Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	X1000Genome_AA	X1000Genome_AC	X1000Genome_AF	X1000Genome_AFR_AF	X1000Genome_AMR_AF	X1000Genome_AN	X1000Genome_ASN_AF	X1000Genome_AVGPOST	X1000Genome_CIEND	X1000Genome_CIPOS	X1000Genome_END	X1000Genome_ERATE	X1000Genome_EUR_AF	X1000Genome_HOMLEN	X1000Genome_HOMSEQ	X1000Genome_LDAF	X1000Genome_RSQ	X1000Genome_SNPSOURCE	X1000Genome_SVLEN	X1000Genome_SVTYPE	X1000Genome_THETA	X1000Genome_VT	ACHILLES_Lineage_Results_Top_Genes	CGC_Cancer.Germline.Mut	CGC_Cancer.Molecular.Genetics	CGC_Cancer.Somatic.Mut	CGC_Cancer.Syndrome	CGC_Chr	CGC_Chr.Band	CGC_GeneID	CGC_Name	CGC_Other.Germline.Mut	CGC_Tissue.Type	COSMIC_n_overlapping_mutations	COSMIC_overlapping_mutation_descriptions	COSMIC_overlapping_primary_sites	ClinVar_ASSEMBLY	ClinVar_HGMD_ID	ClinVar_SYM	ClinVar_TYPE	ClinVar_rs	ESP_AA	ESP_AAC	ESP_AA_AC	ESP_AA_AGE	ESP_AA_GTC	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_CA	ESP_CDP	ESP_CG	ESP_CP	ESP_Chromosome	ESP_DBSNP	ESP_DP	ESP_EA_AC	ESP_EA_AGE	ESP_EA_GTC	ESP_EXOME_CHIP	ESP_FG	ESP_GL	ESP_GM	ESP_GS	ESP_GTC	ESP_GTS	ESP_GWAS_PUBMED	ESP_MAF	ESP_PH	ESP_PP	ESP_Position	ESP_TAC	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	Familial_Cancer_Genes_Reference	Familial_Cancer_Genes_Synonym	HGNC_Accession.Numbers	HGNC_CCDS.IDs	HGNC_Chromosome	HGNC_Date.Modified	HGNC_Date.Name.Changed	HGNC_Date.Symbol.Changed	HGNC_Ensembl.Gene.ID	HGNC_Ensembl.ID.supplied.by.Ensembl.	HGNC_Entrez.Gene.ID	HGNC_Entrez.Gene.ID.supplied.by.NCBI.	HGNC_Enzyme.IDs	HGNC_Gene.family.description	HGNC_HGNC.ID	HGNC_Locus.Group	HGNC_Locus.Type	HGNC_Name.Synonyms	HGNC_OMIM.ID.supplied.by.NCBI.	HGNC_Previous.Names	HGNC_Previous.Symbols	HGNC_Primary.IDs	HGNC_Pubmed.IDs	HGNC_Record.Type	HGNC_RefSeq.IDs	HGNC_RefSeq.supplied.by.NCBI.	HGNC_Secondary.IDs	HGNC_Status	HGNC_Synonyms	HGNC_UCSC.ID.supplied.by.UCSC.	HGNC_UniProt.ID.supplied.by.UniProt.	HGNC_VEGA.IDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	ORegAnno_bin	UniProt_alt_uniprot_accessions	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP.._NR	dbNSFP_GERP.._RS	dbNSFP_GERP.._RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_fold.degenerate	dbNSFP_genename	dbNSFP_hg18_pos.1.coor.	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_id	gene_type	havana_transcript	secondary_variant_classification	strand	transcript_id	variant_classification	variant_type	key	t_ref_count	t_alt_count
AP3D1	8943	broad.mit.edu	37	19	2110781	2110781	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:2110781G>A	ENST00000355272.6	-	27	3306	c.3100C>T	c.(3100-3102)Ctc>Ttc	p.L1034F	AP3D1_ENST00000350812.6_Missense_Mutation_p.L803F|AP3D1_ENST00000345016.5_Missense_Mutation_p.L972F|AP3D1_ENST00000356926.4_Missense_Mutation_p.L931F	NM_001261826.1	NP_001248755.1	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	972					eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGCATTGAGTGAGTCCAGC	0.667		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													35	40	38			NA	NA	19		NA											NA				2110781		2202	4298	6500	SO:0001583	missense			U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000	8943	8943			568	protein-coding gene	gene with protein product		607246			NA	9151686, 9303295	Standard		NM_003938	NA	Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000355272.6:c.3100C>T	19.37:g.2110781G>A	ENSP00000347416:p.Leu1034Phe	NA	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	37	CCDS58638.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297458	0.81025	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	4.81	3.76	0.43208	.	0.000000	0.64402	D	0.000001	T	0.68357	0.2992	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.994;0.992	D;D;D;P	0.85130	0.958;0.997;0.924;0.876	T	0.69007	-0.5259	10	0.44086	T	0.13	-39.004	12.0641	0.53578	0.0879:0.0:0.9121:0.0	.	803;1034;972;931	E7EMM2;O14617-5;O14617;G5E988	.;.;AP3D1_HUMAN;.	F	931;972;1034;840;803	ENSP00000349398:L931F;ENSP00000344055:L972F;ENSP00000347416:L1034F;ENSP00000342321:L803F	ENSP00000341579:L840F	L	-	1	0	AP3D1	2061781	1.000000	0.71417	0.960000	0.40013	0.959000	0.62525	6.290000	0.72712	2.214000	0.71695	0.491000	0.48974	CTC	AP3D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000450910.2		-	ENST00000355272.6	Missense_Mutation	SNP	19 : 2110781 - 2110781 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	283	12
ASPM	259266	broad.mit.edu	37	1	197062202	197062202	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:197062202C>T	ENST00000367409.4	-	21	9530	c.9274G>A	c.(9274-9276)Ggt>Agt	p.G3092S	ASPM_ENST00000294732.7_Missense_Mutation_p.G1507S|ASPM_ENST00000367408.1_Missense_Mutation_p.G757S	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3092	IQ 37.				mitosis	cytoplasm|nucleus	calmodulin binding			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACTAGCCAACCACGCACCAGT	0.323		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													76	76	76			NA	NA	1		NA											NA				197062202		2203	4299	6502	SO:0001583	missense			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279	259266	259266			19048	protein-coding gene	gene with protein product		605481	microcephaly, primary autosomal recessive 5, asp (abnormal spindle)-like, microcephaly associated (Drosophila)	MCPH5	NA	11078481	Standard	NM_018136	NM_018136	NA	Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9274G>A	1.37:g.197062202C>T	ENSP00000356379:p.Gly3092Ser	NA	Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887516	0.91814	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.42513	0.97;0.97;0.97	5.28	5.28	0.74379	.	0.059343	0.64402	D	0.000004	T	0.65417	0.2689	M	0.77103	2.36	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;0.988	D;D;P	0.79108	0.992;0.987;0.893	T	0.66787	-0.5835	10	0.46703	T	0.11	.	16.0593	0.80830	0.0:1.0:0.0:0.0	.	1078;1507;3092	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	S	3092;1507;757;1078	ENSP00000356379:G3092S;ENSP00000294732:G1507S;ENSP00000356378:G757S	ENSP00000294732:G1507S	G	-	1	0	ASPM	195328825	0.938000	0.31826	1.000000	0.80357	0.988000	0.76386	1.931000	0.40134	2.447000	0.82792	0.655000	0.94253	GGT	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000088256.1		-	ENST00000367409.4	Missense_Mutation	SNP	1 : 197062202 - 197062202 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	517	10
AVPR1B	553	broad.mit.edu	37	1	206230924	206230924	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:206230924C>A	ENST00000367126.4	+	2	1522	c.1057C>A	c.(1057-1059)Ctt>Att	p.L353I		NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	353					activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CCTGCGTCACCTTGCCTGCTG	0.652		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													35	31	32			NA	NA	1		NA											NA				206230924		2203	4300	6503	SO:0001583	missense			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049	553	553		GPCR / Class A : Vasopressin and oxytocin receptors	896	protein-coding gene	gene with protein product		600264		AVPR3	NA	7929452, 8586456	Standard	NM_000707	NM_000707	NA	Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.1057C>A	1.37:g.206230924C>A	ENSP00000356094:p.Leu353Ile	NA	B0M0J6|Q5TZ00	37	CCDS30994.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917594	0.52546	.	.	ENSG00000198049	ENST00000367126	T	0.47177	0.85	5.6	3.68	0.42216	.	0.625252	0.13928	N	0.353117	T	0.40119	0.1104	L	0.50333	1.59	0.09310	N	1	B	0.16396	0.017	B	0.19946	0.027	T	0.32798	-0.9893	10	0.49607	T	0.09	-0.6355	6.3659	0.21455	0.1629:0.6944:0.0:0.1426	.	353	P47901	V1BR_HUMAN	I	353	ENSP00000356094:L353I	ENSP00000356094:L353I	L	+	1	0	AVPR1B	204397547	0.000000	0.05858	0.017000	0.16124	0.528000	0.34623	0.400000	0.20932	1.310000	0.45006	0.563000	0.77884	CTT	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000087996.1		+	ENST00000367126.4	Missense_Mutation	SNP	1 : 206230924 - 206230924 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	117	4
C1QTNF9B	387911	broad.mit.edu	37	13	24465897	24465897	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr13:24465897C>T	ENST00000382140.2	-	5	593	c.533G>A	c.(532-534)cGg>cAg	p.R178Q	C1QTNF9B-AS1_ENST00000382133.4_RNA|C1QTNF9B_ENST00000382145.1_Intron|C1QTNF9B_ENST00000382137.3_Missense_Mutation_p.R178Q|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000556521.1_Intron|C1QTNF9B_ENST00000382057.3_Intron|C1QTNF9B-AS1_ENST00000435039.2_RNA			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	178	Collagen-like 3.					collagen				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						TCTTATTCCCCGGACTCCTGG	0.587		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													32	41	38			NA	NA	13		NA											NA				24465897		2201	4297	6498	SO:0001583	missense			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863	387911	387911			34072	protein-coding gene	gene with protein product		614148			NA	17544811	Standard	NM_001007537	NM_001007537	NA	Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.533G>A	13.37:g.24465897C>T	ENSP00000371575:p.Arg178Gln	NA	A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	37	CCDS31947.1	.	.	.	.	.	.	.	.	.	.	c	13.47	2.246859	0.39697	.	.	ENSG00000205863	ENST00000382137;ENST00000382140	D;D	0.96136	-3.92;-3.92	4.26	3.24	0.37175	.	0.122397	0.64402	D	0.000018	D	0.89336	0.6686	L	0.48362	1.52	0.80722	D	1	B	0.29037	0.231	B	0.15484	0.013	T	0.83168	-0.0095	10	0.23302	T	0.38	.	2.9984	0.06005	0.0:0.5062:0.0:0.4938	.	178	B2RNN3	C1T9B_HUMAN	Q	178	ENSP00000371572:R178Q;ENSP00000371575:R178Q	ENSP00000371572:R178Q	R	-	2	0	C1QTNF9B	23363897	0.846000	0.29590	0.928000	0.36995	0.984000	0.73092	1.463000	0.35277	1.950000	0.56595	0.456000	0.33151	CGG	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000044162.3		-	ENST00000382140.2	Missense_Mutation	SNP	13 : 24465897 - 24465897 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	251	5
C7orf10	0	broad.mit.edu	37	7	40899974	40899974	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr7:40899974G>A	ENST00000335693.4	+	14	1257	c.1234G>A	c.(1234-1236)Ggg>Agg	p.G412R	C7orf10_ENST00000401647.2_Missense_Mutation_p.G364R|C7orf10_ENST00000464028.1_3'UTR|C7orf10_ENST00000309930.5_Missense_Mutation_p.G438R	NM_001193313.1	NP_001180242.1	Q9HAC7	CG010_HUMAN		412							transferase activity			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						CCCGCTGCTCGGGCAGCACAC	0.567		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													99	110	106			NA	NA	7		NA											NA				40899974		2104	4227	6331	SO:0001583	missense											NA	NA			NA							NA					NA						ENST00000335693.4:c.1234G>A	7.37:g.40899974G>A	ENSP00000338475:p.Gly412Arg	NA	A4D1W5|B4DR73|Q4KMW4|Q4KMZ0|Q8TE00|Q8TEY1	37	CCDS55105.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637058	0.87760	.	.	ENSG00000175600	ENST00000309930;ENST00000401647;ENST00000335693	D;T;T	0.96396	-4.0;-1.11;-1.11	5.51	5.51	0.81932	CoA-transferase family III domain (1);	0.275863	0.34484	N	0.003935	D	0.98689	0.9560	M	0.93594	3.435	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.994;0.997	D	0.99593	1.0976	10	0.87932	D	0	-10.9205	18.9884	0.92782	0.0:0.0:1.0:0.0	.	364;412;401	Q4KMW8;Q9HAC7;Q9HAC7-2	.;CG010_HUMAN;.	R	438;364;412	ENSP00000312054:G438R;ENSP00000385222:G364R;ENSP00000338475:G412R	ENSP00000312054:G438R	G	+	1	0	C7orf10	40866499	1.000000	0.71417	0.988000	0.46212	0.858000	0.48976	6.455000	0.73497	2.575000	0.86900	0.655000	0.94253	GGG	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000338388.1		+	ENST00000335693.4	Missense_Mutation	SNP	7 : 40899974 - 40899974 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1118	26
CACNA1I	8911	broad.mit.edu	37	22	40075752	40075752	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr22:40075752C>G	ENST00000402142.3	+	33	5420	c.5420C>G	c.(5419-5421)tCt>tGt	p.S1807C	CACNA1I_ENST00000401624.1_Missense_Mutation_p.S1807C|CACNA1I_ENST00000400164.3_Missense_Mutation_p.S1772C|CACNA1I_ENST00000407673.1_Missense_Mutation_p.S1772C|CACNA1I_ENST00000336649.4_Missense_Mutation_p.S1813C|CACNA1I_ENST00000404898.1_Missense_Mutation_p.S1772C	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1807					axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	GACAGCGTCTCTTTAATCATC	0.632		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													38	41	40			NA	NA	22		NA											NA				40075752		1942	4143	6085	SO:0001583	missense			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346	8911	8911		Calcium channel subunits, Voltage-gated ion channels / Calcium channels	1396	protein-coding gene	gene with protein product		608230			NA	10454147, 16382099	Standard	NM_001003406	NM_021096	NA	Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.5420C>G	22.37:g.40075752C>G	ENSP00000385019:p.Ser1807Cys	NA	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	37	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169998	0.78452	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98968	-5.26;-5.23;-5.14;-5.09;-5.28;-5.19	4.3	4.3	0.51218	.	5.708610	0.00397	N	0.000043	D	0.99211	0.9726	M	0.68952	2.095	0.52501	D	0.999956	D;D;D;D	0.89917	0.999;0.969;1.0;1.0	D;P;D;D	0.87578	0.995;0.708;0.998;0.996	D	0.94094	0.7356	10	0.72032	D	0.01	.	17.1233	0.86707	0.0:1.0:0.0:0.0	.	1772;1807;1772;1807	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	C	1807;1772;1807;1772;1813;1772	ENSP00000385019:S1807C;ENSP00000384093:S1772C;ENSP00000383887:S1807C;ENSP00000385680:S1772C;ENSP00000337829:S1813C;ENSP00000383028:S1772C	ENSP00000337829:S1813C	S	+	2	0	CACNA1I	38405698	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	7.347000	0.79356	2.087000	0.62958	0.462000	0.41574	TCT	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000321290.1		+	ENST00000402142.3	Missense_Mutation	SNP	22 : 40075752 - 40075752 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	191	8
CYP1A2	1544	broad.mit.edu	37	15	75047332	75047332	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr15:75047332C>T	ENST00000343932.4	+	7	1517	c.1454C>T	c.(1453-1455)cCg>cTg	p.P485L		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	485					alkaloid metabolic process|exogenous drug catabolic process|methylation|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative deethylation|oxidative demethylation|steroid catabolic process|toxin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|demethylase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Aciclovir(DB00787)|Alosetron(DB00969)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Anagrelide(DB00261)|Azelastine(DB00972)|Bortezomib(DB00188)|Caffeine(DB00201)|Carmustine(DB00262)|Chlordiazepoxide(DB00475)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Clomipramine(DB01242)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Desloratadine(DB00967)|Diazepam(DB00829)|Dibucaine(DB00527)|Diclofenac(DB00586)|Duloxetine(DB00476)|Enoxacin(DB00467)|Esomeprazole(DB00736)|Estradiol(DB00783)|Estrone(DB00655)|Fluorouracil(DB00544)|Flutamide(DB00499)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Grepafloxacin(DB00365)|Haloperidol(DB00502)|Hesperetin(DB01094)|Imipramine(DB00458)|Ketoconazole(DB01026)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Melatonin(DB01065)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mirtazapine(DB00370)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pefloxacin(DB00487)|Pimozide(DB01100)|Propafenone(DB01182)|Propranolol(DB00571)|Quinidine(DB00908)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifampin(DB01045)|Riluzole(DB00740)|Rofecoxib(DB00533)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Tacrine(DB00382)|Telithromycin(DB00976)|Terfenadine(DB00342)|Theophylline(DB00277)|Thiabendazole(DB00730)|Tizanidine(DB00697)|Tolbutamide(DB01124)|Verapamil(DB00661)|Warfarin(DB00682)|Zileuton(DB00744)|Zolmitriptan(DB00315)	AGCGTGCCGCCGGGCGTGAAA	0.617		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													83	69	74			NA	NA	15		NA											NA				75047332		2197	4296	6493	SO:0001583	missense			AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1544	1544	1.14.14.1	Cytochrome P450s	2596	protein-coding gene	gene with protein product		124060	cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2		NA	15128046	Standard	NM_000761	NM_000761	NA	Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	ENST00000343932.4:c.1454C>T	15.37:g.75047332C>T	ENSP00000342007:p.Pro485Leu	NA	Q16754|Q6NWU5|Q9BXX7|Q9UK49	37	CCDS32293.1	.	.	.	.	.	.	.	.	.	.	C	7.577	0.667880	0.14710	.	.	ENSG00000140505	ENST00000343932	T	0.71341	-0.56	4.39	4.39	0.52855	.	0.284989	0.40144	N	0.001179	T	0.66237	0.2769	M	0.64170	1.965	0.09310	N	0.999995	B	0.22541	0.071	B	0.15870	0.014	T	0.61973	-0.6952	10	0.56958	D	0.05	.	12.0723	0.53624	0.3113:0.6887:0.0:0.0	.	485	P05177-2	.	L	485	ENSP00000342007:P485L	ENSP00000342007:P485L	P	+	2	0	CYP1A2	72834385	0.023000	0.18921	0.020000	0.16555	0.041000	0.13682	2.991000	0.49409	2.251000	0.74343	0.455000	0.32223	CCG	CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000421263.2		+	ENST00000343932.4	Missense_Mutation	SNP	15 : 75047332 - 75047332 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	529	8
CYP4F11	57834	broad.mit.edu	37	19	16024638	16024638	+	Silent	SNP	C	C	T	rs143714626	byFrequency	TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:16024638C>T	ENST00000402119.4	-	12	1905	c.1479G>A	c.(1477-1479)ccG>ccA	p.P493P	CYP4F11_ENST00000326742.8_3'UTR|CYP4F11_ENST00000591841.1_Silent_p.P168P|CYP4F11_ENST00000248041.8_Silent_p.P493P	NM_021187.3	NP_067010.3	Q9HBI6	CP4FB_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 11	NA					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						CAGTGTGGGTCGGCAGGATGC	0.627		NA											c	1	5e-04	0.002	NA	2184	NA	1	,	,	NA	3e-04	NA	NA	NA	5e-04	0.9547	EXOME	NA	NA	0.0012	SNP								NA				0								C	,	6,4400	11.4+/-27.6	0,6,2197	66	59	62		1479,1479	-5.5	0	19	dbSNP_134	62	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CYP4F11	NM_001128932.1,NM_021187.3	,	0,6,6497	TT,TC,CC	NA	0.0,0.1362,0.0461	,	493/525,493/525	16024638	6,13000	2203	4300	6503	SO:0001819	synonymous_variant			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903	57834	57834		Cytochrome P450s	13265	protein-coding gene	gene with protein product		611517	cytochrome P450, subfamily IVF, polypeptide 11		NA	10964514, 9068972	Standard	NM_021187	NM_021187	NA	Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.1479G>A	19.37:g.16024638C>T		NA	O75254|Q96AQ5	37	CCDS12337.1																																																																																			CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000460385.2		-	ENST00000402119.4	Silent	SNP	19 : 16024638 - 16024638 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	274	6
DHX58	79132	broad.mit.edu	37	17	40262918	40262918	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr17:40262918G>A	ENST00000251642.3	-	5	606	c.384C>T	c.(382-384)atC>atT	p.I128I		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	128	Helicase ATP-binding.				innate immune response	cytoplasm	ATP binding|DNA binding|helicase activity|protein binding|RNA binding|zinc ion binding			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CATCCACCACGATCAGGGAGA	0.542		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													136	117	123			NA	NA	17		NA											NA				40262918		2203	4300	6503	SO:0001819	synonymous_variant			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771	79132	79132			29517	protein-coding gene	gene with protein product	RNA helicase LGP2	608588			NA	11735219	Standard	NM_024119	NM_024119	NA	Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.384C>T	17.37:g.40262918G>A		NA	Q9HAM6	37	CCDS11416.1																																																																																			DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000257396.1		-	ENST00000251642.3	Silent	SNP	17 : 40262918 - 40262918 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	794	25
ELAVL3	1995	broad.mit.edu	37	19	11565684	11565684	+	Missense_Mutation	SNP	G	G	A	rs143463189		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:11565684G>A	ENST00000359227.3	-	7	1185	c.761C>T	c.(760-762)tCg>tTg	p.S254L	ELAVL3_ENST00000438662.2_Intron	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	254					cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						GGCGATGAGCGACAGGGGACT	0.677		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0								G	LEU/SER,	1,4399		0,1,2199	122	137	132		761,	4.8	1	19	dbSNP_134	132	0,8578		0,0,4289	no	missense,intron	ELAVL3	NM_001420.3,NM_032281.2	145,	0,1,6488	AA,AG,GG	NA	0.0,0.0227,0.0077	benign,	254/368,	11565684	1,12977	2200	4289	6489	SO:0001583	missense				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361	1995	1995		RNA binding motif (RRM) containing	3314	protein-coding gene	gene with protein product	Hu antigen C, paraneoplastic limbic encephalitis antigen 21, paraneoplastic cerebellar degeneration-associated antigen, ELAV-like protein 3	603458	ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)		NA	9799595	Standard	NM_001420	NM_001420	NA	Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.761C>T	19.37:g.11565684G>A	ENSP00000352162:p.Ser254Leu	NA	Q16135|Q96CL8|Q96QS9	37	CCDS32912.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.011022	0.54361	2.27E-4	0.0	ENSG00000196361	ENST00000359227	T	0.08546	3.08	4.78	4.78	0.61160	.	0.481200	0.19343	N	0.116597	T	0.06826	0.0174	N	0.17474	0.49	0.80722	D	1	B	0.15141	0.012	B	0.06405	0.002	T	0.37865	-0.9687	10	0.28530	T	0.3	.	16.6509	0.85189	0.0:0.0:1.0:0.0	.	254	Q14576	ELAV3_HUMAN	L	254	ENSP00000352162:S254L	ENSP00000352162:S254L	S	-	2	0	ELAVL3	11426684	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.754000	0.55189	2.231000	0.72958	0.505000	0.49811	TCG	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000458827.2		-	ENST00000359227.3	Missense_Mutation	SNP	19 : 11565684 - 11565684 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1945	27
EZR	7430	broad.mit.edu	37	6	159197482	159197482	+	Silent	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:159197482A>G	ENST00000367075.3	-	8	921	c.753T>C	c.(751-753)aaT>aaC	p.N251N	EZR_ENST00000337147.7_Silent_p.N251N|EZR_ENST00000392177.4_Silent_p.N219N	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	251	FERM.|Interaction with SCYL3.				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		ACTTTTTGTCATTGAAAGAGA	0.378		NA	T	ROS1	NSCLC									NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA				Dom	yes		6	6q25.3	7430	ezrin		E	0													129	128	129			NA	NA	6		NA											NA				159197482		2203	4300	6503	SO:0001819	synonymous_variant			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820	7430	7430		A-kinase anchor proteins	12691	protein-coding gene	gene with protein product	cytovillin 2	123900	villin 2 (ezrin)	VIL2	NA		Standard	NM_003379	NM_003379	NA	Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.753T>C	6.37:g.159197482A>G		NA	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	37	CCDS5258.1																																																																																			EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000042878.1		-	ENST00000367075.3	Silent	SNP	6 : 159197482 - 159197482 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	709	26
FAM13A	10144	broad.mit.edu	37	4	89950680	89950680	+	Missense_Mutation	SNP	G	G	A	rs114435452	byFrequency	TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr4:89950680G>A	ENST00000264344.5	-	2	355	c.148C>T	c.(148-150)Cgg>Tgg	p.R50W	FAM13A_ENST00000509094.1_Missense_Mutation_p.R50W|FAM13A_ENST00000502459.1_5'UTR|FAM13A_ENST00000515600.1_Missense_Mutation_p.R50W|FAM13A_ENST00000511976.1_De_novo_Start_InFrame	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	50	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						AGCCCCTGCCGTTCAAGTTCT	0.418		NA											G	0	0	NA	NA	2184	NA	1	,	,	NA	3e-04	NA	NA	NA	0	0	EXOME	NA	NA	4e-04	SNP								NA				0								G	TRP/ARG	12,4394	19.1+/-41.9	0,12,2191	161	163	162		148	3.3	0.2	4	dbSNP_132	162	0,8600		0,0,4300	yes	missense	FAM13A	NM_014883.2	101	0,12,6491	AA,AG,GG	NA	0.0,0.2724,0.0923	benign	50/1024	89950680	12,12994	2203	4300	6503	SO:0001583	missense			AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640	10144	10144		Rho GTPase activating proteins	19367	protein-coding gene	gene with protein product		613299	family with sequence similarity 13, member A1	FAM13A1	NA		Standard		NM_014883	NA	Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.148C>T	4.37:g.89950680G>A	ENSP00000264344:p.Arg50Trp	NA	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	37	CCDS34029.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	15.85	2.955573	0.53293	0.002724	0.0	ENSG00000138640	ENST00000264344;ENST00000509094;ENST00000515600;ENST00000506913	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.12	3.28	0.37604	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.769691	0.11970	N	0.511820	T	0.42765	0.1217	M	0.68317	2.08	0.27130	N	0.961917	D;P	0.62365	0.991;0.482	P;B	0.44860	0.462;0.007	T	0.35943	-0.9768	9	.	.	.	.	7.72	0.28727	0.085:0.0:0.7527:0.1623	.	50;50	Q6P521;O94988	.;FA13A_HUMAN	W	50;50;50;60	ENSP00000264344:R50W;ENSP00000426517:R50W;ENSP00000422345:R50W;ENSP00000421269:R60W	.	R	-	1	2	FAM13A	90169703	0.953000	0.32496	0.250000	0.24296	0.018000	0.09664	2.839000	0.48207	1.323000	0.45263	0.655000	0.94253	CGG	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000363371.1		-	ENST00000264344.5	Missense_Mutation	SNP	4 : 89950680 - 89950680 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1035	26
FAM179A	165186	broad.mit.edu	37	2	29274886	29274886	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr2:29274886G>A	ENST00000379558.4	+	20	3338	c.2987G>A	c.(2986-2988)cGc>cAc	p.R996H	FAM179A_ENST00000465300.1_3'UTR|FAM179A_ENST00000403861.2_Missense_Mutation_p.R941H	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	996							binding			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGAGGCAGCCGCAAGGCCACT	0.557		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													23	25	24			NA	NA	2		NA											NA				29274886		1906	4125	6031	SO:0001583	missense			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350	165186	165186			33715	protein-coding gene	gene with protein product					NA	16344560	Standard	NM_199280	NM_199280	NA	Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2987G>A	2.37:g.29274886G>A	ENSP00000368876:p.Arg996His	NA	Q6ZUF5	37	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	G	8.471	0.857506	0.17106	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.09817	3.12;2.94	5.68	-11.4	0.00090	.	3.053280	0.00954	N	0.003001	T	0.02929	0.0087	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36065	-0.9763	10	0.30078	T	0.28	.	4.172	0.10334	0.1668:0.2241:0.4866:0.1225	.	941;996	F8W8E4;Q6ZUX3	.;F179A_HUMAN	H	996;941	ENSP00000368876:R996H;ENSP00000384699:R941H	ENSP00000368876:R996H	R	+	2	0	FAM179A	29128390	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.423000	0.02450	-2.378000	0.00596	-1.904000	0.00526	CGC	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000317848.4		+	ENST00000379558.4	Missense_Mutation	SNP	2 : 29274886 - 29274886 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	221	5
HNRNPC	3183	broad.mit.edu	37	14	21680019	21680019	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr14:21680019G>T	ENST00000430246.2	-	6	3538	c.587C>A	c.(586-588)tCt>tAt	p.S196Y	HNRNPC_ENST00000555914.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000556142.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000554455.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000420743.2_Missense_Mutation_p.S209Y|HNRNPC_ENST00000555883.1_Missense_Mutation_p.S153Y|HNRNPC_ENST00000555309.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000320084.7_Missense_Mutation_p.S209Y|HNRNPC_ENST00000556628.1_Missense_Mutation_p.S129Y|HNRNPC_ENST00000556897.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000449098.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000336053.6_Missense_Mutation_p.S196Y|HNRNPC_ENST00000553300.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000554969.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000553753.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000557201.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000556513.1_Missense_Mutation_p.S209Y			P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	209	Asp/Glu-rich (acidic).					catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding			breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		TTCCAGGAGAGAATCCACTTT	0.363		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		NSCLC(108;607 2244 12726 38757)							NA				0													134	138	137			NA	NA	14		NA											NA				21680019		1999	4190	6189	SO:0001583	missense				CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199	3183	3183		RNA binding motif (RRM) containing	5035	protein-coding gene	gene with protein product		164020		HNRPC	NA	3457372	Standard		NM_031314	NA	Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000430246.2:c.587C>A	14.37:g.21680019G>T	ENSP00000442816:p.Ser196Tyr	NA	D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	37	CCDS45079.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282988	0.23392	.	.	ENSG00000092199	ENST00000336053;ENST00000320084;ENST00000449098;ENST00000554969;ENST00000556142;ENST00000554455;ENST00000430246;ENST00000553753;ENST00000555914;ENST00000555309;ENST00000556628;ENST00000555883;ENST00000556513;ENST00000557201;ENST00000553300;ENST00000216296;ENST00000556897;ENST00000420743;ENST00000557157;ENST00000445284;ENST00000554539;ENST00000554383	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.15603	2.79;2.97;2.82;2.82;2.81;2.97;2.82;2.79;2.82;2.99;2.41;2.59;2.81;2.97;2.82;2.82;2.97;2.63;2.41;2.8	5.34	4.43	0.53597	.	0.215683	0.29565	U	0.011792	T	0.17066	0.0410	L	0.44542	1.39	0.35600	D	0.807759	B;B;B;B;B;B;B	0.30482	0.182;0.101;0.039;0.001;0.281;0.185;0.162	B;B;B;B;B;B;B	0.29524	0.045;0.026;0.057;0.005;0.103;0.032;0.094	T	0.14062	-1.0486	10	0.48119	T	0.1	.	14.5545	0.68091	0.0:0.0:0.8522:0.1478	.	104;196;129;153;196;209;196	B4DQQ2;B4DY08;P07910-3;P07910-4;G3V4C1;P07910;P07910-2	.;.;.;.;.;HNRPC_HUMAN;.	Y	196;209;196;196;209;209;196;196;196;209;129;153;209;209;196;104;196;209;117;209;93;196	ENSP00000338095:S196Y;ENSP00000319690:S209Y;ENSP00000404559:S196Y;ENSP00000450725:S196Y;ENSP00000451187:S209Y;ENSP00000451291:S209Y;ENSP00000442816:S196Y;ENSP00000450548:S196Y;ENSP00000451708:S196Y;ENSP00000450790:S209Y;ENSP00000451652:S129Y;ENSP00000450629:S153Y;ENSP00000452214:S209Y;ENSP00000452276:S209Y;ENSP00000450544:S196Y;ENSP00000451176:S196Y;ENSP00000404848:S209Y;ENSP00000450601:S117Y;ENSP00000452545:S93Y;ENSP00000452021:S196Y	ENSP00000216296:S104Y	S	-	2	0	HNRNPC	20749859	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	4.949000	0.63596	1.358000	0.45922	0.655000	0.94253	TCT	HNRNPC-015	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000410226.1		-	ENST00000430246.2	Missense_Mutation	SNP	14 : 21680019 - 21680019 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1319	30
IFT122	55764	broad.mit.edu	37	3	129214429	129214429	+	Silent	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr3:129214429C>T	ENST00000296266.3	+	19	2532	c.2340C>T	c.(2338-2340)ctC>ctT	p.L780L	IFT122_ENST00000349441.2_Silent_p.L618L|IFT122_ENST00000504021.1_Silent_p.L605L|IFT122_ENST00000513932.1_3'UTR|IFT122_ENST00000347300.2_Silent_p.L670L|IFT122_ENST00000348417.2_Silent_p.L729L|IFT122_ENST00000431818.2_Silent_p.L579L|IFT122_ENST00000440957.2_Silent_p.L520L|IFT122_ENST00000507564.1_Silent_p.L721L	NM_052985.2	NP_443711.2	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	729					camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						ACACCGACCTCTGCATGTTTG	0.537		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													123	110	114			NA	NA	3		NA											NA				129214429		2203	4300	6503	SO:0001819	synonymous_variant			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913	55764	55764		WD repeat domain containing, Intraflagellar transport homologs	13556	protein-coding gene	gene with protein product		606045	WD repeat domain 10, intraflagellar transport 122 homolog (Chlamydomonas)	WDR10	NA	11242542	Standard	NM_018262	NM_052985	NA	Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000296266.3:c.2340C>T	3.37:g.129214429C>T		NA	Q53G36|Q9HAT9|Q9UF80	37	CCDS3060.1																																																																																			IFT122-002	KNOWN	basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000355851.1		+	ENST00000296266.3	Silent	SNP	3 : 129214429 - 129214429 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	474	16
IMPAD1	54928	broad.mit.edu	37	8	57905955	57905955	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr8:57905955G>C	ENST00000262644.4	-	1	448	c.190C>G	c.(190-192)Cgc>Ggc	p.R64G		NM_017813.4	NP_060283.3	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	64						Golgi apparatus|integral to membrane	inositol-1(or 4)-monophosphatase activity|metal ion binding			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				AGCATCTCGCGCAAGTCCACG	0.741		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													19	19	19			NA	NA	8		NA											NA				57905955		2194	4291	6485	SO:0001583	missense				CCDS6169.1	8q12.1	2013-05-16			ENSG00000104331	ENSG00000104331	54928	54928			26019	protein-coding gene	gene with protein product		614010			NA	21549340	Standard	NM_017813	NM_017813	NA	Approved	FLJ20421, IMPA3, gPAPP	uc003xte.4	Q9NX62	OTTHUMG00000164415	ENST00000262644.4:c.190C>G	8.37:g.57905955G>C	ENSP00000262644:p.Arg64Gly	NA	Q6NVY7	37	CCDS6169.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819807	0.50633	.	.	ENSG00000104331	ENST00000262644	T	0.52983	0.64	5.05	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	M	0.79011	2.435	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.61898	-0.6968	10	0.37606	T	0.19	-0.0018	6.9727	0.24658	0.0931:0.0:0.7402:0.1667	.	64	Q9NX62	IMPA3_HUMAN	G	64	ENSP00000262644:R64G	ENSP00000262644:R64G	R	-	1	0	IMPAD1	58068509	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	3.892000	0.56235	1.023000	0.39654	-0.378000	0.06908	CGC	IMPAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000378665.1		-	ENST00000262644.4	Missense_Mutation	SNP	8 : 57905955 - 57905955 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	224	9
KDM1A	23028	broad.mit.edu	37	1	23376993	23376993	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:23376993C>G	ENST00000400181.4	+	4	795	c.691C>G	c.(691-693)Ctt>Gtt	p.L231V	RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000542151.1_Missense_Mutation_p.L231V|KDM1A_ENST00000356634.3_Missense_Mutation_p.L211V	NM_001009999.2	NP_001009999.1	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	211	SWIRM.				blood coagulation|muscle cell development|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin	androgen receptor binding|chromatin binding|enzyme binding|flavin adenine dinucleotide binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-K9 specific)|ligand-dependent nuclear receptor transcription coactivator activity|MyoD binding|oxidoreductase activity|p53 binding|transcription regulatory region DNA binding			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GAAGGTTTTTCTTTTCATTAG	0.383		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													116	112	113			NA	NA	1		NA											NA				23376993		2203	4300	6503	SO:0001583	missense			AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487	23028	23028		Chromatin-modifying enzymes / K-demethylases	29079	protein-coding gene	gene with protein product		609132	amine oxidase (flavin containing) domain 2, lysine (K)-specific demethylase 1	AOF2, KDM1	NA	9628581, 12493763	Standard	NM_015013	NM_015013	NA	Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000400181.4:c.691C>G	1.37:g.23376993C>G	ENSP00000383042:p.Leu231Val	NA	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	37	CCDS53278.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478654	0.63849	.	.	ENSG00000004487	ENST00000356634;ENST00000400181;ENST00000542151	T;T;T	0.60920	0.24;0.16;0.15	5.82	4.91	0.64330	Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);SWIRM (2);	0.000000	0.64402	D	0.000001	T	0.76212	0.3956	M	0.86178	2.8	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.79315	-0.1854	10	0.87932	D	0	-15.4498	9.9819	0.41819	0.0:0.8483:0.0:0.1517	.	231;211	O60341-2;O60341	.;KDM1A_HUMAN	V	211;231;231	ENSP00000349049:L211V;ENSP00000383042:L231V;ENSP00000439072:L231V	ENSP00000349049:L211V	L	+	1	0	KDM1A	23249580	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.695000	0.37763	1.462000	0.47948	0.655000	0.94253	CTT	KDM1A-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000008881.2		+	ENST00000400181.4	Missense_Mutation	SNP	1 : 23376993 - 23376993 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	725	17
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr12:25398285C>G	ENST00000311936.3	-	2	225	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000256078.4_Missense_Mutation_p.G12R	NM_004985.3	NP_004976.2	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		pancreatic, colorectal, lung, thyroid, AML, others				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		L, E, M, O	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	GRCh37	CM076251	KRAS	M	rs121913530						93	83	86			NA	NA	12		NA											NA				25398285		2203	4300	6503	SO:0001583	missense	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703	3845	3845			6407	protein-coding gene	gene with protein product		190070	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog, v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog	KRAS2	NA		Standard	NM_033360	NM_004985	NA	Approved	KRAS1	uc001rgp.1	P01116		ENST00000311936.3:c.34G>C	12.37:g.25398285C>G	ENSP00000308495:p.Gly12Arg	NA	A8K8Z5|B0LPF9|P01118|Q96D10	37	CCDS8702.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	KRAS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000412230.1		-	ENST00000311936.3	Missense_Mutation	SNP	12 : 25398285 - 25398285 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	185	8
LAMA4	3910	broad.mit.edu	37	6	112486440	112486440	+	Silent	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:112486440C>T	ENST00000230538.7	-	13	1987	c.1590G>A	c.(1588-1590)gtG>gtA	p.V530V	RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000389463.4_Silent_p.V523V|LAMA4_ENST00000424408.2_Silent_p.V523V|LAMA4_ENST00000522006.1_Silent_p.V523V	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	530	Domain II and I.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GAGACATGTTCACCACTTCCA	0.453		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													194	167	176			NA	NA	6		NA											NA				112486440		2203	4300	6503	SO:0001819	synonymous_variant				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769	3910	3910		Laminins	6484	protein-coding gene	gene with protein product		600133			NA	7959779	Standard	NM_001105206	NM_001105206	NA	Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1590G>A	6.37:g.112486440C>T		NA	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	37	CCDS43491.1																																																																																			LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000041876.2		-	ENST00000230538.7	Silent	SNP	6 : 112486440 - 112486440 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	549	12
LPAR3	23566	broad.mit.edu	37	1	85279808	85279808	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:85279808G>A	ENST00000440886.1	-	2	821	c.783C>T	c.(781-783)ctC>ctT	p.L261L	LPAR3_ENST00000491034.1_5'UTR|LPAR3_ENST00000370611.3_Silent_p.L261L			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	261					G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						TCAGGCCGTCGAGGAGCAGAA	0.582		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													64	60	62			NA	NA	1		NA											NA				85279808		2203	4300	6503	SO:0001819	synonymous_variant			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517	23566	23566		GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid	14298	protein-coding gene	gene with protein product		605106	endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7	EDG7	NA	10488122	Standard	NM_012152	NM_012152	NA	Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.783C>T	1.37:g.85279808G>A		NA	A0AVA3	37	CCDS700.1																																																																																			LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000027467.1		-	ENST00000440886.1	Silent	SNP	1 : 85279808 - 85279808 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	531	18
MAP7D3	79649	broad.mit.edu	37	X	135313711	135313711	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chrX:135313711C>T	ENST00000370661.1	-	7	1312	c.1300G>A	c.(1300-1302)Gct>Act	p.A434T	MAP7D3_ENST00000370663.5_Missense_Mutation_p.A451T|MAP7D3_ENST00000316077.9_Missense_Mutation_p.A469T	NM_001173517.1	NP_001166988.1	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	469						cytoplasm|spindle				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					ACCTTTGGAGCGTCTCTCGCT	0.428		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													130	115	120			NA	NA	X		NA											NA				135313711		1887	4107	5994	SO:0001583	missense			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680	79649	79649			25742	protein-coding gene	gene with protein product		300930			NA	24927501	Standard		NM_001173516	NA	Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000370661.1:c.1300G>A	X.37:g.135313711C>T	ENSP00000359695:p.Ala434Thr	NA	A2A2J0|A6NCZ7|A6NHR4|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	37	CCDS55508.1	.	.	.	.	.	.	.	.	.	.	C	3.209	-0.161936	0.06502	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.04194	4.42;3.85;3.85;3.68	4.33	-7.09	0.01553	.	1.863520	0.03468	N	0.213251	T	0.02533	0.0077	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.28971	0.079;0.128;0.079;0.229	B;B;B;B	0.15870	0.011;0.011;0.011;0.014	T	0.35968	-0.9767	10	0.35671	T	0.21	-3.1947	1.1109	0.01704	0.2367:0.3632:0.1659:0.2342	.	451;428;469;434	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	T	434;469;451;428	ENSP00000359695:A434T;ENSP00000318086:A469T;ENSP00000359697:A451T;ENSP00000359694:A428T	ENSP00000318086:A469T	A	-	1	0	MAP7D3	135141377	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.359000	0.07632	-1.469000	0.01890	-1.699000	0.00722	GCT	MAP7D3-002	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000058488.2		-	ENST00000370661.1	Missense_Mutation	SNP	X : 135313711 - 135313711 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1091	34
MDN1	23195	broad.mit.edu	37	6	90448153	90448153	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:90448153G>A	ENST00000369393.3	-	33	4730	c.4615C>T	c.(4615-4617)Cgg>Tgg	p.R1539W	MDN1_ENST00000428876.1_Missense_Mutation_p.R1539W			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1539					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCTGTAAACCGGTTTCTTAAG	0.378		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													81	80	81			NA	NA	6		NA											NA				90448153		2203	4300	6503	SO:0001583	missense			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159	23195	23195			18302	protein-coding gene	gene with protein product					NA	9205841, 12102729	Standard		XM_005248699	NA	Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4615C>T	6.37:g.90448153G>A	ENSP00000358400:p.Arg1539Trp	NA	O15019|Q5T794	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138698	0.56936	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.73897	-0.79;-0.79	5.62	3.62	0.41486	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.063133	0.64402	D	0.000010	D	0.89238	0.6658	H	0.99573	4.635	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.90061	0.4156	10	0.87932	D	0	.	7.7774	0.29046	0.0:0.1127:0.487:0.4003	.	1539	Q9NU22	MDN1_HUMAN	W	1539	ENSP00000358400:R1539W;ENSP00000413970:R1539W	ENSP00000358400:R1539W	R	-	1	2	MDN1	90504874	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.095000	0.50235	1.340000	0.45581	0.557000	0.71058	CGG	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000041514.2		-	ENST00000369393.3	Missense_Mutation	SNP	6 : 90448153 - 90448153 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	499	12
MUC16	94025	broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													96	95	96			NA	NA	19		NA											NA				9090831		2041	4195	6236	SO:0001819	synonymous_variant			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143	94025	94025		Mucins	15582	protein-coding gene	gene with protein product		606154			NA	11369781	Standard	NM_024690	XM_006722941	NA	Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	19.37:g.9090831A>G		NA	Q6ZQW5|Q96RK2	37	CCDS54212.1																																																																																			MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000402806.1		-	ENST00000397910.4	Silent	SNP	19 : 9090831 - 9090831 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	578	8
NOTUM	147111	broad.mit.edu	37	17	79910974	79910974	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr17:79910974C>T	ENST00000409678.3	-	11	1737	c.1354G>A	c.(1354-1356)Gtc>Atc	p.V452I		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	452						extracellular region	hydrolase activity			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TGGTCTCGGACGGTGGGGCAT	0.662		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													53	45	48			NA	NA	17		NA											NA				79910974		2203	4299	6502	SO:0001583	missense			BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269	147111	147111			27106	protein-coding gene	gene with protein product		609847			NA		Standard	NM_178493	NM_178493	NA	Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.1354G>A	17.37:g.79910974C>T	ENSP00000387310:p.Val452Ile	NA	Q8N410|Q8NI82	37	CCDS32771.2	.	.	.	.	.	.	.	.	.	.	C	5.424	0.263310	0.10294	.	.	ENSG00000185269	ENST00000409678	.	.	.	4.84	1.17	0.20885	.	0.216848	0.47852	N	0.000211	T	0.07188	0.0182	N	0.01352	-0.895	0.21473	N	0.999676	B	0.02656	0.0	B	0.01281	0.0	T	0.38045	-0.9679	9	0.02654	T	1	.	5.2505	0.15519	0.0:0.1662:0.1503:0.6835	.	452	Q6P988	NOTUM_HUMAN	I	452	.	ENSP00000387310:V452I	V	-	1	0	NOTUM	77504264	1.000000	0.71417	0.999000	0.59377	0.882000	0.50991	1.932000	0.40143	0.228000	0.21019	-0.402000	0.06365	GTC	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000335123.2		-	ENST00000409678.3	Missense_Mutation	SNP	17 : 79910974 - 79910974 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	440	7
OR10G4	390264	broad.mit.edu	37	11	123886737	123886737	+	Silent	SNP	T	T	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:123886737T>C	ENST00000320891.4	+	1	456	c.456T>C	c.(454-456)tcT>tcC	p.S152S		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	152					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCAGTGGCTCTCTGCACTCTG	0.562		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													126	124	125			NA	NA	11		NA											NA				123886737		2201	4299	6500	SO:0001819	synonymous_variant			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737	390264	390264		GPCR / Class A : Olfactory receptors	14809	protein-coding gene	gene with protein product					NA		Standard	NM_001004462	NM_001004462	NA	Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.456T>C	11.37:g.123886737T>C		NA	Q6IEW0	37	CCDS31702.1																																																																																			OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000387268.1		+	ENST00000320891.4	Silent	SNP	11 : 123886737 - 123886737 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1241	37
PCNT	5116	broad.mit.edu	37	21	47831434	47831434	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr21:47831434C>A	ENST00000359568.5	+	28	5554	c.5447C>A	c.(5446-5448)gCc>gAc	p.A1816D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1816					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CACAGCCAGGCCCTGGAGGCC	0.706		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													8	11	10			NA	NA	21		NA											NA				47831434		2125	4213	6338	SO:0001583	missense			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299	5116	5116			16068	protein-coding gene	gene with protein product	kendrin, Seckel syndrome 4	605925	pericentrin 2 (kendrin)	PCNT2	NA	8812505, 9455477	Standard	NM_006031	NM_006031	NA	Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.5447C>A	21.37:g.47831434C>A	ENSP00000352572:p.Ala1816Asp	NA	O43152|Q7Z7C9	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574208	0.65878	.	.	ENSG00000160299	ENST00000359568	T	0.01572	4.76	5.79	3.8	0.43715	.	0.000000	0.32190	N	0.006460	T	0.04272	0.0118	L	0.34521	1.04	0.09310	N	0.999999	D;D	0.76494	0.999;0.999	D;D	0.69479	0.964;0.922	T	0.51156	-0.8741	10	0.18710	T	0.47	.	12.1547	0.54070	0.2978:0.7022:0.0:0.0	.	1698;1816	O95613-2;O95613	.;PCNT_HUMAN	D	1816	ENSP00000352572:A1816D	ENSP00000352572:A1816D	A	+	2	0	PCNT	46655862	0.477000	0.25909	1.000000	0.80357	0.855000	0.48748	0.786000	0.26844	2.739000	0.93911	0.563000	0.77884	GCC	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000207336.1		+	ENST00000359568.5	Missense_Mutation	SNP	21 : 47831434 - 47831434 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	99	9
RECQL4	9401	broad.mit.edu	37	8	145741394	145741394	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr8:145741394C>A	ENST00000532237.1	-	0	1234				RECQL4_ENST00000428558.2_Missense_Mutation_p.R370L			O94761	RECQ4_HUMAN	RecQ protein-like 4	NA					DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GAGCCTGCTACGGAGTGCCCG	0.642		NA	N, F, S			osteosarcoma, skin basal and sqamous cell		Genes defective in diseases associated with sensitivity to DNA damaging agents	Rothmund-Thomson syndrome;RAPADILINO syndrome;Baller-Gerold syndrome					NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA			yes	Rec		Rothmund-Thompson Syndrome	8	8q24.3	9401	RecQ protein-like 4		M	0													30	36	34			NA	NA	8		NA											NA				145741394		2071	4187	6258	SO:0001623	5_prime_UTR_variant	Familial Cancer Database	RTS, Poikiloderma Atrophicans and Cataract, Congenital Poikiloderma; ;Craniosynostosis with Radial Defects	AB006532	CCDS75804.1	8q24.3	2014-09-17	2014-03-07	2014-03-07		ENSG00000160957	9401	9401			9949	protein-coding gene	gene with protein product		603780			NA	9878247, 15960976	Standard	NM_004260	NM_004260	NA	Approved	RecQ4	uc003zdj.3	O94761		ENST00000532237.1:c.-2663G>T	8.37:g.145741394C>A		NA	Q3Y424|Q96DW2|Q96F55	37																																																																																				RECQL4-001	KNOWN	basic	processed_transcript	NA	protein_coding	OTTHUMT00000382482.1		-	ENST00000532237.1	5'UTR	SNP	8 : 145741394 - 145741394 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	263	4
RGPD1	400966	broad.mit.edu	37	2	87140987	87140987	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr2:87140987G>A	ENST00000398193.3	+	1	53	c.15G>A	c.(13-15)aaG>aaA	p.K5K	RGPD1_ENST00000409776.2_Intron			Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1	0					intracellular transport		binding			breast(1)|endometrium(1)|lung(1)	3						GGCGCAGCAAGGCCTACGGGG	0.672		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													19	28	25			NA	NA	2		NA											NA				87140987		2182	4283	6465	SO:0001819	synonymous_variant				CCDS46358.1, CCDS46358.2	2p11.2	2013-09-24			ENSG00000187627	ENSG00000187627	400966	400966		Tetratricopeptide (TTC) repeat domain containing	32414	protein-coding gene	gene with protein product		612704			NA	15710750, 15815621	Standard	NM_001024457	NM_001024457	NA	Approved	RGP1	uc021vkh.1	P0DJD0	OTTHUMG00000153248	ENST00000398193.3:c.15G>A	2.37:g.87140987G>A		NA	P0C839|Q6V1X0	37																																																																																				RGPD1-201	KNOWN	basic|appris_candidate_longest	protein_coding	NA	protein_coding			+	ENST00000398193.3	Silent	SNP	2 : 87140987 - 87140987 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	93	4
RP11-867G23.8	0	broad.mit.edu	37	11	66130881	66130881	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:66130881C>A	ENST00000531602.1	+	2	263	c.130C>A	c.(130-132)Ctg>Atg	p.L44M	SLC29A2_ENST00000311161.7_3'UTR|RP11-867G23.8_ENST00000580881.1_Intron|SLC29A2_ENST00000357440.2_3'UTR|SLC29A2_ENST00000544554.1_3'UTR|SLC29A2_ENST00000546034.1_3'UTR						NA								p.L44M(1)		kidney(1)	1						CGAGAAGAGGCTGCCAAAGAG	0.642		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				1	Substitution - Missense(1)	kidney(1)											42	39	40			NA	NA	11		NA											NA				66130881		2192	4293	6485	SO:0001583	missense											NA	NA			NA							NA					NA						ENST00000531602.1:c.130C>A	11.37:g.66130881C>A	ENSP00000435142:p.Leu44Met	NA		37		.	.	.	.	.	.	.	.	.	.	C	6.121	0.390492	0.11581	.	.	ENSG00000255468	ENST00000531602	.	.	.	3.61	-0.912	0.10504	.	.	.	.	.	T	0.34600	0.0903	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.38394	-0.9663	5	0.87932	D	0	.	3.0762	0.06247	0.407:0.3684:0.0:0.2246	.	.	.	.	M	44	.	ENSP00000435142:L44M	L	+	1	2	RP11-867G23.8	65887457	0.001000	0.12720	0.001000	0.08648	0.034000	0.12701	-0.267000	0.08619	-0.274000	0.09232	-0.302000	0.09304	CTG	RP11-867G23.8-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	NA	protein_coding	OTTHUMT00000391898.1		+	ENST00000531602.1	Missense_Mutation	SNP	11 : 66130881 - 66130881 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	101	10
RPH3A	22895	broad.mit.edu	37	12	113303278	113303278	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr12:113303278G>A	ENST00000389385.4	+	6	787	c.290G>A	c.(289-291)cGc>cAc	p.R97H	RPH3A_ENST00000551052.1_Missense_Mutation_p.R93H|RPH3A_ENST00000543106.2_Missense_Mutation_p.R97H|RPH3A_ENST00000548866.1_Missense_Mutation_p.R48H|RPH3A_ENST00000415485.3_Missense_Mutation_p.R97H|RPH3A_ENST00000420983.2_Missense_Mutation_p.R97H|RPH3A_ENST00000447659.2_Missense_Mutation_p.R48H	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	97	RabBD.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GGGGTGAACCGCTGCATACTG	0.522		NA											G	0	0	NA	NA	2184	NA	1	,	,	NA	3e-04	NA	NA	NA	0	0	EXOME	NA	NA	5e-04	SNP								NA				0													199	173	182			NA	NA	12		NA											NA				113303278		2203	4300	6503	SO:0001583	missense			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169	22895	22895		Synaptotagmins	17056	protein-coding gene	gene with protein product		612159	rabphilin 3A homolog (mouse)		NA	10231032, 7822236	Standard	NM_014954	NM_014954	NA	Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.290G>A	12.37:g.113303278G>A	ENSP00000374036:p.Arg97His	NA	B7Z3C3|Q96AE0	37	CCDS44979.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	25.2	4.613988	0.87359	.	.	ENSG00000089169	ENST00000548197;ENST00000543106;ENST00000551593;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000447659;ENST00000550901;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	5.61	5.61	0.85477	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000006	T	0.78811	0.4342	L	0.35487	1.065	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.998;0.999	P;P;P;P	0.60173	0.87;0.605;0.605;0.778	T	0.79293	-0.1863	10	0.51188	T	0.08	.	18.4097	0.90548	0.0:0.0:1.0:0.0	.	48;97;97;93	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	H	97;97;97;97;97;97;97;97;48;30;97;93;97;97;48;97	ENSP00000446570:R97H;ENSP00000440384:R97H;ENSP00000446780:R97H;ENSP00000450382:R97H;ENSP00000449613:R97H;ENSP00000447505:R97H;ENSP00000449650:R97H;ENSP00000374036:R97H;ENSP00000413254:R48H;ENSP00000448100:R30H;ENSP00000447083:R97H;ENSP00000448297:R93H;ENSP00000405357:R97H;ENSP00000450216:R97H;ENSP00000450347:R48H;ENSP00000408889:R97H	ENSP00000374036:R97H	R	+	2	0	RPH3A	111787661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.191000	0.77763	2.631000	0.89168	0.655000	0.94253	CGC	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000405561.1		+	ENST00000389385.4	Missense_Mutation	SNP	12 : 113303278 - 113303278 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	791	37
RPS27A	6233	broad.mit.edu	37	2	55462084	55462084	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr2:55462084C>A	ENST00000272317.6	+	5	631	c.307C>A	c.(307-309)Ctg>Atg	p.L103M	RPS27A_ENST00000402285.3_Missense_Mutation_p.L103M|RPS27A_ENST00000404735.1_Missense_Mutation_p.L103M	NM_002954.5	NP_002945.1	P62979	RS27A_HUMAN	ribosomal protein S27a	103					activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endocrine pancreas development|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	metal ion binding|structural constituent of ribosome			cervix(1)|ovary(1)|urinary_tract(1)	3						GCTGGCTGTCCTGAAATATTA	0.383		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													46	44	45			NA	NA	2		NA											NA				55462084		2203	4300	6503	SO:0001583	missense			AB007163	CCDS33202.1	2p16	2011-04-06			ENSG00000143947	ENSG00000143947	6233	6233		S ribosomal proteins	10417	protein-coding gene	gene with protein product	ubiquitin carboxyl extension protein 80	191343			NA	9582194	Standard		NM_001135592	NA	Approved	UBCEP80, Uba80, S27A	uc010yow.2	P62979	OTTHUMG00000151919	ENST00000272317.6:c.307C>A	2.37:g.55462084C>A	ENSP00000272317:p.Leu103Met	NA	P02248|P02249|P02250|P14798|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BQ77|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	37	CCDS33202.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680555	0.68042	.	.	ENSG00000143947	ENST00000402285;ENST00000272317;ENST00000449323;ENST00000404735	T;T;T;T	0.80994	-1.18;-1.18;-1.44;-1.18	5.2	2.44	0.29823	Ribosomal protein S27a (1);	0.000000	0.85682	D	0.000000	D	0.91147	0.7212	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90538	0.4500	10	0.87932	D	0	.	10.373	0.44066	0.0:0.7853:0.0:0.2147	.	103	P62979	RS27A_HUMAN	M	103	ENSP00000383981:L103M;ENSP00000272317:L103M;ENSP00000408482:L103M;ENSP00000385659:L103M	ENSP00000272317:L103M	L	+	1	2	RPS27A	55315588	1.000000	0.71417	0.987000	0.45799	0.975000	0.68041	3.131000	0.50515	0.217000	0.20800	-0.225000	0.12378	CTG	RPS27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000324423.15		+	ENST00000272317.6	Missense_Mutation	SNP	2 : 55462084 - 55462084 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	155	4
SHANK2	22941	broad.mit.edu	37	11	70332827	70332827	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:70332827C>T	ENST00000409161.1	-	9	1782	c.1783G>A	c.(1783-1785)Gcg>Acg	p.A595T	SHANK2_ENST00000449833.2_Missense_Mutation_p.A596T|SHANK2_ENST00000338508.4_Missense_Mutation_p.A1192T|SHANK2_ENST00000423696.2_Missense_Mutation_p.A812T			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	812					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCGCTGCTCGCGGAGGGCACT	0.706		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													20	26	24			NA	NA	11		NA											NA				70332827		2192	4290	6482	SO:0001583	missense			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105	22941	22941		Sterile alpha motif (SAM) domain containing, Ankyrin repeat domain containing	14295	protein-coding gene	gene with protein product		603290	cortactin binding protein 1	CORTBP1	NA	10506216	Standard	NM_012309	XM_005277930	NA	Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000409161.1:c.1783G>A	11.37:g.70332827C>T	ENSP00000386491:p.Ala595Thr	NA	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	37		.	.	.	.	.	.	.	.	.	.	C	0.010	-1.777281	0.00640	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	3.62	1.14	0.20703	.	1.993000	0.03565	N	0.227639	T	0.30293	0.0760	L	0.29908	0.895	0.27447	N	0.953541	B;B;B	0.17667	0.008;0.023;0.023	B;B;B	0.08055	0.001;0.002;0.003	T	0.13791	-1.0496	10	0.20046	T	0.44	.	5.831	0.18581	0.0:0.0901:0.3193:0.5906	.	812;1191;596	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	T	596;595;470;1192;812;830;815	ENSP00000399423:A596T;ENSP00000386491:A595T;ENSP00000402944:A470T;ENSP00000345193:A1192T;ENSP00000394536:A812T;ENSP00000294018:A815T	ENSP00000294018:A815T	A	-	1	0	SHANK2	70010475	1.000000	0.71417	0.001000	0.08648	0.000000	0.00434	1.432000	0.34936	-0.061000	0.13110	-0.340000	0.08031	GCG	SHANK2-001	KNOWN	basic	protein_coding	NA	protein_coding	OTTHUMT00000259184.1		-	ENST00000409161.1	Missense_Mutation	SNP	11 : 70332827 - 70332827 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	457	9
SLC12A8	84561	broad.mit.edu	37	3	124826478	124826478	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr3:124826478C>T	ENST00000393469.4	-	9	1601	c.1552G>A	c.(1552-1554)Gag>Aag	p.E518K	SLC12A8_ENST00000423114.2_Missense_Mutation_p.E547K|SLC12A8_ENST00000314584.7_Missense_Mutation_p.E271K|SLC12A8_ENST00000430155.2_Missense_Mutation_p.E319K|SLC12A8_ENST00000469902.1_Missense_Mutation_p.E518K|SLC12A8_ENST00000465475.1_5'UTR	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	518					potassium ion transport	integral to membrane	symporter activity			endometrium(2)|kidney(2)|lung(12)	16						TCAGAGATCTCGACAGGGAAA	0.552		NA											C	1	5e-04	NA	NA	2184	NA	0.9997	,	,	NA	3e-04	0.0013	NA	NA	5e-04	0.7622	EXOME	NA	NA	0.0011	SNP								NA				0								C	LYS/GLU,LYS/GLU	0,4142		0,0,2071	107	124	118		1552,1552	0.9	0	3		118	8,8424		0,8,4208	yes	missense,missense	SLC12A8	NM_001195483.1,NM_024628.5	56,56	0,8,6279	TT,TC,CC	NA	0.0949,0.0,0.0636	benign,benign	518/715,518/715	124826478	8,12566	2071	4216	6287	SO:0001583	missense				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955	84561	84561		Solute carriers	15595	protein-coding gene	gene with protein product	solute carrier family 12 (sodium/potassium/chloride transporters), member 8, cation-chloride cotransporter 9	611316			NA	11863360	Standard	NM_024628	NM_024628	NA	Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.1552G>A	3.37:g.124826478C>T	ENSP00000377112:p.Glu518Lys	NA	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	37	CCDS43143.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.97	1.501163	0.26861	0.0	9.49E-4	ENSG00000221955	ENST00000430155;ENST00000393469;ENST00000423114;ENST00000469902;ENST00000314584	D;D;D;D;T	0.88509	-1.89;-2.37;-2.39;-2.37;-1.45	4.85	0.905	0.19307	.	.	.	.	.	T	0.79747	0.4499	L	0.50333	1.59	0.09310	N	1	P;B;B;P	0.44521	0.837;0.051;0.05;0.466	B;B;B;B	0.34418	0.182;0.007;0.003;0.029	T	0.68269	-0.5453	9	0.32370	T	0.25	.	3.2098	0.06678	0.1205:0.5474:0.1174:0.2147	.	271;547;518;319	A0AV02-4;A0AV02-2;A0AV02;A0AV02-3	.;.;S12A8_HUMAN;.	K	319;518;547;518;271	ENSP00000415713:E319K;ENSP00000377112:E518K;ENSP00000404243:E547K;ENSP00000418783:E518K;ENSP00000323632:E271K	ENSP00000323632:E271K	E	-	1	0	SLC12A8	126309168	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.118000	0.15605	0.234000	0.21139	-0.181000	0.13052	GAG	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000355711.4		-	ENST00000393469.4	Missense_Mutation	SNP	3 : 124826478 - 124826478 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	660	14
SLC22A8	9376	broad.mit.edu	37	11	62760741	62760741	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:62760741G>A	ENST00000336232.2	-	11	1732	c.1597C>T	c.(1597-1599)Cag>Tag	p.Q533*	SLC22A8_ENST00000430500.2_Nonsense_Mutation_p.Q533*|SLC22A8_ENST00000535878.1_Nonsense_Mutation_p.Q410*|SLC22A8_ENST00000545207.1_Nonsense_Mutation_p.Q442*|SLC22A8_ENST00000311438.8_3'UTR	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	533					response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28						CCGTGAGGCTGTAGAGGGATC	0.607		NA											G	1	5e-04	NA	NA	2184	NA	1	,	,	NA	3e-04	0.0013	NA	NA	5e-04	1	EXOME	NA	NA	4e-04	SNP								NA				0													55	54	54			NA	NA	11		NA											NA				62760741		2201	4298	6499	SO:0001587	stop_gained			AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452	9376	9376		Solute carriers	10972	protein-coding gene	gene with protein product		607581			NA	10049739	Standard	NM_004254	NM_004254	NA	Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.1597C>T	11.37:g.62760741G>A	ENSP00000337335:p.Gln533*	NA	O95820|Q59EW9|Q96TC1	37	CCDS8042.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	20.2	3.942501	0.73672	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000430500	.	.	.	5.26	3.29	0.37713	.	0.598101	0.15881	N	0.240067	.	.	.	.	.	.	0.36702	D	0.880157	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	10.4632	0.44592	0.0:0.0:0.5628:0.4372	.	.	.	.	X	533;519;442;410;533	.	ENSP00000337335:Q533X	Q	-	1	0	SLC22A8	62517317	0.970000	0.33590	0.889000	0.34880	0.520000	0.34377	1.273000	0.33121	0.615000	0.30124	0.561000	0.74099	CAG	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000396191.1		-	ENST00000336232.2	Nonsense_Mutation	SNP	11 : 62760741 - 62760741 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	190	5
SLC45A2	51151	broad.mit.edu	37	5	33947401	33947401	+	Missense_Mutation	SNP	G	G	A	rs149980670		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr5:33947401G>A	ENST00000382102.3	-	6	1292	c.1235C>T	c.(1234-1236)aCg>aTg	p.T412M	SLC45A2_ENST00000296589.4_Missense_Mutation_p.T412M|SLC45A2_ENST00000342059.3_Missense_Mutation_p.T353M	NM_001012509.2	NP_001012527	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	412					melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane		p.T412M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						AATAAATCCCGTCCCCAGGCC	0.488		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		Ovarian(31;380 859 8490 22203 49048)							NA				1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						G	MET/THR,MET/THR	0,4406		0,0,2203	146	147	147		1235,1235	5.6	1	5	dbSNP_134	147	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLC45A2	NM_001012509.2,NM_016180.3	81,81	0,1,6502	AA,AG,GG	NA	0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	412/461,412/531	33947401	1,13005	2203	4300	6503	SO:0001583	missense			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175	51151	51151		Solute carriers	16472	protein-coding gene	gene with protein product		606202	membrane associated transporter	MATP	NA	11916009, 11574907	Standard	NM_016180	NM_001012509	NA	Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000382102.3:c.1235C>T	5.37:g.33947401G>A	ENSP00000371534:p.Thr412Met	NA	Q6P2P0|Q9BTM3	37	CCDS43308.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988904	0.93106	0.0	1.16E-4	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63	5.62	5.62	0.85841	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.91872	0.7427	L	0.39020	1.185	0.80722	D	1	D;P	0.89917	1.0;0.622	D;P	0.85130	0.997;0.466	D	0.86327	0.1696	10	0.02654	T	1	-12.7534	19.6445	0.95771	0.0:0.0:1.0:0.0	.	412;412	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	M	412;353;412;237	ENSP00000296589:T412M;ENSP00000341014:T353M;ENSP00000371534:T412M;ENSP00000424010:T237M	ENSP00000296589:T412M	T	-	2	0	SLC45A2	33983158	1.000000	0.71417	0.958000	0.39756	0.964000	0.63967	9.519000	0.98025	2.646000	0.89796	0.655000	0.94253	ACG	SLC45A2-002	KNOWN	basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000246885.2		-	ENST00000382102.3	Missense_Mutation	SNP	5 : 33947401 - 33947401 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1163	49
SLC4A5	57835	broad.mit.edu	37	2	74474203	74474203	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr2:74474203G>A	ENST00000394019.2	-	19	2416	c.2019C>T	c.(2017-2019)ttC>ttT	p.F673F	SLC4A5_ENST00000377632.1_Silent_p.F673F|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000357822.5_Silent_p.F673F|SLC4A5_ENST00000377634.4_Silent_p.F673F|SLC4A5_ENST00000359484.4_Silent_p.F609F|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000358683.4_Silent_p.F609F|SLC4A5_ENST00000423644.1_Silent_p.F673F|SLC4A5_ENST00000346834.4_Silent_p.F673F	NM_133478.2	NP_597812.1	Q9BY07	S4A5_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 5	673						apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						AGGTAGTGATGAAGTTTGGCT	0.532		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													257	241	247			NA	NA	2		NA											NA				74474203		2203	4300	6503	SO:0001819	synonymous_variant			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687	57835	57835		Solute carriers	18168	protein-coding gene	gene with protein product		606757	solute carrier family 4, sodium bicarbonate cotransporter, member 5		NA	10978526, 11087115	Standard		NM_133478	NA	Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000394019.2:c.2019C>T	2.37:g.74474203G>A		NA	Q32MA7|Q59EQ9|Q8WXD3|Q8WXD7|Q96DS7|Q96DS8|Q9HBU5	37	CCDS1937.1																																																																																			SLC4A5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000206584.2		-	ENST00000394019.2	Silent	SNP	2 : 74474203 - 74474203 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1537	61
SPC24	147841	broad.mit.edu	37	19	11258504	11258504	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:11258504C>A	ENST00000592540.1	-	4	508	c.477G>T	c.(475-477)atG>atT	p.M159I		NM_182513.2	NP_872319.1	Q8NBT2	SPC24_HUMAN	SPC24, NDC80 kinetochore complex component	159	Interaction with the C-terminus of SPBC25.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	5						TGCCTTTGACCATCCCTGGCT	0.413		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													57	59	58			NA	NA	19		NA											NA				11258504		1911	4119	6030	SO:0001583	missense			AK075287	CCDS45974.1	19p13.2	2013-06-05	2013-06-05	2007-03-02		ENSG00000161888	147841	147841			26913	protein-coding gene	gene with protein product		609394	spindle pole body component 24 homolog (S. cerevisiae), SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)	SPBC24	NA		Standard	NM_182513	NM_182513	NA	Approved	FLJ90806	uc002mql.2	Q8NBT2		ENST00000592540.1:c.477G>T	19.37:g.11258504C>A	ENSP00000465075:p.Met159Ile	NA		37	CCDS45974.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.267896	0.00259	.	.	ENSG00000161888	ENST00000429831;ENST00000423327	.	.	.	5.09	-3.27	0.05048	.	0.808315	0.11282	N	0.580210	T	0.20901	0.0503	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26744	-1.0094	9	0.19590	T	0.45	-10.8297	8.142	0.31089	0.1205:0.2107:0.5919:0.077	.	159	Q8NBT2	SPC24_HUMAN	I	113;159	.	ENSP00000397131:M159I	M	-	3	0	SPC24	11119504	0.000000	0.05858	0.007000	0.13788	0.124000	0.20399	-0.899000	0.04101	-0.105000	0.12132	-0.150000	0.13652	ATG	SPC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000453059.1		-	ENST00000592540.1	Missense_Mutation	SNP	19 : 11258504 - 11258504 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	124	5
SPTA1	6708	broad.mit.edu	37	1	158631116	158631116	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:158631116G>C	ENST00000368147.4	-	18	2728	c.2548C>G	c.(2548-2550)Caa>Gaa	p.Q850E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	NA					actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTTATCTCTTGAATGCGTGGT	0.443		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													262	255	258			NA	NA	1		NA											NA				158631116		1934	4151	6085	SO:0001583	missense			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554	6708	6708		EF-hand domain containing	11272	protein-coding gene	gene with protein product	elliptocytosis 2	182860	spectrin, alpha, erythrocytic 1 (elliptocytosis 2)		NA		Standard	NM_003126	NM_003126	NA	Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2548C>G	1.37:g.158631116G>C	ENSP00000357129:p.Gln850Glu	NA	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	0.767	-0.767128	0.02974	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.30448	1.53;1.53	4.81	3.88	0.44766	.	.	.	.	.	T	0.08223	0.0205	L	0.36672	1.1	0.09310	N	1	B	0.11235	0.004	B	0.15052	0.012	T	0.32561	-0.9902	9	0.09590	T	0.72	.	10.6579	0.45686	0.0:0.0:0.5318:0.4682	.	850	P02549	SPTA1_HUMAN	E	850	ENSP00000357130:Q850E;ENSP00000357129:Q850E	ENSP00000357129:Q850E	Q	-	1	0	SPTA1	156897740	0.819000	0.29175	0.012000	0.15200	0.057000	0.15508	2.290000	0.43531	1.197000	0.43143	0.650000	0.86243	CAA	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000051851.3		-	ENST00000368147.4	Missense_Mutation	SNP	1 : 158631116 - 158631116 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	859	21
SRCAP	10847	broad.mit.edu	37	16	30723229	30723229	+	Silent	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr16:30723229A>G	ENST00000262518.4	+	12	1951	c.1566A>G	c.(1564-1566)gcA>gcG	p.A522A	SRCAP_ENST00000395059.2_Silent_p.A522A|SRCAP_ENST00000344771.4_Silent_p.A522A	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	522	Glu-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GAAGTTCAGCATCAGAGGAAT	0.483		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													79	77	78			NA	NA	16		NA											NA				30723229		2197	4300	6497	SO:0001819	synonymous_variant			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603	10847	10847			16974	protein-coding gene	gene with protein product	Swi2/Snf2-related ATPase homolog (S. cerevisiae), domino homolog 1 (Drosophila)	611421			NA	10347196, 9205841	Standard	NM_006662	NM_006662	NA	Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1566A>G	16.37:g.30723229A>G		NA	B0JZA6|O15026|Q7Z744|Q9Y5L9	37	CCDS10689.2																																																																																			SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000255523.1		+	ENST00000262518.4	Silent	SNP	16 : 30723229 - 30723229 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	453	13
SYNE2	23224	broad.mit.edu	37	14	64580216	64580216	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr14:64580216A>G	ENST00000554584.1	+	66	12863	c.12812A>G	c.(12811-12813)aAc>aGc	p.N4271S	SYNE2_ENST00000358025.3_Missense_Mutation_p.N4256S|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.N890S|SYNE2_ENST00000357395.3_Missense_Mutation_p.N641S|SYNE2_ENST00000394768.2_Missense_Mutation_p.N641S|SYNE2_ENST00000344113.4_Missense_Mutation_p.N4256S			Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4256					centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAACAAGCCAACGTGGCAGTT	0.577		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													36	34	35			NA	NA	14		NA											NA				64580216		2203	4300	6503	SO:0001583	missense			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654	23224	23224			17084	protein-coding gene	gene with protein product	nuclear envelope spectrin repeat-2, nucleus and actin connecting element	608442			NA	10231032, 10878022	Standard	NM_182914	NM_182910	NA	Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000554584.1:c.12812A>G	14.37:g.64580216A>G	ENSP00000452570:p.Asn4271Ser	NA	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	37		.	.	.	.	.	.	.	.	.	.	A	12.33	1.904349	0.33628	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000553308	T;T;T;T;T;T	0.56611	0.84;4.14;0.84;0.45;4.19;4.14	5.73	0.724	0.18236	.	0.494042	0.20205	N	0.097004	T	0.37758	0.1015	L	0.32530	0.975	0.80722	D	1	B;B;B	0.23377	0.004;0.051;0.084	B;B;B	0.18561	0.008;0.01;0.022	T	0.10989	-1.0606	10	0.46703	T	0.11	.	9.7131	0.40258	0.7534:0.0:0.2466:0.0	.	641;4256;4256	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	S	4256;641;4256;4271;4271;890;641;148	ENSP00000350719:N4256S;ENSP00000349969:N641S;ENSP00000341781:N4256S;ENSP00000452570:N4271S;ENSP00000450831:N890S;ENSP00000378249:N641S	ENSP00000261678:N4271S	N	+	2	0	SYNE2	63649969	0.765000	0.28485	0.998000	0.56505	0.999000	0.98932	0.068000	0.14531	-0.097000	0.12307	0.533000	0.62120	AAC	SYNE2-002	NOVEL	basic|exp_conf	protein_coding	NA	protein_coding	OTTHUMT00000411905.1		+	ENST00000554584.1	Missense_Mutation	SNP	14 : 64580216 - 64580216 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	236	12
TAP2	6891	broad.mit.edu	37	6	32800563	32800563	+	Silent	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:32800563C>T	ENST00000452392.2	-	6	1157	c.984G>A	c.(982-984)gcG>gcA	p.A328A	TAP2_ENST00000374899.4_Silent_p.A328A|TAP2_ENST00000374897.2_Silent_p.A328A			Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	328	ABC transmembrane type-1.|Involved in peptide-binding site.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding	p.A328A(1)			NA						CCACCTGCCCCGCCCTGGCCA	0.592		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				1	Substitution - coding silent(1)	large_intestine(1)											60	62	61			NA	NA	6		NA											NA				32800563		1509	2709	4218	SO:0001819	synonymous_variant			M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267	6891	6891		ATP binding cassette transporters / subfamily B	44	protein-coding gene	gene with protein product		170261		ABCB3	NA	1529427, 1946428, 16395595	Standard	NM_000544	NM_001290043	NA	Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.984G>A	6.37:g.32800563C>T		NA	B0V2J8|O95410|Q9UQ83	37																																																																																				TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	NA	protein_coding	OTTHUMT00000361828.1		-	ENST00000452392.2	Silent	SNP	6 : 32800563 - 32800563 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	636	10
TNFRSF1B	7133	broad.mit.edu	37	1	12262126	12262126	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:12262126G>T	ENST00000376259.3	+	9	1092	c.1003G>T	c.(1003-1005)Gcc>Tcc	p.A335S	TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	335					apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)|Infliximab(DB00065)	GGAGAGCTCGGCCAGTGCGTT	0.706		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													11	14	13			NA	NA	1		NA											NA				12262126		2194	4288	6482	SO:0001583	missense			M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137	7133	7133		Tumor necrosis factor receptor superfamily, CD molecules	11917	protein-coding gene	gene with protein product		191191		TNFR2	NA	2158863, 8702885	Standard	NM_001066	NM_001066	NA	Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.1003G>T	1.37:g.12262126G>T	ENSP00000365435:p.Ala335Ser	NA	B1AJZ3|Q16042|Q6YI29|Q9UIH1	37	CCDS145.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428595	0.43122	.	.	ENSG00000028137	ENST00000376259	D	0.87029	-2.2	4.76	2.74	0.32292	.	2.391520	0.01257	N	0.009056	D	0.85839	0.5790	M	0.67953	2.075	0.09310	N	0.999997	P	0.42908	0.793	B	0.38842	0.283	T	0.70718	-0.4795	10	0.32370	T	0.25	-19.0182	7.1672	0.25698	0.1003:0.1731:0.7265:0.0	.	335	P20333	TNR1B_HUMAN	S	335	ENSP00000365435:A335S	ENSP00000365435:A335S	A	+	1	0	TNFRSF1B	12184713	0.448000	0.25681	0.930000	0.37139	0.708000	0.40852	1.783000	0.38664	1.123000	0.41961	0.561000	0.74099	GCC	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000005133.1		+	ENST00000376259.3	Missense_Mutation	SNP	1 : 12262126 - 12262126 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	68	11
TOMM70A	9868	broad.mit.edu	37	3	100092471	100092471	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr3:100092471G>C	ENST00000284320.5	-	8	1694	c.1246C>G	c.(1246-1248)Caa>Gaa	p.Q416E		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	416					protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						TCTTCAACTTGATCAAGGAGT	0.358		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													117	113	114			NA	NA	3		NA											NA				100092471		2203	4300	6503	SO:0001583	missense			AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174	9868	9868		Tetratricopeptide (TTC) repeat domain containing	11985	protein-coding gene	gene with protein product		606081	translocase of outer mitochondrial membrane 70 (yeast) homolog A, translocase of outer mitochondrial membrane 70 homolog A (yeast)		NA	10582581	Standard		NM_014820	NA	Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1246C>G	3.37:g.100092471G>C	ENSP00000284320:p.Gln416Glu	NA	D3DN48	37	CCDS33807.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509968	0.85282	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	T	0.53423	0.62	5.89	5.89	0.94794	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.049763	0.85682	D	0.000000	T	0.29223	0.0727	N	0.10645	0.015	0.80722	D	1	B	0.26258	0.145	B	0.26693	0.072	T	0.20338	-1.0278	10	0.05620	T	0.96	-6.0465	20.2576	0.98430	0.0:0.0:1.0:0.0	.	416	O94826	TOM70_HUMAN	E	416;309	ENSP00000284320:Q416E	ENSP00000284320:Q416E	Q	-	1	0	TOMM70A	101575161	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.907000	0.92634	2.783000	0.95769	0.655000	0.94253	CAA	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000353141.2		-	ENST00000284320.5	Missense_Mutation	SNP	3 : 100092471 - 100092471 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	520	9
TP53	7157	broad.mit.edu	37	17	7579317	7579317	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr17:7579317A>G	ENST00000420246.2	-	4	502	c.370T>C	c.(370-372)Tgc>Cgc	p.C124R	TP53_ENST00000445888.2_Missense_Mutation_p.C124R|TP53_ENST00000413465.2_Missense_Mutation_p.C124R|TP53_ENST00000359597.4_Missense_Mutation_p.C124R|TP53_ENST00000455263.2_Missense_Mutation_p.C124R|TP53_ENST00000269305.4_Missense_Mutation_p.C124R	NM_001126114.2|NM_001276696.1	NP_001119586.1|NP_001263625.1	P04637	P53_HUMAN	tumor protein p53	124	Interaction with AXIN1 (By similarity).|Interaction with HIPK1 (By similarity).|Required for interaction with FBXO42.		C -> G (in a sporadic cancer; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in a sporadic cancer; somatic mutation).|C -> Y (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(8)|p.C124G(4)|p.C124R(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.C124fs*46(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.C124fs*48(1)|p.C124fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CTGACCGTGCAAGTCACAGAC	0.542		111	Mis, N, F		breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types	breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		L, E, M, O	28	Deletion - Frameshift(9)|Substitution - Missense(8)|Whole gene deletion(8)|Insertion - Frameshift(2)|Deletion - In frame(1)	ovary(5)|upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(3)|breast(3)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)											66	62	63			NA	NA	17		NA											NA				7579317		2203	4300	6503	SO:0001583	missense	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510	7157	7157			11998	protein-coding gene	gene with protein product	Li-Fraumeni syndrome	191170			NA	6396087, 3456488, 2047879	Standard	NM_000546	NM_001126115	NA	Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000420246.2:c.370T>C	17.37:g.7579317A>G	ENSP00000391127:p.Cys124Arg	NA	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	37	CCDS45606.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.075353	0.76415	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99751	-6.63;-6.63;-6.63;-6.63;-6.63;-6.63;-6.63;-6.63	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.099990	0.64402	D	0.000002	D	0.99674	0.9878	M	0.78049	2.395	0.80722	D	1	D;P;D;P;D;D;D	0.89917	0.988;0.934;1.0;0.923;0.999;1.0;0.986	P;P;D;P;D;D;D	0.91635	0.883;0.806;0.997;0.63;0.995;0.999;0.918	D	0.97415	1.0005	10	0.72032	D	0.01	-11.7577	12.5363	0.56144	1.0:0.0:0.0:0.0	.	85;124;124;124;124;124;124	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	124;124;124;124;124;124;113;124;124	ENSP00000410739:C124R;ENSP00000352610:C124R;ENSP00000269305:C124R;ENSP00000398846:C124R;ENSP00000391127:C124R;ENSP00000391478:C124R;ENSP00000424104:C124R;ENSP00000426252:C124R	ENSP00000269305:C124R	C	-	1	0	TP53	7520042	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	5.673000	0.68109	2.125000	0.65367	0.533000	0.62120	TGC	TP53-005	KNOWN	NMD_exception|basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000367401.1		-	ENST00000420246.2	Missense_Mutation	SNP	17 : 7579317 - 7579317 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	649	11
TRPS1	7227	broad.mit.edu	37	8	116430660	116430660	+	Silent	SNP	A	A	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr8:116430660A>T	ENST00000395715.3	-	6	3298	c.2721T>A	c.(2719-2721)gtT>gtA	p.V907V	TRPS1_ENST00000220888.5_Silent_p.V894V|TRPS1_ENST00000520276.1_Silent_p.V898V|TRPS1_ENST00000519076.1_Silent_p.V648V	NM_001282902.1|NM_001282903.1|NM_014112.2	NP_001269831.1|NP_001269832.1|NP_054831.2	Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	894					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGGCACAAAAAACACCGGAGC	0.488		NA							Langer-Giedion syndrome					NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													112	113	113			NA	NA	8		NA											NA				116430660		1914	4128	6042	SO:0001819	synonymous_variant	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447	7227	7227		GATA zinc finger domain containing, Zinc fingers, C2H2-type	12340	protein-coding gene	gene with protein product		604386			NA	8530105, 10615131, 10647898	Standard	NM_014112	NM_001282903	NA	Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000395715.3:c.2721T>A	8.37:g.116430660A>T		NA	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	37	CCDS6318.2	.	.	.	.	.	.	.	.	.	.	A	5.146	0.212445	0.09757	.	.	ENSG00000104447	ENST00000518018	.	.	.	5.81	3.3	0.37823	.	.	.	.	.	T	0.56217	0.1970	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51529	-0.8694	4	.	.	.	.	7.5919	0.28025	0.8057:0.0:0.0684:0.1259	.	.	.	.	I	19	.	.	F	-	1	0	TRPS1	116499836	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.219000	0.32479	1.027000	0.39758	0.528000	0.53228	TTT	TRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000286435.3		-	ENST00000395715.3	Silent	SNP	8 : 116430660 - 116430660 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	830	29
TTN	7273	broad.mit.edu	37	2	179614657	179614657	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr2:179614657G>C	ENST00000589042.1	-	47	11536				TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.P4157R|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000591111.1_Intron	NM_001267550.1	NP_001254479.1	Q8WZ42	TITIN_HUMAN	titin	NA							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATTTTTGGTGGTTCATTAGT	0.388		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													75	80	79			NA	NA	2		NA											NA				179614657		2203	4297	6500	SO:0001627	intron_variant			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657	7273	7273		Immunoglobulin superfamily / I-set domain containing, Immunoglobulin superfamily / Immunoglobulin-like domain containing, Fibronectin type III domain containing	12403	protein-coding gene	gene with protein product		188840	cardiomyopathy, dilated 1G (autosomal dominant)	CMD1G	NA	2129545, 10051295	Standard	NM_133378	NM_003319	NA	Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000589042.1:c.11311+3193C>G	2.37:g.179614657G>C		NA	E7ET18	37	CCDS59435.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934167	0.52866	.	.	ENSG00000155657	ENST00000360870	T	0.63913	-0.07	5.84	5.84	0.93424	.	.	.	.	.	T	0.67785	0.2930	L	0.27053	0.805	0.80722	D	1	D	0.67145	0.996	D	0.66497	0.944	T	0.70594	-0.4829	9	0.87932	D	0	.	15.2925	0.73875	0.0687:0.0:0.9313:0.0	.	4157	Q8WZ42-6	.	R	4157	ENSP00000354117:P4157R	ENSP00000354117:P4157R	P	-	2	0	TTN	179322902	1.000000	0.71417	0.998000	0.56505	0.418000	0.31294	5.415000	0.66411	2.765000	0.95021	0.655000	0.94253	CCA	TTN-018	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000450680.2		-	ENST00000589042.1	Intron	SNP	2 : 179614657 - 179614657 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	385	10
TUBGCP6	85378	broad.mit.edu	37	22	50664531	50664531	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr22:50664531T>C	ENST00000248846.5	-	9	1885	c.1781A>G	c.(1780-1782)gAc>gGc	p.D594G	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.D594G|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	594					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GACGTATATGTCGTGGGCAAT	0.557		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													249	236	241			NA	NA	22		NA											NA				50664531		2203	4300	6503	SO:0001583	missense			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159	85378	85378			18127	protein-coding gene	gene with protein product	gamma-tubulin complex component 6	610053			NA	11694571, 11258795	Standard	NM_020461	XR_244458	NA	Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.1781A>G	22.37:g.50664531T>C	ENSP00000248846:p.Asp594Gly	NA	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.010753	0.75046	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.08807	3.05;3.05	5.04	5.04	0.67666	.	0.109872	0.64402	N	0.000010	T	0.26122	0.0637	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.00802	-1.1560	10	0.62326	D	0.03	.	14.7674	0.69648	0.0:0.0:0.0:1.0	.	594;594	B2RWN4;Q96RT7	.;GCP6_HUMAN	G	594	ENSP00000248846:D594G;ENSP00000397387:D594G	ENSP00000248846:D594G	D	-	2	0	TUBGCP6	49006658	1.000000	0.71417	0.991000	0.47740	0.435000	0.31806	7.905000	0.87416	1.906000	0.55180	0.379000	0.24179	GAC	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000075004.3		-	ENST00000248846.5	Missense_Mutation	SNP	22 : 50664531 - 50664531 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1264	37
TULP4	56995	broad.mit.edu	37	6	158924700	158924700	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:158924700G>C	ENST00000367097.3	+	13	5362	c.4005G>C	c.(4003-4005)aaG>aaC	p.K1335N	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1335					intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AATTTGGAAAGAAGAACCGGA	0.537		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													43	47	46			NA	NA	6		NA											NA				158924700		2203	4300	6503	SO:0001583	missense				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338	56995	56995		WD repeat domain containing	15530	protein-coding gene	gene with protein product					NA	11595174	Standard	NM_020245	NM_020245	NA	Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.4005G>C	6.37:g.158924700G>C	ENSP00000356064:p.Lys1335Asn	NA	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440322	0.63067	.	.	ENSG00000130338	ENST00000367097	T	0.70869	-0.52	5.7	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.76492	0.3995	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.80020	-0.1557	10	0.66056	D	0.02	-27.8828	11.6899	0.51510	0.1417:0.0:0.8583:0.0	.	1335	Q9NRJ4	TULP4_HUMAN	N	1335	ENSP00000356064:K1335N	ENSP00000356064:K1335N	K	+	3	2	TULP4	158844688	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.612000	0.54142	1.425000	0.47237	0.561000	0.74099	AAG	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000042869.1		+	ENST00000367097.3	Missense_Mutation	SNP	6 : 158924700 - 158924700 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	390	13
TXNIP	10628	broad.mit.edu	37	1	145440118	145440118	+	Silent	SNP	T	T	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:145440118T>A	ENST00000369317.4	+	4	886	c.552T>A	c.(550-552)atT>atA	p.I184I	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	184					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTGCTCGAATTGACAGAAAAG	0.448		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													148	162	157			NA	NA	1		NA											NA				145440118		2203	4300	6503	SO:0001819	synonymous_variant			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972	10628	10628			16952	protein-coding gene	gene with protein product	upregulated by 1,25-dihydroxyvitamin D-3, thioredoxin binding protein 2	606599			NA	8086474	Standard	NM_006472	NM_006472	NA	Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.552T>A	1.37:g.145440118T>A		NA	Q16226|Q6PML0|Q9BXG9	37	CCDS913.1																																																																																			TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000038547.1		+	ENST00000369317.4	Silent	SNP	1 : 145440118 - 145440118 A PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	1389	56
WDR34	89891	broad.mit.edu	37	9	131403176	131403176	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr9:131403176C>T	ENST00000372715.2	-	2	289	c.229G>A	c.(229-231)Gcc>Acc	p.A77T		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	77						cytoplasm				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						CTGGCCTGGGCGGATGCACTG	0.652		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													37	40	39			NA	NA	9		NA											NA				131403176		2203	4299	6502	SO:0001583	missense			BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333	89891	89891		WD repeat domain containing	28296	protein-coding gene	gene with protein product		613363			NA	19521662, 21953912, 24183451	Standard	NM_052844	NM_052844	NA	Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.229G>A	9.37:g.131403176C>T	ENSP00000361800:p.Ala77Thr	NA	Q5VXV4|Q9BV46	37	CCDS6906.2	.	.	.	.	.	.	.	.	.	.	C	6.909	0.537276	0.13188	.	.	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T	0.61980	0.06	5.4	-3.5	0.04710	.	1.250360	0.05511	N	0.560229	T	0.42653	0.1212	L	0.37630	1.12	0.09310	N	1	B;B	0.13594	0.003;0.008	B;B	0.06405	0.002;0.002	T	0.28650	-1.0037	10	0.06365	T	0.9	.	5.4964	0.16805	0.2163:0.3838:0.0:0.3999	.	62;77	A2A3F8;Q96EX3	.;WDR34_HUMAN	T	77;68;62	ENSP00000361800:A77T	ENSP00000361800:A77T	A	-	1	0	WDR34	130442997	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.250000	0.08830	-0.472000	0.06881	-0.140000	0.14226	GCC	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000054463.1		-	ENST00000372715.2	Missense_Mutation	SNP	9 : 131403176 - 131403176 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	430	12
WDR90	197335	broad.mit.edu	37	16	716059	716059	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr16:716059C>T	ENST00000549091.1	+	36	4642	c.4550C>T	c.(4549-4551)aCg>aTg	p.T1517M	WDR90_ENST00000547543.1_3'UTR|WDR90_ENST00000293879.4_Missense_Mutation_p.T1515M|WDR90_ENST00000315764.4_Missense_Mutation_p.T114M|WDR90_ENST00000547944.1_Missense_Mutation_p.T114M	NM_145294.4	NP_660337.3	Q96KV7	WDR90_HUMAN	WD repeat domain 90	1515										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GTCTCCCGCACGGCCATGGAG	0.677		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													49	53	52			NA	NA	16		NA											NA				716059		2132	4228	6360	SO:0001583	missense			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996	197335	197335		WD repeat domain containing	26960	protein-coding gene	gene with protein product			chromosome 16 open reading frame 17, chromosome 16 open reading frame 15, chromosome 16 open reading frame 16, chromosome 16 open reading frame 19, chromosome 16 open reading frame 18	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18	NA	11572484, 11157797	Standard	NM_145294	XM_005255160	NA	Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000549091.1:c.4550C>T	16.37:g.716059C>T	ENSP00000448122:p.Thr1517Met	NA	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	37		.	.	.	.	.	.	.	.	.	.	C	5.658	0.306009	0.10733	.	.	ENSG00000161996	ENST00000549091;ENST00000293879;ENST00000547944;ENST00000315764	T;T;T;T	0.65549	3.43;1.56;-0.16;1.62	4.45	1.23	0.21249	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	1.085630	0.06926	N	0.810310	T	0.47173	0.1431	L	0.41027	1.25	0.09310	N	1	P;P;P;P	0.45428	0.858;0.823;0.621;0.729	B;B;B;B	0.33042	0.133;0.157;0.05;0.121	T	0.28618	-1.0038	10	0.33940	T	0.23	.	8.6721	0.34156	0.0:0.8547:0.0:0.1453	.	114;114;114;1515	Q96KV7-10;Q96KV7-7;G3V201;Q96KV7	.;.;.;WDR90_HUMAN	M	1517;1515;114;114	ENSP00000448122:T1517M;ENSP00000293879:T1515M;ENSP00000449576:T114M;ENSP00000322808:T114M	ENSP00000293879:T1515M	T	+	2	0	WDR90	656060	0.364000	0.24997	0.000000	0.03702	0.097000	0.18754	2.238000	0.43070	-0.005000	0.14395	0.561000	0.74099	ACG	WDR90-001	NOVEL	basic|appris_candidate_longest	protein_coding	NA	protein_coding	OTTHUMT00000109343.3		+	ENST00000549091.1	Missense_Mutation	SNP	16 : 716059 - 716059 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	622	14
ZNF134	7693	broad.mit.edu	37	19	58131705	58131705	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:58131705A>G	ENST00000396161.5	+	3	528	c.218A>G	c.(217-219)cAt>cGt	p.H73R	ZNF134_ENST00000597975.1_3'UTR	NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	73						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		GGTACACACCATGGACTGAAA	0.488		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													107	104	105			NA	NA	19		NA											NA				58131705		2043	4224	6267	SO:0001583	missense			U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762	7693	7693		Zinc fingers, C2H2-type	12918	protein-coding gene	gene with protein product		604076	zinc finger protein 134 (clone pHZ-15)		NA	7557990	Standard	NM_003435	NM_003435	NA	Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.218A>G	19.37:g.58131705A>G	ENSP00000379464:p.His73Arg	NA	Q9Y4B2	37	CCDS42638.1	.	.	.	.	.	.	.	.	.	.	A	9.039	0.989204	0.18966	.	.	ENSG00000213762	ENST00000418193;ENST00000396161	T	0.19394	2.15	4.05	-1.24	0.09435	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11024	0.0269	N	0.21583	0.68	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.34403	-0.9830	9	0.87932	D	0	.	0.8496	0.01169	0.3547:0.262:0.0975:0.2858	.	73	P52741	ZN134_HUMAN	R	140;73	ENSP00000379464:H73R	ENSP00000379464:H73R	H	+	2	0	ZNF134	62823517	0.000000	0.05858	0.000000	0.03702	0.969000	0.65631	-1.220000	0.02971	-0.103000	0.12175	0.533000	0.62120	CAT	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000466808.1		+	ENST00000396161.5	Missense_Mutation	SNP	19 : 58131705 - 58131705 G PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	784	13
ZNF442	79973	broad.mit.edu	37	19	12462842	12462842	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:12462842T>C	ENST00000242804.4	-	5	830	c.248A>G	c.(247-249)aAt>aGt	p.N83S	ZNF442_ENST00000438182.1_Missense_Mutation_p.N14S	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	83	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						CCTCCTGGGATTTCTGTGCTG	0.358		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													133	122	126			NA	NA	19		NA											NA				12462842		2203	4300	6503	SO:0001583	missense			AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342	79973	79973		Zinc fingers, C2H2-type, -	20877	protein-coding gene	gene with protein product					NA		Standard	NM_030824	NM_030824	NA	Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.248A>G	19.37:g.12462842T>C	ENSP00000242804:p.Asn83Ser	NA		37	CCDS12271.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.573187	0.28092	.	.	ENSG00000198342	ENST00000242804;ENST00000438182;ENST00000424168	T;T;T	0.06371	3.41;3.31;3.99	1.51	1.51	0.23008	Krueppel-associated box (3);	.	.	.	.	T	0.02970	0.0088	N	0.13327	0.33	0.09310	N	1	P	0.36616	0.561	B	0.32864	0.154	T	0.43589	-0.9382	9	0.14656	T	0.56	.	5.4007	0.16295	0.0:0.0:0.0:1.0	.	83	Q9H7R0	ZN442_HUMAN	S	83;14;14	ENSP00000242804:N83S;ENSP00000388634:N14S;ENSP00000404935:N14S	ENSP00000242804:N83S	N	-	2	0	ZNF442	12323842	0.003000	0.15002	0.232000	0.24009	0.613000	0.37349	0.306000	0.19279	0.617000	0.30160	0.260000	0.18958	AAT	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000344109.1		-	ENST00000242804.4	Missense_Mutation	SNP	19 : 12462842 - 12462842 C PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	526	12
ZNF831	128611	broad.mit.edu	37	20	57768617	57768617	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr20:57768617C>T	ENST00000371030.2	+	1	2543	c.2543C>T	c.(2542-2544)aCg>aTg	p.T848M		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	848						intracellular	nucleic acid binding|zinc ion binding			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGTGGGCCCACGCAGCCTGCC	0.637		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0								C	MET/THR	1,4017		0,1,2008	27	34	32		2543	-9.8	0	20		32	0,8370		0,0,4185	no	missense	ZNF831	NM_178457.1	81	0,1,6193	TT,TC,CC	NA	0.0,0.0249,0.0081	benign	848/1678	57768617	1,12387	2009	4185	6194	SO:0001583	missense			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203	128611	128611			16167	protein-coding gene	gene with protein product			chromosome 20 open reading frame 174	C20orf174	NA		Standard	NM_178457	NM_178457	NA	Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2543C>T	20.37:g.57768617C>T	ENSP00000360069:p.Thr848Met	NA	Q5TDR4|Q8TCP0	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	6.842	0.524657	0.13066	2.49E-4	0.0	ENSG00000124203	ENST00000371030	T	0.04654	3.58	4.91	-9.81	0.00487	.	2.099750	0.01863	N	0.036738	T	0.01835	0.0058	N	0.02539	-0.55	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.39941	-0.9589	10	0.31617	T	0.26	2.2937	6.1548	0.20332	0.0856:0.6705:0.0859:0.1581	.	848	Q5JPB2	ZN831_HUMAN	M	848	ENSP00000360069:T848M	ENSP00000360069:T848M	T	+	2	0	ZNF831	57202012	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.016000	0.00313	-2.912000	0.00307	-2.815000	0.00110	ACG	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000079916.2		+	ENST00000371030.2	Missense_Mutation	SNP	20 : 57768617 - 57768617 T PAAD-TCGA-HZ-8003-Tumor-SM-2RBK5	444	8
