Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
C1orf127	148345	broad.mit.edu	37	1	11008388	11008388	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:11008388C>T	uc010oao.1	-	8	1362	c.1357G>A	c.(1357-1359)GAG>AAG	p.E453K	C1orf127_uc001arr.1_Missense_Mutation_p.E435K|C1orf127_uc001ars.1_Missense_Mutation_p.E427K	NM_173507	NP_775778	B7ZLG7	B7ZLG7_HUMAN	hypothetical protein LOC148345	453										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		ACCAGCTCCTCTGCAGCCAGT	0.672			NA											17	35					0	0	1	0	0
HSPG2	3339	broad.mit.edu	37	1	22166366	22166366	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:22166366C>T	uc001bfj.2	-	72	9698	c.9658G>A	c.(9658-9660)GAG>AAG	p.E3220K	HSPG2_uc009vqd.2_Missense_Mutation_p.E3221K	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3220	Ig-like C2-type 18.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	ACAGTCAGCTCAGCTTCTTCA	0.642			NA											28	61					0	0	1	0	0
ARID1A	8289	broad.mit.edu	37	1	27088651	27088651	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:27088651C>T	uc001bmv.1	+	7	2633	c.2260C>T	c.(2260-2262)CAG>TAG	p.Q754*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q754*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q754*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q371*	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	754					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGGTTATATGCAGAGGAACCC	0.498			NA	Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								5	87					0	0	1	0	0
CDC20	991	broad.mit.edu	37	1	43826219	43826219	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:43826219C>T	uc001cix.2	+	7	904	c.803C>T	c.(802-804)TCT>TTT	p.S268F	CDC20_uc001ciy.2_Missense_Mutation_p.S268F	NM_001255	NP_001246	Q12834	CDC20_HUMAN	cell division cycle 20	268	WD 3.				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	cytosol|nucleoplasm|spindle	enzyme binding|protein C-terminus binding				0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACCAGTCACTCTGCCCGAGTG	0.498	Esophageal Squamous(137;1154 1759 10362 10401 46925)		NA											43	70					0	0	1	0	0
AKNAD1	254268	broad.mit.edu	37	1	109358811	109358811	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:109358811C>G	uc001dwa.2	-	16	2762	c.2493G>C	c.(2491-2493)AGG>AGC	p.R831S	AKNAD1_uc001dwb.2_RNA	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268	831										ovary(3)	3						TCAGTCGATTCCTCCACCTCT	0.373			NA											30	45					0	0	1	0	0
PDE4DIP	9659	broad.mit.edu	37	1	144994592	144994592	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:144994592C>T	uc001elw.3	-	1	431	c.140G>A	c.(139-141)CGG>CAG	p.R47Q	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001ell.1_Missense_Mutation_p.R50Q|PDE4DIP_uc001elm.3_Missense_Mutation_p.R15Q|PDE4DIP_uc001eln.3_Missense_Mutation_p.R113Q|PDE4DIP_uc001elo.2_Missense_Mutation_p.R184Q|PDE4DIP_uc001elx.3_Missense_Mutation_p.R113Q|PDE4DIP_uc001emc.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001emd.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001emg.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001emh.2_Missense_Mutation_p.R184Q	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	47	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCACTCACCCGCTTGTAGAT	0.612			NA	T	PDGFRB	MPD								6	164					0	0	1	0	0
FLG	2312	broad.mit.edu	37	1	152285020	152285020	+	Missense_Mutation	SNP	T	T	C	rs138055273	byFrequency	TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:152285020T>C	uc001ezu.1	-	3	2378	c.2342A>G	c.(2341-2343)GAC>GGC	p.D781G	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	781	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCTGACCGGTCACGTGCGGA	0.562			NA							Ichthyosis				101	364					0	0	1	0	0
CHRNB2	1141	broad.mit.edu	37	1	154543728	154543728	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:154543728C>T	uc001ffg.2	+	5	693	c.429C>T	c.(427-429)ATC>ATT	p.I143I		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	143	Extracellular (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	ATGGCAGCATCTTCTGGCTGC	0.537			NA											31	119					0	0	1	0	0
KIFAP3	22920	broad.mit.edu	37	1	170003513	170003513	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:170003513C>G	uc001ggv.2	-	7	1013	c.742G>C	c.(742-744)GTT>CTT	p.V248L	KIFAP3_uc010ply.1_3'UTR|KIFAP3_uc001ggw.1_3'UTR	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	248					blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AAAAGGATATCAGCTTTCTTC	0.328			NA											10	38					0	0	1	0	0
ASTN1	460	broad.mit.edu	37	1	177133601	177133601	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:177133601C>A	uc001glc.2	-	1	424	c.212G>T	c.(211-213)CGC>CTC	p.R71L	ASTN1_uc001glb.1_Missense_Mutation_p.R71L|ASTN1_uc001gld.1_Missense_Mutation_p.R71L|ASTN1_uc009wwx.1_Missense_Mutation_p.R71L	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	71					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GAAGTCGTTGCGCACCGAGAA	0.647			NA											13	18					0.00136819	0.00139292	1	1	0
ZNF648	127665	broad.mit.edu	37	1	182026921	182026921	+	Silent	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:182026921G>T	uc001goz.2	-	2	433	c.225C>A	c.(223-225)GGC>GGA	p.G75G		NM_001009992	NP_001009992	Q5T619	ZN648_HUMAN	zinc finger protein 648	75					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTTCCTCTTTGCCCAGTGGAT	0.567	NSCLC(71;908 1374 5429 20458 35642)		NA											19	44					6.49762e-13	7.1305e-13	1	1	0
RNASEL	6041	broad.mit.edu	37	1	182555637	182555637	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:182555637G>A	uc001gpj.1	-	1	472	c.305C>T	c.(304-306)GCG>GTG	p.A102V	RNASEL_uc009wxz.1_Missense_Mutation_p.A102V|RNASEL_uc001gpk.2_Missense_Mutation_p.A102V|RNASEL_uc009wya.1_Missense_Mutation_p.A102V	NM_021133	NP_066956	Q05823	RN5A_HUMAN	ribonuclease L	102	ANK 3.				mRNA processing|response to virus|type I interferon-mediated signaling pathway	mitochondrion	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding|protein kinase activity|RNA binding			ovary(4)|stomach(1)	5						CACGCTCCCCGCAATCGCTGC	0.498			NA							Hereditary_Prostate_Cancer				9	36					0	0	1	0	0
RGS16	6004	broad.mit.edu	37	1	182571203	182571203	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:182571203C>T	uc001gpl.3	-	4	439	c.285G>A	c.(283-285)TGG>TGA	p.W95*	RGS16_uc010pnv.1_Nonsense_Mutation_p.W95*	NM_002928	NP_002919	O15492	RGS16_HUMAN	regulator of G-protein signalling 16	95	RGS.				negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity			ovary(1)	1						CACAGGCCAGCCAGAACTCCA	0.537			NA									OREG0014036	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	75					0	0	1	0	0
HMCN1	83872	broad.mit.edu	37	1	186023068	186023068	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:186023068C>T	uc001grq.1	+	44	7041	c.6812C>T	c.(6811-6813)GCG>GTG	p.A2271V		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2271	Ig-like C2-type 20.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TCATGTGTGGCGTCGAATGTT	0.403			NA											14	67					0	0	1	0	0
F13B	2165	broad.mit.edu	37	1	197036345	197036345	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:197036345C>T	uc001gtt.1	-	1	53	c.9G>A	c.(7-9)TTG>TTA	p.L3L		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	3					blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCAGGTTTTTCAACCTCATCT	0.299			NA											9	49					0	0	1	0	0
CRB1	23418	broad.mit.edu	37	1	197411420	197411420	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:197411420G>A	uc001gtz.2	+	11	4138	c.4003G>A	c.(4003-4005)GAC>AAC	p.D1335N	CRB1_uc010poz.1_Missense_Mutation_p.D1311N|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.D1223N|CRB1_uc010ppb.1_Missense_Mutation_p.D799N|CRB1_uc010ppd.1_Missense_Mutation_p.D816N|CRB1_uc001gub.1_3'UTR	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	1335	Extracellular (Potential).				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CTGCGAGGTGGACGTAAGCAG	0.483			NA											115	138					0	0	1	0	0
LMOD1	25802	broad.mit.edu	37	1	201868453	201868453	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:201868453C>G	uc001gxb.2	-	2	1936	c.1688G>C	c.(1687-1689)GGA>GCA	p.G563A	LMOD1_uc010ppu.1_Missense_Mutation_p.G512A	NM_012134	NP_036266	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	563					muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3						GACTTTGTCTCCCATCTTCCT	0.567			NA											6	5					0	0	1	0	0
CENPF	1063	broad.mit.edu	37	1	214788288	214788288	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:214788288C>G	uc001hkm.2	+	3	450	c.276C>G	c.(274-276)GTC>GTG	p.V92V		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	92	Interaction with SNAP25 and required for localization to the cytoplasm (By similarity).|Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AACTTCAAGTCAAGGAGTCAC	0.368	Colon(80;575 1284 11000 14801 43496)		NA											12	41					0	0	1	0	0
OPN3	23596	broad.mit.edu	37	1	241767856	241767856	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:241767856G>A	uc001hza.2	-	2	544	c.399C>T	c.(397-399)ACC>ACT	p.T133T	OPN3_uc001hzb.2_RNA|OPN3_uc001hzc.2_Intron	NM_014322	NP_055137	Q9H1Y3	OPN3_HUMAN	opsin 3	133	Helical; Name=3; (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity				0	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			AGGCCAGCACGGTTAGGGTGG	0.507			NA											6	25					0	0	1	0	0
ITIH2	3698	broad.mit.edu	37	10	7759700	7759700	+	Silent	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:7759700C>A	uc001ijs.2	+	6	741	c.579C>A	c.(577-579)TCC>TCA	p.S193S		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	193					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						AGCTGGGCTCCTATGAGCACA	0.498			NA											3	51					0.004672	0.00469981	1	1	0
TAF3	83860	broad.mit.edu	37	10	7860740	7860740	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:7860740G>T	uc010qbd.1	+	1	68	c.68G>T	c.(67-69)TGG>TTG	p.W23L		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	23				W->R: Loss of interaction with TAF10.|WDS -> TRP (in Ref. 4; CAB56032).	maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						GCGCTGGGCTGGGACTCGGTG	0.667			NA											7	2					8.12818e-05	8.4794e-05	1	1	0
WAPAL	23063	broad.mit.edu	37	10	88213467	88213467	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:88213467C>G	uc001kdo.2	-	13	3221	c.2779G>C	c.(2779-2781)GAG>CAG	p.E927Q	WAPAL_uc009xsv.2_Missense_Mutation_p.E241Q|WAPAL_uc001kdn.2_Missense_Mutation_p.E964Q|WAPAL_uc009xsw.2_Missense_Mutation_p.E921Q	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	927	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						ATGCAGTCCTCCACTGCTTTG	0.413			NA											19	19					0	0	1	0	0
BMPR1A	657	broad.mit.edu	37	10	88677025	88677025	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:88677025C>T	uc001kdy.2	+	9	1358	c.810C>T	c.(808-810)AGC>AGT	p.S270S		NM_004329	NP_004320	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	270	Cytoplasmic (Potential).|Protein kinase.				BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						AAGAAGCCAGCTGGTTTCGAG	0.448	Ovarian(190;603 2086 22044 30335 47971)		NA	Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				4	6					0	0	1	0	0
ATE1	11101	broad.mit.edu	37	10	123670659	123670659	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:123670659G>A	uc001lfp.2	-	5	427	c.345C>T	c.(343-345)CCC>CCT	p.P115P	ATE1_uc001lfq.2_Silent_p.P115P|ATE1_uc010qtr.1_5'UTR|ATE1_uc010qts.1_Silent_p.P19P|ATE1_uc010qtt.1_Silent_p.P108P|ATE1_uc001lfr.2_5'UTR|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972	O95260	ATE1_HUMAN	arginyltransferase 1 isoform 2	115					protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				TGGAATCCATGGGCTCATCTA	0.358			NA											27	21					0	0	1	0	0
UBQLNL	143630	broad.mit.edu	37	11	5536678	5536678	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:5536678T>G	uc001maz.3	-	1	1279	c.994A>C	c.(994-996)ATC>CTC	p.I332L	HBG2_uc001mak.1_Intron	NM_145053	NP_659490	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	332										large_intestine(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		CTATTATAGATGACTCGGGTT	0.498			NA											30	56					0	0	1	0	0
SBF2	81846	broad.mit.edu	37	11	9861153	9861153	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:9861153C>G	uc001mib.2	-	26	3485	c.3347G>C	c.(3346-3348)AGA>ACA	p.R1116T	SBF2_uc001mif.3_Missense_Mutation_p.R872T|uc001mig.2_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1116	Myotubularin phosphatase.				myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CTGATAGTCTCTGAAACAAGC	0.463			NA											4	100					0	0	1	0	0
SLC39A13	91252	broad.mit.edu	37	11	47431696	47431696	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:47431696C>G	uc009ylq.2	+	2	222	c.51C>G	c.(49-51)CTC>CTG	p.L17L	SLC39A13_uc001nfd.2_Silent_p.L17L|SLC39A13_uc001nfe.1_RNA|SLC39A13_uc001nff.3_Silent_p.L17L|SLC39A13_uc001nfg.3_Silent_p.L17L	NM_001128225	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter),	17	Helical; (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				Lung(87;0.0936)		CAAGGCTCCTCTTCCTCACTG	0.637			NA											30	75					0	0	1	0	0
OR4C3	256144	broad.mit.edu	37	11	48346598	48346598	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:48346598G>C	uc010rhv.1	+	1	106	c.106G>C	c.(106-108)GAA>CAA	p.E36Q		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	9	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						AAATATCACAGAATTTTTCAT	0.408			NA											23	69					0	0	1	0	0
OR4D6	219983	broad.mit.edu	37	11	59224646	59224646	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:59224646C>T	uc010rku.1	+	1	213	c.213C>T	c.(211-213)ATC>ATT	p.I71I		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TCCTGGACATCGTTTTTTCAT	0.463			NA											19	55					0	0	1	0	0
CCDC83	220047	broad.mit.edu	37	11	85626533	85626533	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:85626533C>T	uc001pbh.1	+	9	1378	c.866C>T	c.(865-867)ACA>ATA	p.T289I	CCDC83_uc001pbg.1_Missense_Mutation_p.T320I|CCDC83_uc001pbi.1_RNA|CCDC83_uc001pbj.1_Missense_Mutation_p.T190I	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	289										skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				TTGCCAGAAACACATATAGGT	0.353			NA											14	42					0	0	1	0	0
ARHGEF12	23365	broad.mit.edu	37	11	120298837	120298837	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:120298837C>T	uc001pxl.1	+	8	473	c.466C>T	c.(466-468)CTT>TTT	p.L156F	ARHGEF12_uc009zat.2_Missense_Mutation_p.L137F|ARHGEF12_uc010rzn.1_Missense_Mutation_p.L53F|ARHGEF12_uc009zau.1_Missense_Mutation_p.L53F	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	156					apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CCAGATTCCACTTGCCGACTC	0.527			NA	T	MLL	AML								54	103					0	0	1	0	0
VSIG2	23584	broad.mit.edu	37	11	124619682	124619682	+	Missense_Mutation	SNP	C	C	T	rs114520645	by1000genomes	TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:124619682C>T	uc001qas.2	-	4	584	c.508G>A	c.(508-510)GAG>AAG	p.E170K	VSIG2_uc001qat.2_Missense_Mutation_p.E170K	NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	170	Extracellular (Potential).|Ig-like C2-type.					integral to plasma membrane|membrane fraction				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		GGAGCCCCCTCGGAAGAGCTG	0.512			NA											15	46					0	0	1	0	0
C1R	715	broad.mit.edu	37	12	7188187	7188187	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:7188187C>G	uc010sfy.1	-	10	1826	c.1767G>C	c.(1765-1767)TTG>TTC	p.L589F		NM_001733	NP_001724	P00736	C1R_HUMAN	complement component 1, r subcomponent	589	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity				0					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CATAGCCCATCAAGCCCAGGT	0.567			NA											8	23					0	0	1	0	0
PDZRN4	29951	broad.mit.edu	37	12	41967475	41967475	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:41967475G>A	uc010skn.1	+	10	2365	c.2297G>A	c.(2296-2298)CGA>CAA	p.R766Q	PDZRN4_uc001rmq.3_Missense_Mutation_p.R707Q|PDZRN4_uc009zjz.2_Missense_Mutation_p.R705Q|PDZRN4_uc001rmr.2_Missense_Mutation_p.R592Q	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	965							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TTCATGATGCGAAGCAGGTTA	0.507			NA											5	16					0	0	1	0	0
PUS7L	83448	broad.mit.edu	37	12	44124206	44124206	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:44124206C>T	uc001rnq.3	-	9	2568	c.2079G>A	c.(2077-2079)CTG>CTA	p.L693L	PUS7L_uc001rnr.3_Silent_p.L693L|PUS7L_uc001rns.3_Silent_p.L693L|PUS7L_uc009zkb.2_Silent_p.L380L	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.	693					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TTATTTCCTTCAGACAAACGG	0.338			NA											15	34					0	0	1	0	0
HDAC7	51564	broad.mit.edu	37	12	48179570	48179570	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:48179570A>G	uc010slo.1	-	23	2866	c.2671T>C	c.(2671-2673)TCT>CCT	p.S891P	HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_Missense_Mutation_p.S325P|HDAC7_uc001rqj.3_Missense_Mutation_p.S854P|HDAC7_uc001rqk.3_Missense_Mutation_p.S874P|HDAC7_uc010slp.1_Missense_Mutation_p.S135P	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN	histone deacetylase 7 isoform a	852	Histone deacetylase.				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)		CAGGCCTCAGAGGCGTCACAG	0.602			NA											3	4					0	0	1	0	0
SUOX	6821	broad.mit.edu	37	12	56398128	56398128	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:56398128G>C	uc001six.2	+	6	1281	c.955G>C	c.(955-957)GAG>CAG	p.E319Q	SUOX_uc001siy.2_Missense_Mutation_p.E319Q|SUOX_uc001siz.2_Missense_Mutation_p.E319Q|SUOX_uc001sja.2_Missense_Mutation_p.E319Q	NM_000456	NP_000447	P51687	SUOX_HUMAN	sulfite oxidase precursor	319	Molybdenum-pterin domain (By similarity).					mitochondrial intermembrane space	electron carrier activity|molybdenum ion binding|sulfite oxidase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			CGTCTGCTTTGAGGGACTGGA	0.602			NA											17	22					0	0	1	0	0
CAND1	55832	broad.mit.edu	37	12	67699360	67699360	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:67699360T>C	uc001stn.2	+	10	2349	c.1912T>C	c.(1912-1914)TCA>CCA	p.S638P	CAND1_uc001sto.2_Missense_Mutation_p.S148P	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	638	HEAT 14.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		GATTGCTGGGTCACCTTTGAA	0.413			NA											35	89					0	0	1	0	0
DUSP6	1848	broad.mit.edu	37	12	89743067	89743067	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:89743067C>G	uc001tay.2	-	3	1590	c.1110G>C	c.(1108-1110)CAG>CAC	p.Q370H	DUSP6_uc001taz.2_Missense_Mutation_p.Q224H	NM_001946	NP_001937	Q16828	DUS6_HUMAN	dual specificity phosphatase 6 isoform a	370	Tyrosine-protein phosphatase.				dorsal/ventral pattern formation|inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|nerve growth factor receptor signaling pathway|positive regulation of apoptosis|regulation of endodermal cell fate specification|regulation of fibroblast growth factor receptor signaling pathway|regulation of heart growth|response to nitrosative stress|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0						GGTATACATTCTGGTTGGAAG	0.547	Colon(132;3456 5224)		NA											30	56					0	0	1	0	0
TMEM132D	121256	broad.mit.edu	37	12	129558864	129558864	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:129558864G>C	uc009zyl.1	-	9	3184	c.2856C>G	c.(2854-2856)TTC>TTG	p.F952L	TMEM132D_uc001uia.2_Missense_Mutation_p.F490L	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	952	Cytoplasmic (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCTGCTCCTCGAAGGGAACCT	0.463			NA											32	59					0	0	1	0	0
OR4Q3	441669	broad.mit.edu	37	14	20216038	20216038	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:20216038G>A	uc010tkt.1	+	1	452	c.452G>A	c.(451-453)TGT>TAT	p.C151Y		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GCCTGCTGGTGTGGGGGTTTT	0.498			NA											14	48					0	0	1	0	0
OR4K13	390433	broad.mit.edu	37	14	20502887	20502887	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:20502887C>T	uc010tkz.1	-	1	31	c.31G>A	c.(31-33)GAA>AAA	p.E11K		NM_001004714	NP_001004714	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K,	11	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AAAATAAATTCCGATACCACT	0.373			NA											8	30					0	0	1	0	0
KIAA0391	9692	broad.mit.edu	37	14	35739633	35739633	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:35739633A>G	uc001wsy.1	+	7	1811	c.1451A>G	c.(1450-1452)TAT>TGT	p.Y484C	KIAA0391_uc010tps.1_Missense_Mutation_p.Y389C|KIAA0391_uc001wsz.1_Missense_Mutation_p.Y468C|KIAA0391_uc001wta.2_RNA|KIAA0391_uc001wtb.1_Missense_Mutation_p.Y468C|KIAA0391_uc001wtc.1_Missense_Mutation_p.Y112C	NM_014672	NP_055487	O15091	MRRP3_HUMAN	mitochondrial RNase P protein 3 precursor	484					tRNA processing	mitochondrion					0	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TTCCTTCTGTATGCCACACTG	0.512			NA											19	46					0	0	1	0	0
NKX2-1	7080	broad.mit.edu	37	14	36988447	36988447	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:36988447G>A	uc001wtt.2	-	1	457	c.116C>T	c.(115-117)GCG>GTG	p.A39V	SFTA3_uc001wts.2_Intron|NKX2-1_uc001wtu.2_Missense_Mutation_p.A69V|NKX2-1_uc001wtv.2_Missense_Mutation_p.A39V|uc001wtw.1_5'Flank	NM_003317	NP_003308	P43699	NKX21_HUMAN	thyroid transcription factor 1 isoform 2	39					epithelial tube branching involved in lung morphogenesis|globus pallidus development|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|thyroid gland development		protein binding|transcription regulatory region DNA binding			skin(1)	1	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		CCTGTACGCCGCCAGCGGAGC	0.682			NA	A		NSCLC								9	26					0	0	1	0	0
C14orf37	145407	broad.mit.edu	37	14	58599890	58599890	+	Silent	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:58599890C>A	uc001xdc.2	-	3	1650	c.1539G>T	c.(1537-1539)CTG>CTT	p.L513L	C14orf37_uc010tro.1_Silent_p.L551L|C14orf37_uc001xdd.2_Silent_p.L513L|C14orf37_uc001xde.2_Silent_p.L513L	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	513	Extracellular (Potential).					integral to membrane	binding				0						ATCTTCTTGACAGCTGAGTAA	0.498			NA											22	55					1.10513e-12	1.20495e-12	1	1	0
ATP6V1D	51382	broad.mit.edu	37	14	67807182	67807182	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:67807182C>T	uc001xjf.2	-	8	753	c.577G>A	c.(577-579)GAG>AAG	p.E193K	ATP6V1D_uc001xje.2_RNA	NM_015994	NP_057078	Q9Y5K8	VATD_HUMAN	H(+)-transporting two-sector ATPase	193					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)|lung(1)	2				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		CGCTCTCTCTCATCCAGCTCT	0.358			NA											19	36					0	0	1	0	0
SIPA1L1	26037	broad.mit.edu	37	14	72139160	72139160	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:72139160G>A	uc001xms.2	+	9	3273	c.2925G>A	c.(2923-2925)GCG>GCA	p.A975A	SIPA1L1_uc001xmt.2_Silent_p.A975A|SIPA1L1_uc001xmu.2_Silent_p.A975A|SIPA1L1_uc001xmv.2_Silent_p.A975A|SIPA1L1_uc010ttm.1_Silent_p.A450A	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	975	PDZ.				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GCATTGTGGCGGATGTGGAGC	0.562			NA											23	34					0	0	1	0	0
SETD3	84193	broad.mit.edu	37	14	99927677	99927677	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:99927677C>A	uc001ygc.2	-	4	367	c.197G>T	c.(196-198)GGT>GTT	p.G66V	SETD3_uc001ygd.2_Missense_Mutation_p.G66V|SETD3_uc001ygf.2_Missense_Mutation_p.G66V	NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	66					peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				AACGGACAGACCTATATTAAT	0.373			NA											12	43					0.00136819	0.00139292	1	1	0
C15orf2	23742	broad.mit.edu	37	15	24924444	24924444	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:24924444G>C	uc001ywo.2	+	1	3904	c.3430G>C	c.(3430-3432)GAA>CAA	p.E1144Q		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	1144					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CTATGGACAAGAAACATATGT	0.448			NA											25	57					0	0	1	0	0
ATP10A	57194	broad.mit.edu	37	15	25958906	25958906	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:25958906G>A	uc010ayu.2	-	10	2365	c.2259C>T	c.(2257-2259)ATC>ATT	p.I753I		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	753	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCGGGTGCCGGATCACCACTG	0.602			NA											10	36					0	0	1	0	0
GABRA5	2558	broad.mit.edu	37	15	27182355	27182355	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:27182355G>A	uc001zbd.1	+	9	943	c.604G>A	c.(604-606)GTT>ATT	p.V202I	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	202	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TTCTGAAGTCGTTTACGTCTG	0.512			NA											15	34					0	0	1	0	0
MGA	23269	broad.mit.edu	37	15	41961679	41961679	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:41961679C>G	uc001zog.1	+	2	678	c.587C>G	c.(586-588)TCT>TGT	p.S196C	MGA_uc010ucy.1_Missense_Mutation_p.S196C|MGA_uc010ucz.1_Missense_Mutation_p.S196C	NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 2	196	T-box.					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		ATCTTGCACTCTATGCATCGT	0.448			NA											51	95					0	0	1	0	0
MGA	23269	broad.mit.edu	37	15	42040834	42040834	+	Splice_Site	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:42040834G>A	uc010ucy.1	+	16	5394	c.5213_splice	c.e16-1	p.E1738_splice	MGA_uc010ucz.1_Splice_Site_p.E1529_splice|MGA_uc010uda.1_Splice_Site_p.E354_splice|MGA_uc001zoi.2_5'Flank	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1							MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		CTGTTTTTCAGAAAATGCTGC	0.368			NA											4	9					0	0	1	0	0
FAM63B	54629	broad.mit.edu	37	15	59064389	59064389	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:59064389C>T	uc002afj.2	+	1	997	c.795C>T	c.(793-795)CCC>CCT	p.P265P	FAM63B_uc002afi.2_Silent_p.P265P|FAM63B_uc002afk.2_RNA|FAM63B_uc002afl.2_RNA	NM_001040450	NP_001035540	Q8NBR6	FA63B_HUMAN	hypothetical protein LOC54629 isoform a	265										central_nervous_system(1)	1						AGAACGGACCCTGCCCCTTGC	0.527			NA											14	28					0	0	1	0	0
RNF111	54778	broad.mit.edu	37	15	59323235	59323235	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:59323235C>G	uc002afv.2	+	2	493	c.214C>G	c.(214-216)CAA>GAA	p.Q72E	RNF111_uc002afs.2_Missense_Mutation_p.Q72E|RNF111_uc002aft.2_Missense_Mutation_p.Q72E|RNF111_uc002afu.2_Missense_Mutation_p.Q72E|RNF111_uc002afw.2_Missense_Mutation_p.Q72E	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111	72					multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		TGATGATTCTCAAAAGCAAGA	0.443	NSCLC(72;983 1365 10746 34387 47081)		NA											10	15					0	0	1	0	0
HAGHL	84264	broad.mit.edu	37	16	777579	777579	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:777579G>A	uc002cjl.1	+	2	351	c.70G>A	c.(70-72)GAG>AAG	p.E24K	CCDC78_uc002cjf.2_5'Flank|CCDC78_uc002cji.3_5'Flank|CCDC78_uc002cjg.2_5'Flank|CCDC78_uc002cjj.3_5'Flank|CCDC78_uc002cjh.2_5'Flank|CCDC78_uc010uuo.1_5'Flank|CCDC78_uc002cjk.2_5'Flank|HAGHL_uc002cjm.1_Missense_Mutation_p.E24K|HAGHL_uc002cjn.1_Missense_Mutation_p.E24K|HAGHL_uc002cjo.1_Missense_Mutation_p.E24K|HAGHL_uc010uup.1_Missense_Mutation_p.E24K	NM_207112	NP_996995	Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like isoform 1	24							hydrolase activity|metal ion binding				0		Hepatocellular(780;0.00335)				GCTCACGCGCGAGGCGGTGGC	0.701	Pancreas(46;538 1326 12403 32360)		NA											4	15					0	0	1	0	0
CIITA	4261	broad.mit.edu	37	16	10995954	10995954	+	Missense_Mutation	SNP	A	A	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:10995954A>C	uc002dai.3	+	7	674	c.541A>C	c.(541-543)ACC>CCC	p.T181P	CIITA_uc002daj.3_Missense_Mutation_p.T182P|CIITA_uc002dak.3_Intron|CIITA_uc002dag.2_Missense_Mutation_p.T181P|CIITA_uc002dah.2_Intron|CIITA_uc010bup.1_Missense_Mutation_p.T181P	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	181					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						CGACTGCTCCACCCTGCCCTG	0.617			NA	T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								7	58					0	0	1	0	0
CES7	221223	broad.mit.edu	37	16	55905608	55905608	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:55905608C>T	uc002eip.2	-	3	495	c.346G>A	c.(346-348)GGA>AGA	p.G116R	CES7_uc002eio.2_Missense_Mutation_p.G116R|CES7_uc002eiq.2_5'UTR|CES7_uc002eir.2_Missense_Mutation_p.G10R	NM_001143685	NP_001137157	Q6NT32	EST5A_HUMAN	carboxylesterase 7 isoform 1	116						extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.229)|Epithelial(162;0.231)		TCTGACACTCCGAATTTCGGG	0.537			NA											12	25					0	0	1	0	0
AMFR	267	broad.mit.edu	37	16	56436943	56436943	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:56436943G>A	uc002eiy.2	-	7	1133	c.928C>T	c.(928-930)CGT>TGT	p.R310C	AMFR_uc002eix.2_Silent_p.F7F	NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN	autocrine motility factor receptor	310					endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2						TTGTGCCGACGAATTCGACGT	0.428	Pancreas(2;144 323 39528)		NA											25	55					0	0	1	0	0
CDT1	81620	broad.mit.edu	37	16	88872241	88872241	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:88872241G>C	uc002flu.2	+	5	850	c.796G>C	c.(796-798)GAT>CAT	p.D266H		NM_030928	NP_112190	Q9H211	CDT1_HUMAN	chromatin licensing and DNA replication factor	266					DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|regulation of DNA-dependent DNA replication initiation|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CAGGAGGTCAGATTACCAGCT	0.617	Melanoma(159;511 3380 30971)		NA											9	15					0	0	1	0	0
NUFIP2	57532	broad.mit.edu	37	17	27613864	27613864	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:27613864G>C	uc002hdy.3	-	2	1237	c.1148C>G	c.(1147-1149)TCT>TGT	p.S383C	NUFIP2_uc002hdx.3_Intron	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	383	Ser-rich.					nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			AGATGATGAAGATGATGAAGA	0.393			NA											5	142					0	0	1	0	0
NF1	4763	broad.mit.edu	37	17	29664477	29664477	+	Silent	SNP	T	T	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:29664477T>G	uc002hgg.2	+	43	6852	c.6519T>G	c.(6517-6519)GCT>GCG	p.A2173A	NF1_uc002hgh.2_Silent_p.A2152A|NF1_uc010cso.2_Silent_p.A361A|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2173					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.E2143_S2180del(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCAAGTCAGCTGCTGTCATTG	0.453			NA	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			13	54					0	0	1	0	0
PSMD11	5717	broad.mit.edu	37	17	30781559	30781559	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:30781559C>G	uc010cta.1	+	3	280	c.240C>G	c.(238-240)ATC>ATG	p.I80M	PSMD11_uc010wbz.1_Missense_Mutation_p.I80M|PSMD11_uc002hhm.2_Missense_Mutation_p.I80M	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11	80					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGAATTCCATCAGCAAGGCTA	0.428	Ovarian(130;1038 1716 9294 11987 19279)		NA											24	68					0	0	1	0	0
GPR179	440435	broad.mit.edu	37	17	36486375	36486375	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:36486375C>T	uc002hpz.2	-	11	3098	c.3077G>A	c.(3076-3078)CGA>CAA	p.R1026Q		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1026	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GAGCCTGGCTCGAGCTGGGGC	0.612			NA											14	51					0	0	1	0	0
PSMC3IP	29893	broad.mit.edu	37	17	40729545	40729545	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:40729545C>G	uc002iai.2	-	2	112	c.69G>C	c.(67-69)CAG>CAC	p.Q23H	PSMC3IP_uc002iaj.2_5'UTR|PSMC3IP_uc002iak.2_Missense_Mutation_p.Q23H|PSMC3IP_uc010wgn.1_5'UTR|PSMC3IP_uc010wgo.1_RNA|PSMC3IP_uc010wgp.1_RNA	NM_016556	NP_057640	Q9P2W1	HOP2_HUMAN	PSMC3 interacting protein isoform 2	23					DNA recombination|meiosis	nucleus	DNA binding			upper_aerodigestive_tract(1)|skin(1)	2		all_cancers(22;0.00426)|Breast(137;0.00116)|all_epithelial(22;0.0395)		BRCA - Breast invasive adenocarcinoma(366;0.13)		AGGGCCGGTTCTGCTCCTGCA	0.662			NA											16	34					0	0	1	0	0
TLK2	11011	broad.mit.edu	37	17	60655841	60655841	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:60655841G>A	uc010ddp.2	+	15	1526	c.1258G>A	c.(1258-1260)GAA>AAA	p.E420K	TLK2_uc002izx.3_Missense_Mutation_p.E246K|TLK2_uc002izz.3_Missense_Mutation_p.E398K|TLK2_uc002jaa.3_Missense_Mutation_p.E366K|TLK2_uc010wpd.1_Missense_Mutation_p.E366K	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A	420	Potential.				cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						GCTTTAGGAGGAAGCAGAGAT	0.368			NA											8	32					0	0	1	0	0
DSC3	1825	broad.mit.edu	37	18	28602410	28602410	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr18:28602410C>T	uc002kwj.3	-	7	989	c.834G>A	c.(832-834)ACG>ACA	p.T278T	DSC3_uc002kwi.3_Silent_p.T278T	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	278	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ATTTCAGGCGCGTATGCATTG	0.453			NA											3	40					0	0	1	0	0
SMAD4	4089	broad.mit.edu	37	18	48584552	48584552	+	Nonsense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr18:48584552C>G	uc010xdp.1	+	6	1263	c.725C>G	c.(724-726)TCA>TGA	p.S242*	SMAD4_uc010xdo.1_RNA|SMAD4_uc002lfb.3_Nonsense_Mutation_p.S87*	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	242					BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(2)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CAGATAGCATCAGGGCCTCAG	0.433			NA							Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				14	8					0	0	1	0	0
ATP8B3	148229	broad.mit.edu	37	19	1785556	1785556	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:1785556C>T	uc002ltw.2	-	26	3539	c.3305G>A	c.(3304-3306)CGC>CAC	p.R1102H	ATP8B3_uc002ltv.2_Missense_Mutation_p.R1065H|ATP8B3_uc002ltx.2_RNA	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	1102	Extracellular (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCGTGTCGCGGCTGATCCA	0.602			NA											10	15					0	0	1	0	0
NFIC	4782	broad.mit.edu	37	19	3381997	3381997	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:3381997C>G	uc010xhi.1	+	2	380	c.318C>G	c.(316-318)CTC>CTG	p.L106L	NFIC_uc002lxo.2_Silent_p.L97L|NFIC_uc010xhh.1_Silent_p.L97L|NFIC_uc002lxp.2_Silent_p.L106L|NFIC_uc010xhj.1_Silent_p.L106L|NFIC_uc002lxq.1_Silent_p.L58L	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2	106	CTF/NF-I.				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		GCTGCGTGCTCTCCAACCCCG	0.667			NA											42	53					0	0	1	0	0
C3	718	broad.mit.edu	37	19	6707234	6707234	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:6707234C>G	uc002mfm.2	-	17	2160	c.2098G>C	c.(2098-2100)GAG>CAG	p.E700Q		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	700	Anaphylatoxin-like.			E -> Q (in Ref. 5; AA sequence).	complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		ATGGGGTTCTCCCGCATGCCG	0.652			NA											8	12					0	0	1	0	0
ZNF180	7733	broad.mit.edu	37	19	44980651	44980651	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:44980651G>C	uc002ozf.3	-	5	2329	c.2047C>G	c.(2047-2049)CAT>GAT	p.H683D	ZNF180_uc002ozh.3_Missense_Mutation_p.H340D|ZNF180_uc002ozi.3_Missense_Mutation_p.H656D|ZNF180_uc002ozg.3_Missense_Mutation_p.H682D|ZNF180_uc010ejm.2_Missense_Mutation_p.H658D	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	683	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				TCTTCAGTATGAGTTGCCTGA	0.313	Esophageal Squamous(180;1353 2003 32862 46574 49854)		NA											26	67					0	0	1	0	0
FTL	2512	broad.mit.edu	37	19	49469553	49469553	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:49469553G>C	uc002plo.2	+	3	464	c.265G>C	c.(265-267)GAG>CAG	p.E89Q	FTL_uc002pln.1_3'UTR	NM_000146	NP_000137	P02792	FRIL_HUMAN	ferritin, light polypeptide	89	Ferritin-like diiron.			E -> W (in Ref. 12; AA sequence).	cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	AGCTGAAGATGAGTGGGGTAA	0.512			NA											15	31					0	0	1	0	0
FTL	2512	broad.mit.edu	37	19	49469609	49469609	+	Silent	SNP	G	G	T	rs11553263		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:49469609G>T	uc002plo.2	+	3	520	c.321G>T	c.(319-321)CTG>CTT	p.L107L	FTL_uc002pln.1_3'UTR	NM_000146	NP_000137	P02792	FRIL_HUMAN	ferritin, light polypeptide	107	Ferritin-like diiron.				cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	AGAAAAAGCTGAACCAGGCCC	0.547			NA											17	28					3.52763e-06	3.77323e-06	1	1	0
SPIB	6689	broad.mit.edu	37	19	50926966	50926966	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:50926966G>A	uc002psd.2	+	5	469	c.444G>A	c.(442-444)TCG>TCA	p.S148S	SPIB_uc002pse.2_Silent_p.S148S|SPIB_uc010ycc.1_Silent_p.S57S	NM_003121	NP_003112	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	148					regulation of transcription from RNA polymerase II promoter	cytoplasm|microtubule cytoskeleton|nucleus	sequence-specific DNA binding			lung(1)|kidney(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		ACAGCGAGTCGGATGAGGCCC	0.672			NA											4	13					0	0	1	0	0
ZNF836	162962	broad.mit.edu	37	19	52658555	52658555	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:52658555G>A	uc010ydi.1	-	5	2755	c.2381C>T	c.(2380-2382)GCA>GTA	p.A794V	ZNF836_uc010ydj.1_Missense_Mutation_p.A794V	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	794	C2H2-type 21.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCGATGACGTGCTAGTGTTGA	0.423			NA											38	65					0	0	1	0	0
ZBTB45	84878	broad.mit.edu	37	19	59028392	59028392	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:59028392C>T	uc002qtd.2	-	2	941	c.649G>A	c.(649-651)GAG>AAG	p.E217K	ZBTB45_uc002qte.2_Missense_Mutation_p.E217K|ZBTB45_uc002qtf.2_Missense_Mutation_p.E217K	NM_032792	NP_116181	Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	217					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		CCATCGGTCTCATCGTCACTT	0.652	NSCLC(164;1383 2017 5233 27540 46677)		NA									OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	324					0	0	1	0	0
C2orf63	130162	broad.mit.edu	37	2	55439826	55439826	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:55439826G>C	uc002ryi.2	-	5	828	c.482C>G	c.(481-483)CCT>CGT	p.P161R	C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Missense_Mutation_p.P39R	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1	161							binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			AGGTTTTGAAGGATCTTTGGA	0.313			NA											12	31					0	0	1	0	0
OTX1	5013	broad.mit.edu	37	2	63280140	63280140	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:63280140C>T	uc002scd.2	+	3	263	c.15C>T	c.(13-15)CTC>CTT	p.L5L	OTX1_uc010ypt.1_5'UTR	NM_014562	NP_055377	P32242	OTX1_HUMAN	orthodenticle homeobox 1	5						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(2)	2	Lung NSC(7;0.121)|all_lung(7;0.211)					TGTCTTACCTCAAACAACCCC	0.687			NA											18	92					0	0	1	0	0
DYSF	8291	broad.mit.edu	37	2	71901354	71901354	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:71901354G>A	uc002sie.2	+	51	6071	c.5695G>A	c.(5695-5697)GAG>AAG	p.E1899K	DYSF_uc010feg.2_Missense_Mutation_p.E1930K|DYSF_uc010feh.2_Missense_Mutation_p.E1906K|DYSF_uc002sig.3_Missense_Mutation_p.E1885K|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.E1920K|DYSF_uc010fef.2_Missense_Mutation_p.E1937K|DYSF_uc010fei.2_Missense_Mutation_p.E1916K|DYSF_uc010fek.2_Missense_Mutation_p.E1917K|DYSF_uc010fej.2_Missense_Mutation_p.E1907K|DYSF_uc010fel.2_Missense_Mutation_p.E1886K|DYSF_uc010feo.2_Missense_Mutation_p.E1931K|DYSF_uc010fem.2_Missense_Mutation_p.E1921K|DYSF_uc010fen.2_Missense_Mutation_p.E1938K|DYSF_uc002sif.2_Missense_Mutation_p.E1900K|DYSF_uc010yqy.1_Missense_Mutation_p.E780K|DYSF_uc010yqz.1_Missense_Mutation_p.E660K	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1899	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GGACAAGACTGAGAGCAAAAT	0.502			NA											16	24					0	0	1	0	0
CTNNA2	1496	broad.mit.edu	37	2	80101245	80101245	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:80101245G>A	uc010ysh.1	+	5	634	c.629G>A	c.(628-630)CGA>CAA	p.R210Q	CTNNA2_uc010yse.1_Missense_Mutation_p.R210Q|CTNNA2_uc010ysf.1_Missense_Mutation_p.R210Q|CTNNA2_uc010ysg.1_Missense_Mutation_p.R210Q	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	210					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GCAGCCGCCCGAGGGGCTCTG	0.512			NA											13	38					0	0	1	0	0
GPR45	11250	broad.mit.edu	37	2	105859054	105859054	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:105859054C>T	uc002tco.1	+	1	855	c.739C>T	c.(739-741)CGG>TGG	p.R247W		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	247	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						GGCGGGCCTGCGGCGCCTGCA	0.642			NA											41	76					0	0	1	0	0
ZEB2	9839	broad.mit.edu	37	2	145161555	145161555	+	Silent	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:145161555G>C	uc002tvu.2	-	6	1215	c.735C>G	c.(733-735)CTC>CTG	p.L245L	ZEB2_uc002tvv.2_Silent_p.L239L|ZEB2_uc010zbm.1_Silent_p.L216L|ZEB2_uc010fnp.2_Silent_p.L153L|ZEB2_uc010fnq.1_Silent_p.L274L	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	245	C2H2-type 2.					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		TGTAGCTACAGAGAGGGCAGG	0.512	Melanoma(33;1235 1264 5755 16332)		NA											30	62					0	0	1	0	0
IFIH1	64135	broad.mit.edu	37	2	163134108	163134108	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:163134108C>G	uc002uce.2	-	10	2083	c.1861G>C	c.(1861-1863)GAT>CAT	p.D621H		NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	621					detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						GTATACGCATCTATCATTCGA	0.299			NA											24	44					0	0	1	0	0
COBLL1	22837	broad.mit.edu	37	2	165584560	165584560	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:165584560G>A	uc010zcw.1	-	6	863	c.739C>T	c.(739-741)CAA>TAA	p.Q247*	COBLL1_uc002ucp.2_Nonsense_Mutation_p.Q194*|COBLL1_uc002ucq.2_Nonsense_Mutation_p.Q194*|COBLL1_uc010zcx.1_Nonsense_Mutation_p.Q240*|COBLL1_uc002ucs.1_RNA	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1	232										ovary(2)|pancreas(1)	3						TCCTGCGATTGATAATCTTTC	0.393			NA											34	50					0	0	1	0	0
SESTD1	91404	broad.mit.edu	37	2	180014079	180014079	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:180014079C>T	uc002uni.3	-	7	676	c.526G>A	c.(526-528)GAA>AAA	p.E176K		NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	176					regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AAAGCAAGTTCATCTAATAAT	0.289			NA											6	12					0	0	1	0	0
XRCC5	7520	broad.mit.edu	37	2	217012854	217012854	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:217012854C>T	uc002vfy.2	+	14	1665	c.1525C>T	c.(1525-1527)CAG>TAG	p.Q509*	XRCC5_uc002vfz.2_Nonsense_Mutation_p.Q395*	NM_021141	NP_066964	P13010	XRCC5_HUMAN	ATP-dependent DNA helicase II	509	Pro-rich.				double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding			lung(1)|kidney(1)	2		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		ACCCCCAATTCAGCAGCATAT	0.433			NA						Direct_reversal_of_damage|NHEJ					43	77					0	0	1	0	0
SP140	11262	broad.mit.edu	37	2	231135347	231135347	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:231135347G>A	uc002vql.2	+	15	1606	c.1491G>A	c.(1489-1491)AGG>AGA	p.R497R	SP140_uc010zma.1_RNA|SP140_uc002vqn.2_Silent_p.R383R|SP140_uc002vqm.2_Silent_p.R437R|SP140_uc010fxl.2_Silent_p.R470R	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	497	Nuclear localization signal (Potential).				defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AACCCAAGAGGAAAAGAAGTA	0.284			NA											5	26					0	0	1	0	0
PYGB	5834	broad.mit.edu	37	20	25263896	25263896	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:25263896G>A	uc002wup.2	+	13	1712	c.1603G>A	c.(1603-1605)GTG>ATG	p.V535M		NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	535					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)	CATCAGGGACGTGGCCAAGGT	0.622			NA											25	26					0	0	1	0	0
FRG1B	284802	broad.mit.edu	37	20	29628261	29628261	+	Missense_Mutation	SNP	T	T	C	rs111331725	by1000genomes	TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:29628261T>C	uc010ztl.1	+	3	205	c.173T>C	c.(172-174)TTT>TCT	p.F58S	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.F10S					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						AATAGCTGCTTTATTAGATGC	0.363			NA											5	41					0	0	1	0	0
HNF4A	3172	broad.mit.edu	37	20	42984468	42984468	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:42984468C>T	uc002xlv.2	+	1	28	c.24C>T	c.(22-24)CTC>CTT	p.L8L	HNF4A_uc010zwo.1_5'UTR|HNF4A_uc002xlt.2_Silent_p.L8L|HNF4A_uc002xlu.2_Silent_p.L8L	NM_175914	NP_787110	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform d	156					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACGCGCCCCTCGGGGCTCCAG	0.682	Colon(79;2 1269 8820 14841 52347)		NA											20	9					0	0	1	0	0
SLC17A9	63910	broad.mit.edu	37	20	61596969	61596969	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:61596969G>T	uc002yea.3	+	10	1137	c.953G>T	c.(952-954)GGC>GTC	p.G318V	SLC17A9_uc002ydz.3_Missense_Mutation_p.G312V|SLC17A9_uc011aap.1_Missense_Mutation_p.G338V	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	318	Helical; (Potential).				exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2						CAGGGCATGGGCCTTGGCCTC	0.662			NA											62	163					2.32099e-22	2.58057e-22	1	1	0
PTK6	5753	broad.mit.edu	37	20	62168655	62168655	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:62168655C>A	uc002yfg.2	-	1	53	c.13G>T	c.(13-15)GAC>TAC	p.D5Y	PTK6_uc011aay.1_5'UTR|PTK6_uc011aba.1_Missense_Mutation_p.D5Y	NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6	5						cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|kidney(1)	2	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)			TGAGCCTGGTCCCGGGACACC	0.711			NA											9	4					0.000442599	0.000458891	1	1	0
IL10RB	3588	broad.mit.edu	37	21	34649001	34649001	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr21:34649001G>A	uc002yrk.1	+	3	373	c.274G>A	c.(274-276)GAA>AAA	p.E92K	IL10RB_uc002yrh.1_Missense_Mutation_p.E162K|IL10RB_uc002yri.1_Missense_Mutation_p.E45K|IL10RB_uc002yrl.1_Missense_Mutation_p.E94K	NM_000628	NP_000619	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta precursor	92	Extracellular (Potential).				immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity				0						AGTCAGGGCTGAATTTGCAGA	0.393	Melanoma(67;315 1275 21667 21943 44564)		NA											45	77					0	0	1	0	0
EWSR1	2130	broad.mit.edu	37	22	29668239	29668239	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr22:29668239G>A	uc003aet.2	+	2	376	c.48G>A	c.(46-48)CAG>CAA	p.Q16Q	EWSR1_uc003aes.3_Silent_p.Q16Q|EWSR1_uc003aev.2_Silent_p.Q16Q|EWSR1_uc003aew.2_Silent_p.Q16Q|EWSR1_uc003aex.2_Silent_p.Q16Q	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2	16	31 X approximate tandem repeats.|EAD (Gln/Pro/Thr-rich).|1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						CAGCGCAGCAGGGGTAAGTCA	0.368			NA	T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								17	29					0	0	1	0	0
EIF3L	51386	broad.mit.edu	37	22	38274173	38274173	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr22:38274173G>A	uc003auf.2	+	11	1657	c.1570G>A	c.(1570-1572)GAT>AAT	p.D524N	EIF3L_uc003aue.1_Missense_Mutation_p.D524N|EIF3L_uc011ann.1_Missense_Mutation_p.D476N|EIF3L_uc003aug.2_Missense_Mutation_p.D416N|EIF3L_uc003auh.2_Missense_Mutation_p.D257N	NM_016091	NP_057175	Q9Y262	EIF3L_HUMAN	eukaryotic translation initiation factor 3	524						eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1						CTTCTACATTGATAAGGTATG	0.338			NA											17	31					0	0	1	0	0
EFHB	151651	broad.mit.edu	37	3	19940970	19940970	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:19940970C>A	uc003cbl.3	-	7	1652	c.1456G>T	c.(1456-1458)GAT>TAT	p.D486Y	EFHB_uc003cbm.2_Missense_Mutation_p.D356Y	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B	486					signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						TCTTTGAAATCATCTGCTCTT	0.294			NA											21	12					1.22574e-08	1.32788e-08	1	1	0
SCN11A	11280	broad.mit.edu	37	3	38938482	38938482	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:38938482C>A	uc011ays.1	-	14	2456	c.2257G>T	c.(2257-2259)GAT>TAT	p.D753Y	SCN11A_uc010hhn.1_5'Flank	NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	753	II.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	TGCCAGAAATCCCCCATGTGC	0.488			NA											12	11					2.27111e-07	2.4447e-07	1	1	0
TTC21A	199223	broad.mit.edu	37	3	39159580	39159580	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:39159580G>A	uc003cjc.2	+	7	914	c.737G>A	c.(736-738)AGC>AAC	p.S246N	TTC21A_uc003cja.2_Missense_Mutation_p.S246N|TTC21A_uc010hho.1_Missense_Mutation_p.S168N|TTC21A_uc003cjb.2_3'UTR|TTC21A_uc003cje.2_Missense_Mutation_p.S246N|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.S205N	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	246	TPR 5.						binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AAAGATGAGAGCAATATTGAT	0.378			NA											32	22					0	0	1	0	0
CX3CR1	1524	broad.mit.edu	37	3	39307728	39307728	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:39307728C>T	uc003cjl.2	-	2	365	c.273G>A	c.(271-273)TTG>TTA	p.L91L		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	91	Extracellular (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TTTCATTTATCAAATAGTGAG	0.463			NA											17	27					0	0	1	0	0
ZNF502	91392	broad.mit.edu	37	3	44763268	44763268	+	Missense_Mutation	SNP	A	A	G	rs145256884		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:44763268A>G	uc011baa.1	+	4	1214	c.959A>G	c.(958-960)GAA>GGA	p.E320G	ZNF502_uc003cns.2_Missense_Mutation_p.E320G|ZNF502_uc011bab.1_Missense_Mutation_p.E320G|ZNF502_uc003cnt.2_Missense_Mutation_p.E320G	NM_001134440	NP_001127912	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	320					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		CACACTGGGGAAAAACCCCAT	0.403			NA											3	82					0	0	1	0	0
EAF2	55840	broad.mit.edu	37	3	121591540	121591540	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:121591540C>A	uc003een.2	+	5	740	c.641C>A	c.(640-642)TCA>TAA	p.S214*	EAF2_uc003eeo.2_Nonsense_Mutation_p.S84*	NM_018456	NP_060926	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	214	Necessary for transactivation activity.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding				0				GBM - Glioblastoma multiforme(114;0.0972)		AATTGTGTCTCAGGACATCCT	0.393	Esophageal Squamous(194;1942 2097 24663 29345 31866)		NA											3	51					0.004672	0.00469981	1	1	0
SLC7A14	57709	broad.mit.edu	37	3	170216672	170216672	+	Silent	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:170216672C>A	uc003fgz.2	-	4	859	c.543G>T	c.(541-543)GGG>GGT	p.G181G	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	181						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CTTCACCTTTCCCTAGAGAGG	0.488			NA											13	12					9.31168e-06	9.83546e-06	1	1	0
RNF168	165918	broad.mit.edu	37	3	196199040	196199040	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:196199040C>G	uc003fwq.2	-	6	1904	c.1366G>C	c.(1366-1368)GAG>CAG	p.E456Q	RNF168_uc010iah.2_Missense_Mutation_p.E289Q|uc010iag.1_5'Flank	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	ring finger protein 168	456	MIU motif 2.				double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		TTATCCACCTCCTTCTGAAGT	0.423			NA											65	50					0	0	1	0	0
CRIPAK	285464	broad.mit.edu	37	4	1389587	1389587	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:1389587C>T	uc003gdf.2	+	1	4248	c.1288C>T	c.(1288-1290)CGT>TGT	p.R430C		NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	430	Interaction with PAK1.				ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CTTTTTAATACGTTTTTATGT	0.443			NA											9	52					0	0	1	0	0
HTT	3064	broad.mit.edu	37	4	3156082	3156082	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:3156082G>A	uc011bvq.1	+	28	3712	c.3567G>A	c.(3565-3567)GAG>GAA	p.E1189E		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1187					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGGGGAAGGAGAAAGAACCAG	0.453			NA											4	9					0	0	1	0	0
MAN2B2	23324	broad.mit.edu	37	4	6580191	6580191	+	Silent	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:6580191G>C	uc003gjf.1	+	3	393	c.357G>C	c.(355-357)GTG>GTC	p.V119V	MAN2B2_uc003gje.1_Silent_p.V119V|MAN2B2_uc011bwf.1_Silent_p.V119V	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	119					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						ACGAGGCTGTGACGCACCTTG	0.592			NA											4	10					0	0	1	0	0
TBC1D19	55296	broad.mit.edu	37	4	26675489	26675489	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:26675489G>C	uc003gsf.3	+	11	1065	c.795G>C	c.(793-795)TTG>TTC	p.L265F	TBC1D19_uc010iew.2_Missense_Mutation_p.L265F|TBC1D19_uc011bxu.1_Missense_Mutation_p.L200F	NM_018317	NP_060787	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	265	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)				CTCTCATTTTGAATATTTCCA	0.393			NA											5	17					0	0	1	0	0
COL25A1	84570	broad.mit.edu	37	4	109784503	109784503	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:109784503C>T	uc003hze.1	-	20	1655	c.1124G>A	c.(1123-1125)CGA>CAA	p.R375Q	COL25A1_uc003hzg.2_Missense_Mutation_p.R375Q|COL25A1_uc003hzd.2_RNA|COL25A1_uc003hzf.2_Missense_Mutation_p.R156Q	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1	375	Extracellular (Potential).|Collagen-like 5.					collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		AGGTTCCCCTCGCTCACCTCT	0.493			NA											8	16					0	0	1	0	0
DSP	1832	broad.mit.edu	37	6	7581355	7581355	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:7581355G>A	uc003mxp.1	+	23	5211	c.4932G>A	c.(4930-4932)CTG>CTA	p.L1644L	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1644	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATGGCCACCTGAGGGAAAAGC	0.567			NA											40	19					0	0	1	0	0
HIST1H2BC	8347	broad.mit.edu	37	6	26123793	26123793	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:26123793C>G	uc003ngk.3	-	1	362	c.340G>C	c.(340-342)GAG>CAG	p.E114Q	HIST1H2BC_uc003ngl.2_Missense_Mutation_p.E114Q|HIST1H2AC_uc003ngm.2_5'Flank|HIST1H2AC_uc003ngn.2_5'Flank|HIST1H2AC_uc003ngo.2_5'Flank|HIST1H2AC_uc003ngp.2_5'Flank	NM_003526	NP_003517	P62807	H2B1C_HUMAN	histone cluster 1, H2bc	114					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1						TTGGTGCCCTCCGACACGGCG	0.582			NA											21	49					0	0	1	0	0
TREML1	340205	broad.mit.edu	37	6	41118012	41118012	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:41118012C>G	uc011duc.1	-	5	652	c.608G>C	c.(607-609)AGA>ACA	p.R203T	TREML1_uc003opx.2_Intron|TREML1_uc011dud.1_Missense_Mutation_p.R92T	NM_178174	NP_835468	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid	203	Cytoplasmic (Potential).				calcium-mediated signaling|innate immune response|platelet activation	cell surface|integral to membrane|plasma membrane|platelet alpha granule	protein binding|receptor activity			breast(1)	1	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCTGAAACTCTGCTGCTCAG	0.572			NA											9	15					0	0	1	0	0
GRM1	2911	broad.mit.edu	37	6	146351273	146351273	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:146351273C>G	uc010khw.1	+	2	1090	c.620C>G	c.(619-621)TCT>TGT	p.S207C	GRM1_uc010khu.1_Missense_Mutation_p.S207C|GRM1_uc010khv.1_Missense_Mutation_p.S207C|GRM1_uc003qll.2_Missense_Mutation_p.S207C|GRM1_uc011edz.1_Missense_Mutation_p.S207C|GRM1_uc011eea.1_Missense_Mutation_p.S207C	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	207	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	GTTGTCCCTTCTGACACTTTG	0.478			NA											20	60					0	0	1	0	0
PLEKHG1	57480	broad.mit.edu	37	6	151089832	151089832	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:151089832C>T	uc003qny.1	+	4	782	c.470C>T	c.(469-471)TCA>TTA	p.S157L	PLEKHG1_uc011eel.1_Missense_Mutation_p.S197L|PLEKHG1_uc011eem.1_Missense_Mutation_p.S216L|PLEKHG1_uc003qnz.2_Missense_Mutation_p.S157L	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G	157	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GAAGAAAGATCAGCCCTTTTT	0.393			NA											3	20					0	0	1	0	0
HOXA1	3198	broad.mit.edu	37	7	27134880	27134880	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:27134880C>A	uc003sye.2	-	1	746	c.652G>T	c.(652-654)GGG>TGG	p.G218W	HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	NM_005522	NP_005513	P49639	HXA1_HUMAN	homeobox A1 isoform a	218						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						CAGGACTGACCTGTTTTGGGA	0.463			NA											9	18					0.000673444	0.000693976	1	1	0
COBL	23242	broad.mit.edu	37	7	51096213	51096213	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:51096213C>G	uc003tpr.3	-	10	2765	c.2580G>C	c.(2578-2580)CAG>CAC	p.Q860H	COBL_uc003tps.2_Missense_Mutation_p.Q917H|COBL_uc011kcl.1_Missense_Mutation_p.Q860H|COBL_uc003tpp.3_Missense_Mutation_p.Q646H|COBL_uc003tpq.3_Missense_Mutation_p.Q801H|COBL_uc003tpo.3_Missense_Mutation_p.Q402H	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	860										skin(3)|ovary(2)	5	Glioma(55;0.08)					ACGTTCTTCTCTGAGGCTTGA	0.587	NSCLC(189;2119 2138 12223 30818 34679)		NA											32	37					0	0	1	0	0
COBL	23242	broad.mit.edu	37	7	51096593	51096593	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:51096593C>T	uc003tpr.3	-	10	2385	c.2200G>A	c.(2200-2202)GAC>AAC	p.D734N	COBL_uc003tps.2_Missense_Mutation_p.D791N|COBL_uc011kcl.1_Missense_Mutation_p.D734N|COBL_uc003tpp.3_Missense_Mutation_p.D520N|COBL_uc003tpq.3_Missense_Mutation_p.D675N|COBL_uc003tpo.3_Missense_Mutation_p.D276N	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	734										skin(3)|ovary(2)	5	Glioma(55;0.08)					CCCAGCTCGTCAATCTTAATG	0.507	NSCLC(189;2119 2138 12223 30818 34679)		NA											14	30					0	0	1	0	0
SAMD9L	219285	broad.mit.edu	37	7	92763767	92763767	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:92763767G>A	uc003umh.1	-	5	2734	c.1518C>T	c.(1516-1518)AGC>AGT	p.S506S	SAMD9L_uc003umj.1_Silent_p.S506S|SAMD9L_uc003umi.1_Silent_p.S506S|SAMD9L_uc010lfb.1_Silent_p.S506S|SAMD9L_uc003umk.1_Silent_p.S506S|SAMD9L_uc010lfc.1_Silent_p.S506S|SAMD9L_uc010lfd.1_Silent_p.S506S|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	506										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TATATGTCTCGCTTTTCAGGT	0.378			NA											38	70					0	0	1	0	0
SLC12A9	56996	broad.mit.edu	37	7	100457570	100457570	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:100457570G>C	uc003uwp.2	+	8	1183	c.1041G>C	c.(1039-1041)TTG>TTC	p.L347F	SLC12A9_uc003uwq.2_Missense_Mutation_p.L258F|SLC12A9_uc011kki.1_5'UTR|SLC12A9_uc003uwr.2_Missense_Mutation_p.L83F|SLC12A9_uc003uws.2_5'UTR|SLC12A9_uc003uwt.2_Missense_Mutation_p.L83F|SLC12A9_uc003uwv.2_5'UTR	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	347	Helical; (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CACTGGTGTTGATCGGAATCT	0.597			NA											25	53					0	0	1	0	0
OR2F2	135948	broad.mit.edu	37	7	143633081	143633081	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:143633081C>T	uc011ktv.1	+	1	756	c.756C>T	c.(754-756)TAC>TAT	p.Y252Y		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	252	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					CCCTGTGCTACGGCACAACGA	0.512			NA											22	42					0	0	1	0	0
NPM2	10361	broad.mit.edu	37	8	21890671	21890671	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr8:21890671C>T	uc003xab.2	+	5	959	c.301C>T	c.(301-303)CCA>TCA	p.P101S	NPM2_uc003xac.2_Missense_Mutation_p.P101S|NPM2_uc003xad.2_Missense_Mutation_p.P101S|NPM2_uc003xae.2_Missense_Mutation_p.P101S|NPM2_uc003xaf.2_Missense_Mutation_p.P101S	NM_182795	NP_877724	Q86SE8	NPM2_HUMAN	nucleoplasmin 2	101					chromatin remodeling|embryo development|oocyte differentiation|positive regulation of meiosis|regulation of exit from mitosis|single fertilization	cytoplasmic chromatin|nuclear chromatin	histone binding|nucleic acid binding				0				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		GCTTTCTCCCCCAGTTACTTT	0.597			NA											8	44					0	0	1	0	0
RAD54B	25788	broad.mit.edu	37	8	95406084	95406084	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr8:95406084C>G	uc003ygk.2	-	9	1503	c.1405G>C	c.(1405-1407)GAA>CAA	p.E469Q	RAD54B_uc010may.1_Missense_Mutation_p.E276Q|RAD54B_uc003ygl.1_RNA	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:Variant_position_missing_in_O95073_after_alignment					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GCAAAAAATTCTTGCAGATCA	0.318			NA						Direct_reversal_of_damage|Homologous_recombination					29	57					0	0	1	0	0
CYP11B1	1584	broad.mit.edu	37	8	143958264	143958264	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr8:143958264C>G	uc003yxi.2	-	4	640	c.633G>C	c.(631-633)CTG>CTC	p.L211L	CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Silent_p.L211L|CYP11B1_uc010mey.2_Silent_p.L282L	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	211					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	TGTGGCCAACCAGGCCCAGCC	0.627			NA							Familial_Hyperaldosteronism_type_I				8	13					0	0	1	0	0
MPDZ	8777	broad.mit.edu	37	9	13126722	13126722	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr9:13126722C>G	uc010mia.1	-	32	4571	c.4514G>C	c.(4513-4515)GGA>GCA	p.G1505A	MPDZ_uc003zky.3_Missense_Mutation_p.G67A|MPDZ_uc010mib.2_Missense_Mutation_p.G210A|MPDZ_uc010mhx.2_Missense_Mutation_p.G327A|MPDZ_uc011lmm.1_Missense_Mutation_p.G364A|MPDZ_uc003zkz.3_Missense_Mutation_p.G198A|MPDZ_uc010mhy.2_Missense_Mutation_p.G1505A|MPDZ_uc010mhz.2_Missense_Mutation_p.G1472A|MPDZ_uc011lmn.1_Missense_Mutation_p.G1472A|MPDZ_uc003zlb.3_Missense_Mutation_p.G1505A	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1505	PDZ 9.				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		TATGATGACTCCACTGAGTGT	0.408			NA											5	14					0	0	1	0	0
DMD	1756	broad.mit.edu	37	X	31279101	31279101	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:31279101G>T	uc004dda.1	-	63	9501	c.9257C>A	c.(9256-9258)CCC>CAC	p.P3086H	DMD_uc004dcq.1_Missense_Mutation_p.P357H|DMD_uc004dcr.1_Missense_Mutation_p.P626H|DMD_uc004dcs.1_Missense_Mutation_p.P626H|DMD_uc004dct.1_Missense_Mutation_p.P626H|DMD_uc004dcu.1_Missense_Mutation_p.P626H|DMD_uc004dcv.1_Missense_Mutation_p.P626H|DMD_uc004dcw.2_Missense_Mutation_p.P1742H|DMD_uc004dcx.2_Missense_Mutation_p.P1745H|DMD_uc004dcz.2_Missense_Mutation_p.P2963H|DMD_uc004dcy.1_Missense_Mutation_p.P3082H|DMD_uc004ddb.1_Missense_Mutation_p.P3078H|DMD_uc004dcm.1_Missense_Mutation_p.P18H|DMD_uc004dcn.1_Missense_Mutation_p.P18H|DMD_uc004dco.1_Missense_Mutation_p.P18H|DMD_uc004dcp.1_Missense_Mutation_p.P18H|DMD_uc011mkb.1_Missense_Mutation_p.P18H|DMD_uc010ngm.2_Missense_Mutation_p.P18H	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3086	Interaction with SYNM (By similarity).|WW.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGTCATTTTGGGATGGTCCCA	0.393			NA											17	28					1.00905e-13	1.11457e-13	1	1	0
HDAC6	10013	broad.mit.edu	37	X	48681322	48681322	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:48681322A>G	uc011mmi.1	+	25	2608	c.2513A>G	c.(2512-2514)AAG>AGG	p.K838R	HDAC6_uc004dks.1_Missense_Mutation_p.K838R|HDAC6_uc010nig.1_Missense_Mutation_p.K686R|HDAC6_uc004dkt.1_Missense_Mutation_p.K838R|HDAC6_uc011mmk.1_Missense_Mutation_p.K819R|HDAC6_uc004dkv.1_Missense_Mutation_p.K486R|HDAC6_uc004dkw.1_Missense_Mutation_p.K486R|HDAC6_uc004dkx.1_Missense_Mutation_p.K201R	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	838					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	CTGGTTCCAGAGGTAGAAGAC	0.572	Pancreas(112;205 1675 2305 8976 15959)		NA											3	24					0	0	1	0	0
TRO	7216	broad.mit.edu	37	X	54950106	54950106	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:54950106C>G	uc004dtq.2	+	3	1248	c.1141C>G	c.(1141-1143)CAG>GAG	p.Q381E	TRO_uc011moj.1_Missense_Mutation_p.Q324E|TRO_uc004dts.2_Missense_Mutation_p.Q381E|TRO_uc004dtr.2_Missense_Mutation_p.Q381E|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Intron|TRO_uc004dtw.2_Intron|TRO_uc004dtx.2_5'Flank	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	381					embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						CCTTGAGACTCAGGTTGCTGC	0.577			NA											6	18					0	0	1	0	0
ZXDA	7789	broad.mit.edu	37	X	57935303	57935303	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:57935303A>T	uc004dve.2	-	1	1765	c.1552T>A	c.(1552-1554)TGT>AGT	p.C518S		NM_007156	NP_009087	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	518	Required for interaction with ZXDC.|C2H2-type 9.				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						AACCTGGCACAGCAGCCTGCC	0.542			NA											19	24					0	0	1	0	0
KIAA2022	340533	broad.mit.edu	37	X	73964097	73964097	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:73964097T>C	uc004eby.2	-	3	912	c.295A>G	c.(295-297)ATC>GTC	p.I99V		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	99					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GTGAGGGAGATGGCATTCACA	0.517			NA											4	85					0	0	1	0	0
NRK	203447	broad.mit.edu	37	X	105167115	105167115	+	Silent	SNP	A	A	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:105167115A>T	uc004emd.2	+	18	2919	c.2616A>T	c.(2614-2616)CCA>CCT	p.P872P	NRK_uc010npc.1_Silent_p.P540P	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	872							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CACAGGTTCCAGATGGATTTA	0.363			NA								HNSCC(51;0.14)			44	83					0	0	1	0	0
DOCK11	139818	broad.mit.edu	37	X	117788871	117788871	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:117788871C>T	uc004eqp.2	+	44	4979	c.4916C>T	c.(4915-4917)GCG>GTG	p.A1639V	DOCK11_uc004eqq.2_Missense_Mutation_p.A1418V	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1639	DHR-2.				blood coagulation	cytosol	GTP binding			ovary(3)	3						TTTCAGGCTGCGATGTGTTAT	0.378			NA											43	76					0	0	1	0	0
SLC9A6	10479	broad.mit.edu	37	X	135115594	135115594	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:135115594A>G	uc004ezj.2	+	14	1649	c.1573A>G	c.(1573-1575)AGA>GGA	p.R525G	SLC9A6_uc004ezk.2_Missense_Mutation_p.R557G	NM_006359	NP_006350	Q92581	SL9A6_HUMAN	solute carrier family 9 (sodium/hydrogen	525					regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					AAATGAAAGGAGAACTACCAA	0.353			NA											45	83					0	0	1	0	0
CD99L2	83692	broad.mit.edu	37	X	149944650	149944650	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:149944650G>A	uc004fel.2	-	9	770	c.652C>T	c.(652-654)CAG>TAG	p.Q218*	CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Nonsense_Mutation_p.Q169*|CD99L2_uc004fen.2_Nonsense_Mutation_p.Q146*|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Nonsense_Mutation_p.Q145*	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4	218	Cytoplasmic (Potential).				cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CACTTACGCTGAATGCTGAAG	0.612			NA											21	43					0	0	1	0	0
MAGEA10	4109	broad.mit.edu	37	X	151303180	151303180	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:151303180C>T	uc004ffk.2	-	5	1321	c.913G>A	c.(913-915)GAA>AAA	p.E305K	MAGEA10_uc004ffl.2_Missense_Mutation_p.E305K	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	305	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTAATTTCAGCATGAGCC	0.502			NA											7	179					0	0	1	0	0
ARNT	405	broad.mit.edu	37	1	150789333	150789333	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:150789333delG	uc001evr.1	-	18	1876	c.1733delC	c.(1732-1734)CCTfs	p.P578fs	ARNT_uc010pck.1_Frame_Shift_Del_p.P67fs|ARNT_uc001evs.1_Frame_Shift_Del_p.P563fs|ARNT_uc009wmb.1_Frame_Shift_Del_p.P564fs|ARNT_uc009wmc.1_Frame_Shift_Del_p.P578fs|ARNT_uc009wmd.1_Frame_Shift_Del_p.P563fs	NM_001668	NP_001659	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	578					positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity			skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTGGGTGGCAGGGACAGTGCT	0.537			NA	T	ETV6	AML								24	60	---	---	---	---	NA	NA	NA	NA	NA
FASLG	356	broad.mit.edu	37	1	172633495	172633495	+	Frame_Shift_Del	DEL	A	A	-	rs35774809		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:172633495delA	uc001gis.2	+	3	573	c.416delA	c.(415-417)GAAfs	p.E139fs	FASLG_uc001git.2_Frame_Shift_Del_p.K124fs	NM_000639	NP_000630	P48023	TNFL6_HUMAN	fas ligand	139	Extracellular (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of necroptosis by extracellular signals|induction of necroptosis of activated-T cells|necrotic cell death|negative regulation of angiogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane	cytokine activity			lung(2)|breast(1)	3						CCACCCCCTGAAAAAAAGGAG	0.408	Ovarian(28;486 876 30334 44033)		NA											17	55	---	---	---	---	NA	NA	NA	NA	NA
RYR2	6262	broad.mit.edu	37	1	237972262	237972263	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:237972262_237972263insT	uc001hyl.1	+	100	14480_14481	c.14360_14361insT	c.(14359-14361)AATfs	p.N4787fs	RYR2_uc010pyb.1_Frame_Shift_Ins_p.N220fs	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4787					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGGCATTCAATTTTTTCCGAA	0.356			NA											7	336	---	---	---	---	NA	NA	NA	NA	NA
SLC5A12	159963	broad.mit.edu	37	11	26725075	26725076	+	Splice_Site	INS	-	-	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:26725075_26725076insA	uc001mra.2	-	6	1134	c.821_splice	c.e6+1	p.L274_splice	SLC5A12_uc001mrb.2_Splice_Site|SLC5A12_uc001mrc.3_Splice_Site_p.L274_splice	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						ACTGAGAACTTACAGCTTAGCA	0.327			NA											39	63	---	---	---	---	NA	NA	NA	NA	NA
MLL	4297	broad.mit.edu	37	11	118363894	118363894	+	Frame_Shift_Del	DEL	A	A	-			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:118363894delA	uc001pta.2	+	16	5141	c.5118delA	c.(5116-5118)TTAfs	p.L1706fs	MLL_uc001ptb.2_Frame_Shift_Del_p.L1709fs	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1706	Bromo; divergent.				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		AGCAGCCTTTAGATCTAGAAG	0.478			NA	T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								33	58	---	---	---	---	NA	NA	NA	NA	NA
ADAM6	8755	broad.mit.edu	37	14	106774086	106774087	+	Splice_Site	INS	-	-	AGTAATACACGGCA			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:106774086_106774087insAGTAATACACGGCA	uc010tyt.1	-	430		c.15674_splice	c.e430+1							Parts of antibodies, mostly variable regions.												0						GCCTCTTGCACGTGTCCTCAGC	0.55			NA											4	7	---	---	---	---	NA	NA	NA	NA	NA
RANGRF	29098	broad.mit.edu	37	17	8192632	8192661	+	In_Frame_Del	DEL	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	-	rs138959557	byFrequency	TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	-	-	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:8192632_8192661delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	uc002gkv.2	+	3	369_398	c.251_280delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	c.(250-282)TCTGTTCAGCCTCTCAGTTTGGAGAACCTGGCC>TCC	p.VQPLSLENLA85del	SLC25A35_uc002gku.1_3'UTR|SLC25A35_uc002gkt.2_Intron|RANGRF_uc002gkw.2_In_Frame_Del_p.VQPLSLENLA85del|RANGRF_uc002gky.2_In_Frame_Del_p.VQPLSLENLA85del|RANGRF_uc002gkx.2_In_Frame_Del_p.VQPLSLENLA85del|SLC25A35_uc002gkz.1_RNA	NM_016492	NP_057576	Q9HD47	MOG1_HUMAN	RAN guanine nucleotide release factor	85_94				ALR -> PE (in Ref. 3; AAF36156).	protein transport	cytoplasm|nucleus	guanyl-nucleotide exchange factor activity				0						CATGTGGAGTCTGTTCAGCCTCTCAGTTTGGAGAACCTGGCCCTGAGGGG	0.591			NA											10	76	---	---	---	---	NA	NA	NA	NA	NA
ERBB2	2064	broad.mit.edu	37	17	37880981	37880982	+	In_Frame_Ins	INS	-	-	GCATACGTGATG			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:37880981_37880982insGCATACGTGATG	uc002hso.2	+	20	2548_2549	c.2310_2311insGCATACGTGATG	c.(2308-2313)insGCATACGTGATG	p.774_775insAYVM	ERBB2_uc002hsm.2_In_Frame_Ins_p.744_745insAYVM|ERBB2_uc010cwa.2_In_Frame_Ins_p.759_760insAYVM|ERBB2_uc002hsp.2_In_Frame_Ins_p.577_578insAYVM|ERBB2_uc010cwb.2_In_Frame_Ins_p.774_775insAYVM|ERBB2_uc010wek.1_In_Frame_Ins_p.498_499insAYVM	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	774_775	Cytoplasmic (Potential).|Protein kinase.				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.M774_A775insAYVM(24)		lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	GTCCCCAGGAAGCATACGTGAT	0.594			1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			11	72	---	---	---	---	NA	NA	NA	NA	NA
NFKBIZ	64332	broad.mit.edu	37	3	101571949	101571950	+	Frame_Shift_Ins	INS	-	-	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:101571949_101571950insC	uc003dvp.2	+	5	694_695	c.579_580insC	c.(577-582)ACACCAfs	p.T193fs	NFKBIZ_uc003dvo.2_Frame_Shift_Ins_p.T93fs|NFKBIZ_uc010hpo.2_Frame_Shift_Ins_p.T93fs|NFKBIZ_uc003dvq.2_Frame_Shift_Ins_p.T193fs	NM_031419	NP_113607	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene	193_194					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(2)	2						CACCTCAAACACCAACGCCCGG	0.421			NA											23	16	---	---	---	---	NA	NA	NA	NA	NA
UBQLN1	29979	broad.mit.edu	37	9	86279969	86279970	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr9:86279969_86279970insT	uc004amv.2	-	9	1997_1998	c.1423_1424insA	c.(1423-1425)ACGfs	p.T475fs	UBQLN1_uc004amw.2_Frame_Shift_Ins_p.T447fs	NM_013438	NP_038466	Q9UMX0	UBQL1_HUMAN	ubiquilin 1 isoform 1	475					apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0						CGGGGCTTCCGTTGCTAATGTC	0.421	Melanoma(186;1284 2073 12755 14558 18426)		NA											13	15	---	---	---	---	NA	NA	NA	NA	NA
