Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PUSL1	126789	broad.mit.edu	37	1	1245963	1245963	+	Intron	SNP	G	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1245963G>T	uc001aed.2	+						ACAP3_uc001aeb.2_5'Flank|ACAP3_uc001aec.1_5'Flank|PUSL1_uc010nyi.1_Intron|PUSL1_uc009vjx.2_5'UTR	NM_153339	NP_699170	Q8N0Z8	PUSL1_HUMAN	pseudouridylate synthase-like 1						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ATAGTAGGCTGAGGATGGCAA	0.562													5	250	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16946437	16946437	+	RNA	SNP	C	T	T	rs2262202		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946437C>T	uc010ocf.1	-	3		c.461G>A			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						AGCCTTCCGCCGGGCCAGCAG	0.672													3	25	---	---	---	---	PASS
PRKACB	5567	broad.mit.edu	37	1	84610143	84610143	+	Intron	SNP	C	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84610143C>A	uc001djj.2	+						PRKACB_uc001djl.2_Missense_Mutation_p.H33Q|PRKACB_uc001dji.2_Intron|PRKACB_uc001djk.2_Missense_Mutation_p.H33Q	NM_002731	NP_002722	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		TTCATAGACACTCTAAAGGTA	0.403													58	257	---	---	---	---	PASS
PMF1	11243	broad.mit.edu	37	1	156206204	156206204	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156206204C>T	uc001fnq.2	+	4	517	c.494C>T	c.(493-495)GCC>GTC	p.A165V	PMF1_uc001fnr.2_Missense_Mutation_p.P145S|BGLAP_uc001fns.1_Intron	NM_007221	NP_009152	Q6P1K2	PMF1_HUMAN	polyamine-modulated factor 1	165	Potential.				cell division|chromosome segregation|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytosol|MIS12/MIND type complex|transcription factor complex	leucine zipper domain binding|transcription coactivator activity				0	Hepatocellular(266;0.158)					CTGGCAGATGCCGTCCTGGCA	0.642													4	60	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159897239	159897239	+	Silent	SNP	G	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159897239G>T	uc001fur.2	-	21	3634	c.3436C>A	c.(3436-3438)CGG>AGG	p.R1146R	IGSF9_uc001fuq.2_Silent_p.R1130R|CCDC19_uc001ful.2_5'Flank|TAGLN2_uc001fun.1_5'Flank|TAGLN2_uc001fuo.1_5'Flank|TAGLN2_uc010piy.1_5'Flank|IGSF9_uc001fup.2_Silent_p.R292R	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	1146	Cytoplasmic (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			AATTCCTCCCGAAGGGCAGCA	0.642													5	124	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214813680	214813680	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214813680A>C	uc001hkm.2	+	12	2173	c.1999A>C	c.(1999-2001)ACG>CCG	p.T667P		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	667	Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAGAGTAAGAACGCTGGAGAT	0.398													18	62	---	---	---	---	PASS
OR2B11	127623	broad.mit.edu	37	1	247614532	247614532	+	Silent	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614532G>A	uc010pyx.1	-	1	753	c.753C>T	c.(751-753)ATC>ATT	p.I251I		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	251	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGAGGGAGACGATCATCAGGT	0.512													34	144	---	---	---	---	PASS
HADHA	3030	broad.mit.edu	37	2	26435464	26435464	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26435464T>C	uc002rgy.2	-	10	1080	c.950A>G	c.(949-951)GAT>GGT	p.D317G	HADHA_uc010yks.1_Missense_Mutation_p.D230G|HADHA_uc010ykt.1_Missense_Mutation_p.D230G	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha	317					fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)	ATAACCGGCATCACTCCCTTG	0.358													57	169	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39564108	39564108	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39564108C>T	uc002rro.2	-	6	458	c.367G>A	c.(367-369)GGA>AGA	p.G123R	MAP4K3_uc002rrp.2_Missense_Mutation_p.G123R	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	123	Protein kinase.				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				TAATATAATCCCTGGAGTTTC	0.259													21	85	---	---	---	---	PASS
WDR92	116143	broad.mit.edu	37	2	68371743	68371743	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68371743G>T	uc002see.1	-	3	470	c.389C>A	c.(388-390)CCT>CAT	p.P130H	WDR92_uc002sed.1_RNA|WDR92_uc002sef.1_Missense_Mutation_p.P130H|WDR92_uc002seg.1_Missense_Mutation_p.P29H	NM_138458	NP_612467	Q96MX6	WDR92_HUMAN	monad	130	WD 2.				apoptosis|histone lysine methylation		methylated histone residue binding				0						CACAATTTCAGGTGCTCCTTC	0.398													73	200	---	---	---	---	PASS
DDX18	8886	broad.mit.edu	37	2	118578782	118578782	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118578782A>G	uc002tlh.1	+	4	659	c.560A>G	c.(559-561)AAT>AGT	p.N187S		NM_006773	NP_006764	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	187	Q motif.						ATP binding|ATP-dependent RNA helicase activity|RNA binding			breast(2)|ovary(1)|lung(1)	4						AATCTTGTCAATGAAAACACT	0.308													57	126	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179395843	179395843	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179395843G>A	uc010zfg.1	-	307	98019	c.97795C>T	c.(97795-97797)CAA>TAA	p.Q32599*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.Q26294*|TTN_uc010zfi.1_Nonsense_Mutation_p.Q26227*|TTN_uc010zfj.1_Nonsense_Mutation_p.Q26102*|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33526							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTAGCACTTGTCCTTTACGC	0.522													9	478	---	---	---	---	PASS
RQCD1	9125	broad.mit.edu	37	2	219457120	219457120	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219457120A>C	uc010zkh.1	+	6	634	c.634A>C	c.(634-636)ATC>CTC	p.I212L	RQCD1_uc002vih.1_Missense_Mutation_p.I212L|RQCD1_uc010zki.1_Missense_Mutation_p.I244L	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog	212					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTTGCCATGATCTTGGTGAG	0.413													90	240	---	---	---	---	PASS
SLC19A3	80704	broad.mit.edu	37	2	228564091	228564091	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228564091C>A	uc002vpi.2	-	3	429	c.340G>T	c.(340-342)GGG>TGG	p.G114W	SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_Missense_Mutation_p.G110W	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN	solute carrier family 19, member 3	114	Helical; (Potential).				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	GTGACCATCCCATAGAAGAAC	0.547													60	164	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52643743	52643743	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643743T>C	uc003des.2	-	16	2165	c.2153A>G	c.(2152-2154)TAC>TGC	p.Y718C	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.Y718C|PBRM1_uc003der.2_Missense_Mutation_p.Y686C|PBRM1_uc003det.2_Missense_Mutation_p.Y733C|PBRM1_uc003deu.2_Missense_Mutation_p.Y733C|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.Y718C|PBRM1_uc010hmk.1_Missense_Mutation_p.Y718C|PBRM1_uc003dey.2_Missense_Mutation_p.Y718C|PBRM1_uc003dez.1_Missense_Mutation_p.Y718C|PBRM1_uc003dfb.1_Missense_Mutation_p.Y631C|PBRM1_uc003dfa.1_Missense_Mutation_p.Y64C|PBRM1_uc003dfc.2_Missense_Mutation_p.Y85C	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	718	Bromo 5.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.Y718_Q719>*(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AATATCTTGGTACTTGTTGGC	0.403			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								115	151	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2952002	2952002	+	Intron	SNP	A	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2952002A>C	uc003ggj.1	-						C4orf10_uc003ggh.2_RNA|C4orf10_uc003ggi.1_RNA|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						GGACCATCTCACAGCCACATC	0.552													16	48	---	---	---	---	PASS
SEPT11	55752	broad.mit.edu	37	4	77932908	77932908	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77932908A>G	uc003hkj.2	+	4	521	c.359A>G	c.(358-360)TAT>TGT	p.Y120C	SEPT11_uc010ijh.1_Missense_Mutation_p.Y112C|SEPT11_uc011cca.1_Missense_Mutation_p.Y130C	NM_018243	NP_060713	Q9NVA2	SEP11_HUMAN	septin 11	120					cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0						ATAGTAGAATATATTGATGCC	0.363													28	169	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159754698	159754698	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159754698G>T	uc003iqe.3	+	6	756	c.573G>T	c.(571-573)GAG>GAT	p.E191D	FNIP2_uc003iqd.2_Missense_Mutation_p.E191D	NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	191					DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		ACAGCTTTGAGTACATCAACC	0.398													17	115	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33683193	33683193	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33683193A>T	uc003jia.1	-	5	1008	c.845T>A	c.(844-846)TTC>TAC	p.F282Y	ADAMTS12_uc010iuq.1_Missense_Mutation_p.F282Y	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	282	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TGGGTTATGGAACAACCCAGT	0.388										HNSCC(64;0.19)			20	95	---	---	---	---	PASS
ZFYVE16	9765	broad.mit.edu	37	5	79769670	79769670	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79769670T>A	uc003kgr.3	+	17	4587	c.4285T>A	c.(4285-4287)TGT>AGT	p.C1429S	ZFYVE16_uc003kgq.3_Missense_Mutation_p.C1429S|ZFYVE16_uc003kgs.3_Missense_Mutation_p.C1429S|ZFYVE16_uc003kgt.3_Missense_Mutation_p.C517S|ZFYVE16_uc003kgu.3_Missense_Mutation_p.C181S	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1429					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		GATTGTAAAATGTACCGAGGT	0.333													71	77	---	---	---	---	PASS
TMCO6	55374	broad.mit.edu	37	5	140024201	140024201	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140024201A>G	uc003lgl.2	+	11	1345	c.1244A>G	c.(1243-1245)TAC>TGC	p.Y415C	TMCO6_uc003lgm.2_Missense_Mutation_p.Y421C|TMCO6_uc010jft.2_Missense_Mutation_p.Y175C|TMCO6_uc003lgn.2_Missense_Mutation_p.Y306C|TMCO6_uc003lgo.2_Missense_Mutation_p.Y175C	NM_018502	NP_060972	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	415					protein import into nucleus	cytoplasm|nuclear pore	binding|protein transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCCTGCTTACTGCCAGCGG	0.483													37	375	---	---	---	---	PASS
RGL2	5863	broad.mit.edu	37	6	33259932	33259932	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33259932A>G	uc003odv.2	-	18	2414	c.2281T>C	c.(2281-2283)TCC>CCC	p.S761P	WDR46_uc003ods.2_5'Flank|WDR46_uc011dra.1_5'Flank|RGL2_uc003odu.2_Missense_Mutation_p.S321P|RGL2_uc010jur.2_Missense_Mutation_p.S321P|RGL2_uc003odw.2_Missense_Mutation_p.S679P	NM_004761	NP_004752	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation	761					Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity			skin(3)|lung(1)|breast(1)|pancreas(1)	6						CTGGGAAAGGAGCCCCCTCCT	0.597													32	82	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56468870	56468870	+	Intron	SNP	G	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56468870G>T	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.S2982Y	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATCATCTCAGATGTAGAACA	0.328													4	16	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100390871	100390871	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100390871C>A	uc003pqh.1	-	4	856	c.541G>T	c.(541-543)GTT>TTT	p.V181F	MCHR2_uc003pqi.1_Missense_Mutation_p.V181F	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	181	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CAACTCTCAACACCGTCTTTA	0.423													34	159	---	---	---	---	PASS
ZDHHC4	55146	broad.mit.edu	37	7	6628401	6628401	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6628401C>T	uc003sqi.2	+	9	1253	c.895C>T	c.(895-897)CAG>TAG	p.Q299*	ZDHHC4_uc003sql.2_Nonsense_Mutation_p.Q299*|ZDHHC4_uc003sqh.2_Nonsense_Mutation_p.Q299*|ZDHHC4_uc003sqj.2_Nonsense_Mutation_p.Q299*|ZDHHC4_uc003sqk.2_Nonsense_Mutation_p.Q299*|ZDHHC4_uc003sqm.2_Nonsense_Mutation_p.Q299*|uc011jwy.1_5'Flank|C7orf26_uc003sqo.1_5'Flank|C7orf26_uc003sqp.1_5'Flank|C7orf26_uc003sqq.1_5'Flank	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	299						integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		GGCCTGGTGCCAGCGTTGTCC	0.577													6	177	---	---	---	---	PASS
CBX3	11335	broad.mit.edu	37	7	26251843	26251843	+	3'UTR	SNP	C	T	T	rs9768418	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26251843C>T	uc003sxt.2	+	6					CBX3_uc003sxu.2_3'UTR|CBX3_uc003sxv.2_3'UTR	NM_007276	NP_009207	Q13185	CBX3_HUMAN	chromobox homolog 3						chromatin remodeling|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome, centromeric region|nuclear centromeric heterochromatin|nuclear euchromatin|nuclear inner membrane|spindle	enzyme binding|protein domain specific binding			ovary(1)	1						TCACATTGTTCTTTtatatat	0.264													3	27	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59410800	59410800	+	Silent	SNP	A	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59410800A>G	uc003xtm.3	-	2	372	c.309T>C	c.(307-309)GCT>GCC	p.A103A		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	103					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TCGCAGAAGTAGCAAAGTGAA	0.318									Neonatal_Giant_Cell_Hepatitis				3	125	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66499888	66499888	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66499888C>T	uc004aee.1	+	1	698	c.698C>T	c.(697-699)GCC>GTC	p.A233V	LOC442421_uc004aed.1_RNA					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						GTGACCATCGCCATGTACATG	0.562													3	28	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66499904	66499904	+	Silent	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66499904C>T	uc004aee.1	+	1	714	c.714C>T	c.(712-714)GGC>GGT	p.G238G	LOC442421_uc004aed.1_RNA					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						ACATGAAGGGCGGGTAACCTG	0.542													4	26	---	---	---	---	PASS
ALDOB	229	broad.mit.edu	37	9	104187208	104187208	+	Silent	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104187208G>A	uc004bbk.2	-	8	998	c.916C>T	c.(916-918)CTG>TTG	p.L306L		NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	306					fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				CTGGCCTGCAGGGCCCGTCCA	0.552													23	123	---	---	---	---	PASS
ODF2	4957	broad.mit.edu	37	9	131245102	131245102	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131245102T>C	uc011mbd.1	+	10	1234	c.923T>C	c.(922-924)CTG>CCG	p.L308P	ODF2_uc011maz.1_Missense_Mutation_p.L308P|ODF2_uc011mba.1_Missense_Mutation_p.L93P|ODF2_uc010myb.2_Missense_Mutation_p.L284P|ODF2_uc011mbb.1_Missense_Mutation_p.L242P|ODF2_uc011mbc.1_Missense_Mutation_p.L227P|ODF2_uc004bva.2_Missense_Mutation_p.L261P|ODF2_uc004bvb.2_Missense_Mutation_p.L284P|ODF2_uc011mbe.1_Missense_Mutation_p.L303P|ODF2_uc004bvc.2_Missense_Mutation_p.L284P|ODF2_uc010myc.2_Missense_Mutation_p.L251P|ODF2_uc011mbf.1_Missense_Mutation_p.L289P|ODF2_uc004bvd.3_Missense_Mutation_p.L308P|ODF2_uc004bve.2_Missense_Mutation_p.L289P|uc004bvg.2_5'Flank	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1	308	Potential.				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						CAGCGCCTGCTGTTACTGCTG	0.498													18	40	---	---	---	---	PASS
STAM	8027	broad.mit.edu	37	10	17750824	17750824	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17750824C>T	uc001ipj.1	+	13	1475	c.1259C>T	c.(1258-1260)GCG>GTG	p.A420V	STAM_uc009xjw.1_Missense_Mutation_p.A78V	NM_003473	NP_003464	Q92783	STAM1_HUMAN	signal transducing adaptor molecule 1	420					cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity			large_intestine(1)|ovary(1)	2						GCAGGGAACGCGCAGATGAGC	0.522													30	149	---	---	---	---	PASS
LDB3	11155	broad.mit.edu	37	10	88466360	88466360	+	Silent	SNP	A	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88466360A>C	uc001kdv.2	+	7	992	c.969A>C	c.(967-969)CCA>CCC	p.P323P	LDB3_uc010qml.1_Intron|LDB3_uc010qmm.1_Intron|LDB3_uc001kdu.2_Intron|LDB3_uc009xsz.2_Intron	NM_007078	NP_009009	O75112	LDB3_HUMAN	LIM domain binding 3 isoform 1	323						cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding			ovary(1)	1						CTGCCCAGCCACCTGCTGCTG	0.667													11	104	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118305651	118305651	+	Splice_Site	SNP	G	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118305651G>C	uc001lcm.2	+	2	89	c.46_splice	c.e2+1	p.G16_splice		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	GCAGTAGCAGGTAAGAAAACA	0.433													52	117	---	---	---	---	PASS
PC	5091	broad.mit.edu	37	11	66619326	66619326	+	Silent	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66619326G>A	uc001ojn.1	-	14	1966	c.1917C>T	c.(1915-1917)TTC>TTT	p.F639F	PC_uc001ojo.1_Silent_p.F639F|PC_uc001ojp.1_Silent_p.F639F|PC_uc001ojm.1_5'Flank	NM_022172	NP_071504	P11498	PYC_HUMAN	pyruvate carboxylase precursor	639	Carboxyltransferase.				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GCAGCATCTGGAAAGGGATGT	0.637													23	61	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	96074938	96074938	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96074938C>T	uc001pfw.1	-	1	1407	c.122G>A	c.(121-123)CGG>CAG	p.R41Q		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	41					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				GATCCGAGCCCGGAGGCGCTC	0.662			T	MECT1|CRTC3	salivary gland mucoepidermoid						OREG0021305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	37	---	---	---	---	PASS
NCAM1	4684	broad.mit.edu	37	11	113133587	113133587	+	Intron	SNP	T	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113133587T>C	uc001pns.2	+									P13591	NCAM1_HUMAN	SubName: Full=cDNA FLJ52974, highly similar to Neural cell adhesion molecule 1, 140 kDa isoform;						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GAGGCAATTCTGCATCCTACA	0.438													27	52	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	100200323	100200323	+	Silent	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100200323C>T	uc001tge.1	-	4	945	c.528G>A	c.(526-528)GTG>GTA	p.V176V	ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Silent_p.V176V	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	176	ANK 5.					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TCATTTTTACCACTCTAAGCC	0.498													3	117	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120649783	120649783	+	3'UTR	SNP	A	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120649783A>T	uc001txt.2	-	12					uc001txs.1_Intron|PXN_uc001txu.2_3'UTR|PXN_uc001txv.2_3'UTR|PXN_uc001txx.2_3'UTR|PXN_uc001txy.2_3'UTR|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1						cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGAAATATGAGGAAGAGATG	0.602													28	61	---	---	---	---	PASS
EIF2B1	1967	broad.mit.edu	37	12	124107227	124107227	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124107227G>A	uc001ufm.2	-	8	852	c.709C>T	c.(709-711)CGG>TGG	p.R237W	EIF2B1_uc001ufn.2_Missense_Mutation_p.R235W	NM_001414	NP_001405	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B,	237					cellular response to stimulus|oligodendrocyte development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex|membrane fraction|plasma membrane	protein binding|translation initiation factor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		GGAAAGAGCCGGACAAACTTG	0.423													8	234	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20024477	20024477	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20024477T>G	uc001umd.2	-	13	1021	c.810A>C	c.(808-810)AGA>AGC	p.R270S	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.R159S|TPTE2_uc001ume.2_Missense_Mutation_p.R193S|TPTE2_uc009zzm.2_Intron|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	270	Phosphatase tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GATCATAAGCTCTTTCACCTA	0.299													70	191	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35770111	35770111	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35770111G>C	uc001uvb.2	+	31	5244	c.5038G>C	c.(5038-5040)GAG>CAG	p.E1680Q	NBEA_uc010abi.2_Missense_Mutation_p.E336Q	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1680						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AATTGGAGAGGAGCAAGTGGC	0.428													3	126	---	---	---	---	PASS
OR4E2	26686	broad.mit.edu	37	14	22133740	22133740	+	Silent	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22133740C>T	uc010tmd.1	+	1	444	c.444C>T	c.(442-444)CTC>CTT	p.L148L		NM_001001912	NP_001001912	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		TCTTTGCTCTCTGGTTGGGGG	0.478													106	214	---	---	---	---	PASS
C14orf93	60686	broad.mit.edu	37	14	23468257	23468257	+	5'UTR	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23468257G>A	uc001wib.1	-	2					C14orf93_uc001wic.1_Intron|C14orf93_uc001wid.1_5'UTR|C14orf93_uc001wig.2_5'UTR|C14orf93_uc001wih.2_5'UTR|C14orf93_uc001wie.2_5'UTR|C14orf93_uc001wia.3_5'UTR|C14orf93_uc001wif.2_Intron	NM_021944	NP_068763	Q9H972	CN093_HUMAN	hypothetical protein LOC60686 precursor							extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		TAACAACCACGCTTACACTGC	0.577													20	102	---	---	---	---	PASS
C14orf93	60686	broad.mit.edu	37	14	23468258	23468258	+	5'UTR	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23468258C>T	uc001wib.1	-	2					C14orf93_uc001wic.1_Intron|C14orf93_uc001wid.1_5'UTR|C14orf93_uc001wig.2_5'UTR|C14orf93_uc001wih.2_5'UTR|C14orf93_uc001wie.2_5'UTR|C14orf93_uc001wia.3_5'UTR|C14orf93_uc001wif.2_Intron	NM_021944	NP_068763	Q9H972	CN093_HUMAN	hypothetical protein LOC60686 precursor							extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		AACAACCACGCTTACACTGCT	0.577													20	101	---	---	---	---	PASS
C14orf104	55172	broad.mit.edu	37	14	50100543	50100543	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50100543C>T	uc001wws.3	-	1	1406	c.1325G>A	c.(1324-1326)AGG>AAG	p.R442K	SDCCAG1_uc010anj.1_Intron|C14orf104_uc001wwt.3_Missense_Mutation_p.R442K	NM_018139	NP_060609	Q9NVR5	KTU_HUMAN	kintoun isoform 1	442					axonemal dynein complex assembly|ciliary cell motility|flagellar cell motility	cytoplasm					0	all_epithelial(31;0.0021)|Breast(41;0.0124)					CCCCGCGTGCCTGCTCAAGTC	0.716									Kartagener_syndrome				5	6	---	---	---	---	PASS
AMN	81693	broad.mit.edu	37	14	103395248	103395248	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103395248T>C	uc001ymg.3	+	5	482	c.449T>C	c.(448-450)TTC>TCC	p.F150S	AMN_uc001ymh.3_Missense_Mutation_p.F96S	NM_030943	NP_112205	Q9BXJ7	AMNLS_HUMAN	amnionless protein precursor	150	Extracellular (Potential).				lipid metabolic process|lipoprotein metabolic process|multicellular organismal development	integral to membrane|plasma membrane					0				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGTGCCTCCTTCCGCGTGGGG	0.711													12	37	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105414503	105414503	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105414503C>G	uc010axc.1	-	7	7405	c.7285G>C	c.(7285-7287)GAC>CAC	p.D2429H	AHNAK2_uc001ypx.2_Missense_Mutation_p.D2329H	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2429						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTTTCAGGTCCAGCTTGGGG	0.627													112	235	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106234219	106234219	+	Intron	SNP	C	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106234219C>G	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						TGGTGATGGTCGTCCACAGCC	0.607													4	12	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48054430	48054430	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48054430T>G	uc010bek.2	+	8	932	c.572T>G	c.(571-573)TTC>TGC	p.F191C	SEMA6D_uc001zvw.2_Missense_Mutation_p.F191C|SEMA6D_uc001zvx.1_Missense_Mutation_p.F191C|SEMA6D_uc001zvy.2_Missense_Mutation_p.F191C|SEMA6D_uc001zvz.2_Missense_Mutation_p.F191C|SEMA6D_uc001zwa.2_Missense_Mutation_p.F191C|SEMA6D_uc001zwb.2_Missense_Mutation_p.F191C|SEMA6D_uc001zwc.2_Missense_Mutation_p.F191C	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	191	Sema.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GTGGCTGACTTCTTGGCCAGC	0.423													47	78	---	---	---	---	PASS
CAMTA2	23125	broad.mit.edu	37	17	4876239	4876239	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4876239G>T	uc002gah.1	-	15	2436	c.2328C>A	c.(2326-2328)TTC>TTA	p.F776L	CAMTA2_uc010cku.1_Missense_Mutation_p.F799L|CAMTA2_uc002gag.1_Missense_Mutation_p.F775L|CAMTA2_uc002gai.1_Missense_Mutation_p.F778L|CAMTA2_uc010ckv.1_Missense_Mutation_p.F423L	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	776	ANK 2.				cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						GGTTCCAACGGAAAAGGAGCA	0.647													39	117	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11572453	11572453	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11572453C>G	uc002gne.2	+	16	2872	c.2804C>G	c.(2803-2805)CCG>CGG	p.P935R	DNAH9_uc010coo.2_Missense_Mutation_p.P229R	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	935	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	p.P935L(1)		skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTTTTCTATCCGTCTCTGGAG	0.468													123	325	---	---	---	---	PASS
FBXW10	10517	broad.mit.edu	37	17	18682177	18682177	+	Missense_Mutation	SNP	C	A	A	rs150642944		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18682177C>A	uc002guk.2	+	14	2957	c.2725C>A	c.(2725-2727)CCC>ACC	p.P909T	FBXW10_uc002guj.2_Missense_Mutation_p.P908T|FBXW10_uc002gul.2_Missense_Mutation_p.P918T|FBXW10_uc010cqh.1_Missense_Mutation_p.P856T|FAM18B_uc002gum.2_5'Flank	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	909										ovary(1)	1						GTCCACCATACCCCAGCCCAT	0.502													46	318	---	---	---	---	PASS
PPP1R9B	84687	broad.mit.edu	37	17	48212737	48212737	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48212737C>G	uc002iqh.3	-	12	2416	c.2413G>C	c.(2413-2415)GAA>CAA	p.E805Q		NM_032595	NP_115984	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	803	Potential.|Interacts with TGN38 (By similarity).				cell cycle arrest|cell differentiation|cell migration|filopodium assembly|negative regulation of cell growth|nervous system development|regulation of cell growth by extracellular stimulus|regulation of cell proliferation|regulation of exit from mitosis|RNA splicing	adherens junction|cytoskeleton|dendritic spine|filopodium|lamellipodium|nucleoplasm|protein phosphatase type 1 complex|ruffle membrane|synapse	actin binding|protein phosphatase 1 binding|protein phosphatase inhibitor activity				0						AAGTTTCCTTCCAGTTCTGAG	0.527													63	180	---	---	---	---	PASS
VEZF1	7716	broad.mit.edu	37	17	56060482	56060482	+	Silent	SNP	C	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56060482C>T	uc002ivf.1	-	2	449	c.306G>A	c.(304-306)GTG>GTA	p.V102V	VEZF1_uc010dcn.1_5'UTR	NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	102					cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						TTGGCCGGGACACCAACTTGA	0.537													82	139	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67189255	67189255	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67189255C>G	uc010dfa.1	-	16	2655	c.1776G>C	c.(1774-1776)TTG>TTC	p.L592F	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Missense_Mutation_p.L193F	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	592	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					AATCACCAGCCAAGATGTCAG	0.393													15	164	---	---	---	---	PASS
ZCCHC2	54877	broad.mit.edu	37	18	60242521	60242521	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60242521C>A	uc002lip.3	+	13	3207	c.3207C>A	c.(3205-3207)AAC>AAA	p.N1069K	ZCCHC2_uc002lio.2_RNA|ZCCHC2_uc002liq.2_Missense_Mutation_p.N539K	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1069					cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						GCAATGGAAACCAACTTCCTT	0.488													3	38	---	---	---	---	PASS
ZCCHC2	54877	broad.mit.edu	37	18	60242522	60242522	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60242522C>A	uc002lip.3	+	13	3208	c.3208C>A	c.(3208-3210)CAA>AAA	p.Q1070K	ZCCHC2_uc002lio.2_RNA|ZCCHC2_uc002liq.2_Missense_Mutation_p.Q540K	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1070					cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						CAATGGAAACCAACTTCCTTT	0.493													3	37	---	---	---	---	PASS
ZNF844	284391	broad.mit.edu	37	19	12187443	12187443	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12187443C>G	uc002mtb.2	+	4	1651	c.1508C>G	c.(1507-1509)CCT>CGT	p.P503R	ZNF844_uc010dym.1_Missense_Mutation_p.P346R	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	503					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGAGAAACCCTATGAGTGTA	0.413													5	143	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40398046	40398046	+	Silent	SNP	A	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40398046A>G	uc002omp.3	-	14	6929	c.6921T>C	c.(6919-6921)TGT>TGC	p.C2307C		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2307						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCACTGCAGGACAGAGGCCTC	0.692													16	106	---	---	---	---	PASS
CEACAM6	4680	broad.mit.edu	37	19	42265986	42265986	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42265986G>C	uc002orm.2	+	4	962	c.813G>C	c.(811-813)TGG>TGC	p.W271C		NM_002483	NP_002474	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion	271	Ig-like C2-type 2.				cell-cell signaling|signal transduction	anchored to membrane|integral to plasma membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		AGTACTCTTGGTTTATCAATG	0.502													4	160	---	---	---	---	PASS
LYPD4	147719	broad.mit.edu	37	19	42341277	42341277	+	Silent	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42341277G>A	uc002orp.1	-	5	1665	c.681C>T	c.(679-681)TCC>TCT	p.S227S	LYPD4_uc002orq.1_Silent_p.S192S	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	227						anchored to membrane|plasma membrane				ovary(1)	1						CTTGCCTGGAGGATGCTGCAC	0.488													76	183	---	---	---	---	PASS
TRPM2	7226	broad.mit.edu	37	21	45811218	45811218	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45811218C>A	uc002zet.1	+	12	1717	c.1504C>A	c.(1504-1506)CTC>ATC	p.L502I	TRPM2_uc002zeu.1_Missense_Mutation_p.L502I|TRPM2_uc002zew.1_Missense_Mutation_p.L502I|TRPM2_uc010gpt.1_Missense_Mutation_p.L502I|TRPM2_uc002zex.1_Missense_Mutation_p.L288I|TRPM2_uc002zey.1_Missense_Mutation_p.L15I	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	502	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GTTTGTGAAGCTCTTCCTGGA	0.547													5	196	---	---	---	---	PASS
NONO	4841	broad.mit.edu	37	X	70511822	70511822	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70511822G>T	uc004dzo.2	+	5	1058	c.348G>T	c.(346-348)TTG>TTT	p.L116F	BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Missense_Mutation_p.L116F|NONO_uc004dzp.2_Missense_Mutation_p.L116F|NONO_uc011mpv.1_Missense_Mutation_p.L27F|NONO_uc004dzq.2_5'Flank	NM_001145408	NP_001138880	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	116	DBHS.|RRM 1.				DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)					TTATCCGCTTGGTGAGCAACT	0.413			T	TFE3	papillary renal cancer								4	129	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101092585	101092585	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101092585T>A	uc011mrk.1	-	15	1321	c.961A>T	c.(961-963)AAC>TAC	p.N321Y	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	321	NTF2; truncated.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						GAGTCCACGTTTCGTGGACAT	0.537													99	61	---	---	---	---	PASS
FAM45B	55855	broad.mit.edu	37	X	129629950	129629950	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129629950G>A	uc010nrh.2	+	1	1036	c.818G>A	c.(817-819)GGC>GAC	p.G273D	uc004evu.2_Intron	NM_207009	NP_996892			hypothetical protein LOC404636											skin(1)	1				all cancers(201;0.0293)		ATGGCAATGGGCAAACTGCAC	0.448													4	184	---	---	---	---	PASS
PRRG3	79057	broad.mit.edu	37	X	150869436	150869436	+	Silent	SNP	C	T	T	rs149940899	byFrequency	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150869436C>T	uc004few.1	+	4	1017	c.627C>T	c.(625-627)AGC>AGT	p.S209S		NM_024082	NP_076987	Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3	209	Cytoplasmic (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					AGGAGGCCAGCGTGTCTTACA	0.617													4	99	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3519075	3519075	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3519075delT	uc001akl.2	-	2	448	c.221delA	c.(220-222)AAGfs	p.K74fs		NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor	74	EMI.					extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		ACAGCCGGCCTTCCACACCGG	0.687													62	28	---	---	---	---	
KAZ	23254	broad.mit.edu	37	1	15005781	15005781	+	Intron	DEL	T	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15005781delT	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						ttgttgggtcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37597429	37597432	+	IGR	DEL	CTTC	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37597429_37597432delCTTC								GRIK3 (97585 upstream) : ZC3H12A (342687 downstream)																							ttccttccttcttccttccttcct	0.069													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62443869	62443872	+	Intron	DEL	CTTC	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62443869_62443872delCTTC	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						ATCTTCATATcttccttccttcct	0.147													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111248104	111248106	+	IGR	DEL	AAC	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111248104_111248106delAAC								KCNA3 (30449 upstream) : CD53 (165715 downstream)																							acatacccaaaacaacaacaaca	0.000													4	2	---	---	---	---	
IQGAP3	128239	broad.mit.edu	37	1	156530966	156530966	+	Intron	DEL	T	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156530966delT	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTATTAACCGttttttttttt	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	247622015	247622016	+	IGR	DEL	GT	-	-	rs147013127	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247622015_247622016delGT								OR2B11 (6731 upstream) : OR2W5 (32414 downstream)																							CTGgtgtgtggtgtgtgtgtgt	0.144													4	2	---	---	---	---	
KIDINS220	57498	broad.mit.edu	37	2	8933763	8933764	+	Intron	INS	-	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8933763_8933764insT	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					gagatgaggtctcactatactg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71004413	71004414	+	IGR	INS	-	A	A	rs55926232		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71004413_71004414insA								ADD2 (9084 upstream) : FIGLA (28 downstream)																							aactctatctcaaaaaaaaaaa	0.163													7	4	---	---	---	---	
IL1RN	3557	broad.mit.edu	37	2	113877917	113877918	+	Intron	INS	-	TATG	TATG	rs4251988		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113877917_113877918insTATG	uc002tiz.2	+						IL1RN_uc002tix.1_Intron|IL1RN_uc002tiy.2_Intron|IL1RN_uc002tja.2_Intron	NM_173841	NP_776213	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist isoform 2						immune response|inflammatory response|response to glucocorticoid stimulus	centrosome|extracellular space|nucleus|plasma membrane	cytokine activity|interleukin-1 receptor antagonist activity			skin(2)	2					Anakinra(DB00026)	TGTGATTGCTCtatgtatgtat	0.282									Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				8	4	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170100146	170100146	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170100146delA	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACATGGGTTCAAAATTCTTTT	0.338													47	21	---	---	---	---	
SATB2	23314	broad.mit.edu	37	2	200208979	200208980	+	Intron	DEL	AC	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200208979_200208980delAC	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						cacacacacaacacacacacac	0.332													4	2	---	---	---	---	
KIAA1486	57624	broad.mit.edu	37	2	226377346	226377347	+	Intron	INS	-	TCCT	TCCT	rs150939276	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226377346_226377347insTCCT	uc002voe.2	+						KIAA1486_uc010fxa.1_Intron	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		tttactttttctccttccttcc	0.015													6	5	---	---	---	---	
DIS3L2	129563	broad.mit.edu	37	2	232937494	232937495	+	Intron	DEL	GT	-	-	rs55937024	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232937494_232937495delGT	uc010fxz.2	+						DIS3L2_uc002vsm.3_Intron|DIS3L2_uc002vsn.1_Intron|DIS3L2_uc002vso.2_Intron	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.								exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		gggatgtggggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75449778	75449779	+	IGR	INS	-	TCTC	TCTC	rs147246223	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75449778_75449779insTCTC								CNTN3 (879435 upstream) : FAM86D (20926 downstream)																							ctttctttctttctctctctct	0.000													4	2	---	---	---	---	
ROBO2	6092	broad.mit.edu	37	3	77459838	77459838	+	Intron	DEL	T	-	-	rs143772782	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77459838delT	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		cctcctcctcttcctcctcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	103017213	103017216	+	IGR	DEL	CTTC	-	-	rs144334743	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103017213_103017216delCTTC								ZPLD1 (818528 upstream) : None (None downstream)																							tgcttgcttgcttccttccttcct	0.098													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107973477	107973480	+	IGR	DEL	GTGT	-	-	rs35038126		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107973477_107973480delGTGT								IFT57 (32060 upstream) : HHLA2 (41913 downstream)																							ttttatgtgcgtgtgtgtgtgtgt	0.029													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	118075114	118075115	+	IGR	INS	-	GAAG	GAAG	rs141057827	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118075114_118075115insGAAG								TRAM1L1 (68378 upstream) : NDST3 (879658 downstream)																							aaggaaggaaagaaggaaggaa	0.000													5	5	---	---	---	---	
SDHA	6389	broad.mit.edu	37	5	251704	251704	+	Intron	DEL	G	-	-	rs111797600		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:251704delG	uc003jao.3	+						SDHA_uc011clv.1_Frame_Shift_Del_p.A639fs|SDHA_uc011clw.1_Intron|SDHA_uc003jap.3_Intron|SDHA_uc003jaq.3_Intron|SDHA_uc003jar.3_Intron	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TCCAAAAAATGCCTTTTTCCC	0.517									Familial_Paragangliomas				3	4	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11233829	11233830	+	Intron	DEL	TG	-	-	rs138434040		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11233829_11233830delTG	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TTTACgtgtctgtgtgtgtgtg	0.312													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44688706	44688713	+	IGR	DEL	AGGAAAGG	-	-	rs11279833		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44688706_44688713delAGGAAAGG								FGF10 (299922 upstream) : MRPS30 (120314 downstream)																							gaaggaaggaaggaaaggaaggaaggaa	0.000													4	5	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66215807	66215808	+	Intron	DEL	TC	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66215807_66215808delTC	uc003jut.1	+						MAST4_uc003jur.3_Intron|MAST4_uc010iwz.2_Intron|MAST4_uc003jus.2_Intron	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		cttccttctttctctctctctc	0.149													6	3	---	---	---	---	
RAD17	5884	broad.mit.edu	37	5	68669513	68669514	+	Intron	DEL	AT	-	-	rs60134751		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68669513_68669514delAT	uc003jwo.2	+						RAD17_uc003jwg.2_Intron|RAD17_uc003jwh.2_Intron|RAD17_uc003jwi.2_Intron|RAD17_uc003jwj.2_Intron|RAD17_uc003jwk.2_Intron|RAD17_uc003jwl.2_Intron|RAD17_uc003jwm.2_Intron|RAD17_uc003jwn.2_Intron	NM_133339	NP_579917	O75943	RAD17_HUMAN	RAD17 homolog isoform 2						cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		tctcaaaaaaattttttttttt	0.104								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105462856	105462857	+	IGR	INS	-	ACAC	ACAC	rs140944797	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105462856_105462857insACAC								None (None upstream) : None (None downstream)																							atctctactaaacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124187225	124187228	+	IGR	DEL	CTTT	-	-	rs111256114		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124187225_124187228delCTTT								ZNF608 (102725 upstream) : None (None downstream)																							tccttccttcctttcttccttcct	0.029													4	5	---	---	---	---	
AFAP1L1	134265	broad.mit.edu	37	5	148685442	148685447	+	Intron	DEL	CACACA	-	-	rs71997331		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148685442_148685447delCACACA	uc003lqh.2	+						AFAP1L1_uc003lqg.3_Intron|AFAP1L1_uc010jgy.2_Intron	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1								protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCAacacaccacacacacacacaca	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	162694152	162694153	+	IGR	INS	-	TGTTGT	TGTTGT	rs147329196	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162694152_162694153insTGTTGT								None (None upstream) : CCNG1 (170424 downstream)																							ccccctataaatgttgttgttg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29384869	29384870	+	IGR	DEL	AT	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29384869_29384870delAT								OR12D2 (19422 upstream) : OR11A1 (8412 downstream)																							ATCATAACAGatatatatatat	0.292													4	2	---	---	---	---	
LOC285830	285830	broad.mit.edu	37	6	29716073	29716073	+	Intron	DEL	G	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29716073delG	uc003nnp.2	-						LOC285830_uc011dlz.1_Intron|LOC285830_uc003rsi.3_Intron	NR_026972				Homo sapiens cDNA FLJ35429 fis, clone SMINT2002126.												0						AGAATGAGCTGGGGATGAGAG	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29770021	29770021	+	IGR	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29770021delA								HCG4 (9171 upstream) : HLA-G (24735 downstream)																							TAGGGGTGGGAAGAGTGATCC	0.532													4	2	---	---	---	---	
SNX14	57231	broad.mit.edu	37	6	86251852	86251852	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86251852delA	uc003pkr.2	-						SNX14_uc003pkp.2_Intron|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		CAGTTTTGGGAAAAAAAAAAA	0.274													4	2	---	---	---	---	
MLLT4	4301	broad.mit.edu	37	6	168307554	168307558	+	Intron	DEL	TACTT	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168307554_168307558delTACTT	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwf.2_Intron	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		ACTATTAATGTACTTTCAGAAAAAT	0.346			T	MLL	AL								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20042913	20042916	+	IGR	DEL	AAAT	-	-	rs148399376		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20042913_20042916delAAAT								TMEM196 (229697 upstream) : MACC1 (131372 downstream)																							GGGCTACAAAaaataaataaataa	0.299													4	2	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	28037690	28037691	+	Intron	INS	-	AGGCAGGC	AGGCAGGC	rs62449874	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28037690_28037691insAGGCAGGC	uc003szn.2	-							NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						ggaaggaaggaaggcaggcagg	0.054			T	SUZ12	endometrial stromal tumours								3	5	---	---	---	---	
SHFM1	7979	broad.mit.edu	37	7	96339292	96339292	+	5'Flank	DEL	T	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96339292delT	uc003uoi.2	-						SHFM1_uc010lfn.1_5'Flank	NM_006304	NP_006295	P60896	DSS1_HUMAN	split hand/foot malformation type 1						proteolysis	proteasome complex	peptidase activity|protein binding				0	all_cancers(62;4.24e-09)|all_epithelial(64;5.59e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0353)|Lung NSC(181;0.0987)					GTAGAGGTGAttttttttttt	0.458								Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98401059	98401095	+	IGR	DEL	AAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGGAAGG	-	-	rs72367709	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98401059_98401095delAAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGGAAGG								NPTX2 (141878 upstream) : TMEM130 (43017 downstream)																							gaaagaaagaaagaaagaaagaaagaaagaaaagaaagaaaggaaggaaggaaggaa	0.152													4	3	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100369720	100369721	+	Intron	INS	-	T	T			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100369720_100369721insT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron|ZAN_uc011kke.1_5'Flank	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			cctctaaattcttttttttttt	0.257													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	113229609	113229610	+	IGR	DEL	TG	-	-	rs72393021		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113229609_113229610delTG								LOC401397 (470972 upstream) : PPP1R3A (287272 downstream)																							AACTATATACtgtgtgtgtgtg	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	135960078	135960079	+	IGR	INS	-	CTTCCTTCCCTCCTTCCTTCCCTCCTTCCTTCCTTCCTTT	CTTCCTTCCCTCCTTCCTTCCCTCCTTCCTTCCTTCCTTT	rs71740710		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135960078_135960079insCTTCCTTCCCTCCTTCCTTCCCTCCTTCCTTCCTTCCTTT								LUZP6 (297874 upstream) : CHRM2 (593320 downstream)																							tccctccctcccttccttccct	0.000													4	2	---	---	---	---	
UBN2	254048	broad.mit.edu	37	7	138969521	138969521	+	Intron	DEL	T	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138969521delT	uc011kqr.1	+							NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2											ovary(1)|skin(1)	2						GGGATATGGATTTTTTTTTTT	0.388													4	2	---	---	---	---	
ZNF398	57541	broad.mit.edu	37	7	148860287	148860290	+	Intron	DEL	TTTG	-	-	rs1202446	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148860287_148860290delTTTG	uc003wfl.2	+						ZNF398_uc011kul.1_Intron|ZNF398_uc011kum.1_Intron	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform a						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			AAATACCTGTtttgtttgtttgtt	0.201													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53922742	53922742	+	IGR	DEL	C	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53922742delC								NPBWR1 (69289 upstream) : OPRK1 (215534 downstream)																							ctttcttcttctttttttttt	0.000													8	5	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20995359	20995360	+	Intron	INS	-	AA	AA			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20995359_20995360insAA	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		CAGGGTAACTTAAAAAAAAAAA	0.238													4	2	---	---	---	---	
SUGT1P1	441394	broad.mit.edu	37	9	33449647	33449647	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33449647delA	uc010mjq.1	-						AQP3_uc003zsv.1_5'Flank|AQP3_uc003zsx.2_5'Flank|AQP3_uc010mju.2_5'Flank	NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0						actccatctcaaaaaaaaaaa	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90812210	90812211	+	IGR	INS	-	CCTTCCTT	CCTTCCTT	rs141152980	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90812210_90812211insCCTTCCTT								CDK20 (222543 upstream) : SPIN1 (190629 downstream)																							cttccttccttcctccctccct	0.248													4	2	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127360949	127360949	+	Intron	DEL	C	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127360949delC	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						aaaaaaaaaacaaggaaggga	0.274													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132207762	132207762	+	IGR	DEL	T	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132207762delT								C9orf106 (122880 upstream) : C9orf50 (166744 downstream)																							ccttccttccttccttccttc	0.020													3	3	---	---	---	---	
UCMA	221044	broad.mit.edu	37	10	13269743	13269744	+	Intron	INS	-	AC	AC	rs147171864	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13269743_13269744insAC	uc001imd.2	-							NM_145314	NP_660357	Q8WVF2	UCMA_HUMAN	upper zone of growth plate and cartilage matrix							proteinaceous extracellular matrix					0						ggaaaggaaaTacacacacaca	0.158													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19414308	19414311	+	IGR	DEL	TTCC	-	-	rs10450313	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19414308_19414311delTTCC								ARL5B (447368 upstream) : PLXDC2 (691061 downstream)																							ctttctttctttccttccttcctt	0.069													5	6	---	---	---	---	
TET1	80312	broad.mit.edu	37	10	70381974	70381989	+	Intron	DEL	CCTTCCCTCCTTCCTC	-	-	rs12777015	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70381974_70381989delCCTTCCCTCCTTCCTC	uc001jok.3	+							NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						ttccttccttccttccctccttcctcccttccctcc	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71184176	71184177	+	IGR	DEL	AC	-	-	rs150672022		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71184176_71184177delAC								TACR2 (7502 upstream) : TSPAN15 (27049 downstream)																							ggcagaagtgacacacacacac	0.000													4	2	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105186868	105186868	+	Intron	DEL	A	-	-	rs75558099		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105186868delA	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		cttgtcccagaaaaaaaaaaa	0.209													4	2	---	---	---	---	
TSG101	7251	broad.mit.edu	37	11	18511618	18511619	+	Intron	DEL	GA	-	-	rs77974643		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18511618_18511619delGA	uc001mor.2	-							NM_006292	NP_006283	Q99816	TS101_HUMAN	tumor susceptibility gene 101						cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0						TGACCAATCTGAGTTTTAGAAT	0.332													4	2	---	---	---	---	
ATM	472	broad.mit.edu	37	11	108206869	108206869	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108206869delA	uc001pkb.1	+						ATM_uc009yxr.1_Intron|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		acaaaaagttaaaaaaaaaaa	0.000			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109282713	109282716	+	IGR	DEL	GTGT	-	-	rs60726511		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109282713_109282716delGTGT								DDX10 (471067 upstream) : C11orf87 (10159 downstream)																							gtatatgcgcgtgtgtgtgtgtgt	0.176													4	2	---	---	---	---	
C11orf1	64776	broad.mit.edu	37	11	111754316	111754317	+	Intron	INS	-	A	A	rs75371222		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111754316_111754317insA	uc001pmd.2	+						C11orf1_uc001pme.2_Intron	NM_022761	NP_073598	Q9H5F2	CK001_HUMAN	hypothetical protein LOC64776							nucleus					0		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		gactctatctcaaaaaaaaaaa	0.124													3	3	---	---	---	---	
C12orf4	57102	broad.mit.edu	37	12	4645565	4645565	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4645565delA	uc001qms.2	-						C12orf4_uc001qmt.2_Intron|RAD51AP1_uc001qmw.2_5'Flank|RAD51AP1_uc001qmu.2_5'Flank|RAD51AP1_uc001qmv.2_5'Flank|RAD51AP1_uc010sep.1_5'Flank|RAD51AP1_uc010seq.1_5'Flank	NM_020374	NP_065107	Q9NQ89	CL004_HUMAN	hypothetical protein LOC57102												0			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		GTGCTTCTTTAAAAAAAAAAA	0.303													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	15056001	15056002	+	IGR	INS	-	AC	AC	rs149647854	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15056001_15056002insAC								MGP (17173 upstream) : ERP27 (10975 downstream)																							TTCCTAGGGAAacacacacaca	0.287													3	4	---	---	---	---	
SLC11A2	4891	broad.mit.edu	37	12	51388601	51388601	+	Intron	DEL	C	-	-	rs11353962		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51388601delC	uc001rxe.3	-						SLC11A2_uc001rxd.3_Intron|SLC11A2_uc001rxc.3_Intron|SLC11A2_uc001rxf.2_Intron|SLC11A2_uc001rxg.1_5'UTR|SLC11A2_uc010smx.1_Intron|SLC11A2_uc001rxh.1_Intron|SLC11A2_uc001rxj.1_Intron|SLC11A2_uc001rxi.2_Intron|SLC11A2_uc001rxk.1_Intron|SLC11A2_uc010smy.1_Intron	NM_000617	NP_000608	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled						activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1						TCCTTCTACACCCACAGGTCA	0.428													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115078357	115078360	+	IGR	DEL	CCTT	-	-	rs7139366		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115078357_115078360delCCTT								TBX5 (232110 upstream) : TBX3 (29699 downstream)																							ccttttcttcccttcctttctttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20444690	20444691	+	IGR	INS	-	CTTC	CTTC	rs145125818	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20444690_20444691insCTTC								ZMYM5 (6914 upstream) : ZMYM2 (88119 downstream)																							tttctttctttcttccttcctt	0.005													4	2	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114772787	114772788	+	Intron	INS	-	CC	CC			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114772787_114772788insCC	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			cttacccttctcccctcctgcc	0.089													3	3	---	---	---	---	
SOS2	6655	broad.mit.edu	37	14	50623682	50623683	+	Intron	DEL	TA	-	-	rs3736761		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50623682_50623683delTA	uc001wxs.3	-						SOS2_uc010tql.1_Intron|SOS2_uc010tqm.1_Intron|SOS2_uc001wxt.2_Frame_Shift_Del_p.Y385fs	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					tatatatgtgtatatatatata	0.287													4	4	---	---	---	---	
KIAA1409	57578	broad.mit.edu	37	14	93979562	93979569	+	Intron	DEL	TTCCTTCT	-	-	rs67292676		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93979562_93979569delTTCCTTCT	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron|KIAA1409_uc001ybu.1_Intron	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ccttccttccttccttctttccttcctt	0.058													4	3	---	---	---	---	
SIN3A	25942	broad.mit.edu	37	15	75664693	75664693	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75664693delA	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						TTCTTAAAAGAAAAAAAAAAG	0.343													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15130333	15130334	+	3'UTR	INS	-	AT	AT	rs149816223	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15130333_15130334insAT	uc002dda.3	+	23					PDXDC1_uc010uzl.1_3'UTR|PDXDC1_uc010uzm.1_3'UTR|PDXDC1_uc002ddb.3_3'UTR|PDXDC1_uc010uzn.1_3'UTR|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGTAGAACCACGTTTGCTGTCC	0.416													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	17574952	17574957	+	IGR	DEL	ACACAC	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17574952_17574957delACACAC								XYLT1 (10214 upstream) : NOMO2 (936226 downstream)																							agcccttctaacacacacacacacac	0.000													5	3	---	---	---	---	
PRKCB	5579	broad.mit.edu	37	16	23878383	23878384	+	Intron	INS	-	TT	TT	rs113849948		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23878383_23878384insTT	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	ctctctctctctctttctttct	0.005													4	2	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1385942	1385943	+	Intron	INS	-	GCACTG	GCACTG			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1385942_1385943insGCACTG	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCTCCCCTCCCGCACTGGGctt	0.356													4	2	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7658285	7658285	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7658285delA	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTGAGGCAGAAAAAAAAAAA	0.333													4	2	---	---	---	---	
CDK5RAP3	80279	broad.mit.edu	37	17	46055435	46055436	+	Intron	INS	-	T	T	rs71366815		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46055435_46055436insT	uc002imr.2	+						CDK5RAP3_uc010wlc.1_Intron|CDK5RAP3_uc002imq.1_Intron|CDK5RAP3_uc002imu.2_Intron|CDK5RAP3_uc002ims.2_Intron|CDK5RAP3_uc002imv.2_Intron|CDK5RAP3_uc002imw.2_Intron|CDK5RAP3_uc002imx.2_Intron	NM_176096	NP_788276	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding				0						ACCAAGAGAGGttttttttttt	0.223													3	3	---	---	---	---	
HOXB5	3215	broad.mit.edu	37	17	46671172	46671173	+	5'Flank	INS	-	G	G			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46671172_46671173insG	uc002inr.2	-							NM_002147	NP_002138	P09067	HXB5_HUMAN	homeobox B5							nucleus	sequence-specific DNA binding				0						CGGCCAAATATGGGGGGGGGGT	0.470											OREG0024519	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482169	59482169	+	Intron	DEL	C	-	-	rs35619711		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482169delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R354fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						GAGGTGGCGGCGGGGGGTCCT	0.706													5	3	---	---	---	---	
LLGL2	3993	broad.mit.edu	37	17	73568905	73568906	+	Intron	INS	-	A	A			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73568905_73568906insA	uc002joh.2	+						LLGL2_uc002joi.2_Intron|LLGL2_uc010dgg.1_Intron|LLGL2_uc002joj.2_Intron|LLGL2_uc010wsd.1_Intron	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c						cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			catctcggaggaaaaaaaaaaa	0.262													4	3	---	---	---	---	
RNF125	54941	broad.mit.edu	37	18	29616521	29616524	+	Intron	DEL	AAGG	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29616521_29616524delAAGG	uc002kxf.1	+							NM_017831	NP_060301	Q96EQ8	RN125_HUMAN	ring finger protein 125						negative regulation of type I interferon production	intracellular	ligase activity|zinc ion binding				0						CTTGACCAGAaaggaaggaaggaa	0.147													10	6	---	---	---	---	
MPND	84954	broad.mit.edu	37	19	4348251	4348251	+	Intron	DEL	C	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4348251delC	uc002mae.2	+						MPND_uc010dtx.2_Intron|MPND_uc002mag.2_Intron|MPND_uc002maf.2_Intron|MPND_uc002mah.2_Intron|MPND_uc002mai.2_Intron	NM_032868	NP_116257	Q8N594	MPND_HUMAN	MPN domain containing isoform 1								peptidase activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGCAAAtttctttttttttt	0.114													6	5	---	---	---	---	
SH2D3A	10045	broad.mit.edu	37	19	6760567	6760567	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6760567delA	uc002mft.2	-						SH2D3A_uc010xjg.1_Intron	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A						JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						agactcagtcaaaaaaaaaaa	0.234													4	4	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153044	7153045	+	Intron	INS	-	ACCACACAT	ACCACACAT	rs137972884	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153044_7153045insACCACACAT	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	acaccacacacacacacaccac	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34453263	34453266	+	IGR	DEL	GAAG	-	-	rs79488802		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34453263_34453266delGAAG								KCTD15 (146598 upstream) : LSM14A (210086 downstream)																							aggaagaaaagaaggaaggaagga	0.039													4	2	---	---	---	---	
PHLDB3	653583	broad.mit.edu	37	19	44005877	44005880	+	Intron	DEL	CAAA	-	-	rs112058634		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44005877_44005880delCAAA	uc002own.3	-						PHLDB3_uc002owo.2_Intron	NM_198850	NP_942147	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B,												0		Prostate(69;0.0153)				CCCGGTGAGCCAAACAGACCTGTT	0.672													2	7	---	---	---	---	
HSD17B14	51171	broad.mit.edu	37	19	49318109	49318110	+	Intron	DEL	AG	-	-	rs4002563		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49318109_49318110delAG	uc002pkv.1	-						HSD17B14_uc010emk.1_Intron	NM_016246	NP_057330	Q9BPX1	DHB14_HUMAN	dehydrogenase/reductase (SDR family) member 10						steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity				0		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		aaaaaaaaaaagaaaagaaaag	0.213													4	2	---	---	---	---	
FCAR	2204	broad.mit.edu	37	19	55400739	55400739	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55400739delA	uc002qhr.1	+						FCAR_uc002qhs.1_Intron|FCAR_uc002qht.1_Intron|FCAR_uc010esi.1_Intron|FCAR_uc002qhu.1_Intron|FCAR_uc002qhv.1_Intron|FCAR_uc002qhw.1_Intron|FCAR_uc002qhx.1_Intron|FCAR_uc002qhy.1_Intron|FCAR_uc002qhz.1_Intron|FCAR_uc002qia.1_Intron	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		actccatctcaaaaaaaaaaa	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3398848	3398849	+	IGR	DEL	AC	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3398848_3398849delAC								C20orf194 (10261 upstream) : ATRN (52816 downstream)																							ataacaacatacacacacacac	0.000													4	2	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20243445	20243446	+	Intron	DEL	TG	-	-	rs79559760	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243445_20243446delTG	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CACCTGTTTTTGTGTTTTTTTT	0.223													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25738717	25738718	+	IGR	DEL	CT	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25738717_25738718delCT								ZNF337 (61248 upstream) : FAM182B (5384 downstream)																							TCAATGAAACCTTCTGTGGCAG	0.520													4	2	---	---	---	---	
C20orf24	55969	broad.mit.edu	37	20	35240822	35240823	+	3'UTR	INS	-	ATCA	ATCA	rs142502467	by1000genomes	TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35240822_35240823insATCA	uc002xfq.2	+	4					C20orf24_uc002xfo.2_3'UTR|C20orf24_uc002xfp.2_3'UTR|C20orf24_uc002xft.2_RNA|C20orf24_uc002xfr.2_3'UTR|C20orf24_uc002xfs.2_3'UTR	NM_018840	NP_061328	Q9BUV8	CT024_HUMAN	RAB5-interacting protein isoform a								protein binding				0	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GTTTTTAAACTATCAATGGCAT	0.396													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55357327	55357337	+	IGR	DEL	GGAGGAAGGAA	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55357327_55357337delGGAGGAAGGAA								TFAP2C (142991 upstream) : BMP7 (386472 downstream)																							aaagaaggagggaggaaggaaggaggaagga	0.019													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	23605003	23605003	+	IGR	DEL	A	-	-	rs66463347		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23605003delA								NCAM2 (693789 upstream) : None (None downstream)																							ggaaggaaggaaaagaaggaa	0.169													5	6	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43226451	43226452	+	Intron	INS	-	CCG	CCG			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43226451_43226452insCCG	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						caccatcaccatcaccaccacc	0.000													4	2	---	---	---	---	
PPM1F	9647	broad.mit.edu	37	22	22278054	22278054	+	Intron	DEL	T	-	-	rs75904175		TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22278054delT	uc002zvp.1	-						PPM1F_uc011aik.1_Intron	NM_014634	NP_055449	P49593	PPM1F_HUMAN	protein phosphatase 1F						apoptosis|protein dephosphorylation	protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(2)|large_intestine(1)|breast(1)|kidney(1)	5	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		GAGCTCCCCCtttttttcttt	0.299													4	2	---	---	---	---	
DKC1	1736	broad.mit.edu	37	X	153994771	153994771	+	Intron	DEL	A	-	-			TCGA-BP-5200-01A-01D-1429-08	TCGA-BP-5200-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153994771delA	uc004fmm.2	+						DKC1_uc010nvf.2_Intron|SNORA36A_uc004fmn.2_5'Flank	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1						cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTCATTAAGAAAAAAAAAAA	0.418									Congenital_Dyskeratosis				4	2	---	---	---	---	
