insTATC	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		ctcctatccatccatccatcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10547387	10547390	+	Intron	DEL	ACAC	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10547387_10547390delACAC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		cagaataggtacacacacacacac	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18570199	18570200	+	IGR	INS	-	AGGA	AGGA	rs149741218	by1000genomes	TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18570199_18570200insAGGA								C21orf34 (588105 upstream) : CXADR (315130 downstream)																							ggaaggaagggaggaaggaagg	0.104													5	6	---	---	---	---	
GABPA	2551	broad.mit.edu	37	21	27130161	27130162	+	Intron	DEL	TT	-	-	rs143159574		TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27130161_27130162delTT	uc002ylx.3	+						GABPA_uc002yly.3_Intron	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha						positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						TACAGCATAAtttttttttttt	0.307													4	2	---	---	---	---	
APOL1	8542	broad.mit.edu	37	22	36651357	36651358	+	Intron	DEL	CT	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36651357_36651358delCT	uc003apf.2	+						APOL1_uc011amn.1_Intron|APOL1_uc003apc.2_Intron|APOL1_uc003ape.2_Intron|APOL1_uc011amo.1_Intron|APOL1_uc011amp.1_Intron|APOL1_uc011amq.1_Intron|APOL1_uc010gwx.2_Intron	NM_003661	NP_003652	O14791	APOL1_HUMAN	apolipoprotein L1 isoform a precursor						cholesterol metabolic process|cytolysis|innate immune response|killing of cells of other organism|lipid transport|lipoprotein metabolic process	high-density lipoprotein particle|very-low-density lipoprotein particle	chloride channel activity|lipid binding|protein binding			breast(2)|ovary(1)	3						GAGGCACCAGCTCTCTCTACCC	0.604													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	448609	448612	+	IGR	DEL	AAGA	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:448609_448612delAAGA								PPP2R3B (100982 upstream) : SHOX (136467 downstream)																							aaggaaaaagaagaaagaaagaaa	0.025													6	4	---	---	---	---	
CRLF2	64109	broad.mit.edu	37	X	1331700	1331701	+	5'Flank	DEL	AC	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1331700_1331701delAC	uc004cpm.1	-									Q9HC73	CRLF2_HUMAN	Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CTTGTCAAGAacacacacacac	0.307			Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								3	3	---	---	---	---	
SH3KBP1	30011	broad.mit.edu	37	X	19688957	19688958	+	Intron	INS	-	AAAA	AAAA			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19688957_19688958insAAAA	uc004czm.2	-						SH3KBP1_uc011mje.1_5'Flank|SH3KBP1_uc011mjf.1_Intron|SH3KBP1_uc004czl.2_Intron	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						ACTCTAAAAGCAAAAAAAAAAA	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13501844	13501844	+	IGR	DEL	C	-	-			TCGA-BP-5168-01A-01D-1421-08	TCGA-BP-5168-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13501844delC								None (None upstream) : None (None downstream)																							GTTAAAGTCTCCCTCACCttt	0.144													7	4	---	---	---	---	
