Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
RAP1GAP	5909	broad.mit.edu	37	1	21940151	21940151	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:21940151G>A	uc001bex.2	-	9	702	c.444C>T	c.(442-444)ACC>ACT	p.T148T	RAP1GAP_uc001bev.2_Silent_p.T148T|RAP1GAP_uc001bew.2_Silent_p.T212T|RAP1GAP_uc001bey.2_Silent_p.T148T	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c	148					regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		TAGGGAACTCGGTGAGGCAGG	0.582			NA											13	88					0	0	0.016723	0	0
ZCCHC11	23318	broad.mit.edu	37	1	52911672	52911672	+	Silent	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:52911672A>G	uc001ctx.2	-	23	3930	c.3696T>C	c.(3694-3696)CCT>CCC	p.P1232P	ZCCHC11_uc001cty.2_Silent_p.P1232P|ZCCHC11_uc001ctz.2_Silent_p.P1232P|ZCCHC11_uc009vze.1_Silent_p.P1232P|ZCCHC11_uc001cua.1_Silent_p.P149P	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	1232	PAP-associated 2.				miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						TCAAGTCAAAAGGGTCTACAA	0.303			NA											3	60					0	0	0.009096	0	0
NFIA	4774	broad.mit.edu	37	1	61554263	61554263	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:61554263C>G	uc001czw.2	+	2	954	c.470C>G	c.(469-471)TCT>TGT	p.S157C	NFIA_uc001czy.2_Missense_Mutation_p.S149C|NFIA_uc010oos.1_Missense_Mutation_p.S202C|NFIA_uc001czv.2_Missense_Mutation_p.S157C	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1	157	CTF/NF-I.				DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						CCACAATGCTCTAATCCAGGG	0.453			NA											3	100					0	0	0.004672	0	0
AGL	178	broad.mit.edu	37	1	100346852	100346852	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:100346852C>T	uc001dsi.1	+	16	2406	c.2006C>T	c.(2005-2007)TCA>TTA	p.S669L	AGL_uc001dsj.1_Missense_Mutation_p.S669L|AGL_uc001dsk.1_Missense_Mutation_p.S669L|AGL_uc001dsl.1_Missense_Mutation_p.S669L|AGL_uc001dsm.1_Missense_Mutation_p.S653L|AGL_uc001dsn.1_Missense_Mutation_p.S652L	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	669	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GTCCAGATTTCAGTGGTTTCT	0.358			NA											17	74					0	0	0.004007	0	0
AGL	178	broad.mit.edu	37	1	100346961	100346961	+	Silent	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:100346961C>A	uc001dsi.1	+	16	2515	c.2115C>A	c.(2113-2115)ATC>ATA	p.I705I	AGL_uc001dsj.1_Silent_p.I705I|AGL_uc001dsk.1_Silent_p.I705I|AGL_uc001dsl.1_Silent_p.I705I|AGL_uc001dsm.1_Silent_p.I689I|AGL_uc001dsn.1_Silent_p.I688I	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	705	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GGTGTGCTATCAGTAAACTTC	0.393			NA											20	85					0.00152264	0.00178165	0.010504	1	0
AMPD2	271	broad.mit.edu	37	1	110168292	110168292	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:110168292C>G	uc009wfh.1	+	4	935	c.393C>G	c.(391-393)TTC>TTG	p.F131L	AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.F50L|AMPD2_uc001dyc.1_Missense_Mutation_p.F131L|AMPD2_uc010ovr.1_Missense_Mutation_p.F56L|AMPD2_uc010ovs.1_Missense_Mutation_p.F13L|AMPD2_uc001dyd.1_Missense_Mutation_p.F12L	NM_004037	NP_004028	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2 (isoform L)	131					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|breast(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		AGGAGCTGTTCACCCGCTCAC	0.672			NA											7	34					0	0	0.001984	0	0
BAT2L2	23215	broad.mit.edu	37	1	171506560	171506560	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:171506560G>A	uc010pmg.1	+	15	2712	c.2446G>A	c.(2446-2448)GAG>AAG	p.E816K	BAT2L2_uc010pmh.1_5'Flank	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	816							protein C-terminus binding				0						TCCTCATGCTGAGCCTCAACA	0.408			NA											3	9					0	0	0.004672	0	0
C1orf26	54823	broad.mit.edu	37	1	185153948	185153948	+	Silent	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:185153948A>G	uc001grg.3	+	9	1428	c.1314A>G	c.(1312-1314)CTA>CTG	p.L438L	C1orf26_uc001grh.3_Silent_p.L438L	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	438	PINc.										0						AAGGAAAACTACTAAAACGTG	0.363			NA											22	88					0	0	0.004656	0	0
NLRP3	114548	broad.mit.edu	37	1	247588432	247588432	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:247588432G>A	uc001icr.2	+	5	1825	c.1687G>A	c.(1687-1689)GAA>AAA	p.E563K	NLRP3_uc001ics.2_Missense_Mutation_p.E563K|NLRP3_uc001icu.2_Missense_Mutation_p.E563K|NLRP3_uc001icw.2_Missense_Mutation_p.E563K|NLRP3_uc001icv.2_Missense_Mutation_p.E563K|NLRP3_uc010pyw.1_Missense_Mutation_p.E561K|NLRP3_uc001ict.1_Missense_Mutation_p.E561K	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	563					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	p.E563K(1)		lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGTCCTTCTGGAAAACTATGG	0.478			NA											5	36					0	0	0.014758	0	0
ITIH5	80760	broad.mit.edu	37	10	7658063	7658063	+	Splice_Site	SNP	T	T	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:7658063T>C	uc001ijq.2	-	7	902	c.823_splice	c.e7-1	p.V275_splice	ITIH5_uc001ijp.2_Splice_Site_p.V61_splice|ITIH5_uc001ijr.1_Splice_Site_p.V275_splice	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						ATTTAGAACCTGGTGGAGGGA	0.423			NA											13	64					0	0	0.020292	0	0
ANKRD26	22852	broad.mit.edu	37	10	27382712	27382712	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:27382712C>G	uc001ith.2	-	2	431	c.259G>C	c.(259-261)GCC>CCC	p.A87P	ANKRD26_uc009xku.1_Missense_Mutation_p.A87P	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	87	ANK 2.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TTGGCACAGGCCAAATGTAGA	0.403			NA											20	72					0	0	0.010504	0	0
MAP3K8	1326	broad.mit.edu	37	10	30740626	30740626	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:30740626C>T	uc001ivi.1	+	6	1522	c.826C>T	c.(826-828)CAA>TAA	p.Q276*	MAP3K8_uc009xlf.1_Nonsense_Mutation_p.Q276*|MAP3K8_uc001ivj.1_Nonsense_Mutation_p.Q276*	NM_005204	NP_005195	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase	276	Protein kinase.				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			breast(3)|central_nervous_system(1)	4		Prostate(175;0.151)				CCTAAGTGTTCAAATGACCGA	0.308			NA											19	73					0	0	0.01892	0	0
RET	5979	broad.mit.edu	37	10	43615593	43615593	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:43615593C>A	uc001jal.2	+	15	2862	c.2672C>A	c.(2671-2673)TCG>TAG	p.S891*	RET_uc001jak.1_Nonsense_Mutation_p.S891*|RET_uc010qez.1_Nonsense_Mutation_p.S637*	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	891	Protein kinase.|Cytoplasmic (Potential).		S -> A (in MTC; familial form).		homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	ATGAAGATTTCGGATTTCGGC	0.567	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				7	28					2.17888e-05	2.61696e-05	0.006214	1	0
GDF10	2662	broad.mit.edu	37	10	48429252	48429252	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:48429252C>T	uc001jfb.2	-	2	1090	c.634G>A	c.(634-636)GCG>ACG	p.A212T	GDF10_uc009xnp.2_Missense_Mutation_p.A211T|GDF10_uc009xnq.1_Missense_Mutation_p.A212T	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	212					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2						CGGCGGGCCGCCTTGACGATG	0.726			NA											4	23					0	0	0.009096	0	0
ZMIZ1	57178	broad.mit.edu	37	10	81037046	81037046	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:81037046G>A	uc001kaf.2	+	8	961	c.389G>A	c.(388-390)AGC>AAC	p.S130N	ZMIZ1_uc001kag.2_Missense_Mutation_p.S6N|ZMIZ1_uc001kah.1_Missense_Mutation_p.S6N	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	130					transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCCCCTCTCAGCTCCATGAGC	0.617			NA											6	30					0	0	0.001168	0	0
SLK	9748	broad.mit.edu	37	10	105727608	105727608	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:105727608G>C	uc001kxo.1	+	1	139	c.105G>C	c.(103-105)GAG>GAC	p.E35D	SLK_uc001kxp.1_Missense_Mutation_p.E35D	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	35	Protein kinase.				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		ACTTTTGGGAGATTATAGGAG	0.498	NSCLC(111;540 1651 1927 4474 17706)		NA											5	108					0	0	0.014758	0	0
HTRA1	5654	broad.mit.edu	37	10	124248444	124248444	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:124248444C>T	uc001lgj.2	+	2	627	c.499C>T	c.(499-501)CAT>TAT	p.H167Y		NM_002775	NP_002766	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1 precursor	167					proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				CAGTTTGCGCCATAAATATAA	0.448			NA											25	128					0	0	0.008361	0	0
SMPD1	6609	broad.mit.edu	37	11	6413070	6413070	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:6413070C>G	uc001mcw.2	+	2	949	c.775C>G	c.(775-777)CTG>GTG	p.L259V	SMPD1_uc001mcv.1_Intron|SMPD1_uc009yex.2_RNA|SMPD1_uc001mcx.2_Missense_Mutation_p.L259V|SMPD1_uc009yew.2_Missense_Mutation_p.L258V	NM_000543	NP_000534	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid	257					cell death|ceramide biosynthetic process|negative regulation of MAP kinase activity|nervous system development|positive regulation of protein dephosphorylation|signal transduction|sphingomyelin catabolic process|termination of signal transduction	lysosome	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Desipramine(DB01151)	CCTGAGGACCCTGGAGAGCCT	0.647			NA											23	80					0	0	0.014323	0	0
DBX1	120237	broad.mit.edu	37	11	20178619	20178619	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:20178619C>G	uc001mpw.1	-	3	636	c.636G>C	c.(634-636)AAG>AAC	p.K212N		NM_001029865	NP_001025036	A6NMT0	DBX1_HUMAN	developing brain homeobox 1	212	Homeobox.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCGCCAGCTTCTTGCGGTCGG	0.667			NA											16	40					0	0	0.00499	0	0
SPRYD5	84767	broad.mit.edu	37	11	55658753	55658753	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:55658753C>G	uc010rip.1	+	7	1096	c.1004C>G	c.(1003-1005)GCT>GGT	p.A335G	SPRYD5_uc010riq.1_Missense_Mutation_p.A192G	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	335	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				GGGGCTCAGGCTTTCACATCT	0.423			NA											37	157					0	0	0.019004	0	0
SRPR	6734	broad.mit.edu	37	11	126135202	126135202	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:126135202G>A	uc001qdh.2	-	10	1323	c.1272C>T	c.(1270-1272)TGC>TGT	p.C424C	SRPR_uc010sbm.1_Silent_p.C396C	NM_003139	NP_003130	P08240	SRPR_HUMAN	signal recognition particle receptor	424					SRP-dependent cotranslational protein targeting to membrane	integral to membrane|signal recognition particle receptor complex	GTP binding|GTPase activity|receptor activity|signal recognition particle binding				0	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		CATTAACGCCGCAGAAGGTGA	0.532			NA											12	59					0	0	0.016723	0	0
TMEM45B	120224	broad.mit.edu	37	11	129724602	129724602	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:129724602G>A	uc001qfe.1	+	3	337	c.276G>A	c.(274-276)ATG>ATA	p.M92I	TMEM45B_uc001qff.1_Missense_Mutation_p.M92I	NM_138788	NP_620143	Q96B21	TM45B_HUMAN	transmembrane protein 45B	92						integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)		ACAGCACCATGTACCTATTCT	0.517			NA											5	94					0	0	0.014758	0	0
RERGL	79785	broad.mit.edu	37	12	18234236	18234236	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:18234236G>C	uc001rdq.2	-	6	701	c.507C>G	c.(505-507)ATC>ATG	p.I169M	RERGL_uc001rdr.2_Missense_Mutation_p.I168M	NM_024730	NP_079006	Q9H628	RERGL_HUMAN	RERG/RAS-like	169	Small GTPase-like.				signal transduction	membrane	GTP binding|GTPase activity				0						GGATGTCCTTGATAATTCTGA	0.408			NA											10	150					0	0	0.008291	0	0
SLCO1B1	10599	broad.mit.edu	37	12	21349967	21349967	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:21349967C>G	uc001req.3	+	8	919	c.815C>G	c.(814-816)TCT>TGT	p.S272C		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	272	Helical; Name=6; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	TCCATTATTTCTTCCATACCA	0.378			NA											7	340					0	0	0.00308	0	0
IAPP	3375	broad.mit.edu	37	12	21526328	21526328	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:21526328G>A	uc001rev.2	+	2	195	c.43G>A	c.(43-45)GTT>ATT	p.V15I	SLCO1A2_uc001res.2_Intron|SLCO1A2_uc010siq.1_Intron	NM_000415	NP_000406	P10997	IAPP_HUMAN	islet amyloid polypeptide precursor	15					apoptosis|cell-cell signaling|endocrine pancreas development|signal transduction	extracellular region|soluble fraction	hormone activity				0					Perindopril(DB00790)	TGTGCTCTCTGTTGCATTGAA	0.348			NA											11	211					0	0	0.004007	0	0
ITPR2	3709	broad.mit.edu	37	12	26629850	26629850	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:26629850C>G	uc001rhg.2	-	44	6631	c.6214G>C	c.(6214-6216)GAA>CAA	p.E2072Q	ITPR2_uc009zjg.1_Missense_Mutation_p.E223Q	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	2072	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CTTACCAGTTCTCTGGGTCTC	0.343			NA											8	136					0	0	0.00308	0	0
Unknown	0	broad.mit.edu	37	12	31301016	31301016	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:31301016C>G	uc010sjy.1	-	11	1244	c.1244G>C	c.(1243-1245)TGG>TCG	p.W415S						RecName: Full=Ovostatin homolog 1; Flags: Precursor;												NA						AGGCGTCAACCAGCTGGGAAG	0.458			NA											28	409					0	0	0.004656	0	0
ABCD2	225	broad.mit.edu	37	12	40012767	40012767	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:40012767G>T	uc001rmb.2	-	1	1077	c.651C>A	c.(649-651)TTC>TTA	p.F217L		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	217	ABC transmembrane type-1.|Interaction with PEX19.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						CAGATTGGGAGAACATCATAA	0.393			NA											29	61					7.26314e-15	8.96051e-15	0.007291	1	0
LRRK2	120892	broad.mit.edu	37	12	40734215	40734215	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:40734215A>G	uc001rmg.3	+	41	6189	c.6068A>G	c.(6067-6069)TAC>TGC	p.Y2023C	LRRK2_uc009zjw.2_Missense_Mutation_p.Y861C|LRRK2_uc001rmi.2_Missense_Mutation_p.Y856C	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2023	Protein kinase.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATTGCTCAGTACTGCTGTAGA	0.453			NA											20	142					0	0	0.012319	0	0
CNTN1	1272	broad.mit.edu	37	12	41463834	41463834	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:41463834C>T	uc001rmm.1	+	24	3167	c.3054C>T	c.(3052-3054)TTC>TTT	p.F1018F	CNTN1_uc001rmn.1_Silent_p.F1007F	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	1018					axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ACTTGGAATTCTGAATGTGTT	0.507			NA											9	92					0	0	0.004482	0	0
DHH	50846	broad.mit.edu	37	12	49485111	49485111	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:49485111C>T	uc001rtf.2	-	2	672	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_021044	NP_066382	O43323	DHH_HUMAN	desert hedgehog preproprotein	122					cell-cell signaling|proteolysis	extracellular space|plasma membrane	calcium ion binding|peptidase activity|zinc ion binding			lung(1)|breast(1)	2						CACTCGTAGGCGCACTCCGGG	0.607			NA											8	101					0	0	0.00308	0	0
OR6C68	403284	broad.mit.edu	37	12	55886877	55886877	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:55886877G>A	uc010spo.1	+	1	731	c.731G>A	c.(730-732)TGT>TAT	p.C244Y		NM_001005519	NP_001005519	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C,	239	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TTTTCTACCTGTTCTTCACAT	0.343			NA											11	55					0	0	0.008291	0	0
SLC39A5	283375	broad.mit.edu	37	12	56630228	56630228	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:56630228C>T	uc010sqj.1	+	9	1251	c.994C>T	c.(994-996)CCG>TCG	p.P332S	SLC39A5_uc010sqk.1_Missense_Mutation_p.P332S	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion	332	Cytoplasmic (Potential).				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						CAACTTGGATCCGGAGAATGG	0.542			NA											38	127					0	0	0.010771	0	0
GEFT	115557	broad.mit.edu	37	12	58007142	58007142	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:58007142G>A	uc001spb.2	+	3	868	c.408G>A	c.(406-408)CAG>CAA	p.Q136Q	GEFT_uc009zpy.2_Silent_p.Q175Q|GEFT_uc001soz.1_Intron|GEFT_uc001spa.2_Silent_p.Q30Q|uc001spc.2_RNA|GEFT_uc001spd.2_5'Flank	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1	136					regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					ATAAGACGCAGGTGTGAGGAC	0.567			NA											5	176					0	0	0.014758	0	0
GEFT	115557	broad.mit.edu	37	12	58007229	58007229	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:58007229G>T	uc001spb.2	+	4	875	c.415G>T	c.(415-417)GAA>TAA	p.E139*	GEFT_uc009zpy.2_Nonsense_Mutation_p.E178*|GEFT_uc001soz.1_Nonsense_Mutation_p.E13*|GEFT_uc001spa.2_Nonsense_Mutation_p.E33*|uc001spc.2_RNA|GEFT_uc001spd.2_5'Flank	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1	139					regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					CCAGCCACCTGAAGAGGAGAC	0.537			NA											10	371					6.40141e-05	7.60796e-05	0.010729	1	0
TSPAN31	6302	broad.mit.edu	37	12	58140859	58140859	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:58140859C>T	uc001spt.2	+	5	657	c.503C>T	c.(502-504)TCA>TTA	p.S168L	TSPAN31_uc009zqb.2_Missense_Mutation_p.S84L|TSPAN31_uc010ssa.1_Missense_Mutation_p.S90L	NM_005981	NP_005972	Q12999	TSN31_HUMAN	sarcoma amplified sequence	168	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction					0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CTTAAGCATTCAGACGAAGCC	0.443			NA											12	366					0	0	0.020292	0	0
LGR5	8549	broad.mit.edu	37	12	71977945	71977945	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:71977945G>A	uc001swl.2	+	18	2203	c.2155G>A	c.(2155-2157)GAG>AAG	p.E719K	LGR5_uc001swm.2_Missense_Mutation_p.E695K|LGR5_uc001swn.1_Intron	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	719	Extracellular (Potential).					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						GCCTTTTGGGGAGCCCAGCAC	0.567			NA											20	238					0	0	0.010504	0	0
SNRNP35	11066	broad.mit.edu	37	12	123950180	123950180	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:123950180C>T	uc001ufb.1	+	2	209	c.93C>T	c.(91-93)GTC>GTT	p.V31V	SNRNP35_uc010tar.1_Silent_p.V36V|SNRNP35_uc009zxz.2_Silent_p.V36V|SNRNP35_uc001ufc.1_Intron	NM_022717	NP_073208	Q16560	U1SBP_HUMAN	small nuclear ribonucleoprotein 35kDa (U11/U12)	31					mRNA processing	U12-type spliceosomal complex	nucleotide binding|RNA binding				0						ACCGCGCGGTCTGGAGGGCAA	0.547			NA											17	43					0	0	0.007413	0	0
NAA16	79612	broad.mit.edu	37	13	41941661	41941661	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr13:41941661G>C	uc001uyf.2	+	14	1950	c.1626G>C	c.(1624-1626)TTG>TTC	p.L542F	NAA16_uc010tfg.1_RNA	NM_024561	NP_078837	Q6N069	NAA16_HUMAN	NMDA receptor regulated 1-like protein isoform	542					N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent	cytoplasm|transcription factor complex	binding			central_nervous_system(1)	1						TTGACCTTTTGAGATTAGAAG	0.343			NA											9	76					0	0	0.006214	0	0
NALCN	259232	broad.mit.edu	37	13	101756652	101756652	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr13:101756652T>C	uc001vox.1	-	25	3072	c.2883A>G	c.(2881-2883)ATA>ATG	p.I961M		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	961	Helical; Name=S3 of repeat III; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTACAAGATATATAAATATGT	0.363			NA											12	83					0	0	0.013537	0	0
COL4A2	1284	broad.mit.edu	37	13	111088678	111088678	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr13:111088678G>A	uc001vqx.2	+	13	1078	c.789G>A	c.(787-789)GCG>GCA	p.A263A		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	263	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CCATCATCGCGCCCACAGGAG	0.453			NA											14	44					0	0	0.004007	0	0
CHD8	57680	broad.mit.edu	37	14	21870611	21870611	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:21870611G>A	uc001was.1	-	19	3023	c.2929C>T	c.(2929-2931)CGC>TGC	p.R977C	CHD8_uc001war.1_Missense_Mutation_p.R873C|CHD8_uc001wav.1_Missense_Mutation_p.R419C	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1256	Helicase C-terminal.				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTGATGAGGCGGTACACCTTC	0.453			NA											7	56					0	0	0.001984	0	0
FERMT2	10979	broad.mit.edu	37	14	53331254	53331254	+	Silent	SNP	A	A	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:53331254A>C	uc001xad.2	-	12	1522	c.1467T>G	c.(1465-1467)GTT>GTG	p.V489V	FERMT2_uc001xac.2_Silent_p.V489V|FERMT2_uc001xae.2_Silent_p.V489V|FERMT2_uc001xaf.2_Silent_p.V489V	NM_006832	NP_006823	Q96AC1	FERM2_HUMAN	fermitin family homolog 2 isoform 1	489	FERM.				actin cytoskeleton organization|cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytosol|focal adhesion|stress fiber	binding				0	Breast(41;0.0342)					GAATATTCTGAACTTCTAAGT	0.423			NA											23	125					0	0	0.016522	0	0
EXOC5	10640	broad.mit.edu	37	14	57684737	57684737	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:57684737C>G	uc001xct.2	-	15	1827	c.1576G>C	c.(1576-1578)GAA>CAA	p.E526Q	EXOC5_uc001xcs.2_Missense_Mutation_p.E205Q|EXOC5_uc010trg.1_Missense_Mutation_p.E471Q|EXOC5_uc010trh.1_Missense_Mutation_p.E461Q	NM_006544	NP_006535	O00471	EXOC5_HUMAN	SEC10 protein	526					exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm				ovary(2)|breast(1)	3						TCCATTTGTTCAATTATTTCT	0.274			NA											15	69					0	0	0.004007	0	0
SYNE2	23224	broad.mit.edu	37	14	64634013	64634013	+	Silent	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:64634013C>G	uc001xgm.2	+	91	16898	c.16668C>G	c.(16666-16668)CTC>CTG	p.L5556L	SYNE2_uc001xgl.2_Silent_p.L5556L|SYNE2_uc010apy.2_Silent_p.L1941L|SYNE2_uc001xgn.2_Silent_p.L518L|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR|SYNE2_uc001xgq.2_5'Flank	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5556	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGTGAGCCTCAAGCTCCCAC	0.463			NA											3	65					0	0	0.009096	0	0
SMOC1	64093	broad.mit.edu	37	14	70477552	70477552	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:70477552C>A	uc001xls.1	+	8	999	c.746C>A	c.(745-747)CCT>CAT	p.P249H	SMOC1_uc001xlt.1_Missense_Mutation_p.P249H	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1	249	Thyroglobulin type-1 2.				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		ATTGTCATCCCTGAATGTGCC	0.592			NA											6	171					0.000157383	0.000185109	0.00308	1	0
KIAA1409	57578	broad.mit.edu	37	14	94089157	94089157	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:94089157C>T	uc001ybv.1	+	28	5196	c.5113C>T	c.(5113-5115)CTG>TTG	p.L1705L	KIAA1409_uc001ybs.1_Silent_p.L1683L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1860						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		CTTCAACATTCTGGACAAACT	0.453			NA											9	80					0	0	0.004482	0	0
DYNC1H1	1778	broad.mit.edu	37	14	102449530	102449530	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:102449530G>A	uc001yks.2	+	6	1300	c.1136G>A	c.(1135-1137)CGT>CAT	p.R379H		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	379	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						AGGGCACTGCGTTTGGTGGAG	0.403			NA											15	58					0	0	0.020292	0	0
DYNC1H1	1778	broad.mit.edu	37	14	102495993	102495993	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:102495993G>A	uc001yks.2	+	49	9750	c.9586G>A	c.(9586-9588)GAG>AAG	p.E3196K		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	3196	Potential.|Stalk (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						CGAGCTGGAGGAGCAGCAGAT	0.567			NA											7	30					0	0	0.001984	0	0
MGA	23269	broad.mit.edu	37	15	42003303	42003303	+	Nonsense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr15:42003303C>G	uc001zog.1	+	8	2931	c.2840C>G	c.(2839-2841)TCA>TGA	p.S947*	MGA_uc010ucy.1_Nonsense_Mutation_p.S947*|MGA_uc010ucz.1_Nonsense_Mutation_p.S947*	NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 2	947						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		GGCATCATCTCAGAAAATCAG	0.393			NA											40	110					0	0	0.011902	0	0
BNC1	646	broad.mit.edu	37	15	83926860	83926860	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr15:83926860G>T	uc002bjt.1	-	5	2407	c.2319C>A	c.(2317-2319)AAC>AAA	p.N773K	BNC1_uc010uos.1_Missense_Mutation_p.N761K	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	773	C2H2-type 4.				epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TTTGGTGGAGGTTTAGGTTTG	0.438			NA											17	77					5.3912e-06	6.50959e-06	0.006122	1	0
GP2	2813	broad.mit.edu	37	16	20335277	20335277	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr16:20335277G>A	uc002dgv.2	-	3	479	c.396C>T	c.(394-396)ATC>ATT	p.I132I	GP2_uc002dgw.2_Silent_p.I132I|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	132						anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						TGTGGTTGGTGATGCCATCCC	0.597			NA											8	32					0	0	0.004482	0	0
ARHGAP17	55114	broad.mit.edu	37	16	24981885	24981885	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr16:24981885G>A	uc002dnb.2	-	4	308	c.215C>T	c.(214-216)ACA>ATA	p.T72I	ARHGAP17_uc002dnc.2_Missense_Mutation_p.T72I|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dnf.2_5'Flank|ARHGAP17_uc002dng.1_Missense_Mutation_p.T72I	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1	72	BAR.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		AGCAAGAGCTGTCAGAGGCAG	0.408			NA											39	157					0	0	0.019004	0	0
CHRNB1	1140	broad.mit.edu	37	17	7350939	7350939	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:7350939G>A	uc002ghb.2	+	6	621	c.580G>A	c.(580-582)GAA>AAA	p.E194K	CHRNB1_uc010vty.1_Missense_Mutation_p.E122K|CHRNB1_uc010vtz.1_Missense_Mutation_p.E28K	NM_000747	NP_000738	P11230	ACHB_HUMAN	nicotinic acetylcholine receptor beta 1 subunit	194	Extracellular (Potential).				behavioral response to nicotine|muscle contraction|muscle fiber development|neuromuscular synaptic transmission|postsynaptic membrane organization|regulation of membrane potential|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine binding|receptor activity			ovary(2)	2		Prostate(122;0.157)				AGGGCATCAGGAAATCCACAT	0.458			NA											12	60					0	0	0.010729	0	0
MYO15A	51168	broad.mit.edu	37	17	18025526	18025526	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:18025526C>T	uc010vxh.1	+	2	3750	c.3412C>T	c.(3412-3414)CAA>TAA	p.Q1138*		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1138	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					CCTGAAGCCTCAAGTCCAGCC	0.612			NA											11	34					0	0	0.016723	0	0
FBXO47	494188	broad.mit.edu	37	17	37118263	37118263	+	Silent	SNP	T	T	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:37118263T>G	uc002hrc.2	-	3	419	c.219A>C	c.(217-219)ACA>ACC	p.T73T		NM_001008777	NP_001008777	Q5MNV8	FBX47_HUMAN	F-box protein 47	73	F-box.										0						GTTGGCTGACTGTTTTGGACA	0.373			NA											22	74					0	0	0.016522	0	0
KRTAP4-8	728224	broad.mit.edu	37	17	39253960	39253960	+	Missense_Mutation	SNP	C	C	T	rs144672535	by1000genomes	TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:39253960C>T	uc010wfo.1	-	1	416	c.377G>A	c.(376-378)CGC>CAC	p.R126H		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	126	21.|25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].			R -> H (in Ref. 2; CAC27579).		keratin filament					0						gcagctggggcggcagcagtt	0.09			NA											4	19					0	0	0.001168	0	0
EPX	8288	broad.mit.edu	37	17	56274464	56274464	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:56274464G>A	uc002ivq.2	+	7	1052	c.966G>A	c.(964-966)TCG>TCA	p.S322S		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	322					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						TCTCCCTCTCGCTGCGGCTCC	0.617			NA											22	102					0	0	0.014323	0	0
SAP30BP	29115	broad.mit.edu	37	17	73663525	73663525	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:73663525G>C	uc002jpe.2	+	1	127	c.73G>C	c.(73-75)GAG>CAG	p.E25Q	RECQL5_uc010dgk.2_5'Flank|RECQL5_uc010dgl.2_5'Flank|RECQL5_uc002jpb.1_5'Flank|RECQL5_uc002joz.3_5'Flank|RECQL5_uc002jpa.3_5'Flank|SAP30BP_uc010dgm.1_Missense_Mutation_p.E25Q|SAP30BP_uc002jpc.1_RNA|SAP30BP_uc010wsf.1_RNA|SAP30BP_uc010wsg.1_RNA|SAP30BP_uc002jpf.2_Missense_Mutation_p.E25Q	NM_013260	NP_037392	Q9UHR5	S30BP_HUMAN	transcriptional regulator protein	25					apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GTCTGATGGCGAGGCTGGAAT	0.617			NA											4	81					0	0	0.009096	0	0
CETN1	1068	broad.mit.edu	37	18	580696	580696	+	Silent	SNP	G	G	A	rs114552098	by1000genomes	TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr18:580696G>A	uc002kko.1	+	1	330	c.288G>A	c.(286-288)AAG>AAA	p.K96K		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	96	EF-hand 2.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2						TGACGCAGAAGATGTCCGAGA	0.507			NA											4	59					0	0	0.009096	0	0
SMAD2	4087	broad.mit.edu	37	18	45368254	45368254	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr18:45368254C>T	uc002lcy.2	-	11	1596	c.1348G>A	c.(1348-1350)GAC>AAC	p.D450N	SMAD2_uc002lcz.2_Missense_Mutation_p.D450N|SMAD2_uc010xdc.1_Missense_Mutation_p.D420N	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	450	MH2.		D -> E (in a colorectal carcinoma sample).		anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5						AATACTTTGTCCAACCACTGT	0.398			NA											7	56					0	0	0.001984	0	0
MUC16	94025	broad.mit.edu	37	19	9047598	9047598	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:9047598C>G	uc002mkp.2	-	5	34237	c.34033G>C	c.(34033-34035)GAG>CAG	p.E11345Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11347	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GCTGTTGCCTCTGATTCATGT	0.502			NA											10	212					0	0	0.010729	0	0
OR7D2	162998	broad.mit.edu	37	19	9296806	9296806	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:9296806G>A	uc002mkz.1	+	1	537	c.349G>A	c.(349-351)GTG>ATG	p.V117M		NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D,	117	Helical; Name=3; (Potential).				regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|upper_aerodigestive_tract(1)	3						ACTCCTGACCGTGATGGCCTA	0.512			NA											18	194					0	0	0.006122	0	0
NOVA2	4858	broad.mit.edu	37	19	46443408	46443408	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:46443408C>G	uc002pdv.2	-	4	1240	c.1192G>C	c.(1192-1194)GAG>CAG	p.E398Q		NM_002516	NP_002507	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	398	Ala-rich.					nucleus	RNA binding				0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		GCCAGCTTCTCCGCCGTCAGG	0.373			NA											6	42					0	0	0.001984	0	0
KIR3DL1	3811	broad.mit.edu	37	19	55341715	55341715	+	Silent	SNP	T	T	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:55341715T>A	uc002qhk.3	+	9	1383	c.1320T>A	c.(1318-1320)GTT>GTA	p.V440V	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Silent_p.V365V|KIR3DL1_uc010esf.2_Silent_p.V345V|KIR3DL1_uc010yfo.1_Silent_p.V382V|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	440	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		GATCCAAAGTTGTCTCCTGCC	0.527			NA											51	370					0	0	0.01441	0	0
ZSCAN5A	79149	broad.mit.edu	37	19	56736297	56736297	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:56736297G>A	uc002qmq.2	-	2	285	c.119C>T	c.(118-120)CCT>CTT	p.P40L	ZSCAN5A_uc010ygi.1_Intron|ZSCAN5A_uc002qmr.2_Missense_Mutation_p.P40L|ZSCAN5A_uc002qms.1_Missense_Mutation_p.P40L	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	40					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						AGAAATCTCAGGGTCCACGTC	0.542			NA											21	62					0	0	0.012319	0	0
ZIK1	284307	broad.mit.edu	37	19	58102051	58102051	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:58102051G>A	uc002qpg.2	+	4	969	c.872G>A	c.(871-873)GGA>GAA	p.G291E	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.G236E|ZIK1_uc002qpi.2_Missense_Mutation_p.G278E|ZIK1_uc002qpj.2_Missense_Mutation_p.G188E	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	291					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ATCCACACCGGAGAAAGGCCT	0.458			NA											11	50					0	0	0.008291	0	0
ZNF135	7694	broad.mit.edu	37	19	58578972	58578972	+	Nonsense_Mutation	SNP	C	C	T	rs149615463	byFrequency	TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:58578972C>T	uc010yhq.1	+	5	1252	c.1156C>T	c.(1156-1158)CGA>TGA	p.R386*	ZNF135_uc002qre.2_Nonsense_Mutation_p.R374*|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Nonsense_Mutation_p.R332*|ZNF135_uc002qrg.2_Nonsense_Mutation_p.R344*|ZNF135_uc010yhr.1_Nonsense_Mutation_p.R195*	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	386					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CAAACACCAGCGAATCCACAC	0.557			NA											11	56					0	0	0.010729	0	0
ALLC	55821	broad.mit.edu	37	2	3744967	3744967	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:3744967G>A	uc010ewt.2	+	10	932	c.771G>A	c.(769-771)CCG>CCA	p.P257P	ALLC_uc002qyf.2_Silent_p.P28P	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	276							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCTTGGTTCCGGGTTGTGAAT	0.393			NA								HNSCC(21;0.051)			28	115					0	0	0.012213	0	0
EIF2B4	8890	broad.mit.edu	37	2	27587635	27587635	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:27587635T>C	uc002rkb.2	-	12	1465	c.1322A>G	c.(1321-1323)TAC>TGC	p.Y441C	EIF2B4_uc002rjz.2_Missense_Mutation_p.Y461C|EIF2B4_uc002rka.2_Missense_Mutation_p.Y426C|EIF2B4_uc002rkc.2_Missense_Mutation_p.Y440C|EIF2B4_uc002rkd.2_Missense_Mutation_p.Y235C|EIF2B4_uc002rke.2_Missense_Mutation_p.Y410C	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B,	441					myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACAGAACTTGTATGTTTCACA	0.522			NA											23	101					0	0	0.01892	0	0
SOS1	6654	broad.mit.edu	37	2	39234206	39234206	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:39234206G>A	uc002rrk.3	-	16	2680	c.2639C>T	c.(2638-2640)TCA>TTA	p.S880L	SOS1_uc002rrj.3_Missense_Mutation_p.S494L	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	880	Ras-GEF.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				AACAGGTGATGAATTCATAGC	0.333			NA							Noonan_syndrome				34	124					0	0	0.015359	0	0
ABCG5	64240	broad.mit.edu	37	2	44051398	44051398	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:44051398C>G	uc002rtn.2	-	8	1218	c.1078G>C	c.(1078-1080)GAT>CAT	p.D360H	ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Missense_Mutation_p.D189H|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	360	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCAGGAGAATCTTTGGTTTTG	0.388			NA											21	128					0	0	0.016522	0	0
ABCG5	64240	broad.mit.edu	37	2	44051514	44051514	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:44051514C>G	uc002rtn.2	-	8	1102	c.962G>C	c.(961-963)AGA>ACA	p.R321T	ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Missense_Mutation_p.R150T|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	321	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CATCTGGACTCTCTTGGAGGT	0.373			NA											23	187					0	0	0.00632	0	0
CTNNA2	1496	broad.mit.edu	37	2	80085262	80085262	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:80085262C>T	uc010ysh.1	+	3	427	c.422C>T	c.(421-423)GCG>GTG	p.A141V	CTNNA2_uc010yse.1_Missense_Mutation_p.A141V|CTNNA2_uc010ysf.1_Missense_Mutation_p.A141V|CTNNA2_uc010ysg.1_Missense_Mutation_p.A141V	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	141					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CTCATCCTGGCGGACATGGCA	0.498			NA											8	62					0	0	0.00308	0	0
IMMT	10989	broad.mit.edu	37	2	86406604	86406604	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:86406604C>T	uc002sqz.3	-	3	649	c.261G>A	c.(259-261)GAG>GAA	p.E87E	IMMT_uc002srb.3_Silent_p.E87E|IMMT_uc002sra.3_Silent_p.E87E|IMMT_uc010ytd.1_Silent_p.E87E|IMMT_uc010yte.1_Silent_p.E87E|IMMT_uc002srd.2_Silent_p.E87E|IMMT_uc002sre.3_Silent_p.E87E|IMMT_uc010ytf.1_Silent_p.E87E|IMMT_uc010fgs.1_Silent_p.E87E	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	87	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1						CAAGAACCATCTCGAAGAGTT	0.383			NA											5	34					0	0	0.014758	0	0
THSD7B	80731	broad.mit.edu	37	2	138000026	138000026	+	Splice_Site	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:138000026G>A	uc002tva.1	+	9	2058	c.2058_splice	c.e9-1	p.R686_splice	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Splice_Site_p.R576_splice	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CACATTGACAGATGTCCAGAT	0.368			NA											4	51					0	0	0.009096	0	0
PLA2R1	22925	broad.mit.edu	37	2	160825826	160825826	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:160825826C>T	uc002ube.1	-	19	2912	c.2705G>A	c.(2704-2706)GGA>GAA	p.G902E	PLA2R1_uc010zcp.1_Missense_Mutation_p.G902E|PLA2R1_uc002ubf.2_Missense_Mutation_p.G902E	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	902	Extracellular (Potential).|C-type lectin 5.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						TCTTTCTCTTCCTGTGTCCCA	0.388			NA											19	70					0	0	0.008871	0	0
TTN	7273	broad.mit.edu	37	2	179644903	179644903	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:179644903G>A	uc010zfg.1	-	22	3777	c.3553C>T	c.(3553-3555)CAA>TAA	p.Q1185*	TTN_uc010zfh.1_Nonsense_Mutation_p.Q1139*|TTN_uc010zfi.1_Nonsense_Mutation_p.Q1139*|TTN_uc010zfj.1_Nonsense_Mutation_p.Q1139*|TTN_uc002unb.2_Nonsense_Mutation_p.Q1185*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1185							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCATTTCTTGCTGGGACTTC	0.328			NA											7	65					0	0	0.001984	0	0
ANKRD44	91526	broad.mit.edu	37	2	197873717	197873717	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:197873717C>G	uc002uua.1	-	19	1965	c.1888G>C	c.(1888-1890)GAA>CAA	p.E630Q	ANKRD44_uc002utz.3_Missense_Mutation_p.E362Q	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	655	ANK 19.						protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCTGCAATTTCTAGCAACAGC	0.438			NA											5	177					0	0	0.001168	0	0
MDH1B	130752	broad.mit.edu	37	2	207621660	207621660	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:207621660C>T	uc002vbs.2	-	4	430	c.375G>A	c.(373-375)CTG>CTA	p.L125L	MDH1B_uc010ziw.1_RNA|MDH1B_uc010fui.2_Silent_p.L125L|MDH1B_uc010fuj.2_Silent_p.L27L|MDH1B_uc002vbt.2_RNA	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	125					carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity			ovary(3)|kidney(1)	4				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		TGCAAGTTTTCAGGGCTTCTT	0.433	Pancreas(76;29 1355 28675 37177 51207)		NA											7	47					0	0	0.001984	0	0
IKZF2	22807	broad.mit.edu	37	2	213886806	213886806	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:213886806C>T	uc002vem.2	-	6	792	c.623G>A	c.(622-624)CGC>CAC	p.R208H	IKZF2_uc010fuu.2_Missense_Mutation_p.R63H|IKZF2_uc002vej.2_Missense_Mutation_p.R155H|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Missense_Mutation_p.R182H|IKZF2_uc002vel.2_Missense_Mutation_p.R129H|IKZF2_uc010fuw.2_5'UTR|IKZF2_uc010fux.2_5'UTR|IKZF2_uc010fuy.2_Intron|IKZF2_uc002ven.2_Missense_Mutation_p.R182H	NM_016260	NP_057344	Q9UKS7	IKZF2_HUMAN	helios isoform 1	208	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		CAGTGAACTGCGCTGCTTGTA	0.502			NA											15	74					0	0	0.004007	0	0
SPEG	10290	broad.mit.edu	37	2	220355150	220355150	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:220355150C>T	uc010fwg.2	+	37	8941	c.8941C>T	c.(8941-8943)CGA>TGA	p.R2981*		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	2981	Protein kinase 2.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGGTGTTGTGCGAGCGTGCCG	0.657			NA											5	46					0	0	0.014758	0	0
STK11IP	114790	broad.mit.edu	37	2	220480797	220480797	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:220480797G>A	uc002vml.2	+	25	3225	c.3182G>A	c.(3181-3183)CGT>CAT	p.R1061H		NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN	LKB1 interacting protein	1061					protein localization	cytoplasm	protein kinase binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGCACTCCGTGTGGTGTGT	0.617			NA											6	28					0	0	0.001984	0	0
ZSWIM3	140831	broad.mit.edu	37	20	44506472	44506472	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr20:44506472C>T	uc002xqd.2	+	2	1478	c.1275C>T	c.(1273-1275)TTC>TTT	p.F425F	ZSWIM3_uc010zxg.1_Silent_p.F419F	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	425							zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)				ACATAGACTTCTTTAATACCA	0.498			NA											3	61					0	0	0.009096	0	0
PREX1	57580	broad.mit.edu	37	20	47269227	47269227	+	Silent	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr20:47269227G>T	uc002xtw.1	-	21	2387	c.2364C>A	c.(2362-2364)ATC>ATA	p.I788I	PREX1_uc002xtv.1_Silent_p.I85I	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	788					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGGTGTGGTAGATCCACTGGT	0.642			NA											7	43					8.12818e-05	9.60988e-05	0.001984	1	0
CDH4	1002	broad.mit.edu	37	20	60498691	60498691	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr20:60498691C>T	uc002ybn.1	+	10	1571	c.1557C>T	c.(1555-1557)GGC>GGT	p.G519G	CDH4_uc002ybp.1_Silent_p.G445G	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	519	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TGGAGGAGGGCGTGCCCCCCG	0.622			NA											9	23					0	0	0.004482	0	0
PCNT	5116	broad.mit.edu	37	21	47805840	47805840	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr21:47805840G>A	uc002zji.3	+	17	3513	c.3406G>A	c.(3406-3408)GAA>AAA	p.E1136K	PCNT_uc002zjj.2_Missense_Mutation_p.E1018K	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	1136	Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					GGAGAACCGGGAAGGCGCAAA	0.597			NA											15	125					0	0	0.020292	0	0
CACNA1I	8911	broad.mit.edu	37	22	40015399	40015399	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr22:40015399C>G	uc003ayc.2	+	4	567	c.567C>G	c.(565-567)ATC>ATG	p.I189M	CACNA1I_uc003ayd.2_Missense_Mutation_p.I189M|CACNA1I_uc003aye.2_Missense_Mutation_p.I104M|CACNA1I_uc003ayf.2_Missense_Mutation_p.I104M	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	189	I.|Helical; Name=S4 of repeat I; (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	TCAAAGCCATCAACCGCGTGC	0.617			NA											15	62					0	0	0.00499	0	0
MOV10L1	54456	broad.mit.edu	37	22	50553671	50553671	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr22:50553671G>T	uc003bjj.2	+	8	1338	c.1255G>T	c.(1255-1257)GGA>TGA	p.G419*	MOV10L1_uc003bjk.3_Nonsense_Mutation_p.G419*|MOV10L1_uc011arp.1_Nonsense_Mutation_p.G399*|MOV10L1_uc011arq.1_Nonsense_Mutation_p.G180*|MOV10L1_uc010hao.1_RNA	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	419					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CATCTGTGACGGAAAGTAAGG	0.458			NA											24	133					2.79863e-10	3.41554e-10	0.004656	1	0
C3orf75	54859	broad.mit.edu	37	3	47545917	47545917	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:47545917G>A	uc003crk.2	-	4	345	c.226C>T	c.(226-228)CGG>TGG	p.R76W	C3orf75_uc003crj.2_Missense_Mutation_p.R3W|C3orf75_uc011bba.1_Missense_Mutation_p.R27W|C3orf75_uc003crl.1_Missense_Mutation_p.R76W	NM_001031703	NP_001026873	Q0PNE2	CC075_HUMAN	transmembrane protein 103	76											0						CCACGCTCCCGCGCCATGGTC	0.547			NA											5	33					0	0	0.001168	0	0
TMF1	7110	broad.mit.edu	37	3	69073259	69073259	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:69073259C>T	uc003dnn.2	-	16	3332	c.3085G>A	c.(3085-3087)GAT>AAT	p.D1029N	TMF1_uc011bfx.1_Missense_Mutation_p.D1032N	NM_007114	NP_009045	P82094	TMF1_HUMAN	TATA element modulatory factor 1	1029	Potential.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TCAAGTTCATCATTTTGATTT	0.323			NA											13	124					0	0	0.013537	0	0
PROK2	60675	broad.mit.edu	37	3	71830623	71830623	+	Missense_Mutation	SNP	G	G	A	rs121434272		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:71830623G>A	uc003dpa.3	-	2	371	c.217C>T	c.(217-219)CGT>TGT	p.R73C	PROK2_uc003doz.3_Missense_Mutation_p.R73C	NM_001126128	NP_001119600	Q9HC23	PROK2_HUMAN	prokineticin 2 isoform a precursor	73			R -> C (in KAL4).		activation of MAPK activity|angiogenesis|anti-apoptosis|cell proliferation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response|neuropeptide signaling pathway|positive regulation of smooth muscle contraction|sensory perception of pain|spermatogenesis	extracellular region	G-protein-coupled receptor binding				0		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CTAACTTTACGAGTCAGTGGA	0.463			NA											12	135					0	0	0.020292	0	0
ROBO2	6092	broad.mit.edu	37	3	77637907	77637907	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:77637907C>T	uc003dpy.3	+	17	3149	c.2506C>T	c.(2506-2508)CGC>TGC	p.R836C	ROBO2_uc003dpz.2_Missense_Mutation_p.R840C|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.R840C|ROBO2_uc003dqa.2_Translation_Start_Site	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	836	Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CATAGGGAGACGCAATGAAGT	0.343			NA											8	32					0	0	0.004482	0	0
ROBO1	6091	broad.mit.edu	37	3	78988027	78988027	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:78988027A>G	uc003dqe.2	-	4	431	c.223T>C	c.(223-225)TCA>CCA	p.S75P	ROBO1_uc003dqb.2_Missense_Mutation_p.S36P|ROBO1_uc003dqc.2_Missense_Mutation_p.S36P|ROBO1_uc003dqd.2_Missense_Mutation_p.S36P	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	75	Extracellular (Potential).|Ig-like C2-type 1.				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATCAGGTCTGAAGGGTGTTCA	0.453			NA											17	71					0	0	0.006122	0	0
POPDC2	64091	broad.mit.edu	37	3	119367417	119367417	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:119367417G>A	uc003ecx.1	-	3	833	c.699C>T	c.(697-699)TTC>TTT	p.F233F	POPDC2_uc010hqw.1_Silent_p.F233F|POPDC2_uc003ecy.1_Silent_p.F51F	NM_022135	NP_071418	Q9HBU9	POPD2_HUMAN	popeye protein 2	233						integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)		GCAGAGCCGAGAAGAGGCAGG	0.512			NA											13	65					0	0	0.013537	0	0
DHX36	170506	broad.mit.edu	37	3	154027503	154027503	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:154027503C>T	uc003ezy.3	-	5	833	c.752G>A	c.(751-753)AGA>AAA	p.R251K	DHX36_uc010hvq.2_Missense_Mutation_p.R251K|DHX36_uc003ezz.3_Missense_Mutation_p.R251K	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	251	Helicase ATP-binding.					cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCCTTTTCCTCTTTCAATGTA	0.323			NA											8	48					0	0	0.006214	0	0
PSMD2	5708	broad.mit.edu	37	3	184026274	184026274	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:184026274G>A	uc003fnn.1	+	20	2496	c.2463G>A	c.(2461-2463)CTG>CTA	p.L821L	PSMD2_uc011brj.1_Silent_p.L662L|PSMD2_uc011brk.1_Silent_p.L691L	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2	821					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	TGTATGGGCTGGTGGCTGCCA	0.517	Colon(24;313 636 6917 9932 15554)		NA									OREG0015948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	348					0	0	0.00308	0	0
EVC	2121	broad.mit.edu	37	4	5800411	5800411	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:5800411G>A	uc003gil.1	+	15	2380	c.2196G>A	c.(2194-2196)GTG>GTA	p.V732V	EVC_uc003gim.1_RNA|CRMP1_uc003gin.1_Intron	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	732					muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)				CCCAGGAGGTGGGGCAGCTTC	0.677			NA											3	12					0	0	0.004672	0	0
CHRNA9	55584	broad.mit.edu	37	4	40356452	40356452	+	Missense_Mutation	SNP	C	C	T	rs139982841	byFrequency	TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:40356452C>T	uc003gva.1	+	5	1371	c.1355C>T	c.(1354-1356)GCG>GTG	p.A452V		NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9	452	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)	AAGAAGGTGGCGAAAGTCATA	0.433	Esophageal Squamous(115;1297 1602 22235 25158 43327)		NA											7	100					0	0	0.001984	0	0
CENPC1	1060	broad.mit.edu	37	4	68380366	68380366	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:68380366C>T	uc003hdd.1	-	8	1053	c.870G>A	c.(868-870)TCG>TCA	p.S290S	CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA|CENPC1_uc010ihm.1_Silent_p.S290S	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1	290					mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						CGGGAGGACACGAATGAGGTG	0.373			NA											4	15					0	0	0.001168	0	0
ARHGAP24	83478	broad.mit.edu	37	4	86916545	86916545	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:86916545G>A	uc003hpk.2	+	9	2187	c.1738G>A	c.(1738-1740)GAG>AAG	p.E580K	ARHGAP24_uc003hpl.2_Missense_Mutation_p.E485K|ARHGAP24_uc010ikf.2_Missense_Mutation_p.E495K|ARHGAP24_uc003hpm.2_Missense_Mutation_p.E487K	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1	580					angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		CACCTGCCCAGAGCAAGACTT	0.547			NA											5	117					0	0	0.00308	0	0
SYNPO2	171024	broad.mit.edu	37	4	119951360	119951360	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:119951360G>C	uc003icm.3	+	4	1626	c.1430G>C	c.(1429-1431)AGA>ACA	p.R477T	SYNPO2_uc010ina.2_Missense_Mutation_p.R477T|SYNPO2_uc010inb.2_Missense_Mutation_p.R477T|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Missense_Mutation_p.R405T	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform b	477						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						AAACTGAACAGAGGGGACAAG	0.473			NA											7	39					0	0	0.001984	0	0
CLPTM1L	81037	broad.mit.edu	37	5	1339046	1339046	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:1339046C>T	uc003jch.2	-	4	574	c.528G>A	c.(526-528)CTG>CTA	p.L176L	CLPTM1L_uc003jcg.2_Silent_p.L43L	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like	176	Extracellular (Potential).				apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CCATCACGTTCAGCGCCAGCC	0.607			NA											10	65					0	0	0.010729	0	0
GUSBP1	728411	broad.mit.edu	37	5	21459805	21459805	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:21459805C>T	uc010iub.2	+	2	124	c.44C>T	c.(43-45)TCG>TTG	p.S15L	GUSBP1_uc011cnn.1_RNA|GUSBP1_uc003jgh.3_RNA|GUSBP1_uc003jgf.3_Missense_Mutation_p.S15L|GUSBP1_uc003jgg.3_RNA	NR_027028				SubName: Full=Putative uncharacterized protein GUSBL2;												0						TCAGACGCATCGGGACCGGAC	0.642			NA									OREG0016459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	49					0	0	0.010729	0	0
PTGER4	5734	broad.mit.edu	37	5	40692192	40692192	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:40692192G>C	uc003jlz.2	+	3	1771	c.1179G>C	c.(1177-1179)CAG>CAC	p.Q393H		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	393	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						GTACATCTCAGACCCTCCTGC	0.572			NA											4	61					0	0	0.009096	0	0
DMXL1	1657	broad.mit.edu	37	5	118485852	118485852	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:118485852G>C	uc003ksd.2	+	18	4511	c.4330G>C	c.(4330-4332)GAT>CAT	p.D1444H	DMXL1_uc010jcl.1_Missense_Mutation_p.D1444H	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1444										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AGAAAGTTATGATGAGCTTTT	0.338			NA											21	68					0	0	0.012319	0	0
FAM71B	153745	broad.mit.edu	37	5	156589882	156589882	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:156589882G>T	uc003lwn.2	-	2	1494	c.1394C>A	c.(1393-1395)TCT>TAT	p.S465Y		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	465						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCGGTGGGAAGACGCTTTCTG	0.512			NA											29	191					1.55811e-20	1.94336e-20	0.008361	1	0
C5orf58	133874	broad.mit.edu	37	5	169661199	169661199	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:169661199A>C	uc010jjn.2	+	2	143	c.60A>C	c.(58-60)TTA>TTC	p.L20F	C5orf58_uc003mal.2_RNA	NM_001102609	NP_001096079	C9J3I9	CE058_HUMAN	hypothetical protein LOC133874	20											0						GGATTGACTTAAAGGTTAGTT	0.398			NA											24	45					0	0	0.021523	0	0
NSD1	64324	broad.mit.edu	37	5	176636857	176636857	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:176636857C>G	uc003mfr.3	+	5	1595	c.1457C>G	c.(1456-1458)TCT>TGT	p.S486C	NSD1_uc003mft.3_Missense_Mutation_p.S217C|NSD1_uc003mfs.1_Missense_Mutation_p.S383C|NSD1_uc011dfx.1_Missense_Mutation_p.S134C	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	486					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCTGAACATTCTGCAGATGAG	0.408			NA	T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			6	84					0	0	0.001984	0	0
HIST1H2BO	8348	broad.mit.edu	37	6	27861501	27861501	+	Silent	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:27861501C>G	uc003nkc.1	+	1	299	c.261C>G	c.(259-261)CGC>CGG	p.R87R	HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	NM_003527	NP_003518	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	87					nucleosome assembly	nucleosome|nucleus	DNA binding				0						ACAACAAGCGCTCGACCATCA	0.627			NA											5	117					0	0	0.001168	0	0
CFB	629	broad.mit.edu	37	6	31901414	31901414	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:31901414C>T	uc011dor.1	+	3	548	c.284C>T	c.(283-285)TCA>TTA	p.S95L	C2_uc003nyc.2_5'UTR|C2_uc011doo.1_5'UTR|C2_uc011dop.1_Missense_Mutation_p.S34L|C2_uc003nye.3_Missense_Mutation_p.S157L|C2_uc003nyf.2_Missense_Mutation_p.S157L|C2_uc010jtk.2_Missense_Mutation_p.S25L|C2_uc011doq.1_Missense_Mutation_p.S128L|C2_uc003nyg.2_Missense_Mutation_p.S25L	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						CCAGGCATTTCACTGGGCGCA	0.627			NA											12	42					0	0	0.020292	0	0
ITPR3	3710	broad.mit.edu	37	6	33655052	33655052	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:33655052C>T	uc011drk.1	+	45	6344	c.6125C>T	c.(6124-6126)TCG>TTG	p.S2042L	ITPR3_uc003oey.2_Missense_Mutation_p.S129L	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	2042	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						CGTGAGAACTCGGAGGTGAGC	0.602			NA											10	21					0	0	0.016723	0	0
DNAH8	1769	broad.mit.edu	37	6	38905910	38905910	+	Silent	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:38905910C>G	uc003ooe.1	+	76	11673	c.11073C>G	c.(11071-11073)CTC>CTG	p.L3691L	DNAH8_uc003oog.1_Silent_p.L140L|uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GAAGCATCCTCTACTTCCTCA	0.522			NA											7	54					0	0	0.001984	0	0
KIF6	221458	broad.mit.edu	37	6	39581035	39581035	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:39581035T>A	uc003oot.2	-	6	664	c.569A>T	c.(568-570)CAT>CTT	p.H190L	KIF6_uc010jxa.1_5'UTR|KIF6_uc011dua.1_Missense_Mutation_p.H190L|KIF6_uc010jxb.1_Missense_Mutation_p.H190L	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	190	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						GGTTGCCTGATGGAGAGTCAA	0.418			NA											5	72					0	0	0.001984	0	0
YIPF3	25844	broad.mit.edu	37	6	43480052	43480052	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:43480052C>T	uc003ovl.1	-	9	1063	c.906G>A	c.(904-906)GGG>GGA	p.G302G	C6orf154_uc003ovk.1_5'Flank|YIPF3_uc011dvk.1_Silent_p.G267G|YIPF3_uc010jyr.1_Silent_p.G308G|YIPF3_uc010jys.1_Silent_p.G145G|YIPF3_uc003ovm.1_Silent_p.G176G|YIPF3_uc010jyt.1_Silent_p.G213G	NM_015388	NP_056203	Q9GZM5	YIPF3_HUMAN	natural killer cell-specific antigen KLIP1	302					cell differentiation	integral to membrane|plasma membrane|transport vesicle					0	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			TGTCCAGGATCCCTGGAAGGA	0.612			NA											21	63					0	0	0.010504	0	0
MTO1	25821	broad.mit.edu	37	6	74189769	74189769	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:74189769C>G	uc003pgy.3	+	6	1173	c.1049C>G	c.(1048-1050)TCT>TGT	p.S350C	MTO1_uc010kav.2_Missense_Mutation_p.S350C|MTO1_uc003pgz.3_Missense_Mutation_p.S350C|MTO1_uc003pha.3_Missense_Mutation_p.S12C|MTO1_uc003phb.3_Missense_Mutation_p.S276C|MTO1_uc010kaw.1_RNA	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN	mitochondrial translation optimization 1 homolog	350					tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6						CAGGGGTTATCTATGACGCTA	0.428			NA											10	45					0	0	0.006214	0	0
UBE2CBP	90025	broad.mit.edu	37	6	83767714	83767714	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:83767714C>T	uc003pjp.2	-	2	213	c.105G>A	c.(103-105)ATG>ATA	p.M35I	UBE2CBP_uc011dyx.1_RNA|UBE2CBP_uc003pjr.2_Missense_Mutation_p.M3I	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN	ubiquitin-conjugating enzyme E2C binding	35						cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)		TGGAAATATTCATGGGCATAC	0.408			NA									OREG0017549	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	40					0	0	0.001168	0	0
SNX14	57231	broad.mit.edu	37	6	86248583	86248583	+	Splice_Site	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:86248583C>G	uc003pkr.2	-	16	1642	c.1449_splice	c.e16-1	p.R483_splice	SNX14_uc003pkp.2_Splice_Site_p.R346_splice|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Splice_Site_p.R431_splice|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TAGGCTACCTCTGCAATAACA	0.299			NA											3	55					0	0	0.009096	0	0
SYNCRIP	10492	broad.mit.edu	37	6	86325015	86325015	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:86325015C>G	uc003pla.2	-	11	1872	c.1331G>C	c.(1330-1332)AGA>ACA	p.R444T	SYNCRIP_uc003pku.2_Missense_Mutation_p.R444T|SYNCRIP_uc003pkw.2_Missense_Mutation_p.R409T|SYNCRIP_uc003pky.2_Missense_Mutation_p.R346T|SYNCRIP_uc003pkv.2_Missense_Mutation_p.R444T|SYNCRIP_uc003pkx.2_Missense_Mutation_p.R292T|SYNCRIP_uc003pkz.2_Missense_Mutation_p.R409T	NM_006372	NP_006363	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA	444	Interaction with APOBEC1.				CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		CCCTCGACCTCTTGTTGGAGG	0.348			NA											7	36					0	0	0.006214	0	0
MDN1	23195	broad.mit.edu	37	6	90449994	90449994	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:90449994G>A	uc003pnn.1	-	32	4668	c.4552C>T	c.(4552-4554)CTA>TTA	p.L1518L		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1518					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATGGTTGCTAGAATACGAAAT	0.413			NA											5	71					0	0	0.001168	0	0
BVES	11149	broad.mit.edu	37	6	105581342	105581342	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:105581342C>G	uc003pqw.2	-	2	268	c.111G>C	c.(109-111)TGG>TGC	p.W37C	BVES_uc003pqx.2_Missense_Mutation_p.W37C|BVES_uc003pqy.2_Missense_Mutation_p.W37C	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	37	Extracellular (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				GTATCTCTCTCCAGTTTTCAC	0.393			NA											10	87					0	0	0.006214	0	0
STXBP5	134957	broad.mit.edu	37	6	147703982	147703982	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:147703982G>A	uc003qlz.2	+	27	3423	c.3262G>A	c.(3262-3264)GAA>AAA	p.E1088K	STXBP5_uc010khz.1_Missense_Mutation_p.E1052K|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.E743K	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	1088	v-SNARE coiled-coil homology.				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TGGTGGCATTGAAGGCGTAAA	0.488			NA											23	177					0	0	0.021523	0	0
SYNE1	23345	broad.mit.edu	37	6	152746553	152746553	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:152746553C>T	uc010kiw.2	-	39	5832	c.5230G>A	c.(5230-5232)GAG>AAG	p.E1744K	SYNE1_uc003qot.3_Missense_Mutation_p.E1751K|SYNE1_uc003qou.3_Missense_Mutation_p.E1744K|SYNE1_uc010kjb.1_Missense_Mutation_p.E1727K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1744	Spectrin 2.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCCATCTCTCATCCAACTGC	0.318			NA								HNSCC(10;0.0054)			11	104					0	0	0.010729	0	0
ZPBP	11055	broad.mit.edu	37	7	50070765	50070765	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:50070765G>C	uc003tou.2	-	5	699	c.629C>G	c.(628-630)TCC>TGC	p.S210C	ZPBP_uc011kci.1_Missense_Mutation_p.S136C|ZPBP_uc010kyw.2_Missense_Mutation_p.S209C	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	210					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					CTTAAGTAAGGAAATTTCACA	0.333			NA											10	142					0	0	0.010729	0	0
PCLO	27445	broad.mit.edu	37	7	82578974	82578974	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:82578974C>T	uc003uhx.2	-	6	11219	c.10930G>A	c.(10930-10932)GAA>AAA	p.E3644K	PCLO_uc003uhv.2_Missense_Mutation_p.E3644K|PCLO_uc010lec.2_Missense_Mutation_p.E609K	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3575					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AGGGGTTTTTCATAAGGTACA	0.488			NA											20	261					0	0	0.010504	0	0
SEMA3A	10371	broad.mit.edu	37	7	83636683	83636683	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:83636683G>T	uc003uhz.2	-	10	1441	c.1126C>A	c.(1126-1128)CCA>ACA	p.P376T		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	376	Sema.				axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						CCTGGCCGTGGATAGGGGACT	0.418			NA											73	108					9.35569e-46	1.17334e-45	0.01441	1	0
AKAP9	10142	broad.mit.edu	37	7	91729097	91729097	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:91729097G>A	uc003ulg.2	+	44	11035	c.10810G>A	c.(10810-10812)GAA>AAA	p.E3604K	AKAP9_uc003ulf.2_Missense_Mutation_p.E3596K|AKAP9_uc003uli.2_Missense_Mutation_p.E3227K|AKAP9_uc003ulj.2_Missense_Mutation_p.E1374K|AKAP9_uc003ull.2_Missense_Mutation_p.E500K	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3608	Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	p.S3604N(1)		breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCAACTGACTGAAGAGAAGAA	0.453			NA	T	BRAF	papillary thyroid								17	135					0	0	0.004007	0	0
ZKSCAN1	7586	broad.mit.edu	37	7	99621184	99621184	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:99621184G>A	uc003usk.1	+	2	274	c.55G>A	c.(55-57)GAG>AAG	p.E19K	ZKSCAN1_uc003usj.2_Missense_Mutation_p.E18K|ZKSCAN1_uc003usl.1_5'UTR|ZKSCAN1_uc003usm.1_Intron	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	zinc finger protein 36	19					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GGCTGCACAGGAGAAGGATGG	0.557			NA											7	94					0	0	0.004482	0	0
EPHB4	2050	broad.mit.edu	37	7	100405020	100405020	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:100405020C>T	uc003uwn.1	-	13	2792	c.2301G>A	c.(2299-2301)GAG>GAA	p.E767E	EPHB4_uc003uwm.1_Silent_p.E674E|EPHB4_uc010lhj.1_Silent_p.E767E	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	767	Cytoplasmic (Potential).|Protein kinase.				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					CGGAAGAGTTCTCCTCCAGGA	0.562	GBM(200;2113 3072 25865 52728)		NA											5	93					0	0	0.001984	0	0
CDHR3	222256	broad.mit.edu	37	7	105662823	105662823	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:105662823G>C	uc003vdl.3	+	14	2113	c.2005G>C	c.(2005-2007)GAG>CAG	p.E669Q	CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Missense_Mutation_p.E656Q|CDHR3_uc011klt.1_Missense_Mutation_p.E581Q|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	669	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GGCTCTTGTTGAGACAGGAAC	0.488			NA											4	200					0	0	0.009096	0	0
CDHR3	222256	broad.mit.edu	37	7	105664964	105664964	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:105664964C>T	uc003vdl.3	+	15	2322	c.2214C>T	c.(2212-2214)ATC>ATT	p.I738I	CDHR3_uc003vdk.2_Missense_Mutation_p.P170S|CDHR3_uc003vdm.3_Silent_p.I725I|CDHR3_uc011klt.1_Silent_p.I650I|CDHR3_uc003vdn.2_Missense_Mutation_p.P239S	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	738	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						CCAAAGCCATCCACAGACACT	0.542			NA											7	51					0	0	0.00308	0	0
MET	4233	broad.mit.edu	37	7	116412044	116412044	+	Splice_Site	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:116412044G>T	uc003vij.2	+	14	3215	c.3028_splice	c.e14+1	p.D1010_splice	MET_uc010lkh.2_Splice_Site_p.D1028_splice|MET_uc011knj.1_Splice_Site_p.D580_splice	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor						axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	p.982_1028del47(4)|p.?(2)		upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTCCAGAAGGTATATTTCAG	0.343			NA	Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				22	46					2.27525e-19	2.82231e-19	0.021523	1	0
CFTR	1080	broad.mit.edu	37	7	117234984	117234984	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:117234984G>C	uc003vjd.2	+	15	2623	c.2491G>C	c.(2491-2493)GAG>CAG	p.E831Q	CFTR_uc011knq.1_Missense_Mutation_p.E237Q	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	831	Cytoplasmic (Potential).				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	TTTTATTCAGGAGTGCTTTTT	0.313			NA							Cystic_Fibrosis				6	52					0	0	0.004482	0	0
CFTR	1080	broad.mit.edu	37	7	117235031	117235031	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:117235031G>A	uc003vjd.2	+	15	2670	c.2538G>A	c.(2536-2538)TGG>TGA	p.W846*	CFTR_uc011knq.1_Nonsense_Mutation_p.W252*	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	846	Cytoplasmic (Potential).				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	TGACTACATGGAACACATACC	0.358			NA							Cystic_Fibrosis				6	67					0	0	0.001168	0	0
PLXNA4	91584	broad.mit.edu	37	7	131849960	131849960	+	Splice_Site	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:131849960C>T	uc003vra.3	-	23	4516	c.4287_splice	c.e23-1	p.R1429_splice		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						TGACTCAGTCCTGTCAGCAGT	0.517			NA											11	110					0	0	0.008291	0	0
ZC3HAV1	56829	broad.mit.edu	37	7	138764365	138764365	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:138764365G>A	uc003vun.2	-	4	1710	c.1322C>T	c.(1321-1323)TCT>TTT	p.S441F	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Missense_Mutation_p.S441F	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	441					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						GGATCTGGTAGAAGTTATATC	0.458			NA											8	119					0	0	0.004482	0	0
MGAM	8972	broad.mit.edu	37	7	141747587	141747587	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:141747587G>A	uc003vwy.2	+	22	2555	c.2501G>A	c.(2500-2502)CGA>CAA	p.R834Q		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	834	Lumenal (Potential).|Maltase.				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCCCACAGTCGAAAGAACCCT	0.413			NA											6	56					0	0	0.00308	0	0
TRPV5	56302	broad.mit.edu	37	7	142609675	142609675	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:142609675C>A	uc003wby.1	-	13	2025	c.1761G>T	c.(1759-1761)CAG>CAT	p.Q587H		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	587	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					CATCCCTCTCCTGGGCCACCC	0.502			NA											8	98					3.86212e-05	4.61422e-05	0.008291	1	0
OR2A25	392138	broad.mit.edu	37	7	143772003	143772003	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:143772003G>A	uc011ktx.1	+	1	691	c.691G>A	c.(691-693)GAG>AAG	p.E231K		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					CCAGTCAGGAGAGGGGTGCCA	0.488			NA											33	151					0	0	0.009535	0	0
ZNF398	57541	broad.mit.edu	37	7	148863295	148863295	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:148863295G>A	uc003wfl.2	+	3	741	c.466G>A	c.(466-468)GAG>AAG	p.E156K	ZNF398_uc011kul.1_5'UTR|ZNF398_uc011kum.1_Missense_Mutation_p.E161K	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform a	156	KRAB.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			TTCCACTCCAGAGTGGGAAAA	0.408			NA											32	89					0	0	0.009535	0	0
ZNF398	57541	broad.mit.edu	37	7	148876534	148876534	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:148876534G>C	uc003wfl.2	+	6	1845	c.1570G>C	c.(1570-1572)GAG>CAG	p.E524Q	ZNF398_uc011kul.1_Missense_Mutation_p.E353Q|ZNF398_uc011kum.1_Missense_Mutation_p.E529Q	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform a	524	C2H2-type 7.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			CATGCGCAAGGAGCACCTGCT	0.592			NA											4	68					0	0	0.009096	0	0
MYST3	7994	broad.mit.edu	37	8	41791408	41791408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:41791408G>A	uc010lxb.2	-	18	4874	c.4330C>T	c.(4330-4332)CAG>TAG	p.Q1444*	MYST3_uc010lxc.2_Nonsense_Mutation_p.Q1444*|MYST3_uc003xon.3_Nonsense_Mutation_p.Q1444*	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1444					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			TCACAGTCCTGGTAGGCGCCC	0.532			NA											8	117					0	0	0.006214	0	0
IKBKB	3551	broad.mit.edu	37	8	42163879	42163879	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:42163879G>C	uc003xow.1	+	7	673	c.496G>C	c.(496-498)GAC>CAC	p.D166H	IKBKB_uc003xov.2_Missense_Mutation_p.D166H|IKBKB_uc010lxh.1_Missense_Mutation_p.D61H|IKBKB_uc011lco.1_RNA|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_5'UTR|IKBKB_uc011lcp.1_RNA|IKBKB_uc011lcq.1_Missense_Mutation_p.D164H|IKBKB_uc010lxi.1_RNA|IKBKB_uc011lcr.1_Missense_Mutation_p.D107H	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta	166	Protein kinase.				anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	CAAAATTATTGACCTAGGATA	0.463			NA											4	47					0	0	0.009096	0	0
FAM110B	90362	broad.mit.edu	37	8	59058927	59058927	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:59058927G>A	uc003xtj.1	+	5	1018	c.138G>A	c.(136-138)AAG>AAA	p.K46K		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	46						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				CCAACCCCAAGAGGCTCAGCG	0.672			NA											3	31					0	0	0.004672	0	0
CHD7	55636	broad.mit.edu	37	8	61754493	61754493	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:61754493G>A	uc003xue.2	+	21	5209	c.4732G>A	c.(4732-4734)GAC>AAC	p.D1578N		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1578					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGAGTTCTCAGACTTGGAAAG	0.463			NA											4	23					0	0	0.009096	0	0
ZFHX4	79776	broad.mit.edu	37	8	77616334	77616334	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:77616334G>A	uc003yav.2	+	2	398	c.11G>A	c.(10-12)TGT>TAT	p.C4Y	ZFHX4_uc003yat.1_Missense_Mutation_p.C4Y|ZFHX4_uc003yau.1_Missense_Mutation_p.C4Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.C4Y	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	4						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATGGAAACCTGTGACTCCCCT	0.443			NA								HNSCC(33;0.089)			4	25					0	0	0.009096	0	0
Unknown	0	broad.mit.edu	37	8	86567327	86567327	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:86567327G>A	uc003ydl.1	-	1	579	c.492C>T	c.(490-492)ACC>ACT	p.T164T		NM_172239	NP_758439			exonuclease GOR												NA						CGTCCACCACGGTGACGCGGG	0.577			NA											13	127					0	0	0.013537	0	0
VPS13B	157680	broad.mit.edu	37	8	100026130	100026130	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:100026130C>A	uc003yiv.2	+	2	225	c.114C>A	c.(112-114)AGC>AGA	p.S38R	VPS13B_uc003yiw.2_Missense_Mutation_p.S38R|VPS13B_uc003yit.2_Missense_Mutation_p.S38R|VPS13B_uc003yiu.1_Missense_Mutation_p.S38R|VPS13B_uc003yis.2_Missense_Mutation_p.S38R|VPS13B_uc011lgy.1_5'UTR	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	38					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGGTACTCAGCAAGCTCGAGT	0.408	Colon(161;2205 2542 7338 31318)		NA											30	138					9.65021e-13	1.18411e-12	0.010818	1	0
FREM1	158326	broad.mit.edu	37	9	14819377	14819377	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:14819377G>A	uc003zlm.2	-	14	2991	c.2401C>T	c.(2401-2403)CTA>TTA	p.L801L	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	801	CSPG 5.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		TCAGAAATTAGAATGTGCTCT	0.463			NA											3	46					0	0	0.009096	0	0
ADAMTSL1	92949	broad.mit.edu	37	9	18777140	18777140	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:18777140C>T	uc003zne.3	+	19	3040	c.2913C>T	c.(2911-2913)CCC>CCT	p.P971P		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	971						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		TGGCCCGGCCCTTGAGCCCGA	0.647			NA											10	52					0	0	0.010729	0	0
IFNA2	3440	broad.mit.edu	37	9	21384775	21384775	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:21384775C>T	uc003zpb.2	-	1	622	c.554G>A	c.(553-555)AGA>AAA	p.R185K		NM_000605	NP_000596	P01563	IFNA2_HUMAN	interferon, alpha 2 precursor	185					blood coagulation|cell-cell signaling|induction of apoptosis|inflammatory response|negative regulation of interleukin-13 secretion|negative regulation of interleukin-5 secretion|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of transcription, DNA-dependent|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			breast(1)	1				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)	Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	TTCCTTACTTCTTAAACTTTC	0.368			NA											17	181					0	0	0.004007	0	0
GBA2	57704	broad.mit.edu	37	9	35739760	35739760	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:35739760C>G	uc003zxw.2	-	9	1971	c.1447G>C	c.(1447-1449)GAA>CAA	p.E483Q	GBA2_uc003zxx.1_5'Flank|GBA2_uc011lpb.1_Missense_Mutation_p.E483Q|GBA2_uc011lpc.1_Missense_Mutation_p.E483Q|GBA2_uc011lpd.1_Missense_Mutation_p.E489Q|GBA2_uc003zxy.1_Missense_Mutation_p.E196Q	NM_020944	NP_065995	Q9HCG7	GBA2_HUMAN	bile acid beta-glucosidase	483	Extracellular (Potential).				bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity			ovary(3)|skin(1)	4	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AAGTATAGTTCATTGAACAGC	0.522			NA											6	67					0	0	0.001168	0	0
ZNF658	26149	broad.mit.edu	37	9	40772608	40772608	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:40772608C>T	uc004abs.2	-	5	2819	c.2667G>A	c.(2665-2667)AAG>AAA	p.K889K	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Silent_p.K889K	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	889	C2H2-type 19; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGGAGAAAGTCTTCCCACAGT	0.448			NA											7	158					0	0	0.006214	0	0
TRPM6	140803	broad.mit.edu	37	9	77377180	77377180	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:77377180C>T	uc004ajl.1	-	26	4645	c.4407G>A	c.(4405-4407)AAG>AAA	p.K1469K	TRPM6_uc004ajk.1_Silent_p.K1464K|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Silent_p.K425K	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	1469	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GCCACTTTTTCTTGATGCTAA	0.488			NA											4	145					0	0	0.014758	0	0
FAM120A	23196	broad.mit.edu	37	9	96259777	96259777	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:96259777C>T	uc004atw.2	+	4	854	c.829C>T	c.(829-831)CCA>TCA	p.P277S	FAM120A_uc004atv.2_Missense_Mutation_p.P277S|FAM120A_uc004atx.2_Missense_Mutation_p.P59S|FAM120A_uc004aty.2_Missense_Mutation_p.P59S	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator	277						cytoplasm|plasma membrane	RNA binding				0						GCTGGTCTTGCCACCTTGCGA	0.502			NA											4	82					0	0	0.009096	0	0
ZNF189	7743	broad.mit.edu	37	9	104171293	104171293	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:104171293C>G	uc004bbh.1	+	3	1519	c.1243C>G	c.(1243-1245)CTT>GTT	p.L415V	ZNF189_uc004bbg.1_Missense_Mutation_p.L373V|ZNF189_uc004bbi.1_Missense_Mutation_p.L401V|ZNF189_uc011lvk.1_Missense_Mutation_p.L400V	NM_003452	NP_003443	O75820	ZN189_HUMAN	zinc finger protein 189 isoform 1	415	C2H2-type 10.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6		Acute lymphoblastic leukemia(62;0.0559)				AAGCTCAGGTCTTATTCAGCA	0.413			NA											18	61					0	0	0.00499	0	0
CEP110	11064	broad.mit.edu	37	9	123917162	123917162	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:123917162G>A	uc004bkx.1	+	25	4367	c.4336G>A	c.(4336-4338)GAG>AAG	p.E1446K	CEP110_uc004bla.1_Missense_Mutation_p.E894K|CEP110_uc010mvo.1_Missense_Mutation_p.E115K|CEP110_uc004blb.1_Missense_Mutation_p.E115K|CEP110_uc010mvp.1_5'Flank	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1446	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						GGCAGAGGCTGAGAGTGAACT	0.463			NA											11	91					0	0	0.016723	0	0
GOLGA2	2801	broad.mit.edu	37	9	131028134	131028134	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:131028134G>A	uc011maw.1	-	10	691	c.678C>T	c.(676-678)CTC>CTT	p.L226L	GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004bul.1_Silent_p.L127L|GOLGA2_uc004bum.1_Silent_p.L100L	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2	226	Potential.					Golgi cisterna membrane	protein binding			ovary(1)	1						TCTCTGATACGAGGATCCCTA	0.502			NA											6	96					0	0	0.001168	0	0
ODF2	4957	broad.mit.edu	37	9	131219695	131219695	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:131219695C>T	uc011mbd.1	+	2	322	c.11C>T	c.(10-12)TCA>TTA	p.S4L	ODF2_uc011maz.1_Intron|ODF2_uc011mba.1_Intron|ODF2_uc010myb.2_Intron|ODF2_uc011mbb.1_Intron|ODF2_uc011mbc.1_Intron|ODF2_uc004bva.2_Intron|ODF2_uc004bvb.2_5'UTR|ODF2_uc011mbe.1_Intron|ODF2_uc004bvc.2_Intron|ODF2_uc010myc.2_Intron|ODF2_uc011mbf.1_Intron|ODF2_uc004bvd.3_Missense_Mutation_p.S4L|ODF2_uc004bve.2_Missense_Mutation_p.S4L	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1	4					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						ATGTCTGCCTCATCCTCAGGC	0.662			NA											13	149					0	0	0.003163	0	0
FAM73B	84895	broad.mit.edu	37	9	131810777	131810777	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:131810777G>C	uc004bxa.2	+	4	565	c.379G>C	c.(379-381)GAG>CAG	p.E127Q	FAM73B_uc004bwy.2_RNA|FAM73B_uc004bwz.2_RNA|FAM73B_uc011mbn.1_Missense_Mutation_p.E127Q	NM_032809	NP_116198	Q7L4E1	FA73B_HUMAN	hypothetical protein LOC84895	127	Ser-rich.					integral to membrane				skin(1)	1						CTCTTCCATTGAGCCCAGCAA	0.642			NA											7	83					0	0	0.00308	0	0
NRK	203447	broad.mit.edu	37	X	105153377	105153377	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chrX:105153377C>G	uc004emd.2	+	13	2047	c.1744C>G	c.(1744-1746)CGA>GGA	p.R582G	NRK_uc010npc.1_Missense_Mutation_p.R250G	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	582							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TGAGTCATTACGAGTAAATGC	0.537			NA								HNSCC(51;0.14)			2	6					0	0	0.004672	0	0
DCAF12L1	139170	broad.mit.edu	37	X	125686524	125686524	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chrX:125686524G>A	uc004eul.2	-	1	319	c.68C>T	c.(67-69)TCG>TTG	p.S23L		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	23										skin(3)|ovary(1)	4						CTGCGACGGCGAGCTCTCGGC	0.582			NA											16	29					0	0	0.00499	0	0
F8	2157	broad.mit.edu	37	X	154157942	154157942	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chrX:154157942C>G	uc004fmt.2	-	14	4294	c.4123G>C	c.(4123-4125)GAC>CAC	p.D1375H		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	1375	B.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCATTGTAGTCTATCTGTGTG	0.438			NA											10	149					0	0	0.008291	0	0
HAS3	3038	broad.mit.edu	37	16	69148849	69148850	+	Frame_Shift_Ins	INS	-	-	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr16:69148849_69148850insC	uc010cfh.2	+	4	1566_1567	c.1342_1343insC	c.(1342-1344)TCCfs	p.S448fs	HAS3_uc002ewk.2_Intron|HAS3_uc002ewl.2_Frame_Shift_Ins_p.S448fs	NM_005329	NP_005320	O00219	HAS3_HUMAN	hyaluronan synthase 3 isoform a	448	Helical; Name=5; (Potential).				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		CCTCTATATGTCCAGCCTTCTG	0.54			NA											18	180	---	---	---	---	NA	NA	NA	NA	NA
MBNL1	4154	broad.mit.edu	37	3	152177135	152177136	+	Splice_Site	DEL	GT	GT	-			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	GT	GT	-	-	GT	GT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:152177135_152177136delGT	uc003ezm.2	+	8	1974	c.1185_splice	c.e8+1		MBNL1_uc003ezh.2_Splice_Site|MBNL1_uc003ezi.2_Splice_Site|MBNL1_uc003ezj.2_Splice_Site|MBNL1_uc003ezl.2_Splice_Site|MBNL1_uc003ezp.2_Splice_Site|MBNL1_uc003ezn.2_Splice_Site|MBNL1_uc003ezo.2_Splice_Site|MBNL1_uc010hvp.2_Splice_Site	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c						embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TCACTAAACAGTAAGTTCATTA	0.292			NA											7	27	---	---	---	---	NA	NA	NA	NA	NA
