Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
ESPNP	284729	broad.mit.edu	37	1	17017751	17017751	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:17017751C>G	uc001azn.1	-	11	1977	c.1863G>C	c.(1861-1863)TGG>TGC	p.W621C		NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						GGTCCCACCTCCAGGCGGGCA	0.662			NA											9	15					0	0	0.004482	0	0
KANK4	163782	broad.mit.edu	37	1	62737210	62737210	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:62737210C>A	uc001dah.3	-	4	2329	c.1952G>T	c.(1951-1953)GGC>GTC	p.G651V	KANK4_uc001dai.3_Missense_Mutation_p.G23V|KANK4_uc001dag.3_Missense_Mutation_p.G7V	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	651										ovary(3)|skin(2)|lung(1)	6						TGCACGGAAGCCATAGTCTTT	0.468			NA											5	154					2.0095e-06	2.15158e-06	0.001984	1	0
LRRIQ3	127255	broad.mit.edu	37	1	74507534	74507534	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:74507534A>G	uc001dfy.3	-	7	1273	c.1081T>C	c.(1081-1083)TCA>CCA	p.S361P	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	361				S -> G (in Ref. 4; AAH62795).						ovary(2)	2						AATGAACCTGAAGTGTATATG	0.353			NA											28	68					0	0	0.004656	0	0
MAGI3	260425	broad.mit.edu	37	1	114196630	114196630	+	Silent	SNP	A	A	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:114196630A>T	uc001edk.2	+	15	2800	c.2619A>T	c.(2617-2619)CCA>CCT	p.P873P	MAGI3_uc001edh.3_Silent_p.P898P|MAGI3_uc001edi.3_Silent_p.P873P|MAGI3_uc010owm.1_Silent_p.P898P|MAGI3_uc001edj.2_Silent_p.P594P	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	898	Interaction with LPAR2 and GRIN2B.|PDZ 5.				apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAACAAACCACCTCCAGGAG	0.463			NA											69	139					0	0	0.01441	0	0
FAM5C	339479	broad.mit.edu	37	1	190067206	190067206	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:190067206G>A	uc001gse.1	-	8	2475	c.2243C>T	c.(2242-2244)GCG>GTG	p.A748V	FAM5C_uc010pot.1_Missense_Mutation_p.A646V	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	748						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					GGCATTAAACGCCTGCAGAGC	0.428			NA											6	158					0	0	0.001984	0	0
TP53BP2	7159	broad.mit.edu	37	1	223983555	223983555	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:223983555G>A	uc010pvb.1	-	13	2978	c.2686C>T	c.(2686-2688)CGC>TGC	p.R896C	TP53BP2_uc001hod.2_Missense_Mutation_p.R767C|TP53BP2_uc010puz.1_Missense_Mutation_p.R129C|TP53BP2_uc010pva.1_Missense_Mutation_p.R535C	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein, 2 isoform 1	890	Mediates interaction with APC2.|Pro-rich.				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)		TCAGGCGGGCGCATGCTCACC	0.537			NA											4	80					0	0	0.000602	0	0
COL17A1	1308	broad.mit.edu	37	10	105800830	105800830	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr10:105800830G>A	uc001kxr.2	-	39	2863	c.2694C>T	c.(2692-2694)TCC>TCT	p.S898S		NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	898	Extracellular (Potential).|Triple-helical region.				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TACCTGAGTTGGACAGGAACG	0.577			NA											6	46					0	0	0.00308	0	0
OR4D9	390199	broad.mit.edu	37	11	59283060	59283060	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:59283060G>A	uc010rkv.1	+	1	675	c.675G>A	c.(673-675)CTG>CTA	p.L225L		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGATGATGCTGAGGTCTCACA	0.488			NA											34	140					0	0	0.012213	0	0
TMEM132A	54972	broad.mit.edu	37	11	60695271	60695271	+	Silent	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:60695271C>T	uc001nqj.2	+	3	667	c.474C>T	c.(472-474)CCC>CCT	p.P158P	TMEM132A_uc001nqi.2_Silent_p.P158P|TMEM132A_uc001nqk.2_Silent_p.P171P|TMEM132A_uc001nql.1_Silent_p.P171P	NM_178031	NP_821174	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform b	158	Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				skin(1)	1						GCAGCCTGCCCTGTGCCCGGC	0.657			NA											10	44					0	0	0.010729	0	0
C11orf9	745	broad.mit.edu	37	11	61539415	61539415	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:61539415A>G	uc001nsc.1	+	7	1202	c.1106A>G	c.(1105-1107)TAC>TGC	p.Y369C	C11orf9_uc001nse.1_Missense_Mutation_p.Y360C	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	369	NDT80.				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						GATGCTAACTACAAGGAGCTG	0.617			NA											15	58					0	0	0.00499	0	0
FRMD8	83786	broad.mit.edu	37	11	65172387	65172387	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:65172387C>T	uc001odu.3	+	10	1316	c.1124C>T	c.(1123-1125)GCG>GTG	p.A375V	FRMD8_uc009yqj.2_Missense_Mutation_p.A319V|FRMD8_uc010rof.1_Missense_Mutation_p.A341V	NM_031904	NP_114110	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	375	FERM.					cytoskeleton	binding			lung(1)|pancreas(1)	2						AGCCAGGCGGCGGAGCCCGCA	0.682			NA											7	37					0	0	0.006214	0	0
SAPS3	55291	broad.mit.edu	37	11	68337296	68337296	+	Silent	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:68337296T>C	uc001onw.2	+	11	1476	c.1209T>C	c.(1207-1209)CCT>CCC	p.P403P	SAPS3_uc001onv.2_Silent_p.P403P|SAPS3_uc001ony.3_Silent_p.P403P|SAPS3_uc001onx.2_Silent_p.P403P|SAPS3_uc009ysh.2_Silent_p.P352P|SAPS3_uc001onu.2_Silent_p.P352P|SAPS3_uc010rqc.1_Silent_p.P171P|SAPS3_uc010rqd.1_Silent_p.P115P	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	403					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			TTGCAAGTCCTTTTGAAAACA	0.333			NA											3	174					0	0	0.009096	0	0
MMP27	64066	broad.mit.edu	37	11	102565710	102565710	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102565710G>A	uc001phd.1	-	7	1044	c.1021C>T	c.(1021-1023)CTG>TTG	p.L341L		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	341	Hemopexin-like 2.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		TTAAAAACCAGAATCTTATCT	0.428			NA											7	31					0	0	0.001984	0	0
MMP27	64066	broad.mit.edu	37	11	102565768	102565768	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102565768G>C	uc001phd.1	-	7	986	c.963C>G	c.(961-963)TTC>TTG	p.F321L		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	321	Hemopexin-like 1.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		GAGATGGCCAGAATGAAGCAA	0.423			NA											6	74					0	0	0.00308	0	0
MMP27	64066	broad.mit.edu	37	11	102565801	102565801	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102565801G>A	uc001phd.1	-	7	953	c.930C>T	c.(928-930)ATC>ATT	p.I310I		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	310	Hemopexin-like 1.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		CAACATCCGTGATATCATAAT	0.388			NA											7	92					0	0	0.001984	0	0
MMP12	4321	broad.mit.edu	37	11	102743681	102743681	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102743681G>A	uc001phk.2	-	2	309	c.264C>T	c.(262-264)CAC>CAT	p.H88H		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	88					positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	ATCGAGGTGCGTGCATCATCT	0.483			NA											6	19					0	0	0.001168	0	0
SLCO1B1	10599	broad.mit.edu	37	12	21355464	21355464	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr12:21355464T>C	uc001req.3	+	10	1279	c.1175T>C	c.(1174-1176)TTA>TCA	p.L392S		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	392	Helical; Name=8; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	GGAATGTTTTTAGGAGGATAT	0.289			NA											18	30					0	0	0.007413	0	0
RPL6	6128	broad.mit.edu	37	12	112843710	112843710	+	Missense_Mutation	SNP	T	T	G	rs148929822	byFrequency	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr12:112843710T>G	uc001ttu.2	-	6	890	c.661A>C	c.(661-663)AAG>CAG	p.K221Q	RPL6_uc001ttv.2_Missense_Mutation_p.K221Q	NM_001024662	NP_001019833	Q02878	RL6_HUMAN	ribosomal protein L6	221					endocrine pancreas development|regulation of transcription, DNA-dependent|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	DNA binding|RNA binding|structural constituent of ribosome			large_intestine(1)	1						TTCCGCAGCTTCTTCTTCTTG	0.423			NA											15	79					0	0	0.00499	0	0
CFL2	1073	broad.mit.edu	37	14	35182544	35182544	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr14:35182544G>A	uc001wsg.3	-	2	368	c.227C>T	c.(226-228)CCT>CTT	p.P76L	CFL2_uc010tpn.1_Missense_Mutation_p.P59L|CFL2_uc001wsh.3_Missense_Mutation_p.P76L|CFL2_uc001wsi.3_Intron|CFL2_uc001wsj.3_Intron	NM_021914	NP_068733	Q9Y281	COF2_HUMAN	cofilin 2	76	ADF-H.					cytoplasm|cytoskeleton|nuclear matrix	actin binding			breast(2)	2	Breast(36;0.0361)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)		ATCATTCAGAGGTAGCAACTT	0.383			NA											26	88					0	0	0.005443	0	0
SSTR1	6751	broad.mit.edu	37	14	38679102	38679102	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr14:38679102C>T	uc001wul.1	+	3	1125	c.508C>T	c.(508-510)CGG>TGG	p.R170W	SSTR1_uc010amu.1_Intron	NM_001049	NP_001040	P30872	SSR1_HUMAN	somatostatin receptor 1	170	Cytoplasmic (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity			central_nervous_system(3)|ovary(1)|lung(1)	5	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)	CCGCTACCGCCGGCCCACCGT	0.637			NA											5	39					0	0	0.001168	0	0
MIA2	117153	broad.mit.edu	37	14	39716224	39716224	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr14:39716224A>T	uc001wux.2	+	4	640	c.446A>T	c.(445-447)GAT>GTT	p.D149V	MIA2_uc010amy.1_Missense_Mutation_p.D80V	NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	149						extracellular region				ovary(1)|breast(1)	2	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		GAAGATAAAGATGAAAAATCT	0.299			NA											9	34					0	0	0.006214	0	0
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652			NA											5	11					0	0	0.00308	0	0
RRN3P1	730092	broad.mit.edu	37	16	21817457	21817457	+	Silent	SNP	G	G	A	rs150520281	by1000genomes	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:21817457G>A	uc010vbl.1	-	7	603	c.106C>T	c.(106-108)CTG>TTG	p.L36L	uc002diq.3_Intron	NR_003370				SubName: Full=Putative uncharacterized protein ENSP00000219758;												0						CTTACATCCAGCTTGAGTAGT	0.254			NA											4	17					0	0	0.001168	0	0
ITGAM	3684	broad.mit.edu	37	16	31282350	31282351	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:31282350_31282351GG>TT	uc002ebq.2	+	6	601_602	c.503_504GG>TT	c.(502-504)CGG>CTT	p.R168L	ITGAM_uc002ebr.2_Missense_Mutation_p.R168L	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	168	VWFA.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						GACTTTCGGCGGATGAAGGAGT	0.465			NA											50	133					0	0	0.004672	0	0
SALL1	6299	broad.mit.edu	37	16	51173914	51173914	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:51173914C>T	uc010vgs.1	-	2	2250	c.2219G>A	c.(2218-2220)GGC>GAC	p.G740D	SALL1_uc010vgr.1_Missense_Mutation_p.G643D|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	740	C2H2-type 4.				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAAAGCCCGGCCACAGATCTT	0.552	GBM(103;1352 1446 1855 4775 8890)		NA											6	33					0	0	0.001168	0	0
IRX6	79190	broad.mit.edu	37	16	55360423	55360423	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:55360423C>T	uc002ehy.2	+	2	754	c.221C>T	c.(220-222)CCC>CTC	p.P74L	IRX6_uc002ehx.2_Missense_Mutation_p.P74L|IRX6_uc010ccb.1_RNA	NM_024335	NP_077311	P78412	IRX6_HUMAN	iroquois homeobox protein 6	74						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	p.P74H(1)		central_nervous_system(5)|ovary(1)	6						TATGGAGCACCCTATGCGGCC	0.672			NA											5	6					0	0	0.001984	0	0
PKD1L2	114780	broad.mit.edu	37	16	81151065	81151065	+	Silent	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:81151065G>T	uc002fgh.1	-	41	6684	c.6684C>A	c.(6682-6684)ATC>ATA	p.I2228I	PKD1L2_uc002fgf.1_Silent_p.I28I|PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	2228	Helical; (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						AGCTGGCCAGGATGATGGCCA	0.612			NA											41	50					1.00001e-27	1.2184e-27	0.009718	1	0
Unknown	0	broad.mit.edu	37	16	90161578	90161578	+	Silent	SNP	G	G	A	rs13337896	by1000genomes	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:90161578G>A	uc002fqp.2	+	3	931	c.453G>A	c.(451-453)ACG>ACA	p.T151T	uc002fqq.2_Silent_p.T168T					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.												NA						GCCAAGGGACGCTACACCGAA	0.587			NA											6	21					0	0	0.001168	0	0
ZZEF1	23140	broad.mit.edu	37	17	3990763	3990763	+	Silent	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:3990763C>T	uc002fxe.2	-	14	2371	c.2307G>A	c.(2305-2307)CAG>CAA	p.Q769Q	ZZEF1_uc002fxk.1_Silent_p.Q769Q	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	769							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TCCAGAAGATCTGCAAATCAA	0.303			NA											8	41					0	0	0.006214	0	0
RABEP1	9135	broad.mit.edu	37	17	5286437	5286437	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:5286437G>A	uc002gbm.3	+	18	2732	c.2508G>A	c.(2506-2508)CGG>CGA	p.R836R	RABEP1_uc010vsw.1_Silent_p.R793R|RABEP1_uc002gbl.3_Silent_p.R803R|NUP88_uc002gbn.2_Intron	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	836					apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						AGCGGATCCGGCAAGCTGACT	0.473			NA											3	53					0	0	0.004672	0	0
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Nonsense_Mutation	SNP	C	C	A	rs112431538		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:7577085C>A	uc002gim.2	-	8	1047	c.853G>T	c.(853-855)GAG>TAG	p.E285*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.E285*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E153*|TP53_uc010cng.1_Nonsense_Mutation_p.E153*|TP53_uc002gii.1_Nonsense_Mutation_p.E153*|TP53_uc010cnh.1_Nonsense_Mutation_p.E285*|TP53_uc010cni.1_Nonsense_Mutation_p.E285*|TP53_uc002gij.2_Nonsense_Mutation_p.E285*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	285	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCTCTTCCTCTGTGCGCCGG	0.562	Pancreas(47;798 1329 9957 10801)		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			33	22					2.08457e-15	2.37596e-15	0.010818	1	0
PIP4K2B	8396	broad.mit.edu	37	17	36935652	36935652	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:36935652C>T	uc002hqs.2	-	5	1119	c.638G>A	c.(637-639)CGC>CAC	p.R213H	PIP4K2B_uc010wdt.1_Missense_Mutation_p.R213H|PIP4K2B_uc010wdu.1_Missense_Mutation_p.R149H	NM_003559	NP_003550	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	213	PIPK.				cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity			ovary(1)	1						GTCATACTTGCGATGCACAGT	0.552			NA											4	139					0	0	0.001168	0	0
MED13	9969	broad.mit.edu	37	17	60040305	60040305	+	Silent	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:60040305G>T	uc002izo.2	-	21	4949	c.4872C>A	c.(4870-4872)ATC>ATA	p.I1624I		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1624					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						CATCTGTGGGGATTCCCACTT	0.388			NA											41	156					5.44703e-19	6.41539e-19	0.009718	1	0
CCDC45	90799	broad.mit.edu	37	17	62504728	62504728	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:62504728A>G	uc002jem.2	+	2	96	c.38A>G	c.(37-39)AAT>AGT	p.N13S	CCDC45_uc002jen.2_RNA|CCDC45_uc010wqb.1_5'UTR|DDX5_uc010deh.2_5'Flank|DDX5_uc002jek.2_5'Flank|DDX5_uc002jej.2_5'Flank|DDX5_uc010wqa.1_5'Flank	NM_138363	NP_612372	Q96GE4	CEP95_HUMAN	coiled-coil domain containing 45	13						centrosome|spindle pole	protein binding				0	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			ACCATTGCCAATAACCTTCTT	0.348			NA											22	48					0	0	0.014323	0	0
TBC1D16	125058	broad.mit.edu	37	17	77915948	77915948	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:77915948C>T	uc002jxj.2	-	11	2082	c.1966G>A	c.(1966-1968)GTC>ATC	p.V656I	TBC1D16_uc002jxh.2_Missense_Mutation_p.V294I|TBC1D16_uc002jxi.2_Missense_Mutation_p.V281I	NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	656						intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			TGCTCGATGACGTCATCCCCG	0.612	Ovarian(14;397 562 4850 31922 49378)		NA											5	18					0	0	0.001168	0	0
BAHCC1	57597	broad.mit.edu	37	17	79409981	79409981	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:79409981C>T	uc002kaf.2	+	3	1606	c.1606C>T	c.(1606-1608)CCA>TCA	p.P536S	BAHCC1_uc002kae.2_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	536							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GGCCGGCCCCCCAGGGGCACA	0.692			NA											20	12					0	0	0.014323	0	0
P4HB	5034	broad.mit.edu	37	17	79804869	79804869	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:79804869C>T	uc002kbn.1	-	6	1006	c.809G>A	c.(808-810)GGC>GAC	p.G270D	P4HB_uc002kbl.1_5'UTR|P4HB_uc002kbm.1_5'UTR	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor	270					cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			GCTCAGTTTGCCGTCATAGTC	0.507	Colon(49;444 983 1296 7887 42561)		NA											6	409					0	0	0.001168	0	0
C18orf34	374864	broad.mit.edu	37	18	30791980	30791980	+	Silent	SNP	T	T	A	rs61749300		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr18:30791980T>A	uc002kxn.2	-	19	2260	c.2118A>T	c.(2116-2118)GCA>GCT	p.A706A	C18orf34_uc010dme.1_Silent_p.A220A|C18orf34_uc010xbr.1_Silent_p.A706A|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Silent_p.A668A|C18orf34_uc002kxp.2_Silent_p.A706A	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	706										ovary(1)	1						ACACAGTTTGTGCATGTTCCC	0.323			NA											7	27					0	0	0.00308	0	0
RPSAP58	388524	broad.mit.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:24010294C>G	uc002nrn.2	+	4	754	c.331C>G	c.(331-333)CAG>GAG	p.Q111E		NM_002295	NP_002286			ribosomal protein SA												0						CTTCACTAACCAGATCCAGGC	0.567			NA											3	49					0	0	0.004672	0	0
GYS1	2997	broad.mit.edu	37	19	49494725	49494725	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:49494725G>T	uc002plp.2	-	2	375	c.134C>A	c.(133-135)ACG>AAG	p.T45K	GYS1_uc010xzy.1_Intron|GYS1_uc010emm.2_Missense_Mutation_p.T45K|GYS1_uc010xzz.1_Intron|GYS1_uc010yaa.1_Intron|RUVBL2_uc002plq.1_5'Flank|RUVBL2_uc010yab.1_5'Flank|RUVBL2_uc002plr.1_5'Flank|RUVBL2_uc002pls.1_5'Flank|RUVBL2_uc010emn.1_5'Flank	NM_002103	NP_002094	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle) isoform 1	45					glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding			ovary(2)	2		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CTGCAGCACCGTGTAGATGCC	0.672			NA											14	108					2.32078e-09	2.53612e-09	0.003163	1	0
SIGLEC9	27180	broad.mit.edu	37	19	51630513	51630513	+	Silent	SNP	T	T	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:51630513T>A	uc002pvu.2	+	4	1042	c.975T>A	c.(973-975)CCT>CCA	p.P325P	SIGLEC9_uc010yct.1_Silent_p.P325P	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	325	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CTCAGAACCCTCTCGGCTCTC	0.612			NA											6	14					0	0	0.001168	0	0
NLRP4	147945	broad.mit.edu	37	19	56382251	56382251	+	Missense_Mutation	SNP	C	C	G	rs144714657	by1000genomes	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:56382251C>G	uc002qmd.3	+	7	2835	c.2413C>G	c.(2413-2415)CGT>GGT	p.R805G	NLRP4_uc002qmf.2_Missense_Mutation_p.R730G|NLRP4_uc010etf.2_Missense_Mutation_p.R580G	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	805							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AATGCTTCTGCGTAACAAGAG	0.522			NA											25	39					0	0	0.003954	0	0
NCOA1	8648	broad.mit.edu	37	2	24930566	24930566	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:24930566T>G	uc002rfk.2	+	11	2485	c.2227T>G	c.(2227-2229)TCA>GCA	p.S743A	NCOA1_uc010eye.2_Missense_Mutation_p.S743A|NCOA1_uc002rfi.2_Missense_Mutation_p.S592A|NCOA1_uc002rfj.2_Missense_Mutation_p.S743A|NCOA1_uc002rfl.2_Missense_Mutation_p.S743A	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	743									PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAAAAAGAATCAAAAGACCA	0.383			NA	T	PAX3	alveolar rhadomyosarcoma								24	34					0	0	0.014323	0	0
XDH	7498	broad.mit.edu	37	2	31598368	31598368	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:31598368G>A	uc002rnv.1	-	15	1559	c.1480C>T	c.(1480-1482)CTG>TTG	p.L494L		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	494					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	GGCAGATGCAGCTCCTCTGCC	0.627	Colon(66;682 1445 30109 40147)		NA											22	26					0	0	0.012319	0	0
SLC25A12	8604	broad.mit.edu	37	2	172644412	172644412	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:172644412G>A	uc002uhh.2	-	16	1720	c.1631C>T	c.(1630-1632)ACA>ATA	p.T544I	SLC25A12_uc010fqh.2_Missense_Mutation_p.T437I	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12	544	Solcar 3.				gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	CTGCAGTCTTGTCTTGATGAC	0.493			NA											10	21					0	0	0.001855	0	0
MYO1B	4430	broad.mit.edu	37	2	192225432	192225432	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:192225432C>G	uc010fsg.2	+	8	893	c.638C>G	c.(637-639)TCT>TGT	p.S213C	MYO1B_uc002usq.2_Missense_Mutation_p.S213C|MYO1B_uc002usr.2_Missense_Mutation_p.S213C|MYO1B_uc002uss.1_Missense_Mutation_p.S213C	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	213	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CAGCTGCTCTCTGGTGCCTCT	0.318			NA											90	112					0	0	0.01441	0	0
SPAG4	6676	broad.mit.edu	37	20	34207180	34207180	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr20:34207180G>A	uc002xdb.1	+	9	974	c.857G>A	c.(856-858)TGG>TAG	p.W286*	SPAG4_uc010zvi.1_Nonsense_Mutation_p.W209*	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	286	SUN.				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			GCCTACTTCTGGAATCGCTTC	0.597			NA											27	203					0	0	0.010818	0	0
SPAG4	6676	broad.mit.edu	37	20	34208665	34208665	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr20:34208665G>C	uc002xdb.1	+	11	1254	c.1137G>C	c.(1135-1137)GAG>GAC	p.E379D	SPAG4_uc010zvi.1_Missense_Mutation_p.E302D	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	379	SUN.				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TCGATGTTGAGAAATCGGAGA	0.507			NA											20	279					0	0	0.012319	0	0
COL6A2	1292	broad.mit.edu	37	21	47532313	47532313	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr21:47532313G>T	uc002zia.1	+	3	618	c.536G>T	c.(535-537)CGG>CTG	p.R179L	COL6A2_uc002zhy.1_Missense_Mutation_p.R179L|COL6A2_uc002zhz.1_Missense_Mutation_p.R179L|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	179	VWFA 1.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CAGGCCGAGCGGGCCCGCGAG	0.716			NA											14	10					1.3612e-06	1.47232e-06	0.003163	1	0
TOP3B	8940	broad.mit.edu	37	22	22323138	22323138	+	Silent	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr22:22323138A>G	uc002zvs.2	-	7	1026	c.591T>C	c.(589-591)ACT>ACC	p.T197T	TOP3B_uc010gtm.1_5'Flank|TOP3B_uc002zvr.2_5'UTR|TOP3B_uc010gtl.2_Silent_p.T197T|TOP3B_uc002zvt.3_Silent_p.T197T	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	197					DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GGAAATATTTAGTCTGAAACC	0.488			NA											3	99					0	0	0.009096	0	0
FGD5	152273	broad.mit.edu	37	3	14862467	14862467	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr3:14862467C>A	uc003bzc.2	+	1	1999	c.1889C>A	c.(1888-1890)ACA>AAA	p.T630K	FGD5_uc011avk.1_Missense_Mutation_p.T630K	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	630					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						AAGCCCATCACAAAGAGCTCT	0.547			NA											9	36					0.00829132	0.00861647	0.008291	1	0
DPPA4	55211	broad.mit.edu	37	3	109049557	109049557	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr3:109049557G>A	uc003dxq.3	-	5	548	c.493C>T	c.(493-495)CCT>TCT	p.P165S	DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Missense_Mutation_p.P165S	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	165						nucleus	protein binding			upper_aerodigestive_tract(1)	1						ACTTCAGGAGGATGTGTCTCA	0.483			NA											36	58					0	0	0.004289	0	0
TTC14	151613	broad.mit.edu	37	3	180320181	180320181	+	Silent	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr3:180320181C>T	uc003fkk.2	+	1	264	c.132C>T	c.(130-132)GGC>GGT	p.G44G	TTC14_uc003fkl.2_Silent_p.G44G|TTC14_uc003fkm.2_Silent_p.G44G	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	44							RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CAGCCCGGGGCCCGCCGCCCC	0.672			NA											5	5					0	0	0.001168	0	0
RGS12	6002	broad.mit.edu	37	4	3344679	3344679	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:3344679C>T	uc003ggw.2	+	3	2801	c.1897C>T	c.(1897-1899)CGG>TGG	p.R633W	RGS12_uc003ggu.2_Missense_Mutation_p.R633W|RGS12_uc010ics.1_5'UTR|RGS12_uc011bvr.1_RNA|RGS12_uc003ggv.2_Missense_Mutation_p.R633W|RGS12_uc003ggy.1_Missense_Mutation_p.R31W|RGS12_uc003ggx.1_Missense_Mutation_p.R633W	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	633						condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AAAATTTGGGCGGGGAACTGG	0.448			NA											10	57					0	0	0.013537	0	0
C1QTNF7	114905	broad.mit.edu	37	4	15444073	15444073	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:15444073G>C	uc011bxb.1	+	3	747	c.520G>C	c.(520-522)GAG>CAG	p.E174Q	C1QTNF7_uc003gno.2_Missense_Mutation_p.E181Q|C1QTNF7_uc003gnp.2_Missense_Mutation_p.E174Q	NM_001135171	NP_001128643	Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	174	C1q.					collagen					0						CCTCTTCAACGAGGGAGAGCA	0.443			NA											7	269					0	0	0.00308	0	0
TECRL	253017	broad.mit.edu	37	4	65146797	65146797	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:65146797G>T	uc003hcv.2	-	11	1035	c.926C>A	c.(925-927)TCA>TAA	p.S309*	TECRL_uc010ihi.2_Intron	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	309					lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0						ACTAATCCATGATCCAATCTG	0.284			NA											5	25					3.59834e-05	3.77647e-05	0.001168	1	0
WDFY3	23001	broad.mit.edu	37	4	85781638	85781638	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:85781638C>T	uc003hpd.2	-	4	515	c.107G>A	c.(106-108)TGC>TAC	p.C36Y	WDFY3_uc003hpf.2_Missense_Mutation_p.C36Y	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	36						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGGAGGATGGCACAACTCCGT	0.557			NA											16	47					0	0	0.006122	0	0
NAP1L5	266812	broad.mit.edu	37	4	89618409	89618409	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:89618409C>T	uc003hrx.2	-	1	615	c.497G>A	c.(496-498)GGG>GAG	p.G166E	HERC3_uc003hrw.1_Intron|HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_153757	NP_715638	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	166					nucleosome assembly	nucleus	protein binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		ATGTTTGGCCCCCGCGGCAGC	0.373			NA											27	75					0	0	0.008361	0	0
PCDH18	54510	broad.mit.edu	37	4	138453153	138453153	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:138453153C>G	uc003ihe.3	-	1	477	c.90G>C	c.(88-90)TTG>TTC	p.L30F	PCDH18_uc003ihf.3_Missense_Mutation_p.L23F|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Intron|PCDH18_uc011cha.1_Intron	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	30	Extracellular (Potential).|Cadherin 1.				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					TCCTGTATTTCAAATTCTTGC	0.378			NA											3	117					0	0	0.009096	0	0
C5orf51	285636	broad.mit.edu	37	5	41904478	41904478	+	Silent	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:41904478C>G	uc003jmo.2	+	1	9	c.9C>G	c.(7-9)GCC>GCG	p.A3A		NM_175921	NP_787117	A6NDU8	CE051_HUMAN	hypothetical protein LOC285636	3											0						CCATGGCGGCCGCAGTCTCTA	0.662			NA											10	10					0	0	0.001855	0	0
ITGA2	3673	broad.mit.edu	37	5	52360756	52360756	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:52360756G>A	uc003joy.2	+	14	1760	c.1617G>A	c.(1615-1617)CAG>CAA	p.Q539Q	ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Silent_p.Q463Q|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	539	FG-GAP 5.|Extracellular (Potential).				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TTTTGGGTCAGCACCAATTTC	0.368			NA											3	50					0	0	0.009096	0	0
RIOK2	55781	broad.mit.edu	37	5	96503628	96503628	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:96503628C>G	uc003kmz.2	-	8	1050	c.940G>C	c.(940-942)GAA>CAA	p.E314Q	RIOK2_uc003kna.3_Missense_Mutation_p.E314Q	NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1	314	Protein kinase.						ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TGAAGCAGTTCATCATCTGCC	0.408			NA											26	91					0	0	0.00632	0	0
PCDHGB1	56104	broad.mit.edu	37	5	140730641	140730641	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:140730641G>A	uc003ljo.1	+	1	814	c.814G>A	c.(814-816)GCA>ACA	p.A272T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Missense_Mutation_p.A272T	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	272	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCATTAATGCAGAGATCAC	0.498			NA											24	89					0	0	0.00333	0	0
ODZ2	57451	broad.mit.edu	37	5	167551958	167551958	+	Silent	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:167551958C>A	uc010jjd.2	+	11	2112	c.2112C>A	c.(2110-2112)GTC>GTA	p.V704V	ODZ2_uc003lzr.3_Silent_p.V472V|ODZ2_uc003lzt.3_Silent_p.V68V|ODZ2_uc010jje.2_5'UTR|uc003lzs.1_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TGGCGAGGGTCCAGTGCCCAG	0.617			NA											4	19					0.00909568	0.0093606	0.009096	1	0
PAK1IP1	55003	broad.mit.edu	37	6	10702848	10702848	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:10702848C>A	uc003mzg.2	+	4	450	c.419C>A	c.(418-420)TCG>TAG	p.S140*		NM_017906	NP_060376	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1	140	WD 3.				negative regulation of signal transduction	nucleolus|plasma membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				TTGGCCCTGTCGGTTGGTACA	0.408			NA											30	112					1.61788e-16	1.88456e-16	0.012213	1	0
HIST1H3F	8968	broad.mit.edu	37	6	26250719	26250719	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:26250719G>T	uc003nhg.1	-	1	117	c.115C>A	c.(115-117)CCC>ACC	p.P39T	HIST1H2BH_uc003nhh.2_5'Flank	NM_021018	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3f	39					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0						TAGCGGTGGGGCTTCTTCACG	0.612			NA											27	89					6.55177e-30	8.07544e-30	0.007291	1	0
BAT1	7919	broad.mit.edu	37	6	31508296	31508296	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:31508296T>G	uc003ntt.2	-	2	645	c.14A>C	c.(13-15)GAT>GCT	p.D5A	BAT1_uc003nts.2_Missense_Mutation_p.D5A|BAT1_uc011dnn.1_Missense_Mutation_p.M1L|BAT1_uc003ntu.2_Missense_Mutation_p.D5A|BAT1_uc003ntv.2_Missense_Mutation_p.D5A|BAT1_uc003ntw.2_Missense_Mutation_p.D5A|BAT1_uc003ntx.2_Missense_Mutation_p.D5A|BAT1_uc011dno.1_Missense_Mutation_p.M1L|BAT1_uc011dnp.1_Missense_Mutation_p.M1L|BAT1_uc011dnq.1_RNA	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1	5					intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						ATTGTCCACATCGTTCTCTGC	0.552			NA											16	66					0	0	0.007413	0	0
BTNL2	56244	broad.mit.edu	37	6	32362585	32362585	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:32362585G>A	uc003obg.1	-	6	1296	c.1296C>T	c.(1294-1296)GAC>GAT	p.D432D	BTNL2_uc010jty.1_Silent_p.D155D|BTNL2_uc010jtz.1_RNA|BTNL2_uc010jua.1_Silent_p.D222D	NM_019602	NP_062548	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2	432	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1						AACAAGTGACGTCCACAGCGG	0.498			NA											29	135					0	0	0.010818	0	0
PLEKHG1	57480	broad.mit.edu	37	6	151142342	151142342	+	Missense_Mutation	SNP	C	C	T	rs140780640	byFrequency	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:151142342C>T	uc003qny.1	+	14	1732	c.1420C>T	c.(1420-1422)CGG>TGG	p.R474W	PLEKHG1_uc011eel.1_Missense_Mutation_p.R514W|PLEKHG1_uc011eem.1_Missense_Mutation_p.R533W|PLEKHG1_uc003qnz.2_Missense_Mutation_p.R474W	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G	474					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ACCTTCCTCACGGTCACATAA	0.333			NA											14	41					0	0	0.00245	0	0
SYNE1	23345	broad.mit.edu	37	6	152671318	152671318	+	Silent	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:152671318T>C	uc010kiw.2	-	72	12488	c.11886A>G	c.(11884-11886)CAA>CAG	p.Q3962Q	SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Silent_p.Q3962Q|SYNE1_uc010kja.1_Silent_p.Q667Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3962	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGTGGGCCAATTGCTGGGTGA	0.453			NA								HNSCC(10;0.0054)			9	41					0	0	0.008291	0	0
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	T	G	rs121434568		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:55259515T>G	uc003tqk.2	+	21	2819	c.2573T>G	c.(2572-2574)CTG>CGG	p.L858R	EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R|uc003tqo.2_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	858	Cytoplasmic (Potential).|Protein kinase.		L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity).|L -> M (found in a lung cancer sample).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.L858R(3429)|p.L858L(4)|p.L858M(4)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858K(1)|p.L858G(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GATTTTGGGCTGGCCAAACTG	0.537		L858R(NCIH1975_LUNG)	8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			23	57					0	0	0.00278	0	0
WBSCR17	64409	broad.mit.edu	37	7	71175812	71175812	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:71175812G>A	uc003tvy.2	+	10	1567	c.1567G>A	c.(1567-1569)GAC>AAC	p.D523N	WBSCR17_uc003tvz.2_Missense_Mutation_p.D222N	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	523	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ACTCCTCCCTGACACCCGCTG	0.612			NA											15	61					0	0	0.003163	0	0
HEPACAM2	253012	broad.mit.edu	37	7	92838013	92838013	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:92838013G>A	uc003umm.2	-	4	915	c.892C>T	c.(892-894)CGC>TGC	p.R298C	HEPACAM2_uc003uml.2_Missense_Mutation_p.R286C|HEPACAM2_uc010lff.2_Missense_Mutation_p.R286C|HEPACAM2_uc011khy.1_Missense_Mutation_p.R321C	NM_001039372	NP_001034461	A8MVW5	HECA2_HUMAN	HEPACAM family member 2 isoform 1	298	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane				ovary(3)|breast(1)|kidney(1)	5						ACTTCTAAGCGAGGCCCATGC	0.448			NA											39	59					0	0	0.004878	0	0
PSMC2	5701	broad.mit.edu	37	7	103006539	103006539	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:103006539G>A	uc003vbs.2	+	9	843	c.773G>A	c.(772-774)CGT>CAT	p.R258H	SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|PSMC2_uc011klo.1_Missense_Mutation_p.R121H	NM_002803	NP_002794	P35998	PRS7_HUMAN	proteasome 26S ATPase subunit 2	258					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0						CGAATGGTTCGTGAACTCTTT	0.313			NA											25	91					0	0	0.008361	0	0
MKLN1	4289	broad.mit.edu	37	7	131113849	131113849	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:131113849C>T	uc011kpm.1	+	9	969	c.905C>T	c.(904-906)GCG>GTG	p.A302V	MKLN1_uc011kpl.1_Missense_Mutation_p.A279V|MKLN1_uc010lmh.2_Missense_Mutation_p.A302V|MKLN1_uc003vqs.2_Missense_Mutation_p.A95V	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing	302	Kelch 1.				signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					GACTTCTGGGCGTACAGTGTG	0.388			NA											9	80					0	0	0.008291	0	0
CSMD1	64478	broad.mit.edu	37	8	3226892	3226892	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:3226892G>C	uc011kwk.1	-	19	3176	c.2786C>G	c.(2785-2787)GCT>GGT	p.A929G	CSMD1_uc011kwj.1_Missense_Mutation_p.A321G|CSMD1_uc003wqe.2_Missense_Mutation_p.A85G	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	929	Extracellular (Potential).|Sushi 5.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCCACATAGAGCTTAAAATAA	0.388			NA											3	19					0	0	0.004672	0	0
FDFT1	2222	broad.mit.edu	37	8	11683576	11683576	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:11683576G>A	uc003wui.2	+	5	706	c.554G>A	c.(553-555)CGT>CAT	p.R185H	FDFT1_uc003wuh.2_Missense_Mutation_p.R121H|FDFT1_uc010lsa.1_Missense_Mutation_p.R100H|FDFT1_uc011kxe.1_Missense_Mutation_p.R121H|FDFT1_uc011kxf.1_Missense_Mutation_p.R142H|FDFT1_uc011kxg.1_Intron|FDFT1_uc003wuj.2_Missense_Mutation_p.R178H|FDFT1_uc010lsb.2_Missense_Mutation_p.R121H|FDFT1_uc011kxh.1_Missense_Mutation_p.R121H|FDFT1_uc011kxi.1_RNA|FDFT1_uc011kxj.1_Missense_Mutation_p.R121H|FDFT1_uc003wuk.2_Missense_Mutation_p.R244H|FDFT1_uc011kxk.1_Missense_Mutation_p.R100H	NM_004462	NP_004453	P37268	FDFT_HUMAN	squalene synthase	185					cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)		GGCCTTTCCCGTCTTTTCTCA	0.428			NA											20	85					0	0	0.014323	0	0
PTDSS1	9791	broad.mit.edu	37	8	97321848	97321848	+	Silent	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:97321848T>C	uc003yht.1	+	9	1173	c.1071T>C	c.(1069-1071)TTT>TTC	p.F357F	PTDSS1_uc003yhu.1_Silent_p.F211F	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	357	Helical; (Potential).				phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	GCTGGGTGTTTGGGTGAGTAA	0.408			NA											18	38					0	0	0.00278	0	0
CSMD3	114788	broad.mit.edu	37	8	113564858	113564858	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:113564858C>A	uc003ynu.2	-	26	4485	c.4326G>T	c.(4324-4326)ATG>ATT	p.M1442I	CSMD3_uc003yns.2_Missense_Mutation_p.M714I|CSMD3_uc003ynt.2_Missense_Mutation_p.M1402I|CSMD3_uc011lhx.1_Missense_Mutation_p.M1338I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1442	Extracellular (Potential).|CUB 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CAATCATCCACATGCAACGCA	0.378			NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			28	42					7.01153e-11	7.7419e-11	0.007291	1	0
ASS1	445	broad.mit.edu	37	9	133364742	133364742	+	Silent	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr9:133364742C>A	uc004bzm.2	+	13	1217	c.861C>A	c.(859-861)GGC>GGA	p.G287G	ASS1_uc004bzn.2_Silent_p.G287G|ASS1_uc010mza.2_Silent_p.G363G|ASS1_uc004bzo.2_Silent_p.G268G|ASS1_uc010mzb.2_Silent_p.G325G|ASS1_uc004bzp.2_Silent_p.G287G|ASS1_uc010mzc.2_Silent_p.G287G	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1	287					arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	CCCCAGCAGGCACCATCCTTT	0.488			NA											8	96					2.52707e-12	2.81968e-12	0.006214	1	0
TUBBP5	643224	broad.mit.edu	37	9	141071420	141071420	+	Missense_Mutation	SNP	G	G	A	rs147421666	by1000genomes	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr9:141071420G>A	uc004com.2	+	4	1084	c.823G>A	c.(823-825)GAC>AAC	p.D275N	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						CTGGTTCCCCGACAACGTAAA	0.512			NA											6	75					0	0	0.004482	0	0
TUBBP5	643224	broad.mit.edu	37	9	141071629	141071629	+	Silent	SNP	T	T	C	rs151137528	by1000genomes	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr9:141071629T>C	uc004com.2	+	4	1293	c.1032T>C	c.(1030-1032)AAT>AAC	p.N344N	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						GCAACATGAATGACCTGGTGT	0.423			NA											27	82					0	0	0.003954	0	0
ATRX	546	broad.mit.edu	37	X	76875916	76875916	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chrX:76875916G>T	uc004ecp.3	-	20	5451	c.5219C>A	c.(5218-5220)TCA>TAA	p.S1740*	ATRX_uc004ecq.3_Nonsense_Mutation_p.S1702*|ATRX_uc004eco.3_Nonsense_Mutation_p.S1525*	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1740	Helicase ATP-binding.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	CCTCCTCCTTGATCGTATAGA	0.333			NA	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						8	43					1.12685e-05	1.19446e-05	0.004482	1	0
ACTRT1	139741	broad.mit.edu	37	X	127185954	127185954	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chrX:127185954G>T	uc004eum.2	-	1	429	c.232C>A	c.(232-234)CTG>ATG	p.L78M		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	78						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						CCTGTTACCAGTCCACGCTCA	0.493			NA											64	210					3.37043e-27	4.05984e-27	0.01441	1	0
RSPRY1	89970	broad.mit.edu	37	16	57261295	57261295	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:57261295delT	uc002elb.2	+	11	1481	c.1203delT	c.(1201-1203)TATfs	p.Y401fs	RSPRY1_uc002elc.2_Frame_Shift_Del_p.Y401fs|RSPRY1_uc002eld.2_Frame_Shift_Del_p.Y401fs	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	401	B30.2/SPRY.					extracellular region	zinc ion binding			ovary(1)	1						CCTGTGCGTATGATGGCTGCC	0.483			NA											13	40	---	---	---	---	NA	NA	NA	NA	NA
OR7G1	125962	broad.mit.edu	37	19	9226266	9226266	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:9226266delG	uc002mks.1	-	1	174	c.174delC	c.(172-174)CCCfs	p.P58fs		NM_001005192	NP_001005192	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						GGAAGTACATGGGGGTGTGGA	0.483			NA											53	38	---	---	---	---	NA	NA	NA	NA	NA
