Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
KANK4	163782	broad.mit.edu	37	1	62739326	62739326	+	Missense_Mutation	SNP	C	C	T	rs142004576		TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:62739326C>T	uc001dah.3	-	3	1827	c.1450G>A	c.(1450-1452)GAG>AAG	p.E484K	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	484										ovary(3)|skin(2)|lung(1)	6						AGGACCTGCTCGGGTCCCTGT	0.567			NA											48	54					0	0	0.01441	0	0
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	G	A	rs77484671		TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254			NA											6	94					0	0	0.00308	0	0
ADAMTSL4	54507	broad.mit.edu	37	1	150529665	150529665	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:150529665G>A	uc001eux.2	+	12	2137	c.1901G>A	c.(1900-1902)CGC>CAC	p.R634H	ADAMTSL4_uc001euw.2_Missense_Mutation_p.R634H|ADAMTSL4_uc009wlw.2_Missense_Mutation_p.R657H|ADAMTSL4_uc010pcg.1_Intron|ADAMTSL4_uc009wlx.2_5'Flank	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	634	Pro-rich.				apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CCGGCACCCCGCCCAGCCCGG	0.711			NA											10	42					0	0	0.003163	0	0
SPTA1	6708	broad.mit.edu	37	1	158592861	158592861	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:158592861G>A	uc001fst.1	-	43	6231	c.6032C>T	c.(6031-6033)GCC>GTC	p.A2011V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2011	Spectrin 19.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CAGCAGAGCGGCATAACGCTC	0.483			NA											7	910					0	0	0.001168	0	0
LAMC1	3915	broad.mit.edu	37	1	183104244	183104244	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:183104244G>T	uc001gpy.3	+	24	4324	c.4067G>T	c.(4066-4068)GGA>GTA	p.G1356V		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1356	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCAAAGAAGGGACGGGATACC	0.502			NA											16	30					9.16793e-09	1.02982e-08	0.00499	1	0
RYR2	6262	broad.mit.edu	37	1	237791246	237791246	+	Silent	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:237791246G>T	uc001hyl.1	+	41	6426	c.6306G>T	c.(6304-6306)CTG>CTT	p.L2102L		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2102	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCGGGCCCTGCCAAAGACCT	0.567			NA											14	44					4.14922e-12	4.86051e-12	0.004007	1	0
IDI1	3422	broad.mit.edu	37	10	1089975	1089975	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr10:1089975T>A	uc001iga.2	-	2	395	c.277A>T	c.(277-279)AAG>TAG	p.K93*	C10orf110_uc010qaf.1_RNA|C10orf110_uc001ifx.3_RNA|C10orf110_uc001ifw.3_3'UTR|C10orf110_uc001ify.3_RNA|IDI1_uc001ifz.2_Nonsense_Mutation_p.K37*|IDI1_uc001igb.2_Intron|IDI1_uc001igc.2_Nonsense_Mutation_p.K37*	NM_004508	NP_004499	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase	36		Substrate.			carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		CAATTCTTCTTGGTCTCAGCT	0.398			NA											12	198					0	0	0.013537	0	0
TET1	80312	broad.mit.edu	37	10	70450634	70450634	+	Nonsense_Mutation	SNP	C	C	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr10:70450634C>G	uc001jok.3	+	12	5979	c.5474C>G	c.(5473-5475)TCA>TGA	p.S1825*		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	1825					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						TTAAAAAGTTCAGACAACACT	0.453			NA											9	220					0	0	0.004482	0	0
MYOF	26509	broad.mit.edu	37	10	95113621	95113621	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr10:95113621C>G	uc001kin.2	-	32	3551	c.3428G>C	c.(3427-3429)TGC>TCC	p.C1143S	MYOF_uc001kio.2_Missense_Mutation_p.C1130S|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1143	Cytoplasmic (Potential).|C2 4.				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						ATAGACATAGCAGCGCAGATG	0.353			NA											47	69					0	0	0.01441	0	0
SAAL1	113174	broad.mit.edu	37	11	18108506	18108506	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr11:18108506G>A	uc001mnq.2	-	9	999	c.949C>T	c.(949-951)CAA>TAA	p.Q317*	SAAL1_uc001mnr.2_Nonsense_Mutation_p.Q317*|SAAL1_uc001mns.2_RNA|SAAL1_uc009yhf.2_Nonsense_Mutation_p.Q317*	NM_138421	NP_612430	Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	317					acute-phase response	extracellular region	binding				0						TTCTGTTCTTGAAGAATGATG	0.403			NA											4	116					0	0	0.009096	0	0
SLC22A25	387601	broad.mit.edu	37	11	62997041	62997041	+	Silent	SNP	G	G	A	rs150920552	byFrequency	TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr11:62997041G>A	uc001nwr.1	-	1	84	c.84C>T	c.(82-84)AAC>AAT	p.N28N	SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_RNA|SLC22A25_uc001nws.1_RNA|SLC22A25_uc001nwt.1_Silent_p.N28N	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter	28	Helical; Name=1; (Potential).				transmembrane transport	integral to membrane				ovary(3)|skin(1)	4						ATACTATGACGTTGAACATTA	0.458			NA											28	75					0	0	0.00632	0	0
SF1	7536	broad.mit.edu	37	11	64535055	64535055	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr11:64535055G>A	uc001obb.1	-	10	1707	c.1330C>T	c.(1330-1332)CCT>TCT	p.P444S	SF1_uc010rnm.1_Missense_Mutation_p.P136S|SF1_uc010rnn.1_Missense_Mutation_p.P418S|SF1_uc001oaz.1_Missense_Mutation_p.P569S|SF1_uc001oba.1_Missense_Mutation_p.P444S|SF1_uc001obc.1_Missense_Mutation_p.P444S|SF1_uc001obd.1_Missense_Mutation_p.P444S|SF1_uc001obe.1_Missense_Mutation_p.P329S|SF1_uc010rno.1_Missense_Mutation_p.P329S	NM_004630	NP_004621	Q15637	SF01_HUMAN	splicing factor 1 isoform 1	444	Pro-rich.				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3						ATTGGAGGAGGGCCATGGTGC	0.592			NA									OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	65	112					0	0	0.01441	0	0
FAT3	120114	broad.mit.edu	37	11	92526038	92526038	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr11:92526038G>A	uc001pdj.3	+	8	4734	c.4717G>A	c.(4717-4719)GCG>ACG	p.A1573T		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1573	Cadherin 15.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTGTATGAAGCGTCTGTGTT	0.438			NA								TCGA Ovarian(4;0.039)			6	268					0	0	0.004482	0	0
USP15	9958	broad.mit.edu	37	12	62785065	62785065	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr12:62785065G>A	uc001src.1	+	16	2098	c.2089G>A	c.(2089-2091)GAG>AAG	p.E697K	USP15_uc001srb.1_Missense_Mutation_p.E668K	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	697					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATTATGTACTGAGGATACTTG	0.383	Melanoma(181;615 2041 39364 49691 50001)		NA											38	80					0	0	0.006999	0	0
ADCY4	196883	broad.mit.edu	37	14	24798609	24798609	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr14:24798609G>A	uc001wov.2	-	9	1354	c.1348C>T	c.(1348-1350)CGG>TGG	p.R450W	ADCY4_uc001wow.2_Missense_Mutation_p.R450W|ADCY4_uc010toh.1_Missense_Mutation_p.R136W|ADCY4_uc001wox.2_Missense_Mutation_p.R450W|ADCY4_uc001woy.2_Missense_Mutation_p.R450W	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	450	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		GCTTTTACCCGTGGATCGATG	0.607			NA											19	47					0	0	0.021523	0	0
SPTB	6710	broad.mit.edu	37	14	65264536	65264536	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr14:65264536G>C	uc001xht.2	-	9	1147	c.1093C>G	c.(1093-1095)CTA>GTA	p.L365V	SPTB_uc001xhr.2_Missense_Mutation_p.L365V|SPTB_uc001xhs.2_Missense_Mutation_p.L365V|SPTB_uc001xhu.2_Missense_Mutation_p.L365V	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	365	Spectrin 1.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GTAAAAAGTAGAACTTCCAGA	0.433			NA											50	140					0	0	0.01441	0	0
PLD4	122618	broad.mit.edu	37	14	105395177	105395177	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr14:105395177C>G	uc001ypu.1	+	4	517	c.376C>G	c.(376-378)CTG>GTG	p.L126V	PLD4_uc010tyl.1_Missense_Mutation_p.L133V	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	126					lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)|skin(1)	2		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)	GCTGCAGCTGCTGGACACTGC	0.657			NA											9	37					0	0	0.010729	0	0
CHRNA7	1139	broad.mit.edu	37	15	32460235	32460235	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr15:32460235G>A	uc001zft.2	+	10	1157	c.1085G>A	c.(1084-1086)CGG>CAG	p.R362Q	uc001zfv.1_Intron|CHRNA7_uc010baf.2_Missense_Mutation_p.R181Q|CHRNA7_uc010bak.2_Missense_Mutation_p.R277Q	NM_000746	NP_000737	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7	362	Cytoplasmic (Potential).				activation of MAPK activity|calcium ion transport|cellular calcium ion homeostasis|memory|negative regulation of tumor necrosis factor production|positive regulation of angiogenesis|positive regulation of cell proliferation|response to hypoxia|response to nicotine	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|beta-amyloid binding|chloride channel regulator activity|nicotinic acetylcholine-activated cation-selective channel activity|protein homodimerization activity|toxin binding			ovary(1)	1		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Nicotine(DB00184)|Varenicline(DB01273)	CACAAGCAGCGGCGCTGCAGC	0.692	Esophageal Squamous(193;529 2900 40232 43193)		NA											5	38					0	0	0.00499	0	0
VPS18	57617	broad.mit.edu	37	15	41194859	41194859	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr15:41194859G>T	uc001zne.2	+	5	2581	c.2242G>T	c.(2242-2244)GAT>TAT	p.D748Y		NM_020857	NP_065908	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18	748	Clathrin.				endosome organization|lysosome organization|protein transport	HOPS complex|late endosome membrane|lysosomal membrane	metal ion binding|protein binding			ovary(2)|large_intestine(1)	3		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GCCTGAGGAGGATGAGGAATT	0.602			NA											17	44					1.00905e-13	1.21679e-13	0.008871	1	0
UBR1	197131	broad.mit.edu	37	15	43268937	43268937	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr15:43268937C>G	uc001zqq.2	-	39	4413	c.4347G>C	c.(4345-4347)CAG>CAC	p.Q1449H		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1449					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TAAGTAGTATCTGAAGCATGT	0.388			NA											3	144					0	0	0.004672	0	0
SLCO3A1	28232	broad.mit.edu	37	15	92459366	92459366	+	Silent	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr15:92459366G>A	uc002bqx.2	+	2	525	c.324G>A	c.(322-324)CTG>CTA	p.L108L	SLCO3A1_uc002bqy.2_Silent_p.L108L|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Silent_p.L50L	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,	108	Helical; Name=3; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			GGCCGCGCCTGATCGGCTGCG	0.682			NA											3	12					0	0	0.006214	0	0
SCNN1G	6340	broad.mit.edu	37	16	23200956	23200956	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr16:23200956G>C	uc002dlm.1	+	3	721	c.582G>C	c.(580-582)ATG>ATC	p.M194I		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	194	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CAAATGTCATGCACATCGAGT	0.512			NA											63	228					0	0	0.01441	0	0
C16orf93	90835	broad.mit.edu	37	16	30768826	30768826	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr16:30768826G>A	uc002dzm.2	-	9	1298	c.967C>T	c.(967-969)CCG>TCG	p.P323S	C16orf93_uc002dzn.2_Missense_Mutation_p.P388S|C16orf93_uc002dzo.2_Missense_Mutation_p.P286S	NM_001014979	NP_001014979	A1A4V9	CP093_HUMAN	hypothetical protein LOC90835	323											0						CCTTTACCCGGAGGTAGCTGG	0.597			NA											105	314					0	0	0.01441	0	0
HYDIN	54768	broad.mit.edu	37	16	71025246	71025246	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr16:71025246G>T	uc002ezr.2	-	25	3967	c.3839C>A	c.(3838-3840)ACG>AAG	p.T1280K		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	1280										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GGAAGCTTTCGTTTTTCTTAG	0.463			NA											29	65					1.74807e-11	2.0189e-11	0.010818	1	0
DNAH9	1770	broad.mit.edu	37	17	11696840	11696840	+	Silent	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr17:11696840G>T	uc002gne.2	+	42	8150	c.8082G>T	c.(8080-8082)GTG>GTT	p.V2694V	DNAH9_uc010coo.2_Silent_p.V1988V	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2694					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCTCCTCAGTGGAATGTGTGA	0.393			NA											45	115					3.54909e-21	4.40947e-21	0.011902	1	0
THEG	51298	broad.mit.edu	37	19	362332	362332	+	Silent	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr19:362332G>A	uc002lol.2	-	8	1047	c.1008C>T	c.(1006-1008)ATC>ATT	p.I336I	THEG_uc002lom.2_Silent_p.I312I	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	336	THEG 6.				cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGGGAGATGATCCGGGGGC	0.617			NA											39	59					0	0	0.006999	0	0
STK11	6794	broad.mit.edu	37	19	1221229	1221229	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr19:1221229G>T	uc002lrl.1	+	6	1867	c.752G>T	c.(751-753)GGT>GTT	p.G251V		NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11	251	Protein kinase.				anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.?(2)|p.Y246fs*3(1)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCACCACGGGTCTGTACCCC	0.592			14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			10	13					1.58986e-06	1.76174e-06	0.008291	1	0
ZNF536	9745	broad.mit.edu	37	19	30936284	30936284	+	Silent	SNP	G	G	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr19:30936284G>C	uc002nsu.1	+	2	1953	c.1815G>C	c.(1813-1815)CGG>CGC	p.R605R	ZNF536_uc010edd.1_Silent_p.R605R	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	605					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AAAGCAGTCGGGATTTTTTGT	0.552			NA											52	121					0	0	0.01441	0	0
ADD2	119	broad.mit.edu	37	2	70905951	70905951	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr2:70905951G>A	uc002sgz.2	-	11	1733	c.1268C>T	c.(1267-1269)GCC>GTC	p.A423V	ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_Missense_Mutation_p.A423V|ADD2_uc002sha.2_Intron|ADD2_uc002sgx.2_Missense_Mutation_p.A423V|ADD2_uc010fdt.1_Missense_Mutation_p.A423V|ADD2_uc002shc.1_Missense_Mutation_p.A423V|ADD2_uc002shd.1_Intron|ADD2_uc010fdu.1_Missense_Mutation_p.A439V	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a	423					actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3						CTGCTTCTGGGCATGCTGTCG	0.607			NA											5	235					0	0	0.001168	0	0
AAMP	14	broad.mit.edu	37	2	219132260	219132260	+	Silent	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr2:219132260G>A	uc002vhk.2	-	3	435	c.351C>T	c.(349-351)TTC>TTT	p.F117F	PNKD_uc002vhn.2_5'Flank|AAMP_uc002vhj.2_Silent_p.F98F|AAMP_uc010fvo.2_Silent_p.F117F|AAMP_uc002vhl.2_Silent_p.F118F|PNKD_uc002vhm.1_5'Flank	NM_001087	NP_001078	Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	117	WD 1.				angiogenesis|cell differentiation|positive regulation of endothelial cell migration|smooth muscle cell migration	cell surface|cytoplasm|plasma membrane	heparin binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCGCCATACGAAGGCTTTGT	0.552			NA											27	71					0	0	0.005524	0	0
GGTLC1	92086	broad.mit.edu	37	20	23967157	23967157	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr20:23967157A>G	uc002wts.2	-	2	225	c.92T>C	c.(91-93)ATG>ACG	p.M31T	GGTLC1_uc002wtu.2_Missense_Mutation_p.M31T	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	31							gamma-glutamyltransferase activity			ovary(1)	1						GTCATCCGGCATGTAGAACTC	0.622			NA											3	31					0	0	0.004672	0	0
CDH26	60437	broad.mit.edu	37	20	58547105	58547105	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr20:58547105C>T	uc002ybe.2	+	4	620	c.320C>T	c.(319-321)TCT>TTT	p.S107F	CDH26_uc010zzy.1_RNA	NM_177980	NP_817089	Q8IXH8	CAD26_HUMAN	cadherin-like 26 isoform a	107	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GGTTTGTTTTCTCTAGAAGAT	0.388			NA											37	102					0	0	0.019004	0	0
SON	6651	broad.mit.edu	37	21	34927023	34927023	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr21:34927023C>A	uc002yse.1	+	3	5535	c.5486C>A	c.(5485-5487)TCC>TAC	p.S1829Y	SON_uc002ysb.1_Missense_Mutation_p.S1829Y|SON_uc002ysc.2_Missense_Mutation_p.S1829Y|SON_uc002ysd.2_Missense_Mutation_p.S820Y|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Missense_Mutation_p.S820Y	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	1829					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						AGTAAGCGTTCCAAATCTTCT	0.418			NA											36	53					8.16277e-20	9.99026e-20	0.006999	1	0
MYO18B	84700	broad.mit.edu	37	22	26351204	26351204	+	Silent	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr22:26351204G>A	uc003abz.1	+	39	6280	c.6030G>A	c.(6028-6030)GCG>GCA	p.A2010A	MYO18B_uc003aca.1_Silent_p.A1891A|MYO18B_uc010guy.1_Silent_p.A1892A|MYO18B_uc010guz.1_Silent_p.A1890A|MYO18B_uc011aka.1_Silent_p.A1164A|MYO18B_uc011akb.1_Silent_p.A1523A|MYO18B_uc010gva.1_Silent_p.A8A	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2010	Tail.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						TTTCACAGGCGGCCACCTCCG	0.647			NA											5	11					0	0	0.001168	0	0
SCO2	9997	broad.mit.edu	37	22	50962600	50962600	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr22:50962600C>T	uc003bma.2	-	2	417	c.241G>A	c.(241-243)GAG>AAG	p.E81K	SCO2_uc003blz.3_Missense_Mutation_p.E81K	NM_005138	NP_005129	O43819	SCO2_HUMAN	cytochrome oxidase deficient homolog 2	81					cell redox homeostasis|cellular copper ion homeostasis|copper ion transport|oxidation-reduction process|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTCTCCTTCTCAGCCCTCAGG	0.692			NA											18	31					0	0	0.012319	0	0
TRIM71	131405	broad.mit.edu	37	3	32932170	32932170	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr3:32932170G>A	uc003cff.2	+	4	1537	c.1474G>A	c.(1474-1476)GAT>AAT	p.D492N		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	492	Filamin.				multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						GGCCACAGGCGATGGCCTCAA	0.587			NA											27	53					0	0	0.007291	0	0
CTNNB1	1499	broad.mit.edu	37	3	41266113	41266113	+	Missense_Mutation	SNP	C	C	T	rs121913403		TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr3:41266113C>T	uc010hia.1	+	4	266	c.110C>T	c.(109-111)TCT>TTT	p.S37F	CTNNB1_uc003ckp.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckq.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckr.2_Missense_Mutation_p.S37F|CTNNB1_uc011azf.1_Missense_Mutation_p.S30F|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	37			S -> C (in PTR, hepatoblastoma and ovarian cancer).|SG -> W (in hepatocellular carcinoma).|S -> F (in PTR).|S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes).|S -> Y (in hepatocellular carcinoma).		adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.S37F(147)|p.S37C(124)|p.A5_A80del(63)|p.S37A(59)|p.S37Y(23)|p.S37P(16)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.Q28_H134del(5)|p.W25_I140del(4)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32_S47del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.V22_G80>NNNNN(1)|p.GIHS34?(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.V22_T102del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.E9_A80del(1)|p.G34_S37del(1)|p.I35_S37>T(1)|p.I35_K170del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.S37S(1)|p.S37T(1)|p.V22_S71>A(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.V22_Y64del(1)|p.M8_A80del(1)|p.S33_S37del(1)|p.E9_I140del(1)|p.Y30_T40del(1)|p.M1_T42del(1)|p.S37_G38>W(1)|p.A5_Q143>E(1)|p.I35_G38del(1)|p.H36_E53>L(1)|p.A5_Q72del(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.S37_A39>S(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.I35_T41del(1)|p.W25_A80del(1)|p.A20_Q72del(1)|p.A20_S111del(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	GGAATCCATTCTGGTGCCACT	0.498	Colon(6;3 56 14213 18255)	S37F(HUTU80_SMALL_INTESTINE)|S37C(SNU398_LIVER)|S37C(JHUEM2_ENDOMETRIUM)	15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				15	31					0	0	0.003163	0	0
SEMA3F	6405	broad.mit.edu	37	3	50211518	50211518	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr3:50211518G>T	uc003cyj.2	+	4	505	c.307G>T	c.(307-309)GAA>TAA	p.E103*	SEMA3F_uc003cyk.2_Nonsense_Mutation_p.E103*	NM_004186	NP_004177	Q13275	SEM3F_HUMAN	semaphorin 3F precursor	103	Sema.				axon guidance	extracellular space|membrane	chemorepellent activity|receptor activity			lung(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		GCGCATCGAGGAATGCGTGCT	0.627			NA											19	48					1.10923e-09	1.26329e-09	0.016522	1	0
HTR3C	170572	broad.mit.edu	37	3	183773963	183773963	+	Splice_Site	SNP	A	A	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr3:183773963A>T	uc003fmk.2	+	4	314	c.280_splice	c.e4-2	p.V94_splice		NM_130770	NP_570126	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine receptor 3 subunit C							integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GCCCTGATGCAGGTATGGGAC	0.488			NA											37	44					0	0	0.017118	0	0
PPP3CA	5530	broad.mit.edu	37	4	101947129	101947129	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr4:101947129T>C	uc011cen.1	-	14	2134	c.1459A>G	c.(1459-1461)AGA>GGA	p.R487G	PPP3CA_uc003hvu.2_Missense_Mutation_p.R477G|PPP3CA_uc010ilj.2_Missense_Mutation_p.R435G|PPP3CA_uc003hvt.2_Missense_Mutation_p.R464G|PPP3CA_uc003hvs.2_Missense_Mutation_p.R420G|PPP3CA_uc010ilk.2_Missense_Mutation_p.R255G	NM_000944	NP_000935	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha	487	Inhibitory domain.				protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		ATGGCATCTCTGCGAGGCGGC	0.478			NA											4	226					0	0	0.009096	0	0
TLR3	7098	broad.mit.edu	37	4	187003653	187003653	+	Silent	SNP	A	A	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr4:187003653A>G	uc003iyq.2	+	4	914	c.813A>G	c.(811-813)CTA>CTG	p.L271L	TLR3_uc011ckz.1_5'UTR|TLR3_uc003iyr.2_5'UTR	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	271	Lumenal (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)|prostate(1)|lung(1)|breast(1)	5		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TCTTGGGACTAAAGTGGACAA	0.418			NA											50	88					0	0	0.01441	0	0
PDGFRB	5159	broad.mit.edu	37	5	149511607	149511607	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr5:149511607T>G	uc003lro.2	-	8	1647	c.1178A>C	c.(1177-1179)CAC>CCC	p.H393P	PDGFRB_uc010jhd.2_Missense_Mutation_p.H232P	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	393	Ig-like C2-type 4.|Extracellular (Potential).				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CATGGTGTAGTGGCCAGCCTC	0.433			NA	T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								8	20					0	0	0.008291	0	0
KIF4B	285643	broad.mit.edu	37	5	154396899	154396899	+	Silent	SNP	C	C	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr5:154396899C>G	uc010jih.1	+	1	3640	c.3480C>G	c.(3478-3480)GTC>GTG	p.V1160V		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1160	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTAACCCTGTCTGTGCCACCC	0.532			NA											28	61					0	0	0.007291	0	0
RFPL4B	442247	broad.mit.edu	37	6	112671585	112671585	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr6:112671585T>A	uc003pvx.1	+	3	987	c.675T>A	c.(673-675)AAT>AAA	p.N225K		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	225	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		ATGTTGACAATAATGTCCTCA	0.468			NA											25	84					0	0	0.021523	0	0
HGF	3082	broad.mit.edu	37	7	81332027	81332027	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr7:81332027A>G	uc003uhl.2	-	18	2222	c.2057T>C	c.(2056-2058)ATG>ACG	p.M686T	HGF_uc003uhm.2_Missense_Mutation_p.M681T	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	686	Peptidase S1.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						ACCAAGAACCATTCTCATTTT	0.373			NA											30	74					0	0	0.009535	0	0
GRM3	2913	broad.mit.edu	37	7	86394780	86394780	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr7:86394780G>C	uc003uid.2	+	2	1418	c.319G>C	c.(319-321)GAG>CAG	p.E107Q	GRM3_uc010lef.2_Missense_Mutation_p.E105Q|GRM3_uc010leg.2_Intron|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	107	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	CTATGCATTGGAGCAATCACT	0.408	GBM(52;969 1098 3139 52280)		NA											3	229					0	0	0.009096	0	0
AASS	10157	broad.mit.edu	37	7	121717989	121717989	+	Silent	SNP	C	C	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr7:121717989C>T	uc003vka.2	-	22	2661	c.2565G>A	c.(2563-2565)ACG>ACA	p.T855T	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Silent_p.T855T|AASS_uc011knw.1_Silent_p.T343T	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	855	Saccharopine dehydrogenase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	CAAGATCAATCGTTTTATGTT	0.413			NA											153	393					0	0	0.01441	0	0
CA8	767	broad.mit.edu	37	8	61178489	61178489	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr8:61178489T>C	uc003xtz.1	-	3	660	c.412A>G	c.(412-414)ATG>GTG	p.M138V	CA8_uc003xua.1_Missense_Mutation_p.M138V|CA8_uc003xub.2_Missense_Mutation_p.M138V	NM_004056	NP_004047	P35219	CAH8_HUMAN	carbonic anhydrase VIII	138					one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)				CTTACCTCCATGGGAAAAGCT	0.363			NA											17	49					0	0	0.008871	0	0
TRMT12	55039	broad.mit.edu	37	8	125464156	125464156	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr8:125464156G>T	uc003yra.3	+	1	1109	c.988G>T	c.(988-990)GGA>TGA	p.G330*		NM_017956	NP_060426	Q53H54	TYW2_HUMAN	homolog of yeast tRNA methyltransferase 12	330					tRNA processing		methyltransferase activity			upper_aerodigestive_tract(1)	1	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GCAGGATGCTGGAGGCATTTT	0.488			NA											22	178					5.26018e-13	6.25123e-13	0.012319	1	0
TRMT12	55039	broad.mit.edu	37	8	125464490	125464490	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr8:125464490G>C	uc003yra.3	+	1	1443	c.1322G>C	c.(1321-1323)TGC>TCC	p.C441S		NM_017956	NP_060426	Q53H54	TYW2_HUMAN	homolog of yeast tRNA methyltransferase 12	441					tRNA processing		methyltransferase activity			upper_aerodigestive_tract(1)	1	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GATCTGGAATGCTGCCCCTGT	0.512			NA											15	114					0	0	0.003163	0	0
OC90	729330	broad.mit.edu	37	8	133051064	133051064	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr8:133051064C>T	uc003ytg.2	-	6	553	c.553G>A	c.(553-555)GAA>AAA	p.E185K	OC90_uc011lix.1_Missense_Mutation_p.E201K	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	201					lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GTCAAGTCTTCCTTGATGGTT	0.512			NA											51	129					0	0	0.01441	0	0
OC90	729330	broad.mit.edu	37	8	133051249	133051249	+	Silent	SNP	C	C	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr8:133051249C>T	uc003ytg.2	-	5	531	c.531G>A	c.(529-531)CAG>CAA	p.Q177Q	OC90_uc011lix.1_Silent_p.Q193Q	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	193					lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			TACCTGGAGTCTGAGCCAGGC	0.537			NA											57	199					0	0	0.01441	0	0
OC90	729330	broad.mit.edu	37	8	133051317	133051317	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr8:133051317C>T	uc003ytg.2	-	5	463	c.463G>A	c.(463-465)GAG>AAG	p.E155K	OC90_uc011lix.1_Missense_Mutation_p.E171K	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	171	Phospholipase A2-like 1.				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GCCAAGCACTCTATGGCAGCC	0.502			NA											48	125					0	0	0.01441	0	0
FLJ43860	389690	broad.mit.edu	37	8	142487879	142487879	+	Silent	SNP	C	C	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr8:142487879C>T	uc003ywi.2	-	11	1443	c.1362G>A	c.(1360-1362)CTG>CTA	p.L454L	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	454							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AACACACCATCAGACACTGGA	0.617			NA											16	32					0	0	0.004007	0	0
FAM108B1	51104	broad.mit.edu	37	9	74481838	74481838	+	Silent	SNP	G	G	C			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr9:74481838G>C	uc004aim.1	-	4	1334	c.732C>G	c.(730-732)CTC>CTG	p.L244L	FAM108B1_uc004ail.2_Silent_p.L244L	NM_001025780	NP_001020951	Q5VST6	F108B_HUMAN	family with sequence similarity 108, member B1	244						extracellular region	hydrolase activity				0						CAAACAATGCGAGGCCATGTG	0.423			NA											28	64					0	0	0.004656	0	0
NRK	203447	broad.mit.edu	37	X	105190394	105190394	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chrX:105190394G>A	uc004emd.2	+	26	4594	c.4291G>A	c.(4291-4293)GAT>AAT	p.D1431N	NRK_uc011msi.1_5'Flank	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1431	CNH.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CAGCTCAGCAGATGGATATCA	0.378			NA								HNSCC(51;0.14)			4	68					0	0	0.014758	0	0
ARHGEF6	9459	broad.mit.edu	37	X	135827450	135827450	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chrX:135827450A>T	uc004fab.2	-	4	853	c.391T>A	c.(391-393)TCT>ACT	p.S131T	ARHGEF6_uc011mwd.1_5'UTR|ARHGEF6_uc011mwe.1_5'UTR	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	131					apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)					TTTGTCTGAGAAGTATTAGCA	0.448			NA											144	110					0	0	0.01441	0	0
SLITRK2	84631	broad.mit.edu	37	X	144904729	144904729	+	Silent	SNP	C	C	A			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chrX:144904729C>A	uc004fcd.2	+	5	1776	c.786C>A	c.(784-786)CTC>CTA	p.L262L	SLITRK2_uc010nsp.2_Silent_p.L262L|SLITRK2_uc010nso.2_Silent_p.L262L|SLITRK2_uc011mwq.1_Silent_p.L262L|SLITRK2_uc011mwr.1_Silent_p.L262L|SLITRK2_uc011mws.1_Silent_p.L262L|SLITRK2_uc004fcg.2_Silent_p.L262L|SLITRK2_uc011mwt.1_Silent_p.L262L	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	262	Extracellular (Potential).|LRRCT 1.					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					GGCAAGACCTCTGTCCCAGAA	0.522			NA											62	44					3.30712e-30	4.17206e-30	0.01441	1	0
Unknown	0	broad.mit.edu	37	X	155252782	155252782	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chrX:155252782A>G	uc004fnw.1	+	6	1485	c.826A>G	c.(826-828)AGT>GGT	p.S276G	uc004fnx.3_Missense_Mutation_p.S62G	NM_182905	NP_878908			WAS protein family homolog 1												NA						CCTCATGTACAGTGCCGACCT	0.602			NA											3	10					0	0	0.014758	0	0
ZBTB8A	653121	broad.mit.edu	37	1	33065979	33065981	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	GAA	GAA	-	-	GAA	GAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:33065979_33065981delGAA	uc001bvn.2	+	5	1770_1772	c.1285_1287delGAA	c.(1285-1287)GAAdel	p.E433del	ZBTB8A_uc001bvk.2_RNA|ZBTB8A_uc001bvm.2_3'UTR|ZBTB8OS_uc001bvo.1_Intron	NM_001040441	NP_001035531	Q96BR9	ZBT8A_HUMAN	zinc finger and BTB domain containing 8A	433	Poly-Glu.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGATGATAGTGAAGAAGAAGAAG	0.414			NA											7	126	---	---	---	---	NA	NA	NA	NA	NA
LINGO4	339398	broad.mit.edu	37	1	151773518	151773518	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr1:151773518delC	uc001ezf.1	-	2	1853	c.1663delG	c.(1663-1665)GCCfs	p.A555fs		NM_001004432	NP_001004432	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	555	Cytoplasmic (Potential).					integral to membrane				large_intestine(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTCCAAAGGGCAATCAGGCCA	0.567			NA											12	518	---	---	---	---	NA	NA	NA	NA	NA
NFE2L2	4780	broad.mit.edu	37	2	178098919	178098942	+	In_Frame_Del	DEL	TCGCTGACTGAAGTCAAATACTTC	TCGCTGACTGAAGTCAAATACTTC	-			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	TCGCTGACTGAAGTCAAATACTTC	TCGCTGACTGAAGTCAAATACTTC	-	-	TCGCTGACTGAAGTCAAATACTTC	TCGCTGACTGAAGTCAAATACTTC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr2:178098919_178098942delTCGCTGACTGAAGTCAAATACTTC	uc002ulh.3	-	2	658_681	c.103_126delGAAGTATTTGACTTCAGTCAGCGA	c.(103-126)GAAGTATTTGACTTCAGTCAGCGAdel	p.EVFDFSQR35del	NFE2L2_uc002ulg.3_In_Frame_Del_p.EVFDFSQR19del|NFE2L2_uc010zfa.1_In_Frame_Del_p.EVFDFSQR19del|NFE2L2_uc002uli.3_In_Frame_Del_p.EVFDFSQR19del|NFE2L2_uc010fra.2_In_Frame_Del_p.EVFDFSQR19del|NFE2L2_uc010frb.2_In_Frame_Del_p.EVFDFSQR19del	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	35_42					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTCTTTCCGTCGCTGACTGAAGTCAAATACTTCTCGACTTACT	0.379			NA	Mis		NSCLC|HNSCC					HNSCC(56;0.16)			7	61	---	---	---	---	NA	NA	NA	NA	NA
DHX15	1665	broad.mit.edu	37	4	24534645	24534649	+	Frame_Shift_Del	DEL	AGTTG	AGTTG	-			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	AGTTG	AGTTG	-	-	AGTTG	AGTTG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr4:24534645_24534649delAGTTG	uc003gqx.2	-	12	2106_2110	c.1938_1942delCAACT	c.(1936-1944)GACAACTTCfs	p.D646fs	DHX15_uc003gqv.2_Frame_Shift_Del_p.D52fs|DHX15_uc003gqw.2_Frame_Shift_Del_p.D69fs	NM_001358	NP_001349	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 15	646_648					mRNA processing	U12-type spliceosomal complex	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(1)	1		Breast(46;0.0503)				TAGTTAATGAAGTTGTCATAACACC	0.424			NA											33	244	---	---	---	---	NA	NA	NA	NA	NA
C9orf3	84909	broad.mit.edu	37	9	97522333	97522333	+	Frame_Shift_Del	DEL	T	T	-			TCGA-05-4422-01A-01D-1265-08	TCGA-05-4422-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a5370f18-e8a9-43d8-9eb8-be678ccd4669	75ce6746-09a7-4d8f-9015-b79da0dc9a55	g.chr9:97522333delT	uc004ava.2	+	1	403	c.268delT	c.(268-270)TTCfs	p.F90fs	C9orf3_uc011lui.1_RNA|C9orf3_uc004aux.1_Frame_Shift_Del_p.F90fs|C9orf3_uc004auy.2_Frame_Shift_Del_p.F90fs|C9orf3_uc004auz.1_Frame_Shift_Del_p.F90fs	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O	90					leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGCAAGGACCTTCTCATCTGA	0.403			NA											80	194	---	---	---	---	NA	NA	NA	NA	NA
