Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	X1000Genome_AA	X1000Genome_AC	X1000Genome_AF	X1000Genome_AFR_AF	X1000Genome_AMR_AF	X1000Genome_AN	X1000Genome_ASN_AF	X1000Genome_AVGPOST	X1000Genome_CIEND	X1000Genome_CIPOS	X1000Genome_END	X1000Genome_ERATE	X1000Genome_EUR_AF	X1000Genome_HOMLEN	X1000Genome_HOMSEQ	X1000Genome_LDAF	X1000Genome_RSQ	X1000Genome_SNPSOURCE	X1000Genome_SVLEN	X1000Genome_SVTYPE	X1000Genome_THETA	X1000Genome_VT	ACHILLES_Lineage_Results_Top_Genes	CGC_Cancer.Germline.Mut	CGC_Cancer.Molecular.Genetics	CGC_Cancer.Somatic.Mut	CGC_Cancer.Syndrome	CGC_Chr	CGC_Chr.Band	CGC_GeneID	CGC_Name	CGC_Other.Germline.Mut	CGC_Tissue.Type	COSMIC_n_overlapping_mutations	COSMIC_overlapping_mutation_descriptions	COSMIC_overlapping_primary_sites	ClinVar_ASSEMBLY	ClinVar_HGMD_ID	ClinVar_SYM	ClinVar_TYPE	ClinVar_rs	ESP_AA	ESP_AAC	ESP_AA_AC	ESP_AA_AGE	ESP_AA_GTC	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_CA	ESP_CDP	ESP_CG	ESP_CP	ESP_Chromosome	ESP_DBSNP	ESP_DP	ESP_EA_AC	ESP_EA_AGE	ESP_EA_GTC	ESP_EXOME_CHIP	ESP_FG	ESP_GL	ESP_GM	ESP_GS	ESP_GTC	ESP_GTS	ESP_GWAS_PUBMED	ESP_MAF	ESP_PH	ESP_PP	ESP_Position	ESP_TAC	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	Familial_Cancer_Genes_Reference	Familial_Cancer_Genes_Synonym	HGNC_Accession.Numbers	HGNC_CCDS.IDs	HGNC_Chromosome	HGNC_Date.Modified	HGNC_Date.Name.Changed	HGNC_Date.Symbol.Changed	HGNC_Ensembl.Gene.ID	HGNC_Ensembl.ID.supplied.by.Ensembl.	HGNC_Entrez.Gene.ID	HGNC_Entrez.Gene.ID.supplied.by.NCBI.	HGNC_Enzyme.IDs	HGNC_Gene.family.description	HGNC_HGNC.ID	HGNC_Locus.Group	HGNC_Locus.Type	HGNC_Name.Synonyms	HGNC_OMIM.ID.supplied.by.NCBI.	HGNC_Previous.Names	HGNC_Previous.Symbols	HGNC_Primary.IDs	HGNC_Pubmed.IDs	HGNC_Record.Type	HGNC_RefSeq.IDs	HGNC_RefSeq.supplied.by.NCBI.	HGNC_Secondary.IDs	HGNC_Status	HGNC_Synonyms	HGNC_UCSC.ID.supplied.by.UCSC.	HGNC_UniProt.ID.supplied.by.UniProt.	HGNC_VEGA.IDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	ORegAnno_bin	UniProt_alt_uniprot_accessions	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP.._NR	dbNSFP_GERP.._RS	dbNSFP_GERP.._RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_fold.degenerate	dbNSFP_genename	dbNSFP_hg18_pos.1.coor.	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_id	gene_type	havana_transcript	secondary_variant_classification	strand	transcript_id	variant_classification	variant_type	key	t_ref_count	t_alt_count
AARD	441376	broad.mit.edu	37	8	117950573	117950573	+	Missense_Mutation	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr8:117950573C>T	ENST00000378279.3	+	1	136	c.91C>T	c.(91-93)Cgt>Tgt	p.R31C		NM_001025357.2	NP_001020528.1	Q4LEZ3	AARD_HUMAN	alanine and arginine rich domain containing protein	31											NA						GTTCCCACCTCGTCCCGCGTG	0.687		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													23	24	24			NA	NA	8		NA											NA				117950573		2203	4299	6502	SO:0001583	missense			AB181519, BC140924	CCDS34935.1	8q24.11	2012-04-19	2012-04-19	2012-04-19	ENSG00000205002	ENSG00000205002	441376	441376			33842	protein-coding gene	gene with protein product	Alanine and arginine-rich domain-containing protein		chromosome 8 open reading frame 85	C8orf85	NA		Standard	NM_001025357	NM_001025357	NA	Approved	LOC441376	uc003yof.3	Q4LEZ3	OTTHUMG00000164961	ENST00000378279.3:c.91C>T	8.37:g.117950573C>T	ENSP00000367528:p.Arg31Cys	NA	A5PKU8	37	CCDS34935.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149157	0.37923	.	.	ENSG00000205002	ENST00000378279	T	0.31247	1.5	3.76	-7.53	0.01336	.	0.859065	0.09483	N	0.796106	T	0.14614	0.0353	L	0.27053	0.805	0.09310	N	1	B	0.18310	0.027	B	0.08055	0.003	T	0.18618	-1.0331	10	0.66056	D	0.02	4.6087	1.4499	0.02372	0.2432:0.4215:0.2232:0.112	.	31	Q4LEZ3	AARD_HUMAN	C	31	ENSP00000367528:R31C	ENSP00000367528:R31C	R	+	1	0	C8orf85	118019754	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.889000	0.04144	-4.048000	0.00078	-0.484000	0.04775	CGT	AARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000381195.1		+	ENST00000378279.3	Missense_Mutation	SNP	8 : 117950573 - 117950573 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	244	62
ABCB1	5243	broad.mit.edu	37	7	87138667	87138667	+	Missense_Mutation	SNP	C	C	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr7:87138667C>A	ENST00000265724.3	-	27	3830	c.3413G>T	c.(3412-3414)cGg>cTg	p.R1138L	ABCB1_ENST00000543898.1_Missense_Mutation_p.R1074L|ABCB1_ENST00000488737.2_5'UTR	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	1138	ABC transporter 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TGACACCACCCGGCTGTTGTC	0.512		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													163	146	152			NA	NA	7		NA											NA				87138667		2203	4300	6503	SO:0001583	missense			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563	5243	5243		CD molecules, ATP binding cassette transporters / subfamily B	40	protein-coding gene	gene with protein product	multidrug resistance protein 1	171050	colchicin sensitivity	PGY1, MDR1, CLCS	NA	3027054	Standard	NM_000927	NM_000927	NA	Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.3413G>T	7.37:g.87138667C>A	ENSP00000265724:p.Arg1138Leu	NA	A8K294|Q12755|Q14812	37	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789644	0.70337	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.88586	-2.39;-2.4	6.06	6.06	0.98353	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.052964	0.64402	D	0.000001	D	0.89280	0.6670	N	0.25426	0.745	0.80722	D	1	P;D	0.63880	0.933;0.993	P;P	0.54401	0.701;0.751	D	0.90156	0.4224	10	0.87932	D	0	-11.022	19.6164	0.95636	0.0:1.0:0.0:0.0	.	1074;1138	B5AK60;P08183	.;MDR1_HUMAN	L	919;1138;1074	ENSP00000265724:R1138L;ENSP00000444095:R1074L	ENSP00000265724:R1138L	R	-	2	0	ABCB1	86976603	1.000000	0.71417	0.973000	0.42090	0.768000	0.43524	4.938000	0.63519	2.871000	0.98454	0.655000	0.94253	CGG	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000335444.2		-	ENST00000265724.3	Missense_Mutation	SNP	7 : 87138667 - 87138667 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	670	242
ABCB5	340273	broad.mit.edu	37	7	20744419	20744419	+	Missense_Mutation	SNP	C	C	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr7:20744419C>A	ENST00000404938.2	+	20	3062	c.2410C>A	c.(2410-2412)Caa>Aaa	p.Q804K	ABCB5_ENST00000258738.6_Missense_Mutation_p.Q359K	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	359	ABC transporter 2.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AGATATAGCACAAATTCAAGG	0.363		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													140	132	135			NA	NA	7		NA											NA				20744419		2203	4300	6503	SO:0001583	missense			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846	340273	340273		ATP binding cassette transporters / subfamily B	46	protein-coding gene	gene with protein product	P-glycoprotein ABCB5, ATP-binding cassette protein	611785			NA	8894702, 12960149	Standard	NM_178559	NM_001163942	NA	Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2410C>A	7.37:g.20744419C>A	ENSP00000384881:p.Gln804Lys	NA	A4D131|B7WPL1|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145226	0.37825	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.88277	-2.36;-2.36	4.66	3.77	0.43336	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.56097	D	0.000034	D	0.86711	0.5998	L	0.43152	1.355	0.30338	N	0.78601	P;P	0.43701	0.62;0.815	B;P	0.50537	0.223;0.643	T	0.83198	-0.0080	10	0.52906	T	0.07	.	6.0394	0.19726	0.0:0.7051:0.1939:0.1009	.	804;359	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	K	804;359	ENSP00000384881:Q804K;ENSP00000258738:Q359K	ENSP00000258738:Q359K	Q	+	1	0	ABCB5	20710944	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	1.445000	0.35079	2.591000	0.87537	0.462000	0.41574	CAA	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000326736.2		+	ENST00000404938.2	Missense_Mutation	SNP	7 : 20744419 - 20744419 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	215	63
ACTL9	284382	broad.mit.edu	37	19	8808041	8808041	+	Silent	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr19:8808041G>A	ENST00000324436.3	-	1	1131	c.1011C>T	c.(1009-1011)aaC>aaT	p.N337N		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	337						cytoplasm|cytoskeleton				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						AGAGAAGCACGTTTTGGGCCA	0.672		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													36	36	36			NA	NA	19		NA											NA				8808041		2200	4297	6497	SO:0001819	synonymous_variant				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786	284382	284382			28494	protein-coding gene	gene with protein product					NA		Standard	NM_178525	NM_178525	NA	Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1011C>T	19.37:g.8808041G>A		NA	A8K893|Q6X960	37	CCDS12207.1																																																																																			ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000459953.1		-	ENST00000324436.3	Silent	SNP	19 : 8808041 - 8808041 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	398	106
ANK1	286	broad.mit.edu	37	8	41513269	41513269	+	Missense_Mutation	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr8:41513269G>A	ENST00000347528.4	-	42	5706	c.5623C>T	c.(5623-5625)Cac>Tac	p.H1875Y	ANK1_ENST00000396942.1_3'UTR|ANK1_ENST00000352337.4_3'UTR|ANK1_ENST00000522543.1_Missense_Mutation_p.H150Y|ANK1_ENST00000457297.1_Missense_Mutation_p.H103Y|ANK1_ENST00000522231.1_Missense_Mutation_p.H125Y|ANK1_ENST00000379758.2_Missense_Mutation_p.H1828Y|ANK1_ENST00000289734.7_3'UTR|ANK1_ENST00000265709.8_Missense_Mutation_p.H1891Y|ANK1_ENST00000314214.8_3'UTR|ANK1_ENST00000396945.1_Missense_Mutation_p.H1800Y	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1875	55 kDa regulatory domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GTCGAGGTGTGATCCTGGGAG	0.567		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													162	146	151			NA	NA	8		NA											NA				41513269		2203	4300	6503	SO:0001583	missense			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534	286	286		Ankyrin repeat domain containing	492	protein-coding gene	gene with protein product		612641		ANK	NA	1689849	Standard	NM_020475	NM_001142445	NA	Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5623C>T	8.37:g.41513269G>A	ENSP00000339620:p.His1875Tyr	NA	A6NJ23|O43400|Q13768|Q59FP2|Q8N604|Q99407	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862420	0.71949	.	.	ENSG00000029534	ENST00000347528;ENST00000379758;ENST00000396945;ENST00000457297;ENST00000522231;ENST00000522543;ENST00000265709;ENST00000348036	T;T;T;D;D;T	0.86164	-0.07;-0.04;-0.01;-1.62;-2.08;-0.07	5.14	5.14	0.70334	.	.	.	.	.	D	0.84325	0.5447	N	0.03608	-0.345	0.80722	D	1	P;B;B;B;B;B;B	0.48294	0.908;0.435;0.232;0.308;0.232;0.435;0.004	D;B;B;B;B;B;B	0.64144	0.922;0.135;0.135;0.064;0.135;0.136;0.004	D	0.86941	0.2079	9	0.41790	T	0.15	.	15.758	0.78051	0.0:0.0:1.0:0.0	.	125;1891;1713;1875;1850;103;150	Q6PK32;P16157-21;P16157-4;P16157;P16157-5;A0PJN8;E5RFL7	.;.;.;ANK1_HUMAN;.;.;.	Y	1875;1828;1800;103;125;150;1891;103	ENSP00000339620:H1875Y;ENSP00000369082:H1828Y;ENSP00000380149:H1800Y;ENSP00000428750:H125Y;ENSP00000430368:H150Y;ENSP00000265709:H1891Y	ENSP00000265709:H1891Y	H	-	1	0	ANK1	41632426	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	4.123000	0.57917	2.383000	0.81215	0.563000	0.77884	CAC	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000317297.1		-	ENST00000347528.4	Missense_Mutation	SNP	8 : 41513269 - 41513269 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	401	141
ATP2B3	492	broad.mit.edu	37	X	152808544	152808544	+	Silent	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chrX:152808544C>T	ENST00000370186.1	+	6	1160	c.834C>T	c.(832-834)gcC>gcT	p.A278A	ATP2B3_ENST00000263519.4_Silent_p.A278A|ATP2B3_ENST00000370181.2_Silent_p.A278A|ATP2B3_ENST00000349466.2_Silent_p.A278A|ATP2B3_ENST00000393842.1_Silent_p.A278A|ATP2B3_ENST00000359149.3_Silent_p.A278A			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	278					ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGACCGCCGTTGGCGTGA	0.532		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													124	114	117			NA	NA	X		NA											NA				152808544		2203	4300	6503	SO:0001819	synonymous_variant			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	492	492	3.6.3.8	ATPases / P-type	816	protein-coding gene	gene with protein product	plasma membrane calcium-transporting ATPase 3, cilia and flagella associated protein 39	300014	spinocerebellar ataxia, X-linked 1, cerebellar ataxia 2 (X-linked)	SCAX1, CLA2	NA	8187550, 22912398	Standard	NM_021949	NM_021949	NA	Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000370186.1:c.834C>T	X.37:g.152808544C>T		NA	B7WNR8|B7WNY5|Q12995|Q16858	37																																																																																				ATP2B3-001	KNOWN	basic	protein_coding	NA	protein_coding	OTTHUMT00000060956.1		+	ENST00000370186.1	Silent	SNP	X : 152808544 - 152808544 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	424	157
AZGP1	563	broad.mit.edu	37	7	99564799	99564799	+	Missense_Mutation	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr7:99564799C>T	ENST00000292401.4	-	4	860	c.724G>A	c.(724-726)Gcc>Acc	p.A242T	AZGP1_ENST00000411734.1_3'UTR|AZGP1_ENST00000483612.1_5'UTR	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	242	Ig-like C1-type.				antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					ACCTCGCCGGCCCGAGTCCAG	0.582		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													44	37	39			NA	NA	7		NA											NA				99564799		2203	4298	6501	SO:0001583	missense			BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862	563	563		Immunoglobulin superfamily / C1-set domain containing	910	protein-coding gene	gene with protein product		194460	alpha-2-glycoprotein 1, zinc		NA	2049092	Standard	NM_001185	NM_001185	NA	Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.724G>A	7.37:g.99564799C>T	ENSP00000292401:p.Ala242Thr	NA	D6W5T8|O60386|Q5XKQ4|Q8N4N0	37	CCDS5680.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390198	0.25118	.	.	ENSG00000160862	ENST00000292401	T	0.02812	4.15	2.17	2.17	0.27698	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.894418	0.09063	U	0.853996	T	0.04137	0.0115	L	0.42245	1.32	0.21386	N	0.999706	B	0.22683	0.073	B	0.32928	0.155	T	0.42632	-0.9440	10	0.87932	D	0	.	5.3065	0.15807	0.0:0.8132:0.0:0.1868	.	242	P25311	ZA2G_HUMAN	T	242	ENSP00000292401:A242T	ENSP00000292401:A242T	A	-	1	0	AZGP1	99402735	0.000000	0.05858	0.040000	0.18447	0.040000	0.13550	-0.072000	0.11486	1.130000	0.42092	0.313000	0.20887	GCC	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000059387.4		-	ENST00000292401.4	Missense_Mutation	SNP	7 : 99564799 - 99564799 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	172	52
BTBD11	121551	broad.mit.edu	37	12	108045467	108045467	+	Missense_Mutation	SNP	A	A	C			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr12:108045467A>C	ENST00000280758.5	+	16	3536	c.3008A>C	c.(3007-3009)aAg>aCg	p.K1003T	BTBD11_ENST00000357167.4_Missense_Mutation_p.K540T|BTBD11_ENST00000494235.2_Missense_Mutation_p.K82T|BTBD11_ENST00000420571.2_Missense_Mutation_p.K884T	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	1003						integral to membrane	DNA binding			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TCTGCTGCTAAGTTTTTCCAG	0.438		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													100	97	98			NA	NA	12		NA											NA				108045467		2203	4300	6503	SO:0001583	missense			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136	121551	121551		BTB/POZ domain containing, Ankyrin repeat domain containing	23844	protein-coding gene	gene with protein product					NA		Standard	NM_152322	XM_005268645	NA	Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.3008A>C	12.37:g.108045467A>C	ENSP00000280758:p.Lys1003Thr	NA	A4FU41|C9J019|C9JK80|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	37	CCDS31893.1	.	.	.	.	.	.	.	.	.	.	A	19.74	3.883579	0.72410	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000357167;ENST00000494235	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.14	5.14	0.70334	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.37100	0.0991	L	0.41573	1.285	0.58432	D	0.999999	D;D	0.64830	0.991;0.994	D;D	0.76575	0.988;0.946	T	0.04781	-1.0927	10	0.38643	T	0.18	.	15.235	0.73422	1.0:0.0:0.0:0.0	.	540;1003	E9PHS4;A6QL63	.;BTBDB_HUMAN	T	1003;884;540;82	ENSP00000280758:K1003T;ENSP00000413889:K884T;ENSP00000349690:K540T;ENSP00000448322:K82T	ENSP00000280758:K1003T	K	+	2	0	BTBD11	106569597	1.000000	0.71417	0.978000	0.43139	0.941000	0.58515	8.757000	0.91657	2.050000	0.60909	0.533000	0.62120	AAG	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000318003.1		+	ENST00000280758.5	Missense_Mutation	SNP	12 : 108045467 - 108045467 C PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	227	128
CCDC120	90060	broad.mit.edu	37	X	48923087	48923087	+	Missense_Mutation	SNP	C	C	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chrX:48923087C>A	ENST00000376396.3	+	8	1004	c.785C>A	c.(784-786)cCa>cAa	p.P262Q	CCDC120_ENST00000536628.2_Missense_Mutation_p.P250Q|CCDC120_ENST00000422185.2_Missense_Mutation_p.P262Q|CCDC120_ENST00000597275.1_Missense_Mutation_p.P262Q|CCDC120_ENST00000496529.2_Missense_Mutation_p.P262Q|CCDC120_ENST00000603986.1_Missense_Mutation_p.P297Q	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	262							protein binding			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						CGGCGAACCCCATGGAAACCA	0.652		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													22	20	20			NA	NA	X		NA											NA				48923087		2201	4299	6500	SO:0001583	missense			BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144	90060	90060			28910	protein-coding gene	gene with protein product					NA	12477932	Standard	NM_033626	NM_033626	NA	Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.785C>A	X.37:g.48923087C>A	ENSP00000365577:p.Pro262Gln	NA		37	CCDS14316.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424697	0.62733	.	.	ENSG00000147144	ENST00000376396;ENST00000422185;ENST00000536628	.	.	.	5.15	3.26	0.37387	.	0.307063	0.35739	N	0.003002	T	0.39886	0.1095	L	0.34521	1.04	0.31337	N	0.684066	D;D;D;D	0.62365	0.99;0.981;0.981;0.991	P;P;P;P	0.56398	0.797;0.593;0.593;0.593	T	0.38090	-0.9677	9	0.27785	T	0.31	-5.9551	6.3643	0.21445	0.0:0.6106:0.2853:0.1041	.	250;297;250;262	B4DTU2;B4DFC1;B4DF24;Q96HB5	.;.;.;CC120_HUMAN	Q	262;262;250	.	ENSP00000365577:P262Q	P	+	2	0	CCDC120	48810031	0.979000	0.34478	0.899000	0.35326	0.993000	0.82548	2.661000	0.46758	1.088000	0.41272	0.529000	0.55759	CCA	CCDC120-001	KNOWN	basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000056528.1		+	ENST00000376396.3	Missense_Mutation	SNP	X : 48923087 - 48923087 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	190	56
DCHS2	54798	broad.mit.edu	37	4	155219098	155219098	+	Missense_Mutation	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr4:155219098G>A	ENST00000357232.4	-	18	5002	c.5003C>T	c.(5002-5004)aCg>aTg	p.T1668M		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	NA	Cadherin 14.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CAAGAGACCCGTGGTTGTCCT	0.453		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													74	75	75			NA	NA	4		NA											NA				155219098		2203	4300	6503	SO:0001583	missense			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410	54798	54798		Cadherins / Cadherin-related	23111	protein-coding gene	gene with protein product	cadherin-related family member 7	612486	cadherin-like 27, dachsous 2 (Drosophila)	CDH27, PCDH23	NA	15003449	Standard	NM_001142552	NM_017639	NA	Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5003C>T	4.37:g.155219098G>A	ENSP00000349768:p.Thr1668Met	NA	Q4W5P9|Q6ZS61|Q9NXU8	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	7.042	0.562678	0.13498	.	.	ENSG00000197410	ENST00000357232	T	0.63744	-0.06	5.82	-0.253	0.12996	Cadherin (3);Cadherin-like (1);	0.840880	0.10403	N	0.678873	T	0.50411	0.1614	M	0.84326	2.69	0.09310	N	1	P	0.39737	0.685	B	0.21708	0.036	T	0.42085	-0.9472	10	0.31617	T	0.26	.	2.6536	0.05005	0.2432:0.2088:0.4478:0.1002	.	1668	Q6V1P9	PCD23_HUMAN	M	1668	ENSP00000349768:T1668M	ENSP00000349768:T1668M	T	-	2	0	DCHS2	155438548	0.004000	0.15560	0.000000	0.03702	0.384000	0.30261	0.265000	0.18515	-0.137000	0.11455	0.650000	0.86243	ACG	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000365281.2		-	ENST00000357232.4	Missense_Mutation	SNP	4 : 155219098 - 155219098 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	296	91
DLGAP2	9228	broad.mit.edu	37	8	1581003	1581003	+	Missense_Mutation	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr8:1581003C>T	ENST00000421627.2	+	5	1495	c.1361C>T	c.(1360-1362)gCg>gTg	p.A454V		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	533					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding			breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GTGAGCGAGGCGGAGATCAAT	0.577		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0								C	VAL/ALA	2,4362		0,2,2180	108	113	112		1361	5.1	0.3	8		112	0,8546		0,0,4273	no	missense	DLGAP2	NM_004745.3	64	0,2,6453	TT,TC,CC	NA	0.0,0.0458,0.0155	possibly-damaging	454/976	1581003	2,12908	2182	4273	6455	SO:0001583	missense			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010	9228	9228			2906	protein-coding gene	gene with protein product		605438	discs, large (Drosophila) homolog-associated protein 2		NA	9286858, 10854099	Standard	NM_004745	NM_004745	NA	Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1361C>T	8.37:g.1581003C>T	ENSP00000400258:p.Ala454Val	NA	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	37	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.352046|2.352046	0.41700|0.41700	4.58E-4|4.58E-4	0.0|0.0	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	D|.	0.91407|.	-2.84|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.052101|.	0.85682|.	D|.	0.000000|.	T|T	0.68760|0.68760	0.3036|0.3036	L|L	0.47016|0.47016	1.485|1.485	0.42839|0.42839	D|D	0.99404|0.99404	P;P|.	0.45240|.	0.854;0.773|.	B;B|.	0.42827|.	0.399;0.121|.	T|T	0.65981|0.65981	-0.6036|-0.6036	10|5	0.39692|.	T|.	0.17|.	-15.8913|-15.8913	18.7837|18.7837	0.91946|0.91946	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	533;533|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	V|W	499;454|471	ENSP00000400258:A454V|.	ENSP00000348366:A499V|.	A|R	+|+	2|1	0|2	DLGAP2|DLGAP2	1568410|1568410	1.000000|1.000000	0.71417|0.71417	0.329000|0.329000	0.25429|0.25429	0.132000|0.132000	0.20833|0.20833	7.023000|7.023000	0.76437|0.76437	2.475000|2.475000	0.83589|0.83589	0.555000|0.555000	0.69702|0.69702	GCG|CGG	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000374478.1		+	ENST00000421627.2	Missense_Mutation	SNP	8 : 1581003 - 1581003 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	106	30
DMBT1	1755	broad.mit.edu	37	10	124389416	124389416	+	Missense_Mutation	SNP	C	C	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr10:124389416C>A	ENST00000338354.3	+	44	5448	c.5342C>A	c.(5341-5343)tCc>tAc	p.S1781Y	DMBT1_ENST00000368909.3_Missense_Mutation_p.S1781Y|DMBT1_ENST00000359586.6_Missense_Mutation_p.S501Y|DMBT1_ENST00000368955.3_Missense_Mutation_p.S1771Y|DMBT1_ENST00000330163.4_Missense_Mutation_p.S1153Y|DMBT1_ENST00000344338.3_Missense_Mutation_p.S1771Y|DMBT1_ENST00000368956.2_Missense_Mutation_p.S1153Y			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1781	CUB 1.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCCAGCCCATCCTACCCTGCA	0.458		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		Ovarian(182;93 2026 18125 22222 38972)							NA				0													220	209	213			NA	NA	10		NA											NA				124389416		1908	4124	6032	SO:0001583	missense				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908	1755	1755			2926	protein-coding gene	gene with protein product		601969			NA	9288095, 17548659	Standard	NM_004406	NM_004406	NA	Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5342C>A	10.37:g.124389416C>A	ENSP00000342210:p.Ser1781Tyr	NA	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	37		.	.	.	.	.	.	.	.	.	.	C	0.047	-1.262327	0.01445	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57	4.42	-2.46	0.06461	CUB (5);	.	.	.	.	T	0.31295	0.0792	N	0.17800	0.525	0.09310	N	1	B;D;B;D;D;D;D	0.76494	0.046;0.999;0.007;0.998;0.994;0.996;0.991	B;D;B;D;D;D;D	0.83275	0.014;0.996;0.005;0.947;0.969;0.989;0.949	T	0.20174	-1.0283	9	0.35671	T	0.21	.	5.0923	0.14715	0.158:0.2727:0.0:0.5692	.	501;1761;1030;1910;1153;1771;1781	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	Y	1781;1910;1781;1781;1781;1781;1153;1771;1153;1153;1781;1771;1153;501	ENSP00000342210:S1781Y;ENSP00000343175:S1771Y;ENSP00000327747:S1153Y;ENSP00000357905:S1781Y;ENSP00000357951:S1771Y;ENSP00000357952:S1153Y;ENSP00000352593:S501Y	ENSP00000331522:S1153Y	S	+	2	0	DMBT1	124379406	0.000000	0.05858	0.873000	0.34254	0.769000	0.43574	-2.969000	0.00668	-0.668000	0.05296	-0.793000	0.03317	TCC	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	NA	protein_coding	OTTHUMT00000050792.2		+	ENST00000338354.3	Missense_Mutation	SNP	10 : 124389416 - 124389416 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	923	249
DNAH7	56171	broad.mit.edu	37	2	196674543	196674543	+	Missense_Mutation	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr2:196674543G>A	ENST00000312428.6	-	52	9914	c.9814C>T	c.(9814-9816)Cgg>Tgg	p.R3272W		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3272					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AAGAGTGACCGGCAGACATTA	0.353		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													62	58	59			NA	NA	2		NA											NA				196674543		1839	4089	5928	SO:0001583	missense			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997	56171	56171		Axonemal dyneins, EF-hand domain containing	18661	protein-coding gene	gene with protein product		610061	dynein, axonemal, heavy polypeptide 7		NA	9373155, 11877439	Standard	NM_018897	NM_018897	NA	Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9814C>T	2.37:g.196674543G>A	ENSP00000311273:p.Arg3272Trp	NA	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	32	5.115184	0.94339	.	.	ENSG00000118997	ENST00000312428	T	0.80653	-1.4	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.94499	0.8229	H	0.98866	4.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96201	0.9145	10	0.87932	D	0	.	19.2483	0.93912	0.0:0.0:1.0:0.0	.	3272	Q8WXX0	DYH7_HUMAN	W	3272	ENSP00000311273:R3272W	ENSP00000311273:R3272W	R	-	1	2	DNAH7	196382788	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	9.489000	0.97949	2.882000	0.98803	0.655000	0.94253	CGG	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000335202.3		-	ENST00000312428.6	Missense_Mutation	SNP	2 : 196674543 - 196674543 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	278	82
DNAI2	64446	broad.mit.edu	37	17	72277972	72277972	+	Missense_Mutation	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr17:72277972G>A	ENST00000579490.1	+	1	322	c.187G>A	c.(187-189)Gtg>Atg	p.V63M	DNAI2_ENST00000307504.5_5'UTR|DNAI2_ENST00000582036.1_Missense_Mutation_p.V6M|DNAI2_ENST00000311014.6_Missense_Mutation_p.V6M|DNAI2_ENST00000446837.2_Missense_Mutation_p.V6M			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	6					cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GATTGTGTACGTGTACGTCAA	0.632		NA							Kartagener syndrome					NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													95	81	86			NA	NA	17		NA											NA				72277972		2203	4300	6503	SO:0001583	missense	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595	64446	64446		Axonemal dyneins, WD repeat domain containing	18744	protein-coding gene	gene with protein product	dynein intermediate chain 2	605483	dynein, axonemal, intermediate polypeptide 2		NA	11153919, 21953912	Standard	NM_023036	NM_023036	NA	Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000579490.1:c.187G>A	17.37:g.72277972G>A	ENSP00000464197:p.Val63Met	NA	C9J0S6|Q8IUW4|Q9H179|Q9NT53	37		.	.	.	.	.	.	.	.	.	.	G	19.85	3.903787	0.72754	.	.	ENSG00000171595	ENST00000311014;ENST00000446837	T;T	0.68181	-0.31;-0.31	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.77336	0.4115	M	0.78916	2.43	0.80722	D	1	D	0.67145	0.996	P	0.52514	0.701	T	0.78740	-0.2086	10	0.46703	T	0.11	-48.1228	19.0564	0.93067	0.0:0.0:1.0:0.0	.	6	Q9GZS0	DNAI2_HUMAN	M	6	ENSP00000308312:V6M;ENSP00000400252:V6M	ENSP00000308312:V6M	V	+	1	0	DNAI2	69789567	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.624000	0.61254	2.735000	0.93741	0.650000	0.86243	GTG	DNAI2-004	PUTATIVE	NMD_exception|basic	protein_coding	NA	protein_coding	OTTHUMT00000442538.1		+	ENST00000579490.1	Missense_Mutation	SNP	17 : 72277972 - 72277972 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	462	119
DSC3	1825	broad.mit.edu	37	18	28581623	28581623	+	Missense_Mutation	SNP	T	T	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr18:28581623T>A	ENST00000360428.4	-	14	2276	c.2196A>T	c.(2194-2196)ttA>ttT	p.L732F	DSC3_ENST00000434452.1_Missense_Mutation_p.L732F	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	732					homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TTGATATAATTAAGTTTTGCT	0.299		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													97	100	99			NA	NA	18		NA											NA				28581623		2202	4298	6500	SO:0001583	missense			X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762	1825	1825		Cadherins / Major cadherins	3037	protein-coding gene	gene with protein product		600271		DSC4	NA	7774948, 8486729	Standard	NM_001941, NM_024423	NM_001941	NA	Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.2196A>T	18.37:g.28581623T>A	ENSP00000353608:p.Leu732Phe	NA	A6NN35|Q14200|Q9HAZ9	37	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151180	0.38021	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.62639	0.15;0.01	4.48	4.48	0.54585	.	0.000000	0.27302	N	0.019987	T	0.80959	0.4724	M	0.86420	2.815	0.53688	D	0.999975	D;D	0.89917	0.999;1.0	D;D	0.97110	0.991;1.0	D	0.84776	0.0770	10	0.87932	D	0	.	13.8919	0.63744	0.0:0.0:0.0:1.0	.	732;732	Q14574;Q14574-2	DSC3_HUMAN;.	F	732	ENSP00000353608:L732F;ENSP00000392068:L732F	ENSP00000353608:L732F	L	-	3	2	DSC3	26835621	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.554000	0.45845	2.007000	0.58848	0.455000	0.32223	TTA	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000447384.1		-	ENST00000360428.4	Missense_Mutation	SNP	18 : 28581623 - 28581623 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	273	25
FRMPD2	143162	broad.mit.edu	37	10	49392828	49392828	+	Missense_Mutation	SNP	G	G	A	rs34002506	byFrequency	TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr10:49392828G>A	ENST00000374201.3	-	19	2758	c.2456C>T	c.(2455-2457)aCg>aTg	p.T819M	FRMPD2_ENST00000305531.3_Missense_Mutation_p.T794M|FRMPD2_ENST00000407470.4_Missense_Mutation_p.T787M	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	819	PDZ 1.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TGGTTTGATCGTTTTTGCTTT	0.348		NA											G	4	0.0018	0.01	NA	2184	NA	1	,	,	NA	3e-04	NA	NA	NA	0.0018	1	LOWCOV,EXOME	NA	NA	7e-04	SNP								NA				0								G	MET/THR	7,4399	12.9+/-30.5	0,7,2196	90	86	88		2456	-4.4	0	10	dbSNP_126	88	1,8599	1.2+/-3.3	0,1,4299	yes	missense	FRMPD2	NM_001018071.3	81	0,8,6495	AA,AG,GG	NA	0.0116,0.1589,0.0615	benign	819/1310	49392828	8,12998	2203	4300	6503	SO:0001583	missense			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324	143162	143162			28572	protein-coding gene	gene with protein product		613323	PDZ domain containing 5C	PDZD5C, PDZK5C	NA		Standard	NM_152428	NM_001018071	NA	Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2456C>T	10.37:g.49392828G>A	ENSP00000363317:p.Thr819Met	NA	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	37	CCDS31195.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	0.927	-0.714061	0.03206	0.001589	1.16E-4	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.39406	1.08;1.08;1.08	5.1	-4.42	0.03579	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.18425	0.0442	L	0.42245	1.32	0.09310	N	1	B;B;B	0.22604	0.072;0.014;0.072	B;B;B	0.13407	0.009;0.008;0.009	T	0.20638	-1.0269	9	0.33141	T	0.24	.	1.4061	0.02281	0.2083:0.1364:0.3532:0.3022	rs34002506	794;819;787	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	M	819;794;787	ENSP00000363317:T819M;ENSP00000307079:T794M;ENSP00000384339:T787M	ENSP00000307079:T794M	T	-	2	0	FRMPD2	49062834	0.826000	0.29277	0.022000	0.16811	0.008000	0.06430	0.117000	0.15583	-0.877000	0.04012	-3.274000	0.00048	ACG	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000047923.3		-	ENST00000374201.3	Missense_Mutation	SNP	10 : 49392828 - 49392828 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	169	41
KRAS	3845	broad.mit.edu	37	12	25380272	25380272	+	Silent	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr12:25380272C>T	ENST00000311936.3	-	3	377	c.186G>A	c.(184-186)gaG>gaA	p.E62E	KRAS_ENST00000557334.1_Intron|KRAS_ENST00000256078.4_Silent_p.E62E	NM_004985.3	NP_004976.2	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	62					activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.E62D(1)|p.E62_S65>D(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CACTGTACTCCTCTTGACCTG	0.423		119	Mis		pancreatic, colorectal, lung, thyroid, AML, others				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		L, E, M, O	2	Substitution - Missense(1)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(1)|endometrium(1)											112	100	104			NA	NA	12		NA											NA				25380272		2203	4300	6503	SO:0001819	synonymous_variant	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703	3845	3845			6407	protein-coding gene	gene with protein product		190070	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog, v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog	KRAS2	NA		Standard	NM_033360	NM_004985	NA	Approved	KRAS1	uc001rgp.1	P01116		ENST00000311936.3:c.186G>A	12.37:g.25380272C>T		NA	A8K8Z5|B0LPF9|P01118|Q96D10	37	CCDS8702.1																																																																																			KRAS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000412230.1		-	ENST00000311936.3	Silent	SNP	12 : 25380272 - 25380272 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	326	141
KRAS	3845	broad.mit.edu	37	12	25380275	25380275	+	Missense_Mutation	SNP	T	T	G	rs17851045		TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr12:25380275T>G	ENST00000311936.3	-	3	374	c.183A>C	c.(181-183)caA>caC	p.Q61H	KRAS_ENST00000557334.1_Intron|KRAS_ENST00000256078.4_Missense_Mutation_p.Q61H	NM_004985.3	NP_004976.2	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045).|Q -> R (in a colorectal cancer sample; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.Q61H(153)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGTACTCCTCTTGACCTGCTG	0.423	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119	Mis		pancreatic, colorectal, lung, thyroid, AML, others				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		L, E, M, O	153	Substitution - Missense(153)	large_intestine(74)|lung(26)|pancreas(18)|haematopoietic_and_lymphoid_tissue(9)|endometrium(7)|soft_tissue(3)|biliary_tract(3)|liver(3)|cervix(2)|skin(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)|NS(1)											109	98	102			NA	NA	12		NA											NA				25380275		2203	4300	6503	SO:0001583	missense	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703	3845	3845			6407	protein-coding gene	gene with protein product		190070	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog, v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog	KRAS2	NA		Standard	NM_033360	NM_004985	NA	Approved	KRAS1	uc001rgp.1	P01116		ENST00000311936.3:c.183A>C	12.37:g.25380275T>G	ENSP00000308495:p.Gln61His	NA	A8K8Z5|B0LPF9|P01118|Q96D10	37	CCDS8702.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133750	0.77662	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.84146	-1.81;-1.81	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.87265	0.6134	M	0.91140	3.18	0.80722	D	1	B;B	0.33413	0.411;0.09	B;B	0.32724	0.092;0.151	D	0.87829	0.2643	10	0.72032	D	0.01	.	9.9836	0.41828	0.0:0.0752:0.0:0.9248	.	61;61	P01116-2;P01116	.;RASK_HUMAN	H	61	ENSP00000308495:Q61H;ENSP00000256078:Q61H	ENSP00000256078:Q61H	Q	-	3	2	KRAS	25271542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.240000	0.43088	2.326000	0.78906	0.533000	0.62120	CAA	KRAS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000412230.1		-	ENST00000311936.3	Missense_Mutation	SNP	12 : 25380275 - 25380275 G PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	307	131
LEPR	3953	broad.mit.edu	37	1	66102496	66102496	+	Missense_Mutation	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr1:66102496G>A	ENST00000349533.6	+	20	3481	c.3296G>A	c.(3295-3297)aGg>aAg	p.R1099K	LEPR_ENST00000406510.3_Missense_Mutation_p.R166K	NM_002303.5	NP_002294.2	P48357	LEPR_HUMAN	leptin receptor	1099					energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		GACAAGTCAAGGGTATCGTGC	0.398		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													71	69	70			NA	NA	1		NA											NA				66102496		2203	4300	6503	SO:0001583	missense			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678	3953	3953		CD molecules, Immunoglobulin superfamily / Immunoglobulin-like domain containing	6554	protein-coding gene	gene with protein product		601007			NA	8548812, 8812446	Standard	NM_002303	NM_001003680	NA	Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.3296G>A	1.37:g.66102496G>A	ENSP00000330393:p.Arg1099Lys	NA	Q13592|Q13593|Q13594|Q92919|Q92920|Q92921	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.071802	0.00379	.	.	ENSG00000116678	ENST00000349533;ENST00000406510	T	0.54866	0.55	5.11	2.09	0.27110	.	1.018570	0.07786	N	0.954206	T	0.15869	0.0382	L	0.54323	1.7	0.09310	N	1	B	0.21905	0.062	B	0.24394	0.053	T	0.32824	-0.9892	10	0.02654	T	1	-0.0346	1.9257	0.03316	0.2335:0.1353:0.4916:0.1395	.	1099	P48357	LEPR_HUMAN	K	1099;166	ENSP00000330393:R1099K	ENSP00000330393:R1099K	R	+	2	0	LEPR	65875084	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.953000	0.29162	0.273000	0.22049	-0.198000	0.12761	AGG	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000025275.1		+	ENST00000349533.6	Missense_Mutation	SNP	1 : 66102496 - 66102496 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	251	67
MAGEC1	9947	broad.mit.edu	37	X	140993257	140993257	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chrX:140993257C>T	ENST00000285879.4	+	4	353	c.67C>T	c.(67-69)Cag>Tag	p.Q23*	MAGEC1_ENST00000406005.2_5'UTR	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	23							protein binding			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGAGTCCTCAGAGTTGTCC	0.567		NA								HNSCC(15;0.026)				NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													69	68	68			NA	NA	X		NA											NA				140993257		2203	4300	6503	SO:0001587	stop_gained			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495	9947	9947			6812	protein-coding gene	gene with protein product	cancer/testis antigen family 7, member 1	300223			NA	9485030, 9618514	Standard	NM_005462	NM_005462	NA	Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.67C>T	X.37:g.140993257C>T	ENSP00000285879:p.Gln23*	NA	O75451|Q8TCV4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	15.25	2.779207	0.49891	.	.	ENSG00000155495	ENST00000285879;ENST00000370511;ENST00000370510	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	23;23;22	.	ENSP00000285879:Q23X	Q	+	1	0	MAGEC1	140820923	0.009000	0.17119	0.007000	0.13788	0.007000	0.05969	0.156000	0.16382	0.177000	0.19895	0.179000	0.17066	CAG	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000058604.1		+	ENST00000285879.4	Nonsense_Mutation	SNP	X : 140993257 - 140993257 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	512	194
MYH7	4625	broad.mit.edu	37	14	23886078	23886078	+	Splice_Site	SNP	T	T	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr14:23886078T>A	ENST00000355349.3	-	33	4805	c.4643A>T	c.(4642-4644)gAg>gTg	p.E1548V		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1548					adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CACACACACCTCGGCCTCCTC	0.592		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													81	66	71			NA	NA	14		NA											NA				23886078		2203	4300	6503	SO:0001630	splice_region_variant			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054	4625	4625		Myosins / Myosin superfamily : Class II	7577	protein-coding gene	gene with protein product		160760	myopathy, distal 1, myosin, heavy polypeptide 7, cardiac muscle, beta	CMH1, MPD1	NA	2494889, 8483915, 15322983	Standard	NM_000257	XM_005267696	NA	Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4644+1A>T	14.37:g.23886078T>A		NA	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.971197	0.74246	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.90676	-2.71	4.99	4.99	0.66335	Myosin tail (1);	.	.	.	.	D	0.97018	0.9026	H	0.97983	4.12	0.80722	D	1	D	0.63880	0.993	D	0.69654	0.965	D	0.98472	1.0601	9	0.87932	D	0	.	14.8662	0.70419	0.0:0.0:0.0:1.0	.	1548	P12883	MYH7_HUMAN	V	1548;1553	ENSP00000347507:E1548V	ENSP00000347507:E1548V	E	-	2	0	MYH7	22955918	1.000000	0.71417	0.997000	0.53966	0.386000	0.30323	7.517000	0.81783	2.091000	0.63221	0.533000	0.62120	GAG	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000071798.3	Missense_Mutation	-	ENST00000355349.3	Splice_Site	SNP	14 : 23886078 - 23886078 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	414	8
NBEAL2	23218	broad.mit.edu	37	3	47048744	47048744	+	Missense_Mutation	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr3:47048744C>T	ENST00000450053.3	+	47	7417	c.7238C>T	c.(7237-7239)gCc>gTc	p.A2413V	NBEAL2_ENST00000383740.2_Missense_Mutation_p.A662V|NBEAL2_ENST00000292309.5_Missense_Mutation_p.A2229V	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2413							binding			NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		ACTGTGAGTGCCAGTGGGCTG	0.597		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													32	33	33			NA	NA	3		NA											NA				47048744		1980	4154	6134	SO:0001583	missense			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796	23218	23218		WD repeat domain containing	31928	protein-coding gene	gene with protein product		614169			NA		Standard	XM_291064	NM_015175	NA	Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.7238C>T	3.37:g.47048744C>T	ENSP00000415034:p.Ala2413Val	NA	O60288|Q6P994|Q6UX91|Q8NAC9	37	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.020153|4.020153	0.75275|0.75275	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053;ENST00000445550|ENST00000416683	T;T;T|.	0.43688|.	0.94;0.95;0.94|.	4.55|4.55	4.55|4.55	0.56014|0.56014	.|.	0.117338|.	0.64402|.	D|.	0.000018|.	T|T	0.69115|0.69115	0.3075|0.3075	L|L	0.54323|0.54323	1.7|1.7	0.51482|0.51482	D|D	0.999927|0.999927	D;B|.	0.59767|.	0.986;0.076|.	P;B|.	0.56398|.	0.797;0.04|.	T|T	0.67684|0.67684	-0.5607|-0.5607	10|5	0.30854|.	T|.	0.27|.	.|.	16.0625|16.0625	0.80847|0.80847	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2229;2413|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	V|S	2229;662;2413;356|1701	ENSP00000292309:A2229V;ENSP00000373246:A662V;ENSP00000415034:A2413V|.	ENSP00000292309:A2229V|.	A|P	+|+	2|1	0|0	NBEAL2|NBEAL2	47023748|47023748	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.385000|4.385000	0.59613|0.59613	2.358000|2.358000	0.79984|0.79984	0.609000|0.609000	0.83330|0.83330	GCC|CCA	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000344363.3		+	ENST00000450053.3	Missense_Mutation	SNP	3 : 47048744 - 47048744 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	106	18
PADI3	51702	broad.mit.edu	37	1	17593247	17593247	+	Missense_Mutation	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr1:17593247G>A	ENST00000375460.3	+	5	482	c.442G>A	c.(442-444)Ggc>Agc	p.G148S		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	148					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGGGTATGGCGGCATCTTGCT	0.597		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													165	134	145			NA	NA	1		NA											NA				17593247		2203	4300	6503	SO:0001583	missense			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	51702	51702	3.5.3.15	Peptidyl arginine deiminases	18337	protein-coding gene	gene with protein product		606755			NA	11069618	Standard		NM_016233	NA	Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.442G>A	1.37:g.17593247G>A	ENSP00000364609:p.Gly148Ser	NA	Q58EY7|Q70SX5	37	CCDS179.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146291	0.77888	.	.	ENSG00000142619	ENST00000375460	T	0.13538	2.58	5.15	5.15	0.70609	Protein-arginine deiminase (PAD), central domain (2);	0.052990	0.85682	D	0.000000	T	0.08846	0.0219	N	0.08118	0	0.40351	D	0.97913	B	0.32128	0.357	B	0.28139	0.086	T	0.26608	-1.0098	10	0.87932	D	0	-23.3232	17.1987	0.86900	0.0:0.0:1.0:0.0	.	148	Q9ULW8	PADI3_HUMAN	S	148	ENSP00000364609:G148S	ENSP00000364609:G148S	G	+	1	0	PADI3	17465834	1.000000	0.71417	0.655000	0.29622	0.831000	0.47069	8.699000	0.91316	2.403000	0.81681	0.561000	0.74099	GGC	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000006805.1		+	ENST00000375460.3	Missense_Mutation	SNP	1 : 17593247 - 17593247 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	501	126
PPP2R5C	5527	broad.mit.edu	37	14	102349889	102349890	+	Frame_Shift_Ins	INS	-	-	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	-	-	-	-	-	-	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr14:102349889_102349890insT	ENST00000334743.5	+	5	667_668	c.619_620insT	c.(619-621)atafs	p.I207fs	PPP2R5C_ENST00000557095.1_Frame_Shift_Ins_p.I207fs|PPP2R5C_ENST00000445439.3_Frame_Shift_Ins_p.I207fs|PPP2R5C_ENST00000350249.3_Frame_Shift_Ins_p.I207fs|PPP2R5C_ENST00000328724.5_Frame_Shift_Ins_p.I262fs|PPP2R5C_ENST00000422945.2_Frame_Shift_Ins_p.I238fs	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	207					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of cell proliferation|proteasomal ubiquitin-dependent protein catabolic process|signal transduction	chromosome, centromeric region|nucleus|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GATAAATAATATATTTTATAGG	0.45		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													NA	NA	NA			NA	NA			NA											NA				NA		NA	NA	NA	SO:0001589	frameshift_variant			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304	5527	5527		Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits	9311	protein-coding gene	gene with protein product		601645	protein phosphatase 2, regulatory subunit B (B56), gamma isoform, protein phosphatase 2, regulatory subunit B', gamma isoform		NA	7592815	Standard	NM_002719	NM_002719	NA	Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.620dupT	14.37:g.102349890_102349890dupT	ENSP00000333905:p.Ile207fs	NA	B5BUA5|Q14391|Q15060|Q15174	37	CCDS9964.1																																																																																			PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000414373.2		+	ENST00000334743.5	Frame_Shift_Ins	INS	14 : 102349889 - 102349890 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	688	168
RCSD1	92241	broad.mit.edu	37	1	167666774	167666774	+	Missense_Mutation	SNP	G	G	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr1:167666774G>T	ENST00000367854.3	+	6	1244	c.913G>T	c.(913-915)Gct>Tct	p.A305S	RCSD1_ENST00000537350.1_Missense_Mutation_p.A275S	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	305	RCSD.									NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					GGAAAAGCCAGCTGGAGAGGA	0.582		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													24	25	25			NA	NA	1		NA											NA				167666774		2198	4300	6498	SO:0001583	missense			BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771	92241	92241			28310	protein-coding gene	gene with protein product		610579			NA	12477932	Standard	NM_052862	NM_052862	NA	Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.913G>T	1.37:g.167666774G>T	ENSP00000356828:p.Ala305Ser	NA	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	37	CCDS1263.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065111	0.55432	.	.	ENSG00000198771	ENST00000367854;ENST00000537350	T;T	0.41758	0.99;0.99	4.97	0.767	0.18482	.	0.939217	0.09049	N	0.856052	T	0.12178	0.0296	L	0.27053	0.805	0.22240	N	0.999262	B;P	0.47409	0.288;0.895	B;P	0.50049	0.126;0.629	T	0.02983	-1.1086	9	0.07813	T	0.8	-1.646	1.7031	0.02876	0.2201:0.2709:0.3774:0.1316	.	275;305	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	S	305;275	ENSP00000356828:A305S;ENSP00000439409:A275S	ENSP00000356828:A305S	A	+	1	0	RCSD1	165933398	0.000000	0.05858	0.000000	0.03702	0.244000	0.25665	0.435000	0.21510	-0.057000	0.13199	0.585000	0.79938	GCT	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000085451.1		+	ENST00000367854.3	Missense_Mutation	SNP	1 : 167666774 - 167666774 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	49	14
RUNX1T1	862	broad.mit.edu	37	8	92983007	92983007	+	Missense_Mutation	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr8:92983007C>T	ENST00000523629.1	-	11	1872	c.1418G>A	c.(1417-1419)cGg>cAg	p.R473Q	RUNX1T1_ENST00000265814.3_Missense_Mutation_p.R473Q|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.R436Q|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.R446Q|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.R446Q|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.R436Q|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.R436Q|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.R484Q	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	473					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GTGGGCTTTCCGCTCCGCCTC	0.617		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													87	69	75			NA	NA	8		NA											NA				92983007		2203	4300	6503	SO:0001583	missense			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102	862	862		Zinc fingers, MYND-type	1535	protein-coding gene	gene with protein product		133435	core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related	AML1T1, CBFA2T1	NA	1391946, 9790752	Standard	NM_004349, NM_175635	NM_004349	NA	Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1418G>A	8.37:g.92983007C>T	ENSP00000428543:p.Arg473Gln	NA	O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q92479|Q9BRZ0	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672112	0.88348	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.36963	0.0986	L	0.39326	1.205	0.80722	D	1	B;P;B;P	0.45827	0.285;0.824;0.44;0.867	B;B;B;B	0.41412	0.044;0.356;0.02;0.249	T	0.11591	-1.0581	10	0.07990	T	0.79	-15.8283	20.2182	0.98305	0.0:1.0:0.0:0.0	.	484;436;473;446	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	Q	473;446;473;436;436;436;484;446	ENSP00000428543:R473Q;ENSP00000379520:R446Q;ENSP00000265814:R473Q;ENSP00000353504:R436Q;ENSP00000390137:R436Q;ENSP00000428742:R436Q;ENSP00000402257:R484Q;ENSP00000430728:R446Q	ENSP00000265814:R473Q	R	-	2	0	RUNX1T1	93052183	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.785000	0.95823	0.655000	0.94253	CGG	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000377045.3		-	ENST00000523629.1	Missense_Mutation	SNP	8 : 92983007 - 92983007 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	348	77
SHROOM4	57477	broad.mit.edu	37	X	50378665	50378665	+	Silent	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chrX:50378665G>A	ENST00000460112.3	-	3	514	c.60C>T	c.(58-60)gaC>gaT	p.D20D	SHROOM4_ENST00000376020.2_Silent_p.D136D|SHROOM4_ENST00000289292.7_Silent_p.D136D			Q9ULL8	SHRM4_HUMAN	shroom family member 4	136	PDZ.				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GCACACACACGTCACTGTAAG	0.572		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													50	38	42			NA	NA	X		NA											NA				50378665		2203	4300	6503	SO:0001819	synonymous_variant			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352	57477	57477			29215	protein-coding gene	gene with protein product		300579			NA	10574462, 16615870	Standard	NM_020717	NR_027121	NA	Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000460112.3:c.60C>T	X.37:g.50378665G>A		NA	A7E2X9|D6RFW0|Q96LA0	37																																																																																				SHROOM4-002	NOVEL	basic	protein_coding	NA	protein_coding	OTTHUMT00000056565.4		-	ENST00000460112.3	Silent	SNP	X : 50378665 - 50378665 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	147	57
SLC9A5	6553	broad.mit.edu	37	16	67298340	67298340	+	Missense_Mutation	SNP	G	G	A			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	G	G	-	-	G	G	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr16:67298340G>A	ENST00000299798.11	+	13	1993	c.1928G>A	c.(1927-1929)cGg>cAg	p.R643Q		NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	643					regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	p.R643Q(1)		breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		AACATGAAGCGGCGGCTGGAG	0.577		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				1	Substitution - Missense(1)	lung(1)											34	41	38			NA	NA	16		NA											NA				67298340		2158	4265	6423	SO:0001583	missense				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740	6553	6553		Solute carriers	11078	protein-coding gene	gene with protein product		600477	solute carrier family 9 (sodium/hydrogen exchanger), isoform 5, solute carrier family 9 (sodium/hydrogen exchanger), member 5		NA	7759094, 9933642	Standard		NM_004594	NA	Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.1928G>A	16.37:g.67298340G>A	ENSP00000299798:p.Arg643Gln	NA	A5PKY7|Q9Y626	37	CCDS42178.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.765611	0.49574	.	.	ENSG00000135740	ENST00000299798;ENST00000360183	T	0.57752	0.38	5.33	4.37	0.52481	.	0.202625	0.42172	N	0.000749	T	0.49372	0.1553	L	0.55990	1.75	0.31443	N	0.671663	B;D	0.53462	0.196;0.96	B;B	0.42771	0.031;0.397	T	0.60652	-0.7221	10	0.44086	T	0.13	.	13.6817	0.62489	0.0752:0.0:0.9248:0.0	.	156;643	F8WDV9;Q14940	.;SL9A5_HUMAN	Q	643;156	ENSP00000299798:R643Q	ENSP00000299798:R643Q	R	+	2	0	SLC9A5	65855841	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.156000	0.58138	1.385000	0.46445	0.561000	0.74099	CGG	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000421386.1		+	ENST00000299798.11	Missense_Mutation	SNP	16 : 67298340 - 67298340 A PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	286	73
SMAD4	4089	broad.mit.edu	37	18	48604785	48604785	+	Missense_Mutation	SNP	T	T	C			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr18:48604785T>C	ENST00000588745.1	+	8	1319	c.1319T>C	c.(1318-1320)cTa>cCa	p.L440P	SMAD4_ENST00000342988.3_Missense_Mutation_p.L536P|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.L536P			Q13485	SMAD4_HUMAN	SMAD family member 4	536	MH2.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(36)|p.?(2)|p.L536fs*11(1)|p.L536Q(1)|p.L536fs*14(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CTCCAGCTCCTAGACGAAGTA	0.488		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				41	Whole gene deletion(36)|Deletion - Frameshift(2)|Unknown(2)|Substitution - Missense(1)	pancreas(27)|large_intestine(4)|lung(3)|breast(3)|stomach(2)|upper_aerodigestive_tract(1)|oesophagus(1)	GRCh37	CI057962	SMAD4	I							80	82	82			NA	NA	18		NA											NA				48604785		2203	4300	6503	SO:0001583	missense			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646	4089	4089		SMADs	6770	protein-coding gene	gene with protein product		600993	MAD, mothers against decapentaplegic homolog 4 (Drosophila), SMAD, mothers against DPP homolog 4 (Drosophila)	MADH4	NA	8553070, 8774881	Standard	NM_005359	NM_005359	NA	Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000588745.1:c.1319T>C	18.37:g.48604785T>C	ENSP00000464901:p.Leu440Pro	NA	A8K405	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.502174	0.64298	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98474	-4.95;-4.95	6.07	6.07	0.98685	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (1);	0.000000	0.85682	D	0.000000	D	0.99184	0.9717	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99301	1.0901	10	0.87932	D	0	.	15.6232	0.76824	0.0:0.0:0.0:1.0	.	536	Q13485	SMAD4_HUMAN	P	536	ENSP00000341551:L536P;ENSP00000381452:L536P	ENSP00000341551:L536P	L	+	2	0	SMAD4	46858783	1.000000	0.71417	0.464000	0.27143	0.963000	0.63663	7.856000	0.86956	2.326000	0.78906	0.533000	0.62120	CTA	SMAD4-004	NOVEL	not_organism_supported|basic|exp_conf|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000449729.1		+	ENST00000588745.1	Missense_Mutation	SNP	18 : 48604785 - 48604785 C PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	418	130
SRC	6714	broad.mit.edu	37	20	36014538	36014538	+	Missense_Mutation	SNP	C	C	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	C	C	-	-	C	C	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr20:36014538C>T	ENST00000373578.2	+	5	660	c.311C>T	c.(310-312)tCc>tTc	p.S104F	SRC_ENST00000445403.1_Missense_Mutation_p.S104F|SRC_ENST00000373567.2_Missense_Mutation_p.S104F|SRC_ENST00000360723.4_Missense_Mutation_p.S104F|SRC_ENST00000358208.4_Missense_Mutation_p.S104F|SRC_ENST00000373558.2_Missense_Mutation_p.S104F	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	104	SH3.				axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	ACAGACCTGTCCTTCAAGAAA	0.592		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													184	174	178			NA	NA	20		NA											NA				36014538		2203	4300	6503	SO:0001583	missense			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122	6714	6714		SH2 domain containing	11283	protein-coding gene	gene with protein product		190090	v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog	SRC1	NA	2582238	Standard	NM_005417	NM_005417	NA	Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.311C>T	20.37:g.36014538C>T	ENSP00000362680:p.Ser104Phe	NA	E1P5V4|Q76P87|Q86VB9|Q9H5A8	37	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275714	0.59649	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36	3.99	3.99	0.46301	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.75510	0.3859	M	0.93016	3.37	0.80722	D	1	D	0.63046	0.992	P	0.62089	0.898	T	0.82579	-0.0387	9	.	.	.	.	13.9562	0.64150	0.0:1.0:0.0:0.0	.	104	P12931	SRC_HUMAN	F	104	ENSP00000408503:S104F;ENSP00000362680:S104F;ENSP00000353950:S104F;ENSP00000350941:S104F;ENSP00000362668:S104F;ENSP00000362659:S104F	.	S	+	2	0	SRC	35447952	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.761000	0.68801	2.222000	0.72286	0.561000	0.74099	TCC	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000268142.1		+	ENST00000373578.2	Missense_Mutation	SNP	20 : 36014538 - 36014538 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	1006	253
SSBP4	170463	broad.mit.edu	37	19	18545046	18545046	+	Missense_Mutation	SNP	T	T	C			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	T	T	-	-	T	T	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr19:18545046T>C	ENST00000270061.7	+	18	1442	c.1148T>C	c.(1147-1149)aTg>aCg	p.M383T	SSBP4_ENST00000599699.2_Missense_Mutation_p.M69T|SSBP4_ENST00000348495.6_Missense_Mutation_p.M361T	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	NA						nucleus	single-stranded DNA binding			endometrium(2)|kidney(1)|skin(1)	4						GGGATGACCATGAGCGTGTGA	0.716		NA												NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA									NA				0													21	28	25			NA	NA	19		NA											NA				18545046		2179	4267	6446	SO:0001583	missense				CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511	170463	170463			15676	protein-coding gene	gene with protein product		607391			NA	12079286	Standard	NM_032627	NM_032627	NA	Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.1148T>C	19.37:g.18545046T>C	ENSP00000270061:p.Met383Thr	NA		37	CCDS12378.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.438264	0.62955	.	.	ENSG00000130511	ENST00000270061;ENST00000348495	.	.	.	3.5	2.36	0.29203	.	0.000000	0.85682	U	0.000000	T	0.65964	0.2742	L	0.58101	1.795	0.46416	D	0.999039	D;D	0.76494	0.999;0.996	D;D	0.79108	0.992;0.967	T	0.66480	-0.5913	9	0.87932	D	0	-9.8727	5.5046	0.16846	0.2473:0.0:0.0:0.7527	.	361;383	Q9BWW5;Q9BWG4	.;SSBP4_HUMAN	T	383;361	.	ENSP00000270061:M383T	M	+	2	0	SSBP4	18406046	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.606000	0.46291	1.393000	0.46605	0.397000	0.26171	ATG	SSBP4-002	KNOWN	basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000466348.3		+	ENST00000270061.7	Missense_Mutation	SNP	19 : 18545046 - 18545046 C PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	523	112
TP53	7157	broad.mit.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	A	T			TCGA-PZ-A5RE-01A-11D-A32N-08	TCGA-PZ-A5RE-10B-01D-A32N-08	A	A	-	-	A	A	Unknown	Untested	Somatic	NA	WXS	none	NA	NA	Illumina HiSeq	12e8c551-d2c7-48e7-9b07-fa35a0d72776	a630c46b-cbf6-4d8b-91a2-900a19b9eebb	g.chr17:7578268A>T	ENST00000420246.2	-	6	713	c.581T>A	c.(580-582)cTt>cAt	p.L194H	TP53_ENST00000445888.2_Missense_Mutation_p.L194H|TP53_ENST00000413465.2_Missense_Mutation_p.L194H|TP53_ENST00000359597.4_Missense_Mutation_p.L194H|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.L194H|TP53_ENST00000269305.4_Missense_Mutation_p.L194H	NM_001126114.2|NM_001276696.1	NP_001119586.1|NP_001263625.1	P04637	P53_HUMAN	tumor protein p53	194	Interaction with AXIN1 (By similarity).|Interaction with HIPK1 (By similarity).|Required for interaction with FBXO42.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.L194R(47)|p.L194P(8)|p.L194H(8)|p.0?(8)|p.?(6)|p.L101R(5)|p.L62R(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.L194fs*15(1)|p.L194fs*14(1)|p.L101H(1)|p.L194fs*52(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.L62H(1)|p.I195fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACTCGGATAAGATGCTGAGG	0.552		111	Mis, N, F		breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types	breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				NA	NA	NA	NA	NA	NA	NA			NA	NA	NA	NA	NA	NA	NA		NA	NA	NA		Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		L, E, M, O	108	Substitution - Missense(75)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(19)|lung(14)|ovary(14)|large_intestine(11)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(6)|oesophagus(6)|biliary_tract(5)|skin(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(2)|pancreas(2)|liver(2)|soft_tissue(1)|prostate(1)											97	87	90			NA	NA	17		NA											NA				7578268		2203	4300	6503	SO:0001583	missense	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510	7157	7157			11998	protein-coding gene	gene with protein product	Li-Fraumeni syndrome	191170			NA	6396087, 3456488, 2047879	Standard	NM_000546	NM_001126115	NA	Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000420246.2:c.581T>A	17.37:g.7578268A>T	ENSP00000391127:p.Leu194His	NA	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	37	CCDS45606.1	.	.	.	.	.	.	.	.	.	.	A	16.31	3.086635	0.55861	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.994;1.0;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-29.6709	13.709	0.62656	1.0:0.0:0.0:0.0	.	155;194;194;101;194;194;194	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	194;194;194;194;194;194;183;101;62;101;62	ENSP00000410739:L194H;ENSP00000352610:L194H;ENSP00000269305:L194H;ENSP00000398846:L194H;ENSP00000391127:L194H;ENSP00000391478:L194H;ENSP00000425104:L62H;ENSP00000423862:L101H	ENSP00000269305:L194H	L	-	2	0	TP53	7518993	1.000000	0.71417	0.300000	0.25030	0.031000	0.12232	9.287000	0.95975	2.183000	0.69458	0.533000	0.62120	CTT	TP53-005	KNOWN	NMD_exception|basic|CCDS	protein_coding	NA	protein_coding	OTTHUMT00000367401.1		-	ENST00000420246.2	Missense_Mutation	SNP	17 : 7578268 - 7578268 T PAAD-TCGA-PZ-A5RE-Tumor-SM-4WPB1	209	55
