Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_Position	End_Position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_File	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	chromosome_name	start	stop	reference	variant	type	gene_name	transcript_name	transcript_species	transcript_source	transcript_version	strand	transcript_status	trv_type	c_position	amino_acid_change	ucsc_cons	domain	all_domains	deletion_substructures	transcript_error	NormalRefReads_WU	NormalVarReads_WU	NormalVAF_WU	TumorRefReads_WU	TumorVarReads_WU	TumorVAF_WU	RNARefReads_WU	RNAVarReads_WU	RNAVAF_WU
STAG2	0	genome.wustl.edu	36	X	123027969	123027969	+	Splice_Site	SNP	T	T	C			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	X	123027969	123027969	T	C	SNP	STAG2	NM_001042749.1	human	genbank	54_36p	+1	validated	splice_site	c.2265+2	e21+2	1.000	-	-	-	no_errors	63	2	3.08	11	64	85.33	0	100	100.00
ATP2B2	0	genome.wustl.edu	36	3	10362072	10362072	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	3	10362072	10362072	G	A	SNP	ATP2B2	NM_001001331.2	human	genbank	54_36p	-1	reviewed	missense	c.2699	p.T900M	1.000	superfamily_Calcium ATPase transmembrane domain M	HMMPfam_Cation_ATPase_N,HMMPfam_Hydrolase,HMMPfam_Cation_ATPase_C,HMMPfam_E1-E2_ATPase,PatternScan_ATPASE_E1_E2,superfamily_HAD-like,superfamily_Calcium ATPase transduction domain A,superfamily_Metal cation-transporting ATPase ATP-binding domain N,superfamily_Calcium ATPase transmembrane domain M	-	no_errors	375	14	3.60	125	77	38.12	NA	NA	NA
MST1	0	genome.wustl.edu	36	3	49698920	49698920	+	Splice_Site	SNP	T	T	G			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	3	49698920	49698920	T	G	SNP	MST1	NM_020998.3	human	genbank	54_36p	-1	validated	splice_site	c.806-2	e8-2	0.046	-	-	-	no_errors	66	2	2.94	29	12	29.27	0	0	0.00
ADAMTS9	0	genome.wustl.edu	36	3	64507612	64507612	+	Silent	SNP	A	A	T			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	3	64507612	64507612	A	T	SNP	ADAMTS9	NM_182920.1	human	genbank	54_36p	-1	reviewed	silent	c.4926	p.I1642	1.000	HMMSmart_SM00209,superfamily_TSP-1 type 1 repeat	"HMMPfam_TSP_1,HMMSmart_SM00209,superfamily_TSP-1 type 1 repeat,HMMPfam_Reprolysin,HMMPfam_Pep_M12B_propep,HMMPfam_ADAM_spacer1,HMMPfam_GON,superfamily_Metalloproteases (""zincins"") catalytic domain"	-	no_errors	130	5	3.60	150	148	49.50	NA	NA	NA
RGNEF	0	genome.wustl.edu	36	5	73172319	73172319	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	5	73172319	73172319	C	A	SNP	RGNEF	NM_001080479.1	human	genbank	54_36p	+1	provisional	missense	c.1405	p.Q469K	0.990	NULL	HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_DBL homology domain (DH-domain),HMMPfam_PH,HMMSmart_SM00233,HMMPfam_C1_1,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,superfamily_PH domain-like,superfamily_Cysteine-rich domain	-	no_errors	118	5	4.07	76	66	45.21	NA	NA	NA
EPPK1	0	genome.wustl.edu	36	8	145012319	145012319	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	8	145012319	145012319	C	T	SNP	EPPK1	NM_031308.1	human	genbank	54_36p	-1	provisional	missense	c.7016	p.R2339Q	0.999	HMMPfam_Plectin,HMMSmart_SM00250,superfamily_Plakin repeat	HMMPfam_Plectin,HMMSmart_SM00250,superfamily_Plakin repeat	-	no_stop_codon:bad_bp_length_for_coding_region	113	0	0.00	36	6	13.95	1	0	0.00
WT1	0	genome.wustl.edu	36	11	32374378	32374378	+	Splice_Site	SNP	C	C	G			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	11	32374378	32374378	C	G	SNP	WT1	NM_024426.3	human	genbank	54_36p	-1	reviewed	splice_site	c.1249+1	e7+1	1.000	-	-	-	no_errors	150	18	10.71	8	69	89.61	0	5	100.00
ALPK3	0	genome.wustl.edu	36	15	83202210	83202210	+	Silent	SNP	G	G	A			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	15	83202210	83202210	G	A	SNP	ALPK3	NM_020778.4	human	genbank	54_36p	+1	validated	silent	c.3843	p.E1281	0.865	NULL	HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_Alpha_kinase,HMMSmart_SM00811,superfamily_Protein kinase-like (PK-like),HMMPfam_I-set,superfamily_Immunoglobulin	-	no_errors	122	4	3.17	80	70	46.36	NA	NA	NA
ADAMTS17	0	genome.wustl.edu	36	15	98406586	98406586	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	15	98406586	98406586	G	A	SNP	ADAMTS17	NM_139057.2	human	genbank	54_36p	-1	reviewed	missense	c.2590	p.R864W	0.986	HMMPfam_TSP_1,HMMSmart_SM00209,superfamily_TSP-1 type 1 repeat	"HMMPfam_TSP_1,HMMSmart_SM00209,superfamily_TSP-1 type 1 repeat,HMMPfam_Reprolysin,HMMPfam_Pep_M12B_propep,HMMSmart_SM00608,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_ADAM_spacer1,HMMPfam_PLAC,superfamily_Metalloproteases (""zincins"") catalytic domain"	-	no_errors	208	17	7.52	61	38	38.38	NA	NA	NA
ZNF646	0	genome.wustl.edu	36	16	30997770	30997770	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	16	30997770	30997770	C	T	SNP	ZNF646	NM_014699.3	human	genbank	54_36p	+1	validated	missense	c.2624	p.A875V	0.122	NULL	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	-	no_errors	385	49	11.24	43	38	45.78	3	7	70.00
TOX3	0	genome.wustl.edu	36	16	51037488	51037488	+	Silent	SNP	A	A	T			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	16	51037488	51037488	A	T	SNP	TOX3	NM_001080430.1	human	genbank	54_36p	-1	provisional	silent	c.825	p.G275	0.973	HMMPfam_HMG_box,HMMSmart_HMG,superfamily_HMG-box	HMMPfam_HMG_box,HMMSmart_HMG,superfamily_HMG-box	-	no_errors	364	10	2.67	224	152	40.11	NA	NA	NA
HSD17B1	0	genome.wustl.edu	36	17	37960014	37960014	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	17	37960014	37960014	A	G	SNP	HSD17B1	NM_000413.2	human	genbank	54_36p	+1	validated	missense	c.605	p.E202G	0.008	superfamily_NAD(P)-binding Rossmann-fold domains	HMMPfam_adh_short,PatternScan_ADH_SHORT,superfamily_NAD(P)-binding Rossmann-fold domains	-	no_errors	160	13	7.47	36	40	51.28	10	3	23.08
TMEM104	0	genome.wustl.edu	36	17	70302819	70302819	+	Silent	SNP	G	G	A			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	17	70302819	70302819	G	A	SNP	TMEM104	NM_017728.3	human	genbank	54_36p	+1	validated	silent	c.501	p.V167	1.000	NULL	HMMPfam_Aa_trans	-	no_errors	604	35	5.46	126	117	47.37	12	13	52.00
FKBP8	0	genome.wustl.edu	36	19	18513580	18513580	+	Silent	SNP	C	C	T			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	19	18513580	18513580	C	T	SNP	FKBP8	NM_012181.3	human	genbank	54_36p	-1	reviewed	silent	c.201	p.E67	0.994	superfamily_SSF54534	HMMPfam_FKBP_C,HMMPfam_TPR_1,superfamily_SSF48452,superfamily_SSF54534	-	no_errors	606	39	6.05	47	32	40.00	39	33	45.83
EGLN2	0	genome.wustl.edu	36	19	45998824	45998824	+	Silent	SNP	G	G	A			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	19	45998824	45998824	G	A	SNP	EGLN2	NM_053046.2	human	genbank	54_36p	+1	reviewed	silent	c.507	p.A169	0.001	NULL	HMMPfam_2OG-FeII_Oxy,HMMSmart_SM00702	-	no_errors	158	1	0.63	50	47	47.96	8	8	50.00
ZNF548	0	genome.wustl.edu	36	19	62603022	62603022	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	19	62603022	62603022	A	G	SNP	ZNF548	NM_152909.2	human	genbank	54_36p	+1	provisional	missense	c.1555	p.T519A	0.000	NULL	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	-	no_errors	549	33	5.65	278	200	41.41	13	16	55.17
NPM1	0	genome.wustl.edu	36	5	170770152	170770153	+	Frame_Shift_Ins	INS	-	-	TCTG			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	-	-	-	TCTG	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	5	170770152	170770153	-	TCTG	INS	NPM1	NM_002520.1	human	genbank	54_36p	+1	validated	frame_shift_ins	c.863_864	p.W288fs	1.000:1.000	NULL	HMMPfam_Nucleoplasmin,superfamily_Nucleoplasmin-like core domain	-	no_errors	NA	NA	NA	NA	NA	NA	NA	NA	NA
FLT3	0	genome.wustl.edu	36	13	27506240	27506241	+	In_Frame_Ins	INS	-	-	AAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGA			TCGA-AB-2913-03A-01W-0732-08	TCGA-AB-2913-11A-01W-0732-08	-	-	-	AAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGA	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1	dbGAP	Illumina HiSeq	8efe9ea1-d3b2-4fe0-a602-d91c6fdedeb4	7543443c-c06e-445e-a2bd-aae43484175a	13	27506240	27506241	-	AAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGA	INS	FLT3	NM_004119.2	human	genbank	54_36p	-1	reviewed	in_frame_ins	c.1816_1815	p.605in_frame_insSSDNEYFYVDFREYEYDLKWEF	1.000:0.998	superfamily_Kinase_like	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR,superfamily_Kinase_like,HMMPfam_ig,PatternScan_PROTEIN_KINASE_ATP,superfamily_SSF48726	-	no_errors	NA	NA	NA	NA	NA	NA	NA	NA	NA
