Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
B3GALT6	126792	broad.mit.edu	37	1	1168139	1168139	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:1168139G>A	uc001adk.2	+	1	511	c.481G>A	c.(481-483)GCG>ACG	p.A161T	SDF4_uc001adh.3_5'Flank|SDF4_uc001adi.3_5'Flank|SDF4_uc009vjv.2_5'Flank|SDF4_uc009vjw.2_5'Flank	NM_080605	NP_542172	Q96L58	B3GT6_HUMAN	beta-1,3-galactosyltransferase 6	161	Lumenal (Potential).				glycosaminoglycan biosynthetic process|protein glycosylation	Golgi cisterna membrane|Golgi medial cisterna|integral to membrane	galactosylxylosylprotein 3-beta-galactosyltransferase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CGACTCCTTCGCGCGGCTGGA	0.572			NA											4	32					0	0	0.000602	0	0
C1orf93	127281	broad.mit.edu	37	1	2519200	2519200	+	Nonsense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:2519200A>T	uc001aju.1	+	3	365	c.289A>T	c.(289-291)AAG>TAG	p.K97*	C1orf93_uc001ajw.1_Nonsense_Mutation_p.K97*|C1orf93_uc001ajv.1_Nonsense_Mutation_p.K97*|C1orf93_uc010nzd.1_Nonsense_Mutation_p.K97*|C1orf93_uc010nze.1_Nonsense_Mutation_p.K97*|C1orf93_uc010nzf.1_Nonsense_Mutation_p.K97*|C1orf93_uc001ajx.1_5'UTR	NM_152371	NP_689584	Q8TBF2	PGFS_HUMAN	hypothetical protein LOC127281	97					prostaglandin biosynthetic process	cytosol	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor			central_nervous_system(1)	1	all_cancers(77;0.000167)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.97e-16)|all_lung(118;3.05e-07)|Lung NSC(185;2.8e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Lung SC(97;0.109)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Epithelial(90;4.76e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.19e-23)|GBM - Glioblastoma multiforme(42;1.13e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.00205)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		GGATGAGAGCAAGCAGCTTTA	0.632			NA											6	8					0	0	0.001984	0	0
MMEL1	79258	broad.mit.edu	37	1	2526778	2526778	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:2526778C>A	uc001ajy.2	-	16	1735	c.1521G>T	c.(1519-1521)CAG>CAT	p.Q507H	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	507	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GGTGCCCGATCTGCTCCCGGA	0.652			NA											8	45					1.26484e-09	1.49854e-09	0.00308	1	0
ESPN	83715	broad.mit.edu	37	1	6504661	6504661	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:6504661A>T	uc001amy.2	+	6	1279	c.1111A>T	c.(1111-1113)AGC>TGC	p.S371C		NM_031475	NP_113663	B1AK53	ESPN_HUMAN	espin	371					sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		CTTTGACCTCAGCTCGCCTAC	0.612			NA											60	64					0	0	0.00361	0	0
TAS1R1	80835	broad.mit.edu	37	1	6631174	6631174	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:6631174C>T	uc001ant.2	+	2	397	c.397C>T	c.(397-399)CTT>TTT	p.L133F	TAS1R1_uc001anu.2_Missense_Mutation_p.L133F|TAS1R1_uc001anv.2_Missense_Mutation_p.L133F|TAS1R1_uc001anw.2_Missense_Mutation_p.L133F	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	133	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CCAAGGAGACCTTCTCCACTA	0.582			NA											36	140					0	0	0.003755	0	0
H6PD	9563	broad.mit.edu	37	1	9324171	9324171	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:9324171C>T	uc001apt.2	+	5	1892	c.1619C>T	c.(1618-1620)CCC>CTC	p.P540L		NM_004285	NP_004276	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase precursor	540	Linker.					endoplasmic reticulum lumen	6-phosphogluconolactonase activity|glucose 1-dehydrogenase|glucose-6-phosphate dehydrogenase activity|NADP binding				0	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)	NADH(DB00157)	GCCCCAATGCCCAGTGACTTC	0.622			NA											13	71					0	0	0.001368	0	0
UBE4B	10277	broad.mit.edu	37	1	10179590	10179590	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:10179590T>C	uc001aqs.3	+	9	2071	c.1358T>C	c.(1357-1359)GTC>GCC	p.V453A	UBE4B_uc001aqr.3_Missense_Mutation_p.V324A|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_5'UTR	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	453					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CAGCCAGCAGTCAGCCAGCTT	0.463			NA											6	91					0	0	0.001984	0	0
PGD	5226	broad.mit.edu	37	1	10478942	10478942	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:10478942T>C	uc001arc.2	+	11	1259	c.1169T>C	c.(1168-1170)CTA>CCA	p.L390P	PGD_uc001ard.2_Missense_Mutation_p.L310P|PGD_uc010oak.1_Missense_Mutation_p.L368P|PGD_uc010oal.1_Missense_Mutation_p.L377P	NM_002631	NP_002622	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	390					pentose-phosphate shunt, oxidative branch	cytosol	NADP binding|phosphogluconate dehydrogenase (decarboxylating) activity|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)		CAGAACCTCCTACTGGACGAC	0.448			NA											11	138					0	0	0.008291	0	0
MTOR	2475	broad.mit.edu	37	1	11291373	11291373	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:11291373T>G	uc001asd.2	-	17	2754	c.2633A>C	c.(2632-2634)CAG>CCG	p.Q878P		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	878	HEAT 3.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GCGTGTACCCTGGTTCTGCTC	0.502			NA											17	312					0	0	0.007413	0	0
PTCHD2	57540	broad.mit.edu	37	1	11561464	11561464	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:11561464G>A	uc001ash.3	+	2	553	c.415G>A	c.(415-417)GAT>AAT	p.D139N	PTCHD2_uc001asi.1_Missense_Mutation_p.D139N	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	139	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GAACCGGCGCGATTTGGCCGA	0.632			NA											10	36					0	0	0.006214	0	0
PTCHD2	57540	broad.mit.edu	37	1	11561954	11561954	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:11561954A>C	uc001ash.3	+	2	1043	c.905A>C	c.(904-906)GAG>GCG	p.E302A	PTCHD2_uc001asi.1_Missense_Mutation_p.E302A	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	302	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CATGAGATCGAGCGCAAGATC	0.637			NA											5	32					0	0	0.000602	0	0
VPS13D	55187	broad.mit.edu	37	1	12368591	12368591	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:12368591T>G	uc001atv.2	+	27	6684	c.6543T>G	c.(6541-6543)GAT>GAG	p.D2181E	VPS13D_uc001atw.2_Missense_Mutation_p.D2181E|VPS13D_uc001atx.2_Missense_Mutation_p.D1369E|VPS13D_uc001aty.1_5'Flank	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	2181					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CACCAGAGGATAGTAGTGGAG	0.498			NA											30	148					0	0	0.002096	0	0
PRAMEF2	65122	broad.mit.edu	37	1	12921200	12921200	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:12921200C>A	uc001aum.1	+	4	1078	c.991C>A	c.(991-993)CTG>ATG	p.L331M		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	331	LRR 1.										0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCTACGTGCTGCTGTTCCG	0.498			NA											11	181					3.86212e-05	4.16694e-05	0.008291	1	0
PRAMEF2	65122	broad.mit.edu	37	1	12921234	12921234	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:12921234C>A	uc001aum.1	+	4	1112	c.1025C>A	c.(1024-1026)GCT>GAT	p.A342D		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	342	LRR 1.										0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCTAGGAGCTCTGCTAGAG	0.542			NA											138	71					7.33161e-80	9.63096e-80	0.00361	1	0
HTR6	3362	broad.mit.edu	37	1	19992715	19992715	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:19992715G>A	uc001bcl.2	+	1	936	c.469G>A	c.(469-471)GCC>ACC	p.A157T		NM_000871	NP_000862	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6	157	Helical; Name=4; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	histamine receptor activity|protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Granisetron(DB00889)|Ondansetron(DB00904)|Sertindole(DB06144)	CGCCGCTCTCGCCTCCTTCCT	0.716	Esophageal Squamous(168;1879 2619 6848 21062)		NA											8	55					0	0	0.006214	0	0
MUL1	79594	broad.mit.edu	37	1	20827840	20827840	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:20827840G>A	uc001bdi.3	-	4	559	c.402C>T	c.(400-402)GGC>GGT	p.G134G		NM_024544	NP_078820	Q969V5	MUL1_HUMAN	mitochondrial ubiquitin ligase activator of NFKB	134	Mitochondrial intermembrane (Potential).				activation of caspase activity|activation of JUN kinase activity|induction of apoptosis|mitochondrial fission|mitochondrion localization|negative regulation of cell growth|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to mitochondrial outer membrane|nucleus|peroxisome	identical protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		CCACATCCACGCCATCCTCGT	0.507			NA											19	94					0	0	0.006122	0	0
KIF17	57576	broad.mit.edu	37	1	20998460	20998460	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:20998460G>T	uc001bdr.3	-	12	2811	c.2693C>A	c.(2692-2694)CCC>CAC	p.P898H	KIF17_uc001bdp.3_Missense_Mutation_p.P176H|KIF17_uc001bdq.3_Missense_Mutation_p.P176H|KIF17_uc009vpx.2_Missense_Mutation_p.P268H|KIF17_uc001bds.3_Missense_Mutation_p.P898H	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	898					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGTGATGACGGGATGTGGGAT	0.577			NA											16	85					3.45872e-05	3.75122e-05	0.004007	1	0
EIF4G3	8672	broad.mit.edu	37	1	21268372	21268372	+	Silent	SNP	C	C	A	rs150884106	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:21268372C>A	uc001bec.2	-	9	1363	c.1107G>T	c.(1105-1107)ACG>ACT	p.T369T	EIF4G3_uc010odi.1_5'UTR|EIF4G3_uc010odj.1_Silent_p.T368T|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Silent_p.T369T|EIF4G3_uc001bef.2_Silent_p.T368T|EIF4G3_uc001bee.2_Silent_p.T375T|EIF4G3_uc001beg.2_Silent_p.T368T|EIF4G3_uc010odk.1_Silent_p.T369T|EIF4G3_uc001beh.2_Silent_p.T380T	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	369					interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CAATGCTCTCCGTGGCTGATA	0.383			NA											31	126					1.30897e-18	1.66669e-18	0.009535	1	0
C1QA	712	broad.mit.edu	37	1	22965741	22965741	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:22965741C>A	uc001bfy.2	+	3	664	c.579C>A	c.(577-579)ACC>ACA	p.T193T	C1QA_uc001bfz.2_Silent_p.T193T	NM_015991	NP_057075	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	193	C1q.				cell-cell signaling|complement activation, classical pathway|innate immune response	collagen|complement component C1 complex					0		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GTGACACCACCAACAAGGGGC	0.582			NA											27	59					6.12954e-19	7.82869e-19	0.004656	1	0
SRRM1	10250	broad.mit.edu	37	1	24979060	24979060	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:24979060G>T	uc001bjm.2	+	7	1085	c.861G>T	c.(859-861)CGG>CGT	p.R287R	SRRM1_uc010oel.1_Silent_p.R287R|SRRM1_uc009vrh.1_Silent_p.R248R|SRRM1_uc009vri.1_Silent_p.R204R|SRRM1_uc010oem.1_RNA	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	287	Pro-rich.|Arg-rich.|Ser-rich.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CAAGATCCCGGACGCGGTCCC	0.488	Ovarian(68;897 1494 3282 17478)		NA											7	22					0.00307968	0.0032006	0.00308	1	0
SLC9A1	6548	broad.mit.edu	37	1	27480569	27480569	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:27480569C>T	uc001bnm.2	-	1	883	c.257G>A	c.(256-258)CGC>CAC	p.R86H	SLC9A1_uc010ofk.1_5'UTR|SLC9A1_uc001bnn.2_Missense_Mutation_p.R86H	NM_003047	NP_003038	P19634	SL9A1_HUMAN	solute carrier family 9, isoform A1	86	Extracellular (Potential).				regulation of pH	integral to membrane	sodium:hydrogen antiporter activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	AAAGGCCTTGCGCGGCTTCAT	0.587			NA											22	67					0	0	0.002299	0	0
TRNAU1AP	54952	broad.mit.edu	37	1	28880162	28880162	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:28880162A>G	uc001bqi.2	+	2	132	c.38A>G	c.(37-39)TAC>TGC	p.Y13C	TRNAU1AP_uc001bqh.2_5'UTR|TRNAU1AP_uc010ofw.1_5'UTR	NM_017846	NP_060316	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine associated protein 1	13	RRM 1.				selenocysteine incorporation	cytoplasm|nucleus	nucleotide binding|RNA binding				0						CTGGAACCCTACATGGATGAG	0.587			NA											6	30					0	0	0.001984	0	0
SERINC2	347735	broad.mit.edu	37	1	31899543	31899543	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:31899543C>T	uc010ogh.1	+	6	866	c.665C>T	c.(664-666)GCG>GTG	p.A222V	SERINC2_uc010ogg.1_Missense_Mutation_p.A219V|SERINC2_uc001bst.2_Missense_Mutation_p.A218V|SERINC2_uc001bsu.2_Missense_Mutation_p.A163V|SERINC2_uc001bsv.2_Missense_Mutation_p.A163V	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	218	Helical; (Potential).					integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CTGTCGATCGCGGCCGTGGCG	0.597			NA											31	80					0	0	0.009535	0	0
COL16A1	1307	broad.mit.edu	37	1	32120447	32120447	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:32120447T>G	uc001btk.1	-	68	4668	c.4303A>C	c.(4303-4305)AAT>CAT	p.N1435H	COL16A1_uc001bti.1_Missense_Mutation_p.N49H|COL16A1_uc001btj.1_Missense_Mutation_p.N1233H	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	1435	Nonhelical region 2 (NC2).				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TCATCATAATTCACCATGTCT	0.453	Colon(143;498 1786 21362 25193 36625)		NA											29	134					0	0	0.00632	0	0
NDUFS5	4725	broad.mit.edu	37	1	39494495	39494495	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:39494495C>G	uc001ccx.2	+	2	170	c.99C>G	c.(97-99)TGC>TGG	p.C33W	NDUFS5_uc001ccy.2_Missense_Mutation_p.C33W	NM_004552	NP_004543	O43920	NDUS5_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 5,	33	C-X9-C motif 1.				mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.93e-18)		NADH(DB00157)	CTGGTCGATGCCATGCTTTTG	0.438			NA											20	53					0	0	0.008871	0	0
MED8	112950	broad.mit.edu	37	1	43851674	43851674	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:43851674T>C	uc001cjg.3	-	6	765	c.717A>G	c.(715-717)GTA>GTG	p.V239V	MED8_uc001cje.1_Silent_p.V239V|MED8_uc001cjf.3_Silent_p.V150V	NM_201542	NP_963836	Q96G25	MED8_HUMAN	mediator complex subunit 8 isoform 1	239					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GAGCCATTTGTACCCCACTGA	0.562			NA											56	203					0	0	0.00361	0	0
PTPRF	5792	broad.mit.edu	37	1	44071069	44071069	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:44071069G>A	uc001cjr.2	+	18	3684	c.3344G>A	c.(3343-3345)CGC>CAC	p.R1115H	PTPRF_uc001cjs.2_Missense_Mutation_p.R1106H|PTPRF_uc001cju.2_Missense_Mutation_p.R493H|PTPRF_uc009vwt.2_Missense_Mutation_p.R675H|PTPRF_uc001cjv.2_Missense_Mutation_p.R575H|PTPRF_uc001cjw.2_Missense_Mutation_p.R341H	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1115	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GAGGACGGCCGCTTCGATCTC	0.662			NA											22	27					0	0	0.004656	0	0
LRRC41	10489	broad.mit.edu	37	1	46752036	46752036	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:46752036G>T	uc001cpn.2	-	4	537	c.493C>A	c.(493-495)CGA>AGA	p.R165R	LRRC41_uc010omb.1_Silent_p.R165R|LRRC41_uc001cpo.1_Silent_p.R165R	NM_006369	NP_006360	Q15345	LRC41_HUMAN	MUF1 protein	165										ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(166;0.155)					GTGAGCTGTCGGACATGGCGG	0.567			NA											8	47					5.4927e-09	6.42192e-09	0.004482	1	0
TMEM59	9528	broad.mit.edu	37	1	54497896	54497896	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:54497896C>G	uc001cwp.2	-	8	1149	c.899G>C	c.(898-900)AGA>ACA	p.R300T	TMEM59_uc001cwn.2_Missense_Mutation_p.R164T|TMEM59_uc001cwo.2_Missense_Mutation_p.R163T|TMEM59_uc001cwq.2_Missense_Mutation_p.R301T|TMEM59_uc001cwr.2_Missense_Mutation_p.R233T	NM_004872	NP_004863	Q9BXS4	TMM59_HUMAN	thymic dendritic cell-derived factor 1	300	Cytoplasmic (Potential).					Golgi membrane|integral to membrane					0						AGTTTTAGATCTAACAACCAC	0.348			NA											10	21					0	0	0.006214	0	0
USP1	7398	broad.mit.edu	37	1	62907238	62907238	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:62907238A>G	uc001daj.1	+	3	578	c.250A>G	c.(250-252)AAT>GAT	p.N84D	USP1_uc001dak.1_Missense_Mutation_p.N84D|USP1_uc001dal.1_Missense_Mutation_p.N84D	NM_001017415	NP_001017415	O94782	UBP1_HUMAN	ubiquitin specific protease 1	84					DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		TGTGGGACTGAATAATCTCGG	0.348	Ovarian(122;1846 2315 3982 19504)		NA											11	41					0	0	0.000978	0	0
IL23R	149233	broad.mit.edu	37	1	67648610	67648610	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:67648610C>A	uc001ddo.2	+	4	544	c.459C>A	c.(457-459)TAC>TAA	p.Y153*	IL23R_uc009waz.2_5'UTR|IL23R_uc001ddp.2_RNA|IL23R_uc010opi.1_RNA|IL23R_uc010opj.1_5'UTR|IL23R_uc010opk.1_Nonsense_Mutation_p.Y110*|IL23R_uc010opl.1_5'UTR|IL23R_uc010opm.1_RNA|IL23R_uc001ddq.2_5'UTR|IL23R_uc010opn.1_Intron|IL23R_uc001ddr.2_RNA|IL23R_uc010opo.1_Nonsense_Mutation_p.Y12*|IL23R_uc010opp.1_RNA|IL23R_uc010opq.1_Nonsense_Mutation_p.Y12*|IL23R_uc010opr.1_RNA|IL23R_uc010ops.1_5'UTR|IL23R_uc010opt.1_5'UTR|IL23R_uc010opu.1_5'UTR|IL23R_uc010opv.1_Nonsense_Mutation_p.Y12*|IL23R_uc010opw.1_5'UTR|IL23R_uc010opx.1_5'UTR|IL23R_uc010opy.1_5'UTR|IL23R_uc010opz.1_5'UTR|IL23R_uc010oqa.1_5'UTR|IL23R_uc010oqb.1_Nonsense_Mutation_p.Y12*|IL23R_uc010oqc.1_5'UTR|IL23R_uc010oqd.1_5'UTR|IL23R_uc010oqe.1_5'UTR|IL23R_uc010oqf.1_5'UTR|IL23R_uc010oqg.1_5'UTR|IL23R_uc010oqh.1_5'UTR	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor precursor	153	Extracellular (Potential).|Fibronectin type-III 1.				inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						AGCTCACCTACATAGACACAA	0.473			NA											19	70					5.3912e-06	5.9351e-06	0.006122	1	0
SFRS11	9295	broad.mit.edu	37	1	70715732	70715732	+	Splice_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:70715732T>C	uc001des.2	+	11	1242	c.1118_splice	c.e11+2	p.R373_splice	SFRS11_uc001det.2_Splice_Site_p.R373_splice|SFRS11_uc001deu.2_Splice_Site_p.R380_splice|SFRS11_uc001dev.2_Splice_Site_p.R183_splice|SFRS11_uc001dew.2_Splice_Site_p.R313_splice	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						CCCTAGGAGGTAAGAATGTTA	0.373			NA											3	25					0	0	0.004672	0	0
LPHN2	23266	broad.mit.edu	37	1	82409430	82409430	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:82409430T>C	uc001dit.3	+	6	1356	c.1175T>C	c.(1174-1176)TTT>TCT	p.F392S	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.F392S|LPHN2_uc001div.2_Missense_Mutation_p.F392S|LPHN2_uc009wcd.2_Missense_Mutation_p.F392S	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	392	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TCTCTGGAGTTTGGTCCACCT	0.358			NA											19	57					0	0	0.001882	0	0
GBP6	163351	broad.mit.edu	37	1	89844084	89844084	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:89844084A>T	uc001dnf.2	+	5	811	c.537A>T	c.(535-537)ACA>ACT	p.T179T	GBP6_uc010ost.1_Silent_p.T49T	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	179							GTP binding|GTPase activity			ovary(2)	2		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		TTCTTTGGACAGTACGGGATT	0.458			NA											28	56					0	0	0.007291	0	0
MTF2	22823	broad.mit.edu	37	1	93602423	93602423	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:93602423C>T	uc009wdj.2	+	15	1913	c.1621C>T	c.(1621-1623)CAG>TAG	p.Q541*	MTF2_uc010oth.1_Nonsense_Mutation_p.Q439*|MTF2_uc009wdk.2_Nonsense_Mutation_p.Q484*|MTF2_uc001dpi.3_Nonsense_Mutation_p.Q268*|MTF2_uc010oti.1_Nonsense_Mutation_p.Q439*|MTF2_uc001dpj.3_Nonsense_Mutation_p.Q439*|MTF2_uc001dpl.3_Nonsense_Mutation_p.Q439*|MTF2_uc001dpm.3_Nonsense_Mutation_p.Q210*	NM_007358	NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription	541						nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		CTTAGCAGATCAGGAGTTACA	0.388			NA											18	67					0	0	0.007413	0	0
LPPR4	9890	broad.mit.edu	37	1	99772192	99772192	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:99772192G>A	uc001dse.2	+	7	2024	c.1918G>A	c.(1918-1920)GAA>AAA	p.E640K	LPPR4_uc010oue.1_Missense_Mutation_p.E582K	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN	plasticity related gene 1	640							phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CCCGTCCACTGAAGGTGAAGG	0.537			NA											17	38					0	0	0.00499	0	0
HIAT1	64645	broad.mit.edu	37	1	100542725	100542725	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:100542725T>A	uc001dst.2	+	9	896	c.896T>A	c.(895-897)ATA>AAA	p.I299K		NM_033055	NP_149044	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	299	Helical; Name=8; (Potential).				transmembrane transport	integral to membrane|plasma membrane	transporter activity				0		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TTTCAGACCATAGTCTTGAGT	0.303			NA											7	21					0	0	0.006214	0	0
COL11A1	1301	broad.mit.edu	37	1	103385907	103385907	+	Missense_Mutation	SNP	G	G	T	rs151195708		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:103385907G>T	uc001dul.2	-	49	4040	c.3722C>A	c.(3721-3723)CCC>CAC	p.P1241H	COL11A1_uc001duk.2_Missense_Mutation_p.P437H|COL11A1_uc001dum.2_Missense_Mutation_p.P1253H|COL11A1_uc001dun.2_Missense_Mutation_p.P1202H|COL11A1_uc009weh.2_Missense_Mutation_p.P1125H	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1241	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGACCCTGGGGGTCCTTGTGG	0.353			NA											30	102					5.60225e-13	6.88656e-13	0.009535	1	0
SORT1	6272	broad.mit.edu	37	1	109884687	109884687	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:109884687T>C	uc001dxm.1	-	9	1106	c.1057A>G	c.(1057-1059)ATT>GTT	p.I353V	SORT1_uc010ovi.1_Missense_Mutation_p.I216V	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein	353	Extracellular (Potential).				endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		GCTGCCAGAATAGAATAGAAC	0.453			NA											38	105					0	0	0.004878	0	0
GSTM2	2946	broad.mit.edu	37	1	110213909	110213909	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:110213909G>A	uc001dyi.2	+	6	675	c.361G>A	c.(361-363)GAG>AAG	p.E121K	GSTM2_uc001dyj.2_Missense_Mutation_p.E121K|GSTM2_uc010ovt.1_Missense_Mutation_p.E121K|GSTM2_uc009wfk.2_RNA	NM_000848	NP_000839	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 1	121	GST C-terminal.				glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	TCTGCCTCAGGAGAAACTGAA	0.547			NA											9	67					0	0	0.008291	0	0
GSTM1	2944	broad.mit.edu	37	1	110231320	110231320	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:110231320G>A	uc001dyk.2	+	3	216	c.138G>A	c.(136-138)TGG>TGA	p.W46*	GSTM1_uc001dyl.2_Nonsense_Mutation_p.W46*	NM_000561	NP_000552	P09488	GSTM1_HUMAN	glutathione S-transferase mu 1 isoform 1	46	GST N-terminal.|Glutathione binding.				xenobiotic metabolic process	cytosol	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	GAAGCCAGTGGCTGAATGAAA	0.562			NA							Melanoma_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				20	16					0	0	0.009535	0	0
PHTF1	10745	broad.mit.edu	37	1	114249340	114249340	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:114249340T>A	uc009wgp.1	-	11	1726	c.1274A>T	c.(1273-1275)CAT>CTT	p.H425L	PHTF1_uc001edn.2_Missense_Mutation_p.H425L|PHTF1_uc001edm.2_Missense_Mutation_p.H182L|PHTF1_uc001edo.1_Missense_Mutation_p.H182L	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	425						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAGAATAAATGATTCTGAGA	0.383			NA											12	54					0	0	0.000978	0	0
NGF	4803	broad.mit.edu	37	1	115829316	115829316	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:115829316T>C	uc001efu.1	-	3	270	c.101A>G	c.(100-102)CAA>CGA	p.Q34R		NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor	34					activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	CCAGTGGGCTTGGGGGATGGT	0.592			NA											15	65					0	0	0.003163	0	0
TTF2	8458	broad.mit.edu	37	1	117622224	117622224	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:117622224C>A	uc001egy.2	+	9	1756	c.1736C>A	c.(1735-1737)GCT>GAT	p.A579D	TTF2_uc001egx.1_Missense_Mutation_p.A579D	NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	579					mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		CAGGCATTGGCTTGGTTACTA	0.368			NA											18	43					2.37509e-13	2.94578e-13	0.010504	1	0
SPAG17	200162	broad.mit.edu	37	1	118548157	118548157	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:118548157T>C	uc001ehk.2	-	32	4724	c.4656A>G	c.(4654-4656)TCA>TCG	p.S1552S		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1552						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TATTACTGCTTGACTCATGGC	0.418			NA											5	57					0	0	0.000602	0	0
TBX15	6913	broad.mit.edu	37	1	119427471	119427471	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:119427471T>G	uc001ehl.1	-	8	1690	c.1375A>C	c.(1375-1377)AGC>CGC	p.S459R	TBX15_uc009whj.1_Missense_Mutation_p.S283R	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15	565						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		ATGTGCATGCTGTGCTCCATC	0.552			NA											26	77					0	0	0.005443	0	0
NOTCH2	4853	broad.mit.edu	37	1	120480031	120480031	+	Silent	SNP	C	C	T	rs140630687		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:120480031C>T	uc001eik.2	-	21	3652	c.3396G>A	c.(3394-3396)ACG>ACA	p.T1132T	NOTCH2_uc001eil.2_Silent_p.T1132T	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	1132	EGF-like 29.|Extracellular (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACAGTAATGCGTGTTGCCAG	0.542			NA	N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				16	71					0	0	0.003163	0	0
TXNIP	10628	broad.mit.edu	37	1	145440510	145440510	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:145440510T>C	uc001enn.3	+	5	1157	c.816T>C	c.(814-816)GTT>GTC	p.V272V	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_Silent_p.V217V	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	272					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCCTTCGAGTTGAATATTCCT	0.483			NA											29	156					0	0	0.002096	0	0
C1orf51	148523	broad.mit.edu	37	1	150255915	150255915	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:150255915C>T	uc001euh.2	+	2	374	c.238C>T	c.(238-240)CCG>TCG	p.P80S	C1orf51_uc001eui.2_5'UTR|C1orf51_uc001euj.2_Missense_Mutation_p.P80S	NM_144697	NP_653298	Q8N365	CA051_HUMAN	hypothetical protein LOC148523	80											0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACCATCTCATCCGAAACAGCG	0.562			NA											27	255					0	0	0.002096	0	0
ANXA9	8416	broad.mit.edu	37	1	150958830	150958830	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:150958830T>C	uc001ewa.2	+	8	961	c.491T>C	c.(490-492)GTG>GCG	p.V164A		NM_003568	NP_003559	O76027	ANXA9_HUMAN	annexin A9	164	Annexin 2.				cell-cell adhesion	cell surface|cytosol	acetylcholine receptor activity|calcium ion binding|calcium-dependent phospholipid binding|phosphatidylserine binding|protein homodimerization activity				0	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTGGAGGCTGTGGATGACATC	0.562			NA											7	46					0	0	0.00308	0	0
CELF3	11189	broad.mit.edu	37	1	151680015	151680015	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:151680015C>G	uc001eys.1	-	7	1534	c.740G>C	c.(739-741)GGC>GCC	p.G247A	CELF3_uc010pdh.1_Missense_Mutation_p.G55A|CELF3_uc001eyr.2_Missense_Mutation_p.G246A|CELF3_uc009wmy.2_Missense_Mutation_p.G247A|CELF3_uc009wmx.1_Missense_Mutation_p.G247A|CELF3_uc001eyt.2_Missense_Mutation_p.G170A|C1orf230_uc001eyu.2_5'Flank	NM_007185	NP_009116	Q5SZQ8	CELF3_HUMAN	trinucleotide repeat containing 4	247					nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding			ovary(1)|central_nervous_system(1)	2						GGCGATGAGGCCATTGGCATT	0.647			NA											5	23					0	0	0.000602	0	0
LINGO4	339398	broad.mit.edu	37	1	151774831	151774831	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:151774831C>T	uc001ezf.1	-	2	540	c.350G>A	c.(349-351)GGC>GAC	p.G117D		NM_001004432	NP_001004432	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	117	LRR 3.|Extracellular (Potential).					integral to membrane				large_intestine(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GAGCCGATTGCCCTGCAGCCT	0.582			NA											20	90					0	0	0.008871	0	0
FLG2	388698	broad.mit.edu	37	1	152328032	152328032	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:152328032C>T	uc001ezw.3	-	3	2303	c.2230G>A	c.(2230-2232)GGC>AGC	p.G744S	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	744	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCAAAGCCAGAGGACTGA	0.507			NA											83	534					0	0	0.00361	0	0
NPR1	4881	broad.mit.edu	37	1	153655008	153655008	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:153655008C>T	uc001fcs.3	+	5	1627	c.1206C>T	c.(1204-1206)GGC>GGT	p.G402G	NPR1_uc010pdz.1_Silent_p.G148G|NPR1_uc010pea.1_5'Flank	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	402	Extracellular (Potential).				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	ATAGCAGTGGCGATCGGGAAA	0.488	Pancreas(141;1349 1870 15144 15830 40702)		NA											8	76					0	0	0.004482	0	0
ADAR	103	broad.mit.edu	37	1	154557298	154557298	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:154557298T>C	uc001ffh.2	-	15	3865	c.3665A>G	c.(3664-3666)TAT>TGT	p.Y1222C	ADAR_uc001ffj.2_Missense_Mutation_p.Y1177C|ADAR_uc001ffi.2_Missense_Mutation_p.Y1196C|ADAR_uc001ffk.2_Missense_Mutation_p.Y927C	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	1222					adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TGGGCAGAGATAAAAGTTCTT	0.483			NA											16	177					0	0	0.007413	0	0
GBA	2629	broad.mit.edu	37	1	155206228	155206228	+	Silent	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:155206228A>C	uc001fjh.2	-	8	1182	c.1032T>G	c.(1030-1032)GTT>GTG	p.V344V	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Silent_p.V231V|GBA_uc010pfx.1_Silent_p.V295V|GBA_uc001fji.2_Silent_p.V344V|GBA_uc001fjj.2_Silent_p.V344V|GBA_uc001fjk.2_Silent_p.V344V|GBA_uc001fjl.2_Silent_p.V344V|GBA_uc010pfy.1_Silent_p.V257V	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	344					carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	CAATGCCATGAACATATTTAG	0.512			NA							Gaucher_disease_type_I				5	62					0	0	0.000602	0	0
INSRR	3645	broad.mit.edu	37	1	156811294	156811294	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:156811294A>T	uc010pht.1	-	21	3808	c.3554T>A	c.(3553-3555)ATT>AAT	p.I1185N	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	1185	Cytoplasmic (Potential).|Protein kinase.				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGGGTCACAATCTCCCAGAG	0.612			NA											16	122					0	0	0.004007	0	0
INSRR	3645	broad.mit.edu	37	1	156823913	156823913	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:156823913C>T	uc010pht.1	-	2	522	c.268G>A	c.(268-270)GGA>AGA	p.G90R	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron|INSRR_uc009wsj.1_Missense_Mutation_p.G90R	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	90					protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTCTCCAGTCCGTAGACACGG	0.617			NA											24	48					0	0	0.00333	0	0
ARHGEF11	9826	broad.mit.edu	37	1	156914894	156914894	+	Missense_Mutation	SNP	G	G	A	rs140673049		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:156914894G>A	uc001fqo.2	-	29	3828	c.2788C>T	c.(2788-2790)CGC>TGC	p.R930C	ARHGEF11_uc010phu.1_Missense_Mutation_p.R346C|ARHGEF11_uc001fqn.2_Missense_Mutation_p.R970C	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	930					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AAACGGTGGCGGTTCTCTGTT	0.597			NA											41	208					0	0	0.007835	0	0
KIRREL	55243	broad.mit.edu	37	1	158064144	158064144	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:158064144C>T	uc001frn.3	+	14	2165	c.1761C>T	c.(1759-1761)TGC>TGT	p.C587C	KIRREL_uc010pib.1_Silent_p.C487C|KIRREL_uc009wsq.2_Silent_p.C423C|KIRREL_uc001fro.3_Silent_p.C401C|uc001frp.2_5'Flank	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor	587	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)					ACCTGCGCTGCGACACCATCG	0.602			NA											3	24					0	0	0.004672	0	0
CD1E	913	broad.mit.edu	37	1	158326568	158326568	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:158326568T>C	uc001fse.2	+	6	1288	c.1049T>C	c.(1048-1050)ATG>ACG	p.M350T	CD1E_uc001fsd.2_3'UTR|CD1E_uc001fsk.2_Missense_Mutation_p.M260T|CD1E_uc001fsj.2_Missense_Mutation_p.M193T|CD1E_uc001fsc.2_Missense_Mutation_p.M161T|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Missense_Mutation_p.M106T|CD1E_uc001fsf.2_Missense_Mutation_p.M338T|CD1E_uc001fry.2_Missense_Mutation_p.M283T|CD1E_uc001fsg.2_3'UTR|CD1E_uc001fsh.2_Missense_Mutation_p.M149T|CD1E_uc001fsi.2_3'UTR|CD1E_uc009wsv.2_Missense_Mutation_p.M251T|CD1E_uc001frz.2_Missense_Mutation_p.M248T|CD1E_uc009wsw.2_Missense_Mutation_p.W65R	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	350					antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					GTCTTTCTCATGGGAGCCAAC	0.398			NA											26	140					0	0	0.004656	0	0
OR10Z1	128368	broad.mit.edu	37	1	158576744	158576744	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:158576744T>C	uc010pio.1	+	1	516	c.516T>C	c.(514-516)CAT>CAC	p.H172H		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)					GCAGCTCCCATGAAATCCAGC	0.502			NA											8	163					0	0	0.00308	0	0
SPTA1	6708	broad.mit.edu	37	1	158584046	158584046	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:158584046T>C	uc001fst.1	-	49	7038	c.6839A>G	c.(6838-6840)TAT>TGT	p.Y2280C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2280	EF-hand 1.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TACTCACTTATAGATTGTGCT	0.333			NA											6	85					0	0	0.001168	0	0
SPTA1	6708	broad.mit.edu	37	1	158627363	158627363	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:158627363C>T	uc001fst.1	-	19	2908	c.2709G>A	c.(2707-2709)CAG>CAA	p.Q903Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	903	Spectrin 10.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CAGCCAGGTACTGCTGGAACT	0.473			NA											11	256					0	0	0.008291	0	0
SLAMF9	89886	broad.mit.edu	37	1	159923178	159923178	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:159923178A>C	uc001fus.2	-	2	429	c.312T>G	c.(310-312)GAT>GAG	p.D104E	SLAMF9_uc009wtd.2_Missense_Mutation_p.D104E|SLAMF9_uc001fut.2_Intron	NM_033438	NP_254273	Q96A28	SLAF9_HUMAN	SLAM family member 9 isoform 1	104	Extracellular (Potential).					integral to membrane				ovary(1)	1	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AAAGCCCTGAATCCTCCCAGC	0.502			NA											19	127					0	0	0.008871	0	0
KCNJ9	3765	broad.mit.edu	37	1	160054197	160054197	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:160054197G>A	uc001fuy.1	+	2	619	c.377G>A	c.(376-378)CGC>CAC	p.R126H		NM_004983	NP_004974	Q92806	IRK9_HUMAN	potassium inwardly-rectifying channel subfamily	126	Extracellular (By similarity).				synaptic transmission	integral to membrane|plasma membrane	G-protein activated inward rectifier potassium channel activity|protein binding			ovary(1)|skin(1)	2	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TACGGGCACCGCGTCATCACC	0.647			NA											7	69					0	0	0.001984	0	0
OLFML2B	25903	broad.mit.edu	37	1	161954714	161954714	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:161954714C>A	uc001gbu.2	-	7	1955	c.1531G>T	c.(1531-1533)GGG>TGG	p.G511W	OLFML2B_uc001gbt.2_5'UTR|OLFML2B_uc010pkq.1_Missense_Mutation_p.G512W	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	511	Olfactomedin-like.									skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TCATTCCGCCCATATGTGTTC	0.547			NA											19	157					2.94398e-08	3.39732e-08	0.007413	1	0
NUF2	83540	broad.mit.edu	37	1	163306614	163306614	+	Silent	SNP	G	G	C	rs148215962		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:163306614G>C	uc001gcq.1	+	6	711	c.411G>C	c.(409-411)ACG>ACC	p.T137T	NUF2_uc001gcp.2_Silent_p.T137T|NUF2_uc001gcr.1_Silent_p.T137T|NUF2_uc009wvc.1_Silent_p.T137T	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	137	Interaction with the N-terminus of NDC80.				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)					GCCGTGAAACGTATATGGAAT	0.313			NA											9	58					0	0	0.006214	0	0
TMCO1	54499	broad.mit.edu	37	1	165721382	165721382	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:165721382T>G	uc001gdj.3	-	5	429	c.280A>C	c.(280-282)ATT>CTT	p.I94L	TMCO1_uc001gdl.3_Missense_Mutation_p.I10L|TMCO1_uc001gdm.3_Missense_Mutation_p.I10L|TMCO1_uc001gdk.3_Missense_Mutation_p.I82L|TMCO1_uc001gdn.3_RNA	NM_019026	NP_061899	Q9UM00	TMCO1_HUMAN	transmembrane and coiled-coil domains 1	94	Helical; (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				central_nervous_system(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					CAAAAGCCAATAGCAAACATG	0.303			NA											6	42					0	0	0.001984	0	0
ILDR2	387597	broad.mit.edu	37	1	166890011	166890011	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:166890011C>T	uc001gdx.1	-	9	1873	c.1817G>A	c.(1816-1818)CGC>CAC	p.R606H		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	606	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1						GTCGCGGCCGCGGTAGGACGG	0.677			NA											4	6					0	0	0.009096	0	0
DPT	1805	broad.mit.edu	37	1	168670267	168670267	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:168670267G>A	uc001gfp.2	-	3	543	c.527C>T	c.(526-528)TCT>TTT	p.S176F		NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor	176	2 X 53-55 AA tandem repeats.|3 X 6 AA repeats of D-R-[EQ]-W-[NQK]- [FY].				cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					TTCCACTGCAGAGAAAGTGGT	0.433			NA											37	204					0	0	0.006999	0	0
ZBTB37	84614	broad.mit.edu	37	1	173840201	173840201	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:173840201G>T	uc009wwp.1	+	3	1114	c.838G>T	c.(838-840)GGC>TGC	p.G280C	ZBTB37_uc001gjp.1_Missense_Mutation_p.G280C|ZBTB37_uc001gjq.3_Missense_Mutation_p.G280C|ZBTB37_uc001gjr.2_Missense_Mutation_p.G280C	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	280					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGATACCACAGGCCATGGTTC	0.463			NA											4	52					0.00909568	0.00938228	0.009096	1	0
TNN	63923	broad.mit.edu	37	1	175105027	175105027	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:175105027G>A	uc001gkl.1	+	16	3490	c.3377G>A	c.(3376-3378)TGG>TAG	p.W1126*		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	1126	Fibrinogen C-terminal.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TTCAAGCGATGGAGGAGCTAT	0.537			NA											18	141					0	0	0.008871	0	0
ASTN1	460	broad.mit.edu	37	1	176838014	176838014	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:176838014A>G	uc001glc.2	-	22	3825	c.3613T>C	c.(3613-3615)TTC>CTC	p.F1205L	ASTN1_uc001glb.1_Missense_Mutation_p.F1205L|ASTN1_uc001gld.1_Missense_Mutation_p.F1205L	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	1213					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						CGCCAGGTGAATTCCCCAAAA	0.478			NA											7	152					0	0	0.001984	0	0
ASTN1	460	broad.mit.edu	37	1	176915113	176915113	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:176915113T>C	uc001glc.2	-	13	2410	c.2198A>G	c.(2197-2199)AAC>AGC	p.N733S	ASTN1_uc001glb.1_Missense_Mutation_p.N733S|ASTN1_uc001gld.1_Missense_Mutation_p.N733S|ASTN1_uc009wwx.1_Missense_Mutation_p.N733S	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	741					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GGAATGGTTGTTGTAACCAAA	0.488			NA											38	158					0	0	0.004878	0	0
RASAL2	9462	broad.mit.edu	37	1	178410697	178410697	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:178410697G>T	uc001glr.2	+	5	523	c.398G>T	c.(397-399)AGT>ATT	p.S133I	RASAL2_uc001glq.2_Missense_Mutation_p.S281I	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	133	PH.				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						ACCTACTTAAGTGGAAGTAAA	0.383			NA											20	37					5.26018e-13	6.47246e-13	0.001882	1	0
FAM20B	9917	broad.mit.edu	37	1	179013194	179013194	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:179013194T>C	uc001gmc.2	+	2	505	c.212T>C	c.(211-213)GTG>GCG	p.V71A		NM_014864	NP_055679	O75063	XYLK_HUMAN	hypothetical protein LOC9917 precursor	71	Lumenal (Potential).					Golgi membrane|integral to membrane	ATP binding|kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(3)	3						GCCCAGTGGGTGGTTCCCCGG	0.557			NA											12	83					0	0	0.001368	0	0
APOBEC4	403314	broad.mit.edu	37	1	183616967	183616967	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:183616967A>G	uc001gqn.2	-	2	1222	c.950T>C	c.(949-951)GTA>GCA	p.V317A	RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_203454	NP_982279	Q8WW27	ABEC4_HUMAN	apolipoprotein B	317					mRNA processing		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0						TAAGTGCCTTACGATATTCCT	0.478			NA											17	148					0	0	0.007413	0	0
HMCN1	83872	broad.mit.edu	37	1	185964206	185964206	+	Silent	SNP	G	G	A	rs112519612		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:185964206G>A	uc001grq.1	+	24	3994	c.3765G>A	c.(3763-3765)ACG>ACA	p.T1255T		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1255	Ig-like C2-type 9.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAGAGATAACGCTACATGTCC	0.428			NA											16	110					0	0	0.00499	0	0
HMCN1	83872	broad.mit.edu	37	1	186038865	186038865	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:186038865T>C	uc001grq.1	+	51	8179	c.7950T>C	c.(7948-7950)AAT>AAC	p.N2650N		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2650	Ig-like C2-type 24.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TAGCCACGAATGAGGCTGGAG	0.408			NA											9	44					0	0	0.008291	0	0
HMCN1	83872	broad.mit.edu	37	1	186089238	186089238	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:186089238G>C	uc001grq.1	+	80	12419	c.12190G>C	c.(12190-12192)GCT>CCT	p.A4064P		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4064	Ig-like C2-type 39.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCAGAACCCGGCTGGTACAGC	0.448			NA											15	48					0	0	0.00245	0	0
TPR	7175	broad.mit.edu	37	1	186310226	186310226	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:186310226G>A	uc001grv.2	-	29	4251	c.3954C>T	c.(3952-3954)AGC>AGT	p.S1318S		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1318	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCAACATACCGCTTTTCTCAC	0.388			NA	T	NTRK1	papillary thyroid								18	113					0	0	0.00499	0	0
FAM5C	339479	broad.mit.edu	37	1	190129974	190129974	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:190129974G>A	uc001gse.1	-	7	1240	c.1008C>T	c.(1006-1008)CTC>CTT	p.L336L	FAM5C_uc010pot.1_Silent_p.L234L	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	336						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TAGATGTGTTGAGGAAATAAT	0.308			NA											7	141					0	0	0.001984	0	0
FAM5C	339479	broad.mit.edu	37	1	190250870	190250870	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:190250870G>A	uc001gse.1	-	3	479	c.247C>T	c.(247-249)CGC>TGC	p.R83C	FAM5C_uc010pot.1_Intron	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	83						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					ACTTTCCAGCGGCCAAACTCC	0.398			NA											6	74					0	0	0.001168	0	0
ASPM	259266	broad.mit.edu	37	1	197115347	197115347	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:197115347A>G	uc001gtu.2	-	1	478	c.221T>C	c.(220-222)GTG>GCG	p.V74A	ASPM_uc001gtv.2_Missense_Mutation_p.V74A|ASPM_uc001gtw.3_5'UTR	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	74					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CACTTCTGCCACCTCCTCGTT	0.607			NA											34	239					0	0	0.004289	0	0
LHX9	56956	broad.mit.edu	37	1	197890769	197890769	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:197890769A>G	uc001guk.1	+	3	1150	c.713A>G	c.(712-714)GAC>GGC	p.D238G	LHX9_uc001gui.1_Missense_Mutation_p.D229G|LHX9_uc001guj.1_Missense_Mutation_p.D244G	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	238					motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						CTGGGAGTGGACATCGTCAAT	0.647			NA											11	31					0	0	0.000978	0	0
PTPRC	5788	broad.mit.edu	37	1	198677283	198677283	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:198677283A>T	uc001gur.1	+	10	1100	c.920A>T	c.(919-921)CAT>CTT	p.H307L	PTPRC_uc001gus.1_Missense_Mutation_p.H259L|PTPRC_uc001gut.1_Missense_Mutation_p.H146L|PTPRC_uc009wzf.1_Missense_Mutation_p.H195L|PTPRC_uc010ppg.1_Missense_Mutation_p.H243L	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	307	Extracellular (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TTTCAGTTACATGATTGTACA	0.303			NA											19	43					0	0	0.008871	0	0
KIF14	9928	broad.mit.edu	37	1	200558480	200558480	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:200558480C>A	uc010ppk.1	-	18	3418	c.2979G>T	c.(2977-2979)AGG>AGT	p.R993S	KIF14_uc010ppj.1_Missense_Mutation_p.R502S	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	993	Potential.|Required for CIT-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						GCATTTTTTTCCTTTGAGACT	0.313			NA											6	49					5.9392e-07	6.67422e-07	0.001168	1	0
KIF14	9928	broad.mit.edu	37	1	200558485	200558485	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:200558485G>C	uc010ppk.1	-	18	3413	c.2974C>G	c.(2974-2976)CAA>GAA	p.Q992E	KIF14_uc010ppj.1_Missense_Mutation_p.Q501E	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	992	Potential.|Required for CIT-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						TTTTTCCTTTGAGACTCTTCT	0.313			NA											6	49					0	0	0.001168	0	0
KIF21B	23046	broad.mit.edu	37	1	200960786	200960786	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:200960786T>A	uc001gvs.1	-	17	2770	c.2453A>T	c.(2452-2454)GAG>GTG	p.E818V	KIF21B_uc001gvr.1_Missense_Mutation_p.E818V|KIF21B_uc009wzl.1_Missense_Mutation_p.E818V|KIF21B_uc010ppn.1_Missense_Mutation_p.E818V	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	818	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						TGAGCTCACCTCCTGGGTCTT	0.607			NA											13	47					0	0	0.001855	0	0
CSRP1	1465	broad.mit.edu	37	1	201454441	201454441	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:201454441C>T	uc001gws.2	-	5	666	c.475G>A	c.(475-477)GCA>ACA	p.A159T	CSRP1_uc001gwr.1_RNA|CSRP1_uc010ppr.1_Missense_Mutation_p.A153T	NM_004078	NP_004069	P21291	CSRP1_HUMAN	cysteine and glycine-rich protein 1 isoform 1	159	LIM zinc-binding 2.					nucleus	zinc ion binding			ovary(1)	1						TCCTTGTCTGCCAGGGTGGTT	0.527			NA											37	152					0	0	0.002522	0	0
LGR6	59352	broad.mit.edu	37	1	202276032	202276032	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:202276032T>C	uc001gxu.2	+	13	1173	c.1173T>C	c.(1171-1173)GCT>GCC	p.A391A	LGR6_uc001gxv.2_Silent_p.A339A|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Silent_p.A252A|LGR6_uc009xac.1_RNA	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	391	LRR 13.|Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						AAATTGGAGCTGACACCTTCA	0.637			NA											5	72					0	0	0.001168	0	0
PIK3C2B	5287	broad.mit.edu	37	1	204425008	204425008	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:204425008C>T	uc001haw.2	-	12	2398	c.1919G>A	c.(1918-1920)CGC>CAC	p.R640H	PIK3C2B_uc010pqv.1_Missense_Mutation_p.R640H|PIK3C2B_uc001hax.1_Missense_Mutation_p.R640H|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	640					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GATGGGGATGCGGTGGGTGGC	0.612			NA											9	54					0	0	0.006214	0	0
DSTYK	25778	broad.mit.edu	37	1	205126496	205126496	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:205126496T>A	uc001hbw.2	-	10	2321	c.2257A>T	c.(2257-2259)ACA>TCA	p.T753S	DSTYK_uc001hbx.2_Missense_Mutation_p.T753S	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	753	Protein kinase.					cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						TGCAAACGTGTCTCCAGGGTC	0.488			NA											25	75					0	0	0.005443	0	0
CR1	1378	broad.mit.edu	37	1	207751302	207751302	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:207751302T>C	uc001hfy.2	+	21	3480	c.3340T>C	c.(3340-3342)TAC>CAC	p.Y1114H	CR1_uc009xcl.1_Missense_Mutation_p.Y664H|CR1_uc001hfx.2_Missense_Mutation_p.Y1564H	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1114	Extracellular (Potential).|Sushi 17.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						GCCCTCCATATACTGCACCAG	0.502			NA											27	251					0	0	0.00623	0	0
LAMB3	3914	broad.mit.edu	37	1	209805972	209805972	+	Missense_Mutation	SNP	C	C	T	rs113063967		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:209805972C>T	uc001hhg.2	-	7	1168	c.778G>A	c.(778-780)GCA>ACA	p.A260T	LAMB3_uc009xco.2_Missense_Mutation_p.A260T|LAMB3_uc001hhh.2_Missense_Mutation_p.A260T|LAMB3_uc010psl.1_RNA|LAMB3_uc009xcp.1_Missense_Mutation_p.A196T	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	260	Laminin EGF-like 1.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GGCTTGGGTGCGCAGCGATCA	0.657			NA											9	105					0	0	0.006214	0	0
C1orf227	149643	broad.mit.edu	37	1	213009242	213009242	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:213009242T>C	uc001hjq.2	-	2	358	c.250A>G	c.(250-252)ATG>GTG	p.M84V		NM_001024601	NP_001019772	Q537H7	CA227_HUMAN	hypothetical protein LOC149643	84											0						TTTCTCTCCATGTGAGCAAGG	0.348			NA											20	108					0	0	0.007413	0	0
C1orf227	149643	broad.mit.edu	37	1	213009321	213009321	+	Silent	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:213009321G>C	uc001hjq.2	-	2	279	c.171C>G	c.(169-171)TCC>TCG	p.S57S		NM_001024601	NP_001019772	Q537H7	CA227_HUMAN	hypothetical protein LOC149643	57											0						TATCAGTAAAGGACTGATAGG	0.478			NA											45	162					0	0	0.00361	0	0
ANGEL2	90806	broad.mit.edu	37	1	213186655	213186655	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:213186655C>A	uc001hjz.2	-	2	320	c.165G>T	c.(163-165)ATG>ATT	p.M55I	ANGEL2_uc010pto.1_Intron|ANGEL2_uc010ptp.1_Intron|ANGEL2_uc001hka.2_Intron|ANGEL2_uc010ptq.1_Intron|ANGEL2_uc001hkb.2_Missense_Mutation_p.M33I	NM_144567	NP_653168	Q5VTE6	ANGE2_HUMAN	LOC90806 protein	55											0				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		CAGGCCACCTCATACAACTAG	0.473			NA											29	172					8.88839e-20	1.14109e-19	0.002096	1	0
USH2A	7399	broad.mit.edu	37	1	215848155	215848155	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:215848155G>T	uc001hku.1	-	63	13485	c.13098C>A	c.(13096-13098)GCC>GCA	p.A4366A		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4366	Extracellular (Potential).|Fibronectin type-III 29.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGCACTGACGGCCCAAAGAT	0.478			NA								HNSCC(13;0.011)			31	48					6.50621e-10	7.74519e-10	0.002836	1	0
USH2A	7399	broad.mit.edu	37	1	216363655	216363655	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:216363655G>T	uc001hku.1	-	20	4693	c.4306C>A	c.(4306-4308)CCT>ACT	p.P1436T	USH2A_uc001hkv.2_Missense_Mutation_p.P1436T	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1436	Extracellular (Potential).|Fibronectin type-III 4.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATCCTATAAGGTTTCAGTCCT	0.358			NA								HNSCC(13;0.011)			19	94					1.00905e-13	1.25275e-13	0.008871	1	0
WNT9A	7483	broad.mit.edu	37	1	228109378	228109378	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:228109378G>A	uc001hri.2	-	4	1027	c.939C>T	c.(937-939)TGC>TGT	p.C313C		NM_003395	NP_003386	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family,	313					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|cornea development in camera-type eye|embryonic arm morphogenesis|embryonic skeletal joint morphogenesis|endoderm development|iris morphogenesis|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|neuron differentiation|positive regulation of smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding|signal transducer activity			central_nervous_system(1)|pancreas(1)	2		Prostate(94;0.0405)				TCTCACGGTGGCACCTACGGC	0.672			NA											8	35					0	0	0.004482	0	0
TARBP1	6894	broad.mit.edu	37	1	234529224	234529224	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:234529224T>C	uc001hwd.2	-	28	4444	c.4444A>G	c.(4444-4446)AGG>GGG	p.R1482G		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	1482					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCACAGGTCCTGCACAGTCCT	0.502			NA											9	65					0	0	0.006214	0	0
MTR	4548	broad.mit.edu	37	1	236973836	236973836	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:236973836C>T	uc001hyi.3	+	5	866	c.443C>T	c.(442-444)CCG>CTG	p.P148L	MTR_uc010pxv.1_RNA|MTR_uc010pxw.1_5'UTR|MTR_uc010pxx.1_Missense_Mutation_p.P148L|MTR_uc010pxy.1_Missense_Mutation_p.P148L|MTR_uc009xgj.1_5'UTR	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	148	Hcy-binding.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GCTCTGGGTCCGACTAATAAG	0.363			NA											29	136					0	0	0.008361	0	0
RYR2	6262	broad.mit.edu	37	1	237711753	237711753	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:237711753A>C	uc001hyl.1	+	26	3049	c.2929A>C	c.(2929-2931)AAG>CAG	p.K977Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	977	Cytoplasmic (By similarity).|2.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGTGGATACAAGCCTGCCCC	0.423			NA											4	39					0	0	0.001984	0	0
RYR2	6262	broad.mit.edu	37	1	237813350	237813350	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:237813350C>A	uc001hyl.1	+	50	7806	c.7686C>A	c.(7684-7686)ACC>ACA	p.T2562T		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2562	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTTCACTTACCAAAGCTCAGC	0.408			NA											48	166					2.64514e-33	3.45646e-33	0.00361	1	0
FMN2	56776	broad.mit.edu	37	1	240255602	240255602	+	Nonsense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:240255602A>T	uc010pyd.1	+	1	418	c.193A>T	c.(193-195)AAG>TAG	p.K65*	FMN2_uc010pye.1_Nonsense_Mutation_p.K65*	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	65					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGCAAGAAGAAGAGCAAGTC	0.537			NA											6	9					0	0	0.001984	0	0
C1orf101	257044	broad.mit.edu	37	1	244715642	244715642	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:244715642A>G	uc001iam.2	+	9	614	c.555A>G	c.(553-555)GTA>GTG	p.V185V	C1orf101_uc001iak.1_Intron|C1orf101_uc001ial.2_Silent_p.V185V|C1orf101_uc010pym.1_Silent_p.V34V|C1orf101_uc010pyn.1_Silent_p.V118V	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	hypothetical protein LOC257044 isoform 1	185	Extracellular (Potential).					integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			GTATTGTAGTACCAATGACAA	0.338			NA											30	82					0	0	0.009535	0	0
OR2G3	81469	broad.mit.edu	37	1	247768980	247768980	+	Silent	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:247768980C>G	uc010pyz.1	+	1	93	c.93C>G	c.(91-93)GTC>GTG	p.V31V		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TTGTATTTGTCCTTTTCTTCT	0.463			NA											10	224					0	0	0.006214	0	0
OR11L1	391189	broad.mit.edu	37	1	248004548	248004548	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:248004548G>T	uc001idn.1	-	1	651	c.651C>A	c.(649-651)CCC>CCA	p.P217P		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGAAAACATAGGGCCCCAGTG	0.488			NA											12	99					2.27111e-07	2.58487e-07	0.001368	1	0
OR2M5	127059	broad.mit.edu	37	1	248309002	248309002	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:248309002C>A	uc010pze.1	+	1	553	c.553C>A	c.(553-555)CTA>ATA	p.L185I		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CCCTTCCCTACTAATCCTCTC	0.418			NA											58	460					9.53978e-28	1.24397e-27	0.00361	1	0
OR2T34	127068	broad.mit.edu	37	1	248737392	248737392	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:248737392A>G	uc001iep.1	-	1	667	c.667T>C	c.(667-669)TAC>CAC	p.Y223H		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	223	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGAGGGTGTATGAGCTGGAG	0.562			NA											26	292					0	0	0.004656	0	0
OR14I1	401994	broad.mit.edu	37	1	248845570	248845570	+	Silent	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:248845570C>G	uc001ieu.1	-	1	36	c.36G>C	c.(34-36)CTG>CTC	p.L12L		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	12	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AAAACTCCATCAGCAGGAATT	0.443			NA											24	34					0	0	0.004656	0	0
PGBD2	267002	broad.mit.edu	37	1	249211112	249211112	+	Missense_Mutation	SNP	G	G	A	rs146329960		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:249211112G>A	uc001ifh.2	+	3	476	c.329G>A	c.(328-330)CGC>CAC	p.R110H	PGBD2_uc001ifg.2_Intron|PGBD2_uc009xhd.2_Missense_Mutation_p.R107H	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	hypothetical protein LOC267002 isoform a	110										ovary(1)	1	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AAACCTCAGCGCATTTGGACC	0.527			NA											5	69					0	0	0.000602	0	0
ADARB2	105	broad.mit.edu	37	10	1279656	1279656	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:1279656G>A	uc009xhq.2	-	6	1867	c.1493C>T	c.(1492-1494)CCC>CTC	p.P498L		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	498	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GATCTCGTAGGGAGAGTGGAG	0.552			NA											22	135					0	0	0.001882	0	0
ITIH5	80760	broad.mit.edu	37	10	7608296	7608296	+	Missense_Mutation	SNP	G	G	A	rs150896441		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:7608296G>A	uc001ijq.2	-	13	2303	c.2224C>T	c.(2224-2226)CGC>TGC	p.R742C	ITIH5_uc001ijp.2_Missense_Mutation_p.R528C	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	742					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						GTGATAGTGCGCAAGTAAGTG	0.527			NA											10	42					0	0	0.008291	0	0
TAF3	83860	broad.mit.edu	37	10	7866286	7866286	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:7866286C>T	uc010qbd.1	+	2	172	c.172C>T	c.(172-174)CGA>TGA	p.R58*		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	58					maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						TTCAGATGGCCGAACAGACCC	0.353			NA											21	142					0	0	0.00278	0	0
CELF2	10659	broad.mit.edu	37	10	11367850	11367850	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:11367850A>G	uc001iki.3	+	12	1399	c.1307A>G	c.(1306-1308)GAC>GGC	p.D436G	CELF2_uc010qbj.1_Missense_Mutation_p.D442G|CELF2_uc001ikk.2_Missense_Mutation_p.D461G|CELF2_uc001ikl.3_Missense_Mutation_p.D449G|CELF2_uc010qbl.1_Missense_Mutation_p.D412G|CELF2_uc010qbm.1_Missense_Mutation_p.D208G|CELF2_uc001iko.3_Missense_Mutation_p.D416G|CELF2_uc001ikp.3_Missense_Mutation_p.D418G|CELF2_uc010qbn.1_Missense_Mutation_p.D424G|CELF2_uc010qbo.1_Missense_Mutation_p.D331G|CELF2_uc010qbp.1_Missense_Mutation_p.D208G	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2	436	RRM 3.|Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.				mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						GAATTTGGAGACCAGGACATT	0.418			NA											15	86					0	0	0.003163	0	0
DHTKD1	55526	broad.mit.edu	37	10	12131255	12131255	+	Splice_Site	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:12131255G>T	uc001ild.3	+	5	1086	c.987_splice	c.e5+1	p.Q329_splice		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain						glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TTGCTTACAGGTACTTGGAGC	0.557			NA											19	69					1.2644e-06	1.40943e-06	0.010504	1	0
FAM107B	83641	broad.mit.edu	37	10	14816530	14816530	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:14816530C>G	uc001ina.1	-	1	367	c.133G>C	c.(133-135)GTG>CTG	p.V45L	FAM107B_uc010qbu.1_RNA	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641	Error:Variant_position_missing_in_Q9H098_after_alignment										breast(4)	4						GTATCAGCCACGCCGGACTGA	0.552			NA											23	107					0	0	0.002299	0	0
CUBN	8029	broad.mit.edu	37	10	16867008	16867008	+	Missense_Mutation	SNP	C	C	T	rs148626202		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:16867008C>T	uc001ioo.2	-	67	10890	c.10838G>A	c.(10837-10839)CGT>CAT	p.R3613H		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3613	CUB 27.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGCGGATGGACGCCGTGCATA	0.463			NA											7	39					0	0	0.00308	0	0
CUBN	8029	broad.mit.edu	37	10	17110253	17110253	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:17110253T>A	uc001ioo.2	-	21	2870	c.2818A>T	c.(2818-2820)ACA>TCA	p.T940S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	940	CUB 5.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATGGTCCCTGTTGATTCTGTA	0.373			NA											7	142					0	0	0.001984	0	0
SLC39A12	221074	broad.mit.edu	37	10	18331738	18331738	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:18331738A>T	uc001ipo.2	+	13	2325	c.2052A>T	c.(2050-2052)ATA>ATT	p.I684I	SLC39A12_uc001ipn.2_Silent_p.I647I|SLC39A12_uc001ipp.2_Silent_p.I683I|SLC39A12_uc010qck.1_Silent_p.I550I	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	684	Helical; (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TCTTGGCTATATATGAGCAAA	0.343			NA											17	51					0	0	0.00499	0	0
CACNB2	783	broad.mit.edu	37	10	18439885	18439885	+	Nonsense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:18439885C>G	uc001ipr.2	+	2	254	c.194C>G	c.(193-195)TCA>TGA	p.S65*	CACNB2_uc009xjz.1_Nonsense_Mutation_p.S65*|CACNB2_uc001ips.2_Nonsense_Mutation_p.S65*|CACNB2_uc001ipt.2_Nonsense_Mutation_p.S65*|CACNB2_uc010qcl.1_RNA|CACNB2_uc001ipu.2_Nonsense_Mutation_p.S37*|CACNB2_uc001ipv.2_Nonsense_Mutation_p.S37*|CACNB2_uc009xka.1_Nonsense_Mutation_p.S37*	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2	65					axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GATACTACCTCAAATAGTTTT	0.308			NA											31	99					0	0	0.004289	0	0
PLXDC2	84898	broad.mit.edu	37	10	20432341	20432341	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:20432341A>G	uc001iqg.1	+	5	1296	c.659A>G	c.(658-660)GAT>GGT	p.D220G	PLXDC2_uc001iqh.1_Missense_Mutation_p.D171G|PLXDC2_uc009xkc.1_RNA	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor	220	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						AGATATTTTGATAATGGTATG	0.338			NA											12	90					0	0	0.001368	0	0
GPR158	57512	broad.mit.edu	37	10	25861745	25861745	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:25861745A>C	uc001isj.2	+	7	1742	c.1682A>C	c.(1681-1683)CAG>CCG	p.Q561P		NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	561	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						CTTATTGGCCAGGGGAAAACA	0.448			NA											5	55					0	0	0.000602	0	0
SVIL	6840	broad.mit.edu	37	10	29815987	29815987	+	Splice_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:29815987T>C	uc001iut.1	-	13	3000	c.2247_splice	c.e13-1	p.T749_splice	SVIL_uc001iuu.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				ATAGGTTCACTTTAAAAGCAA	0.453			NA											3	25					0	0	0.009096	0	0
LYZL2	119180	broad.mit.edu	37	10	30918551	30918551	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:30918551A>G	uc001ivk.2	-	1	97	c.84T>C	c.(82-84)TCT>TCC	p.S28S		NM_183058	NP_898881	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	Error:Variant_position_missing_in_Q7Z4W2_after_alignment					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)				TGCCTGCCGCAGAGGCTGACT	0.527			NA											12	49					0	0	0.001368	0	0
ZNF438	220929	broad.mit.edu	37	10	31133931	31133931	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:31133931T>C	uc010qdz.1	-	8	2881	c.2446A>G	c.(2446-2448)AAC>GAC	p.N816D	ZNF438_uc001ivn.2_Missense_Mutation_p.N767D|ZNF438_uc010qdy.1_Missense_Mutation_p.N806D|ZNF438_uc001ivo.3_Missense_Mutation_p.N380D|ZNF438_uc009xlg.2_Missense_Mutation_p.N816D|ZNF438_uc001ivp.3_Missense_Mutation_p.N806D|ZNF438_uc010qea.1_Missense_Mutation_p.N816D|ZNF438_uc010qeb.1_Missense_Mutation_p.N816D	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	816					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)				ACTCCCTGGTTGGAGACCGTA	0.532			NA											14	278					0	0	0.003163	0	0
ZNF438	220929	broad.mit.edu	37	10	31137810	31137810	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:31137810T>C	uc010qdz.1	-	7	1959	c.1524A>G	c.(1522-1524)AGA>AGG	p.R508R	ZNF438_uc001ivn.2_Silent_p.R459R|ZNF438_uc010qdy.1_Silent_p.R498R|ZNF438_uc001ivo.3_Silent_p.R72R|ZNF438_uc009xlg.2_Silent_p.R508R|ZNF438_uc001ivp.3_Silent_p.R498R|ZNF438_uc010qea.1_Silent_p.R508R|ZNF438_uc010qeb.1_Silent_p.R508R|ZNF438_uc010qec.1_Silent_p.R72R	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	508	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)				AGACGTGACATCTGTGCCAAG	0.488			NA											16	251					0	0	0.00499	0	0
ANKRD30A	91074	broad.mit.edu	37	10	37486217	37486217	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:37486217G>T	uc001iza.1	+	28	2554	c.2455G>T	c.(2455-2457)GAG>TAG	p.E819*		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	875						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						AGAGCCTCCCGAGAAGCCATC	0.323			NA											60	157					1.84395e-34	2.41207e-34	0.00361	1	0
ZNF37A	7587	broad.mit.edu	37	10	38406690	38406690	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:38406690A>T	uc001izk.2	+	8	1430	c.611A>T	c.(610-612)GAA>GTA	p.E204V	ZNF37A_uc001izl.2_Missense_Mutation_p.E204V|ZNF37A_uc001izm.2_Missense_Mutation_p.E204V	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	204						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1						TATGGTAATGAATGTGGAGAA	0.383			NA											26	60					0	0	0.008361	0	0
ZNF239	8187	broad.mit.edu	37	10	44052263	44052263	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:44052263T>C	uc001jaw.3	-	2	1918	c.1265A>G	c.(1264-1266)CAG>CGG	p.Q422R	ZNF239_uc001jax.3_Missense_Mutation_p.Q422R|ZNF239_uc009xmj.2_Missense_Mutation_p.Q422R|ZNF239_uc009xmk.2_Missense_Mutation_p.Q422R	NM_005674	NP_005665	Q16600	ZN239_HUMAN	zinc finger protein 239	422	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|RNA binding|zinc ion binding				0						ATGTACTCTCTGGTGGATGAG	0.522			NA											6	55					0	0	0.001168	0	0
ANUBL1	93550	broad.mit.edu	37	10	46111911	46111911	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:46111911A>G	uc001jcp.3	-	10	2399	c.2157T>C	c.(2155-2157)GTT>GTC	p.V719V	ANUBL1_uc001jcl.3_Silent_p.V239V|ANUBL1_uc001jcm.3_Silent_p.V719V|ANUBL1_uc009xmu.2_Silent_p.V645V|ANUBL1_uc001jcn.3_Silent_p.V645V|ANUBL1_uc001jco.3_3'UTR	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN	AN1, ubiquitin-like, homolog	719							zinc ion binding				0						TTGGTGCATTAACCACAGGAT	0.408			NA											9	125					0	0	0.004482	0	0
PCDH15	65217	broad.mit.edu	37	10	55582643	55582643	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:55582643A>G	uc001jju.1	-	33	5238	c.4843T>C	c.(4843-4845)TGT>CGT	p.C1615R	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.C1612R|PCDH15_uc010qhw.1_Missense_Mutation_p.C1575R|PCDH15_uc010qhx.1_Missense_Mutation_p.C1546R|PCDH15_uc010qhy.1_Missense_Mutation_p.C1622R|PCDH15_uc010qhz.1_Missense_Mutation_p.C1617R|PCDH15_uc010qia.1_Missense_Mutation_p.C1595R|PCDH15_uc010qib.1_Missense_Mutation_p.C1592R	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1615	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TTGTTTGTACAGATTCCAGTG	0.428			NA								HNSCC(58;0.16)			31	127					0	0	0.003755	0	0
PCDH15	65217	broad.mit.edu	37	10	55582862	55582862	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:55582862T>C	uc001jju.1	-	33	5019	c.4624A>G	c.(4624-4626)ATT>GTT	p.I1542V	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.I1539V|PCDH15_uc010qhw.1_Missense_Mutation_p.I1502V|PCDH15_uc010qhx.1_Missense_Mutation_p.I1473V|PCDH15_uc010qhy.1_Missense_Mutation_p.I1549V|PCDH15_uc010qhz.1_Missense_Mutation_p.I1544V|PCDH15_uc010qia.1_Missense_Mutation_p.I1522V|PCDH15_uc010qib.1_Missense_Mutation_p.I1519V	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1542	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CTCTGTGAAATGTCTGAATTT	0.393			NA								HNSCC(58;0.16)			23	134					0	0	0.00333	0	0
PCDH15	65217	broad.mit.edu	37	10	55944970	55944970	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:55944970G>A	uc001jju.1	-	12	1759	c.1364C>T	c.(1363-1365)ACA>ATA	p.T455I	PCDH15_uc010qhq.1_Missense_Mutation_p.T460I|PCDH15_uc010qhr.1_Missense_Mutation_p.T455I|PCDH15_uc010qhs.1_Missense_Mutation_p.T467I|PCDH15_uc010qht.1_Missense_Mutation_p.T462I|PCDH15_uc010qhu.1_Missense_Mutation_p.T455I|PCDH15_uc001jjv.1_Missense_Mutation_p.T433I|PCDH15_uc010qhv.1_Missense_Mutation_p.T455I|PCDH15_uc010qhw.1_Missense_Mutation_p.T418I|PCDH15_uc010qhx.1_Missense_Mutation_p.T455I|PCDH15_uc010qhy.1_Missense_Mutation_p.T460I|PCDH15_uc010qhz.1_Missense_Mutation_p.T455I|PCDH15_uc010qia.1_Missense_Mutation_p.T433I|PCDH15_uc010qib.1_Missense_Mutation_p.T433I|PCDH15_uc001jjw.2_Missense_Mutation_p.T455I	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	455	Cadherin 4.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ACCAGTCTGTGTGACGGTGAA	0.388			NA								HNSCC(58;0.16)			22	72					0	0	0.00278	0	0
ANK3	288	broad.mit.edu	37	10	61835419	61835419	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:61835419C>T	uc001jky.2	-	37	5412	c.5220G>A	c.(5218-5220)ACG>ACA	p.T1740T	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1740	Ser-rich.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TTTCCTGTAACGTGGCAGTGG	0.433			NA											9	83					0	0	0.004482	0	0
NRBF2	29982	broad.mit.edu	37	10	64913381	64913381	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:64913381C>T	uc001jmj.3	+	4	491	c.267C>T	c.(265-267)AAC>AAT	p.N89N	NRBF2_uc010qip.1_Silent_p.N79N	NM_030759	NP_110386	Q96F24	NRBF2_HUMAN	nuclear receptor binding factor 2	89					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	cytoplasm|nucleoplasm	protein binding				0	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCCAGCAGAACACAGACAAGG	0.512			NA											9	56					0	0	0.006214	0	0
HERC4	26091	broad.mit.edu	37	10	69751983	69751983	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:69751983G>A	uc001jng.3	-	11	1555	c.1244C>T	c.(1243-1245)TCT>TTT	p.S415F	HERC4_uc009xpq.2_5'UTR|HERC4_uc001jnf.3_RNA|HERC4_uc001jnh.3_Missense_Mutation_p.S415F|HERC4_uc009xpr.2_Missense_Mutation_p.S415F|HERC4_uc001jni.3_Missense_Mutation_p.S159F|HERC4_uc001jnj.2_Missense_Mutation_p.S415F	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a	415					cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						AAACCTTCCAGAAGGATAGCT	0.323			NA											16	72					0	0	0.004007	0	0
MYPN	84665	broad.mit.edu	37	10	69934191	69934191	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:69934191A>G	uc001jnm.3	+	12	2527	c.2342A>G	c.(2341-2343)CAA>CGA	p.Q781R	MYPN_uc001jnn.3_Missense_Mutation_p.Q506R|MYPN_uc001jno.3_Missense_Mutation_p.Q781R|MYPN_uc009xpt.2_Missense_Mutation_p.Q781R|MYPN_uc010qit.1_Missense_Mutation_p.Q487R|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	781						nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						CTTTCCATCCAAAATGAGCCA	0.527			NA											23	66					0	0	0.002299	0	0
DDX50	79009	broad.mit.edu	37	10	70672916	70672916	+	Splice_Site	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:70672916A>G	uc001jou.2	+	5	747	c.640_splice	c.e5-2	p.V214_splice	DDX50_uc001jot.2_Splice_Site_p.V214_splice|DDX50_uc010qjc.1_Splice_Site_p.V214_splice	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						CCTCTTGCTCAGGTACTTGTT	0.358			NA											7	34					0	0	0.00308	0	0
CDH23	64072	broad.mit.edu	37	10	73544143	73544143	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:73544143C>A	uc001jrx.3	+	40	5845	c.5468C>A	c.(5467-5469)GCC>GAC	p.A1823D		NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1823	Cadherin 17.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ACCATCTGTGCCCGTGACCGG	0.632			NA											16	63					2.23348e-06	2.47634e-06	0.004007	1	0
CAMK2G	818	broad.mit.edu	37	10	75607836	75607836	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:75607836G>T	uc001jvv.1	-	9	706	c.582C>A	c.(580-582)GTC>GTA	p.V194V	CAMK2G_uc001jvm.1_Silent_p.V202V|CAMK2G_uc001jvo.1_Silent_p.V202V|CAMK2G_uc001jvq.1_Silent_p.V202V|CAMK2G_uc001jvr.1_Silent_p.V202V|CAMK2G_uc001jvp.1_Silent_p.V202V|CAMK2G_uc001jvs.1_Silent_p.V202V|CAMK2G_uc001jvt.1_RNA|CAMK2G_uc001jvu.1_Silent_p.V180V|CAMK2G_uc010qkv.1_Intron	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	202	Protein kinase.				insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					TATACAGGATGACCCCTACGA	0.532			NA											25	111					1.17739e-12	1.44303e-12	0.005443	1	0
LDB3	11155	broad.mit.edu	37	10	88439263	88439263	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:88439263T>A	uc001kdv.2	+	2	256	c.233T>A	c.(232-234)CTC>CAC	p.L78H	LDB3_uc010qml.1_Missense_Mutation_p.L78H|LDB3_uc010qmm.1_Missense_Mutation_p.L78H|LDB3_uc001kdu.2_Missense_Mutation_p.L78H|LDB3_uc009xsz.2_5'UTR|LDB3_uc001kdr.2_Missense_Mutation_p.L78H|LDB3_uc009xsy.2_Missense_Mutation_p.L78H|LDB3_uc001kds.2_Missense_Mutation_p.L78H|LDB3_uc001kdt.2_RNA	NM_007078	NP_009009	O75112	LDB3_HUMAN	LIM domain binding 3 isoform 1	78	PDZ.					cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding			ovary(1)	1						AACTTGAGCCTCACCCTGCAG	0.587			NA											36	45					0	0	0.006999	0	0
IFIT2	3433	broad.mit.edu	37	10	91066380	91066380	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:91066380C>T	uc009xts.2	+	2	842	c.667C>T	c.(667-669)CGT>TGT	p.R223C	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron	NM_001547	NP_001538	P09913	IFIT2_HUMAN	interferon-induced protein with	223					negative regulation of protein binding|response to virus|type I interferon-mediated signaling pathway		protein binding			ovary(1)|skin(1)	2		Colorectal(252;0.0161)				TCATAAGATGCGTGAAGAAGG	0.493			NA											17	59					0	0	0.006122	0	0
PDE6C	5146	broad.mit.edu	37	10	95385369	95385369	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:95385369T>C	uc001kiu.3	+	5	1040	c.902T>C	c.(901-903)GTA>GCA	p.V301A		NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C	301	GAF 2.				visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding	p.V301_E302del(1)		ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)				CTTGGAGAAGTAGAGCCTTAT	0.423			NA											13	29					0	0	0.003163	0	0
PI4K2A	55361	broad.mit.edu	37	10	99426256	99426256	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:99426256T>A	uc001kog.1	+	7	1203	c.1146T>A	c.(1144-1146)GAT>GAA	p.D382E	PI4K2A_uc010qoy.1_Missense_Mutation_p.D352E|PI4K2A_uc009xvw.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	382	PI3K/PI4K.				phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		AGATCAAAGATCTGATCCTTC	0.468			NA											11	51					0	0	0.001368	0	0
SFXN3	81855	broad.mit.edu	37	10	102796833	102796833	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:102796833A>G	uc001ksp.2	+	8	1062	c.606A>G	c.(604-606)AGA>AGG	p.R202R	SFXN3_uc001ksq.2_Silent_p.R202R|SFXN3_uc010qpx.1_Silent_p.R206R	NM_030971	NP_112233	Q9BWM7	SFXN3_HUMAN	sideroflexin 3	202					iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		TCCCTTGCAGAGAGCTGCAGG	0.627			NA											13	27					0	0	0.00245	0	0
CNNM2	54805	broad.mit.edu	37	10	104678357	104678357	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:104678357C>T	uc001kwm.2	+	1	244	c.120C>T	c.(118-120)ATC>ATT	p.I40I	CNNM2_uc001kwn.2_Silent_p.I40I|CNNM2_uc001kwl.2_Silent_p.I40I	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	40					ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GCCGGGGGATCCTGCAGGCGG	0.592			NA											3	6					0	0	0.009096	0	0
ITPRIP	85450	broad.mit.edu	37	10	106075426	106075426	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:106075426G>A	uc001kye.2	-	2	457	c.384C>T	c.(382-384)GGC>GGT	p.G128G	ITPRIP_uc001kyf.2_Silent_p.G128G|ITPRIP_uc001kyg.2_Silent_p.G128G	NM_033397	NP_203755	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-triphosphate receptor interacting	128						plasma membrane					0						GCAAGGGGGCGCCCCCCAGCC	0.692			NA											11	88					0	0	0.001368	0	0
C10orf96	374355	broad.mit.edu	37	10	118084561	118084561	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:118084561C>A	uc001lck.2	+	2	289	c.38C>A	c.(37-39)ACC>AAC	p.T13N		NM_198515	NP_940917	P0C7W6	CJ096_HUMAN	hypothetical protein LOC374355	13	Potential.									ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)		ATCATCTTCACCGAGCATCAG	0.517			NA											14	48					1.05317e-09	1.25014e-09	0.00245	1	0
TIAL1	7073	broad.mit.edu	37	10	121337189	121337189	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:121337189T>C	uc001lei.1	-	8	1180	c.616A>G	c.(616-618)ACT>GCT	p.T206A	TIAL1_uc001leh.1_Missense_Mutation_p.T184A|TIAL1_uc001lej.1_Missense_Mutation_p.T223A|TIAL1_uc001lek.1_Missense_Mutation_p.T83A|TIAL1_uc009xzi.1_Missense_Mutation_p.T75A|TIAL1_uc010qtb.1_Missense_Mutation_p.T83A	NM_003252	NP_003243	Q01085	TIAR_HUMAN	TIA-1 related protein isoform 1	206	RRM 3.				apoptosis|defense response|induction of apoptosis|regulation of transcription from RNA polymerase II promoter	lysosome|nucleus|stress granule	nucleotide binding|RNA binding			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		CAGTACACAGTACAATTTTTT	0.368			NA											39	136					0	0	0.003214	0	0
GPR26	2849	broad.mit.edu	37	10	125426343	125426343	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:125426343C>A	uc001lhh.2	+	1	473	c.420C>A	c.(418-420)GCC>GCA	p.A140A		NM_153442	NP_703143	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	140	Helical; Name=4; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				TCCCAGCCGCCGCGCTCGCCC	0.711			NA											4	11					0.00909568	0.00938228	0.009096	1	0
CPXM2	119587	broad.mit.edu	37	10	125521574	125521574	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:125521574G>T	uc001lhk.1	-	11	1916	c.1591C>A	c.(1591-1593)CGG>AGG	p.R531R	CPXM2_uc001lhj.2_RNA	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	531					cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CAGGGGGACCGCACCAGGTCG	0.632			NA											17	104					1.33834e-09	1.5826e-09	0.007413	1	0
C10orf137	26098	broad.mit.edu	37	10	127436206	127436206	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:127436206T>C	uc001liq.1	+	20	3209	c.2916T>C	c.(2914-2916)TTT>TTC	p.F972F	C10orf137_uc001lin.2_Silent_p.F938F|C10orf137_uc001lio.1_Silent_p.F938F|C10orf137_uc001lip.1_Silent_p.F676F|C10orf137_uc001lis.1_Silent_p.F298F|C10orf137_uc001lit.1_5'Flank	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1	972					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CTACTTACTTTACTATGGCAA	0.388			NA											14	70					0	0	0.00245	0	0
DPYSL4	10570	broad.mit.edu	37	10	134016185	134016185	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:134016185C>A	uc009ybb.2	+	12	1471	c.1317C>A	c.(1315-1317)TGC>TGA	p.C439*		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	439					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		GAGTGGAGTGCCGGGGAGCGC	0.657			NA											11	51					3.07112e-06	3.39597e-06	0.000978	1	0
B4GALNT4	338707	broad.mit.edu	37	11	379674	379674	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:379674G>A	uc001lpb.2	+	15	2470	c.2461G>A	c.(2461-2463)GAC>AAC	p.D821N		NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN	beta	821	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			pancreas(1)	1		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGGCGCCAGGACGTGATGGT	0.682			NA											6	15					0	0	0.00308	0	0
MUC5B	727897	broad.mit.edu	37	11	1269131	1269131	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:1269131C>A	uc009ycr.1	+	50	12731	c.12605C>A	c.(12604-12606)ACC>AAC	p.T4202N	MUC5B_uc001ltb.2_Missense_Mutation_p.T3677N	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3674	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGCCCCAGCACCCCGGCCACC	0.597			NA											28	131					2.59497e-14	3.23137e-14	0.007835	1	0
MRPL23	6150	broad.mit.edu	37	11	1974042	1974042	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:1974042T>C	uc001lux.2	+	4	345	c.254T>C	c.(253-255)GTG>GCG	p.V85A		NM_021134	NP_066957	Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	85					translation	mitochondrial large ribosomal subunit	nucleotide binding|RNA binding|structural constituent of ribosome			large_intestine(2)|ovary(1)	3		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CACAGAAACGTGAGGATCAAG	0.502			NA									OREG0020673	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	18					0	0	0.004672	0	0
OR51E1	143503	broad.mit.edu	37	11	4673831	4673831	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:4673831G>T	uc001lzi.3	+	2	219	c.75G>T	c.(73-75)GAG>GAT	p.E25D		NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTTTAGAAGAGGCTCAGTTCT	0.493			NA											43	111					2.40228e-13	2.97653e-13	0.003214	1	0
OR51F1	256892	broad.mit.edu	37	11	4790450	4790450	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:4790450G>A	uc010qyl.1	-	1	698	c.698C>T	c.(697-699)CCT>CTT	p.P233L		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	233						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCATTCTTCAGGGGAGGCAAT	0.453			NA											36	80					0	0	0.005524	0	0
OR52R1	119695	broad.mit.edu	37	11	4825052	4825052	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:4825052C>A	uc010qym.1	-	1	796	c.796G>T	c.(796-798)GTG>TTG	p.V266L		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	187	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AACTTCAGCACAGCCATGTGC	0.522			NA											43	67					1.41504e-22	1.83365e-22	0.002852	1	0
OR52R1	119695	broad.mit.edu	37	11	4825054	4825054	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:4825054G>C	uc010qym.1	-	1	794	c.794C>G	c.(793-795)GCT>GGT	p.A265G		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	186	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTCAGCACAGCCATGTGCTC	0.522			NA											42	69					0	0	0.002852	0	0
OR51B5	282763	broad.mit.edu	37	11	5364088	5364088	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:5364088C>T	uc001map.1	-	1	667	c.667G>A	c.(667-669)GTC>ATC	p.V223I	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGCTCAGGACAGTCTTGAGT	0.448			NA											7	111					0	0	0.001984	0	0
OR56B1	387748	broad.mit.edu	37	11	5758380	5758380	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:5758380G>A	uc001mbt.1	+	1	634	c.634G>A	c.(634-636)GCA>ACA	p.A212T	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005180	NP_001005180	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B,	212	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		GTTGGTTCTGGCATGGCTTGG	0.453			NA											9	52					0	0	0.008291	0	0
OR56A1	120796	broad.mit.edu	37	11	6048892	6048892	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:6048892G>T	uc010qzw.1	-	1	43	c.43C>A	c.(43-45)CCA>ACA	p.P15T		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	15	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCAGAGACTGGGACAGTGGAG	0.527			NA											9	82					3.09899e-07	3.51746e-07	0.004482	1	0
OR56B4	196335	broad.mit.edu	37	11	6129945	6129945	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:6129945C>A	uc010qzx.1	+	1	937	c.937C>A	c.(937-939)CTG>ATG	p.L313M		NM_001005181	NP_001005181	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B,	313	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTGCTTGGACTGGGTCAGGA	0.483			NA											22	123					2.27731e-05	2.47421e-05	0.001882	1	0
OR10A5	144124	broad.mit.edu	37	11	6867096	6867096	+	Nonsense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:6867096C>G	uc001met.1	+	1	183	c.183C>G	c.(181-183)TAC>TAG	p.Y61*		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCCCCATGTACTTCTTCCTCA	0.473	Pancreas(44;21 1072 25662 28041 45559)		NA											44	165					0	0	0.00361	0	0
OR10A5	144124	broad.mit.edu	37	11	6867123	6867123	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:6867123G>T	uc001met.1	+	1	210	c.210G>T	c.(208-210)CTG>CTT	p.L70L		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TATCTTTCCTGGAGATTGGCT	0.498	Pancreas(44;21 1072 25662 28041 45559)		NA											36	131					1.07637e-12	1.32182e-12	0.004878	1	0
NLRP14	338323	broad.mit.edu	37	11	7081289	7081289	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:7081289A>T	uc001mfb.1	+	9	3121	c.2798A>T	c.(2797-2799)GAC>GTC	p.D933V		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	933	LRR 8.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		AATCTTCAGGACTTGGAGTAG	0.443			NA											40	161					0	0	0.002852	0	0
RIC3	79608	broad.mit.edu	37	11	8148266	8148266	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:8148266T>G	uc001mgd.2	-	5	664	c.610A>C	c.(610-612)ATT>CTT	p.I204L	RIC3_uc001mgb.2_Missense_Mutation_p.I42L|RIC3_uc001mgc.2_Missense_Mutation_p.I203L|RIC3_uc001mge.2_Intron|RIC3_uc010rbl.1_Missense_Mutation_p.I154L|RIC3_uc010rbm.1_Missense_Mutation_p.I232L|RIC3_uc009yfm.2_Intron|RIC3_uc009yfn.2_Missense_Mutation_p.I7L	NM_024557	NP_078833	Q7Z5B4	RIC3_HUMAN	resistance to inhibitors of cholinesterase 3	204	Cytoplasmic (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				large_intestine(1)|ovary(1)|pancreas(1)	3				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		AATCTGTCAATGAATTTTCCT	0.448			NA											17	62					0	0	0.004007	0	0
STK33	65975	broad.mit.edu	37	11	8496256	8496256	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:8496256T>A	uc001mgi.1	-	1	1116	c.197A>T	c.(196-198)AAC>ATC	p.N66I	STK33_uc001mgj.1_Missense_Mutation_p.N66I|STK33_uc001mgk.1_Missense_Mutation_p.N66I|STK33_uc010rbn.1_Missense_Mutation_p.N25I|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168	Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	66						Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		TATATCTCTGTTGATATTTTT	0.388			NA											9	41					0	0	0.004482	0	0
IPO7	10527	broad.mit.edu	37	11	9445353	9445353	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:9445353G>A	uc001mho.2	+	10	1213	c.1071G>A	c.(1069-1071)TTG>TTA	p.L357L		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	357					interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		TTTTTCCATTGATGTGCTATA	0.313			NA											10	95					0	0	0.008291	0	0
IPO7	10527	broad.mit.edu	37	11	9445360	9445360	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:9445360T>C	uc001mho.2	+	10	1220	c.1078T>C	c.(1078-1080)TAT>CAT	p.Y360H		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	360					interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		ATTGATGTGCTATACAGATGC	0.318			NA											12	101					0	0	0.001855	0	0
CSNK2A1P	283106	broad.mit.edu	37	11	11373918	11373918	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:11373918C>A	uc001mjp.2	-	1	987	c.749G>T	c.(748-750)GGG>GTG	p.G250V	GALNTL4_uc001mjo.2_Intron	NM_177559	NP_808227			casein kinase II alpha 1 subunit isoform a												0						ATCTTCTGTCCCCAGAAACTT	0.418			NA											18	113					2.70662e-09	3.18245e-09	0.009535	1	0
CSNK2A1P	283106	broad.mit.edu	37	11	11374301	11374301	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:11374301C>A	uc001mjp.2	-	1	604	c.366G>T	c.(364-366)AAG>AAT	p.K122N	GALNTL4_uc001mjo.2_Intron	NM_177559	NP_808227			casein kinase II alpha 1 subunit isoform a												0						GGTACAATTGCTTGAAGTCTG	0.438			NA											18	108					2.94398e-08	3.39732e-08	0.007413	1	0
SPON1	10418	broad.mit.edu	37	11	14280894	14280894	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:14280894A>T	uc001mle.2	+	13	2099	c.1561A>T	c.(1561-1563)ATG>TTG	p.M521L		NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein	521	TSP type-1 2.				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		CGGCATGGGCATGAGGTCCCG	0.627			NA											5	8					0	0	0.001168	0	0
INSC	387755	broad.mit.edu	37	11	15212305	15212305	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:15212305G>A	uc001mly.2	+	6	825	c.779G>A	c.(778-780)GGG>GAG	p.G260E	INSC_uc001mlz.2_Missense_Mutation_p.G213E|INSC_uc001mma.2_Missense_Mutation_p.G213E|INSC_uc010rcs.1_Missense_Mutation_p.G248E|INSC_uc001mmb.2_Missense_Mutation_p.G213E|INSC_uc001mmc.2_Missense_Mutation_p.G213E	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	260					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						TCCACCACAGGGAACCTGTTC	0.512			NA											35	133					0	0	0.004878	0	0
SOX6	55553	broad.mit.edu	37	11	16077358	16077358	+	Silent	SNP	C	C	A	rs139974161		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:16077358C>A	uc001mme.2	-	10	1263	c.1230G>T	c.(1228-1230)ACG>ACT	p.T410T	SOX6_uc001mmd.2_Silent_p.T359T|SOX6_uc001mmf.2_Silent_p.T356T|SOX6_uc001mmg.2_Silent_p.T397T	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	397					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						TAGGTGAGACCGTCCCTGCTG	0.502			NA											15	57					2.32078e-09	2.73137e-09	0.003163	1	0
PLEKHA7	144100	broad.mit.edu	37	11	16838711	16838711	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:16838711C>A	uc001mmo.2	-	11	1517	c.1502G>T	c.(1501-1503)CGA>CTA	p.R501L	PLEKHA7_uc010rcu.1_Missense_Mutation_p.R501L|PLEKHA7_uc010rcv.1_Missense_Mutation_p.R75L|PLEKHA7_uc001mmn.2_Missense_Mutation_p.R209L	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	501					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						GTGGCTGGCTCGGTCCTGCGC	0.642			NA											21	111					2.89027e-11	3.49756e-11	0.002299	1	0
ABCC8	6833	broad.mit.edu	37	11	17430022	17430022	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:17430022G>T	uc001mnc.2	-	23	2863	c.2737C>A	c.(2737-2739)CTC>ATC	p.L913I		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	913	ABC transporter 1.|Cytoplasmic (By similarity).				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	AAGTCCTTGAGGGTACCCTCC	0.552			NA											21	107					3.8784e-16	4.89324e-16	0.001882	1	0
KCNC1	3746	broad.mit.edu	37	11	17793334	17793334	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:17793334G>A	uc001mnk.3	+	2	748	c.693G>A	c.(691-693)ACG>ACA	p.T231T	KCNC1_uc009yhc.1_Silent_p.T231T	NM_004976	NP_004967	P48547	KCNC1_HUMAN	Shaw-related voltage-gated potassium channel	231						voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1						GCAATGGCACGCAAGTGCGCT	0.577			NA											16	86					0	0	0.003163	0	0
MRGPRX3	117195	broad.mit.edu	37	11	18159239	18159239	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:18159239C>A	uc001mnu.2	+	3	851	c.490C>A	c.(490-492)CTG>ATG	p.L164M		NM_054031	NP_473372	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	164	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|pancreas(1)	2						CTGTGACTTCCTGTTTAGTGG	0.522			NA											11	117					0.000978159	0.00103296	0.000978	1	0
FANCF	2188	broad.mit.edu	37	11	22647210	22647210	+	Silent	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:22647210A>C	uc001mql.1	-	1	178	c.147T>G	c.(145-147)GGT>GGG	p.G49G		NM_022725	NP_073562	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	49					DNA repair	nucleoplasm	protein binding			skin(1)	1						GGCCATGCCGACCAAAGCGCC	0.677			NA	N|F			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	FanconAnemia				6	42					0	0	0.001168	0	0
Unknown	0	broad.mit.edu	37	11	31086146	31086146	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:31086146C>A	uc009yjk.1	-	8	874	c.805G>T	c.(805-807)GGT>TGT	p.G269C	uc009yjl.1_Missense_Mutation_p.G197C|DCDC1_uc001msu.1_Missense_Mutation_p.G440C					RecName: Full=Doublecortin domain-containing protein 5;												NA						TGCTTCAGACCAAGGTTGCTG	0.423			NA											23	83					2.70639e-06	2.998e-06	0.002299	1	0
LRRC4C	57689	broad.mit.edu	37	11	40136488	40136488	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:40136488G>A	uc001mxa.1	-	2	3319	c.1355C>T	c.(1354-1356)TCT>TTT	p.S452F	LRRC4C_uc001mxc.1_Missense_Mutation_p.S448F|LRRC4C_uc001mxd.1_Missense_Mutation_p.S448F|LRRC4C_uc001mxb.1_Missense_Mutation_p.S448F	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	452					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				TGAAAAGTAAGAGAAAGGAGT	0.488			NA											40	73					0	0	0.00623	0	0
LRRC4C	57689	broad.mit.edu	37	11	40137478	40137478	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:40137478C>A	uc001mxa.1	-	2	2329	c.365G>T	c.(364-366)GGT>GTT	p.G122V	LRRC4C_uc001mxc.1_Missense_Mutation_p.G118V|LRRC4C_uc001mxd.1_Missense_Mutation_p.G118V|LRRC4C_uc001mxb.1_Missense_Mutation_p.G118V	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	122	LRR 2.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTTCGCCAGACCATTGAAAGC	0.433			NA											22	39					1.50039e-11	1.82274e-11	0.001882	1	0
CHRM4	1132	broad.mit.edu	37	11	46408003	46408003	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:46408003A>G	uc001nct.1	-	1	105	c.105T>C	c.(103-105)ATT>ATC	p.I35I		NM_000741	NP_000732	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	35	Helical; Name=1; (By similarity).				cell proliferation	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity				0				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)|Tropicamide(DB00809)	TCACTGTGGCAATGAAGACCA	0.552	Esophageal Squamous(171;1020 1936 4566 30205 42542)		NA											18	67					0	0	0.010504	0	0
LRP4	4038	broad.mit.edu	37	11	46921473	46921473	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:46921473C>A	uc001ndn.3	-	4	517	c.371G>T	c.(370-372)CGG>CTG	p.R124L	LRP4_uc009ylh.1_Missense_Mutation_p.R75L	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	124	Extracellular (Potential).|LDL-receptor class A 3.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		CCACAGACTCCGGATGCAGTA	0.632			NA											39	56					2.95478e-19	3.78552e-19	0.00874	1	0
AGBL2	79841	broad.mit.edu	37	11	47681749	47681749	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:47681749G>T	uc001ngg.2	-	18	2785	c.2685C>A	c.(2683-2685)TCC>TCA	p.S895S	AGBL2_uc001ngf.2_RNA	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic	895					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2						ATATGTGCAAGGATGGGTATG	0.522			NA											7	63					0.00307968	0.0032006	0.00308	1	0
OR4A5	81318	broad.mit.edu	37	11	51412112	51412112	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:51412112C>A	uc001nhi.1	-	1	284	c.284G>T	c.(283-285)TGC>TTC	p.C95F		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				CTGGCCCATGCAACCTTGGAA	0.453			NA											23	62					6.44725e-10	7.68236e-10	0.002299	1	0
OR4C46	119749	broad.mit.edu	37	11	51515322	51515322	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:51515322G>T	uc010ric.1	+	1	41	c.41G>T	c.(40-42)GGG>GTG	p.G14V		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GTTTTGCTGGGGCTTACAGAG	0.333			NA											35	70					1.66425e-11	2.01983e-11	0.004878	1	0
OR8H3	390152	broad.mit.edu	37	11	55890409	55890409	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:55890409G>T	uc001nii.1	+	1	561	c.561G>T	c.(559-561)CTG>CTT	p.L187L		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	187	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					TTTTAGCTCTGTCCTGCACTG	0.423			NA											43	226					7.05121e-23	9.14672e-23	0.002522	1	0
OR8H3	390152	broad.mit.edu	37	11	55890411	55890411	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:55890411C>T	uc001nii.1	+	1	563	c.563C>T	c.(562-564)TCC>TTC	p.S188F		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					TTAGCTCTGTCCTGCACTGAC	0.418			NA											42	221					0	0	0.009718	0	0
OR8J3	81168	broad.mit.edu	37	11	55904663	55904663	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:55904663A>G	uc010riz.1	-	1	532	c.532T>C	c.(532-534)TAC>CAC	p.Y178H		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	178	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					ATATCACAGTAAAAATGATTG	0.348			NA											18	71					0	0	0.006122	0	0
OR8K5	219453	broad.mit.edu	37	11	55927589	55927589	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:55927589C>T	uc010rja.1	-	1	205	c.205G>A	c.(205-207)GTT>ATT	p.V69I		NM_001004058	NP_001004058	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CCAAGATCAACAAAAGCCAAA	0.408			NA											31	102					0	0	0.002096	0	0
OR10Q1	219960	broad.mit.edu	37	11	57995971	57995971	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:57995971C>T	uc010rkd.1	-	1	377	c.377G>A	c.(376-378)CGC>CAC	p.R126H		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				AGCCACATAGCGGTCATAGGC	0.607			NA											8	30					0	0	0.00308	0	0
OR5B12	390191	broad.mit.edu	37	11	58207488	58207488	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:58207488A>C	uc010rkh.1	-	1	137	c.137T>G	c.(136-138)TTG>TGG	p.L46W		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	46	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CAGTAGAATCAATTCAATCAT	0.493			NA											15	51					0	0	0.004007	0	0
CNTF	1270	broad.mit.edu	37	11	58391564	58391564	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:58391564G>T	uc001nna.3	+	2	252	c.172G>T	c.(172-174)GTG>TTG	p.V58L	ZFP91-CNTF_uc010rkm.1_RNA	NM_000614	NP_000605	P26441	CNTF_HUMAN	ciliary neurotrophic factor	58					ciliary neurotrophic factor-mediated signaling pathway|growth|negative regulation of neuron apoptosis|positive regulation of tyrosine phosphorylation of Stat3 protein		ciliary neurotrophic factor receptor binding|growth factor activity|interleukin-6 receptor binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TGGGATGCCAGTGGCAAGCAC	0.527			NA											8	59					0.000274275	0.000291872	0.004482	1	0
OR4D9	390199	broad.mit.edu	37	11	59282678	59282678	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:59282678T>C	uc010rkv.1	+	1	293	c.293T>C	c.(292-294)GTC>GCC	p.V98A		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGTGGCTGTGTCACTCAAATG	0.473			NA											9	75					0	0	0.006214	0	0
DDB1	1642	broad.mit.edu	37	11	61097030	61097030	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:61097030G>A	uc001nrc.3	-	4	580	c.354C>T	c.(352-354)ACC>ACT	p.T118T	DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Silent_p.T118T|DDB1_uc010rlg.1_5'Flank|DDB1_uc001nrd.2_Silent_p.T118T|DDB1_uc009ynl.1_Intron	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	118	Interaction with CDT1.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						CAATAATGCCGGTCTCTGAGG	0.507			NA						NER					4	19					0	0	0.000602	0	0
DAGLA	747	broad.mit.edu	37	11	61511354	61511354	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:61511354T>C	uc001nsa.2	+	20	2633	c.2522T>C	c.(2521-2523)CTG>CCG	p.L841P		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	841	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		ACTGAGCTGCTGGCGGCCGAC	0.672			NA											21	283					0	0	0.00333	0	0
EEF1G	1937	broad.mit.edu	37	11	62340201	62340201	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:62340201T>A	uc001ntm.1	-	2	172	c.26A>T	c.(25-27)TAT>TTT	p.Y9F	EEF1G_uc010rlw.1_Missense_Mutation_p.Y59F|EEF1G_uc001ntn.1_5'UTR	NM_001404	NP_001395	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1	9	GST N-terminal.				response to virus	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						GTTTTCAGGATACGTGTACAG	0.522			NA											9	42					0	0	0.006214	0	0
TMEM179B	374395	broad.mit.edu	37	11	62557415	62557415	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:62557415C>T	uc001nvd.3	+	5	586	c.556C>T	c.(556-558)CAG>TAG	p.Q186*		NM_199337	NP_955369	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	186	Helical; (Potential).					integral to membrane					0						CCAGGTCGTGCAGTGGAAGTC	0.562			NA											9	161					0	0	0.006214	0	0
SLC22A9	114571	broad.mit.edu	37	11	63141428	63141428	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:63141428G>A	uc001nww.2	+	4	992	c.724G>A	c.(724-726)GGT>AGT	p.G242S	SLC22A9_uc001nwx.2_RNA	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	242	Helical; (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						GTGCCCTTCTGGTATTGCATT	0.478			NA											18	44					0	0	0.00499	0	0
PLCB3	5331	broad.mit.edu	37	11	64026363	64026363	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:64026363G>A	uc001nzb.2	+	12	1260	c.1260G>A	c.(1258-1260)AAG>AAA	p.K420K	PLCB3_uc009ypg.1_Silent_p.K420K|PLCB3_uc009yph.1_Silent_p.K353K|PLCB3_uc009ypi.2_Silent_p.K420K	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	420	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						GCAGGGCAAAGCAACAGGCAA	0.607			NA											13	48					0	0	0.00245	0	0
MRPL49	740	broad.mit.edu	37	11	64893273	64893273	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:64893273A>G	uc001oda.1	+	4	521	c.430A>G	c.(430-432)ACA>GCA	p.T144A	MRPL49_uc001ocz.1_RNA	NM_004927	NP_004918	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49	144					translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0						CAATGAGGTGACAGGTACCCT	0.557			NA											29	122					0	0	0.005443	0	0
TIGD3	220359	broad.mit.edu	37	11	65123341	65123341	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:65123341T>C	uc001odo.3	+	2	225	c.62T>C	c.(61-63)CTG>CCG	p.L21P		NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	21	HTH psq-type.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						ATCCAGGTGCTGGAACTCCTG	0.602			NA											14	76					0	0	0.00245	0	0
TIGD3	220359	broad.mit.edu	37	11	65124103	65124103	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:65124103G>A	uc001odo.3	+	2	987	c.824G>A	c.(823-825)GGC>GAC	p.G275D		NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	275	DDE.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						GAGCTGGCAGGCCTGCCTGGG	0.647			NA											10	70					0	0	0.006214	0	0
CTSW	1521	broad.mit.edu	37	11	65650585	65650585	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:65650585T>C	uc001ogc.1	+	8	833	c.791T>C	c.(790-792)ATC>ACC	p.I264T	CTSW_uc001ogb.1_Missense_Mutation_p.I264T	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	264					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)		ACCGTGACCATCAACATGAAG	0.612			NA											33	147					0	0	0.003271	0	0
PACS1	55690	broad.mit.edu	37	11	65988100	65988100	+	Splice_Site	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:65988100A>T	uc001oha.1	+	9	1173	c.1039_splice	c.e9-2	p.V347_splice		NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1						interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						TTTTCCCTGCAGGTGGGCTTT	0.502			NA											22	32					0	0	0.002299	0	0
ZDHHC24	254359	broad.mit.edu	37	11	66311439	66311439	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:66311439A>G	uc001oin.1	-	2	492	c.295T>C	c.(295-297)TGC>CGC	p.C99R	ACTN3_uc010rpi.1_5'Flank|ACTN3_uc001oio.1_5'Flank|ZDHHC24_uc001oim.1_RNA|ZDHHC24_uc009yrg.1_Missense_Mutation_p.C99R	NM_207340	NP_997223	Q6UX98	ZDH24_HUMAN	zinc finger, DHHC-type containing 24	99	DHHC-type.					integral to membrane	acyltransferase activity|zinc ion binding				0						TGGCTTTGGCATTGGTAGCAG	0.662			NA									OREG0021110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	75					0	0	0.001984	0	0
RBM4	5936	broad.mit.edu	37	11	66411054	66411054	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:66411054C>T	uc009yrj.2	+	3	1034	c.546C>T	c.(544-546)CGC>CGT	p.R182R	RBM4_uc009yrk.2_Silent_p.R157R|RBM4_uc001oiw.1_Silent_p.R182R|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_Silent_p.R182R|RBM4_uc001oiz.1_Silent_p.R182R	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	182					circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		GTTCAGGCCGCGTGGCAGACT	0.557			NA											13	47					0	0	0.001855	0	0
AIP	9049	broad.mit.edu	37	11	67258406	67258406	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:67258406G>A	uc001olv.2	+	6	1060	c.935G>A	c.(934-936)CGG>CAG	p.R312Q		NM_003977	NP_003968	O00170	AIP_HUMAN	aryl hydrocarbon receptor interacting protein	312					protein maturation by protein folding|protein targeting to mitochondrion	nucleus	signal transducer activity|transcription coactivator activity|transcription factor binding|unfolded protein binding				0						CTGGAGGCACGGATCCGGCAG	0.642			NA							Familial_Isolated_Pituitary_Adenoma_				13	21					0	0	0.004007	0	0
TCIRG1	10312	broad.mit.edu	37	11	67815252	67815252	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:67815252G>A	uc001one.2	+	12	1552	c.1444G>A	c.(1444-1446)GCC>ACC	p.A482T	TCIRG1_uc001ong.2_Missense_Mutation_p.A266T|TCIRG1_uc001onh.2_Missense_Mutation_p.A184T|TCIRG1_uc001oni.2_5'UTR|TCIRG1_uc009ysd.2_5'Flank	NM_006019	NP_006010	Q13488	VPP3_HUMAN	T-cell, immune regulator 1 isoform a	482	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity			ovary(1)	1						GGCCGCCATGGCCAACCAGTC	0.682			NA											26	147					0	0	0.008361	0	0
NUMA1	4926	broad.mit.edu	37	11	71719744	71719744	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:71719744T>C	uc001orl.1	-	20	5378	c.5206A>G	c.(5206-5208)AGT>GGT	p.S1736G	NUMA1_uc001orj.2_5'UTR|NUMA1_uc009ysw.1_Missense_Mutation_p.S1285G|NUMA1_uc001ork.1_Missense_Mutation_p.S600G|NUMA1_uc001orm.1_Missense_Mutation_p.S1722G|NUMA1_uc001orn.2_Missense_Mutation_p.S1299G	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1736					G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CTGGTGATACTGAGTGGGGTC	0.522			NA	T	RARA	APL								24	40					0	0	0.004656	0	0
STARD10	10809	broad.mit.edu	37	11	72466013	72466013	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:72466013C>T	uc001osy.2	-	7	1096	c.805G>A	c.(805-807)GCC>ACC	p.A269T	ARAP1_uc001osv.2_Intron|STARD10_uc001osz.3_Missense_Mutation_p.A269T|STARD10_uc001ota.2_Missense_Mutation_p.A223T|STARD10_uc001otb.2_Missense_Mutation_p.A269T|ARAP1_uc001osu.2_5'Flank	NM_006645	NP_006636	Q9Y365	PCTL_HUMAN	START domain containing 10	269											0			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			CTGCTCTCGGCCACCGCGCTC	0.706			NA											3	21					0	0	0.009096	0	0
C2CD3	26005	broad.mit.edu	37	11	73765676	73765676	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:73765676C>A	uc001ouu.2	-	26	5358	c.5131G>T	c.(5131-5133)GTC>TTC	p.V1711F	C2CD3_uc001out.2_RNA	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1711	C2 2.					centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					ACTTTGAAGACCAGGGTTTGT	0.348			NA											12	98					2.27111e-07	2.58487e-07	0.001368	1	0
MOGAT2	80168	broad.mit.edu	37	11	75439835	75439835	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:75439835G>T	uc010rru.1	+	5	651	c.651G>T	c.(649-651)GGG>GGT	p.G217G	MOGAT2_uc001oww.1_3'UTR|MOGAT2_uc010rrv.1_Silent_p.G135G	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	217					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					TTGTCTCCAGGGCACCCCTGG	0.532			NA											21	67					0.00121646	0.00127919	0.008871	1	0
OMP	4975	broad.mit.edu	37	11	76814356	76814356	+	Silent	SNP	C	C	T	rs2233550	by1000genomes	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:76814356C>T	uc010rsk.1	+	1	471	c.471C>T	c.(469-471)TCC>TCT	p.S157S	CAPN5_uc001oxx.2_Intron|CAPN5_uc009yup.2_Intron|CAPN5_uc009yuq.2_Intron|CAPN5_uc001oxy.2_Intron	NM_006189	NP_006180	P47874	OMP_HUMAN	olfactory marker protein	157					sensory perception of smell|synaptic transmission						0						TCAAGGCCTCCGTGGTTTTTA	0.602			NA											20	89					0	0	0.001882	0	0
GAB2	9846	broad.mit.edu	37	11	77961261	77961261	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:77961261C>T	uc001ozh.2	-	3	562	c.562G>A	c.(562-564)GCA>ACA	p.A188T	GAB2_uc001ozg.2_Missense_Mutation_p.A150T	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a	188					osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			TCCTGAGGTGCGCTGGTGGAC	0.557			NA											25	198					0	0	0.00333	0	0
DLG2	1740	broad.mit.edu	37	11	83195190	83195190	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:83195190C>G	uc001paj.2	-	17	2263	c.1960G>C	c.(1960-1962)GAA>CAA	p.E654Q	DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Missense_Mutation_p.E759Q|DLG2_uc010rtb.1_Missense_Mutation_p.E621Q|DLG2_uc010rsw.1_Intron|DLG2_uc010rsx.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	654						cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TCACTGGTTTCCTGCTCACTC	0.408			NA											17	87					0	0	0.007413	0	0
FAT3	120114	broad.mit.edu	37	11	92085701	92085701	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:92085701G>T	uc001pdj.3	+	1	440	c.423G>T	c.(421-423)TGG>TGT	p.W141C		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	141	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGGAAGCATGGACCAAAGTGA	0.373			NA								TCGA Ovarian(4;0.039)			8	26					5.18039e-06	5.7182e-06	0.00308	1	0
SLC36A4	120103	broad.mit.edu	37	11	92881785	92881785	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:92881785G>A	uc001pdn.2	-	11	1530	c.1433C>T	c.(1432-1434)CCT>CTT	p.P478L	uc001pdl.1_5'Flank|SLC36A4_uc001pdm.2_Missense_Mutation_p.P343L	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid	478					L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTTGGGAGTAGGATAAATAAT	0.328			NA											23	106					0	0	0.001882	0	0
TAF1D	79101	broad.mit.edu	37	11	93471430	93471430	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:93471430T>A	uc001ped.2	-	3	506	c.304A>T	c.(304-306)ACA>TCA	p.T102S	SNORA8_uc001pec.2_5'Flank|TAF1D_uc001pdz.2_RNA|TAF1D_uc001pea.1_RNA	NM_024116	NP_077021	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated	102					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0						GGTCTTCCTGTTGGCTGGTAC	0.358			NA											27	160					0	0	0.002096	0	0
CNTN5	53942	broad.mit.edu	37	11	99690377	99690377	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:99690377G>T	uc001pga.2	+	4	497	c.158G>T	c.(157-159)CGA>CTA	p.R53L	CNTN5_uc009ywv.1_Missense_Mutation_p.R53L|CNTN5_uc001pfz.2_Missense_Mutation_p.R53L|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	53					cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ACCAGACCACGATACAGCAGC	0.423			NA											5	70					5.9392e-07	6.67422e-07	0.001168	1	0
CNTN5	53942	broad.mit.edu	37	11	100221521	100221521	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:100221521T>A	uc001pga.2	+	24	3458	c.3119T>A	c.(3118-3120)GTC>GAC	p.V1040D	CNTN5_uc001pgb.2_Missense_Mutation_p.V966D|CNTN5_uc010ruk.1_Missense_Mutation_p.V311D	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	1040	Fibronectin type-III 4.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GATGCTGGAGTCTATATTATT	0.398			NA											9	95					0	0	0.004482	0	0
TMEM133	83935	broad.mit.edu	37	11	100863357	100863357	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:100863357C>A	uc001pgf.2	+	1	547	c.318C>A	c.(316-318)ACC>ACA	p.T106T		NM_032021	NP_114410	Q9H2Q1	TM133_HUMAN	transmembrane protein 133	106	Helical; (Potential).					integral to membrane					0		Acute lymphoblastic leukemia(157;0.000869)|all_hematologic(158;0.014)		BRCA - Breast invasive adenocarcinoma(274;0.0675)		TCATTGTCACCGTTATCCCCC	0.413			NA											19	242					1.45105e-14	1.81054e-14	0.006122	1	0
MMP13	4322	broad.mit.edu	37	11	102822743	102822743	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:102822743T>C	uc001phl.2	-	5	825	c.797A>G	c.(796-798)TAT>TGT	p.Y266C		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	266					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		CGAGTTACCATAGAGAGACTG	0.353			NA											32	840					0	0	0.004289	0	0
CASP4	837	broad.mit.edu	37	11	104815577	104815577	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:104815577A>G	uc001pid.1	-	8	1110	c.1037T>C	c.(1036-1038)GTA>GCA	p.V346A	CASP4_uc001pib.1_Missense_Mutation_p.V290A|CASP4_uc009yxg.1_Missense_Mutation_p.V255A	NM_001225	NP_001216	P49662	CASP4_HUMAN	caspase 4 isoform alpha precursor	346					apoptosis|induction of apoptosis|proteolysis	intracellular	cysteine-type endopeptidase activity|protein binding			lung(2)|ovary(1)|skin(1)	4		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TGATTGCTGTACCTGAAAAAG	0.413			NA											10	32					0	0	0.006214	0	0
CASP1	834	broad.mit.edu	37	11	104899951	104899951	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:104899951A>G	uc010rve.1	-	7	923	c.906T>C	c.(904-906)TCT>TCC	p.S302S	CASP1_uc001pig.2_Silent_p.S209S|CASP1_uc001pik.2_Silent_p.S265S|CASP1_uc010rvf.1_Silent_p.S209S|CASP1_uc010rvg.1_Silent_p.S281S|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CASP1_uc001pim.3_Silent_p.S302S|CASP1_uc009yxi.2_Silent_p.S281S|CASP1_uc010rvj.1_Silent_p.S302S|CASP1_uc009yxj.2_Silent_p.S147S|CASP1_uc010rvk.1_Silent_p.S263S	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor	302					cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	ATAGGTTTCCAGAAACTCCTA	0.413	NSCLC(41;1246 1743 4934)		NA											6	44					0	0	0.001168	0	0
EXPH5	23086	broad.mit.edu	37	11	108381280	108381280	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:108381280C>A	uc001pkk.2	-	6	5065	c.4954G>T	c.(4954-4956)GAG>TAG	p.E1652*	EXPH5_uc010rvy.1_Nonsense_Mutation_p.E1464*|EXPH5_uc010rvz.1_Nonsense_Mutation_p.E1496*|EXPH5_uc010rwa.1_Nonsense_Mutation_p.E1576*	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1652					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CCAATGGACTCTGCAGATTTT	0.483			NA											39	115					5.04308e-16	6.35622e-16	0.00623	1	0
NCAM1	4684	broad.mit.edu	37	11	113078037	113078037	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:113078037G>T	uc009yyq.1	+	6	1023	c.329G>T	c.(328-330)GGC>GTC	p.G110V	NCAM1_uc001pno.2_Missense_Mutation_p.G110V	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3	228	Ig-like C2-type 3.|Extracellular (Potential).				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCCAACCTCGGCCAGTCCGTC	0.522			NA											11	97					0.000151284	0.000161543	0.001855	1	0
FAM55A	120400	broad.mit.edu	37	11	114401078	114401078	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:114401078T>C	uc001ppa.2	-	3	643	c.226A>G	c.(226-228)ACT>GCT	p.T76A	FAM55A_uc010rxd.1_5'UTR|FAM55A_uc001ppb.1_Missense_Mutation_p.T218A	NM_152315	NP_689528	Q8N323	FA55A_HUMAN	hypothetical protein LOC120400	218						extracellular region					0		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)		CCACATTCAGTGAAGACATGA	0.458			NA											24	63					0	0	0.003954	0	0
APOA4	337	broad.mit.edu	37	11	116692115	116692115	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:116692115C>A	uc001pps.1	-	3	763	c.659G>T	c.(658-660)CGC>CTC	p.R220L		NM_000482	NP_000473			apolipoprotein A-IV precursor												0	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CAGGCTGCGGCGCAGCTCCTC	0.582			NA											30	153					1.16021e-09	1.37588e-09	0.007291	1	0
SIK3	23387	broad.mit.edu	37	11	116734527	116734527	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:116734527A>G	uc001ppy.2	-	15	1678	c.1642T>C	c.(1642-1644)TAC>CAC	p.Y548H	SIK3_uc001ppz.2_Missense_Mutation_p.Y447H|SIK3_uc001pqa.2_Missense_Mutation_p.Y548H|SIK3_uc001ppw.2_5'UTR|SIK3_uc001ppx.2_Silent_p.P22P|SIK3_uc001pqb.2_5'Flank	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	548						cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						GAGTCCTTGTAGGTAGAGCTG	0.537			NA											26	103					0	0	0.004656	0	0
SCN2B	6327	broad.mit.edu	37	11	118037610	118037610	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:118037610C>T	uc001psf.2	-	4	831	c.640G>A	c.(640-642)GCC>ACC	p.A214T		NM_004588	NP_004579	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta	214	Cytoplasmic (Potential).				synaptic transmission	voltage-gated sodium channel complex	voltage-gated sodium channel activity				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)		CACTACTTGGCGCCATCATCC	0.617			NA											15	77					0	0	0.006122	0	0
HYOU1	10525	broad.mit.edu	37	11	118918710	118918710	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:118918710T>G	uc001puu.2	-	21	2652	c.2459A>C	c.(2458-2460)GAA>GCA	p.E820A	HYOU1_uc001put.2_Missense_Mutation_p.E785A|HYOU1_uc010ryu.1_Missense_Mutation_p.E778A|HYOU1_uc010ryv.1_Missense_Mutation_p.E709A|HYOU1_uc001pux.3_Missense_Mutation_p.E820A	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor	820						endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		AGACAGCCGTTCGGGCCACTT	0.542			NA											14	40					0	0	0.003163	0	0
NLRX1	79671	broad.mit.edu	37	11	119045255	119045255	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:119045255A>G	uc001pvu.2	+	6	1158	c.943A>G	c.(943-945)ACC>GCC	p.T315A	NLRX1_uc010rzc.1_Missense_Mutation_p.T137A|NLRX1_uc001pvv.2_Missense_Mutation_p.T315A|NLRX1_uc001pvw.2_Missense_Mutation_p.T315A|NLRX1_uc001pvx.2_Missense_Mutation_p.T315A	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	315	Required for interaction with MAVS.|NACHT.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TTTCTCTGATACCAACCTGCA	0.597			NA											13	179					0	0	0.001368	0	0
USP2	9099	broad.mit.edu	37	11	119243829	119243829	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:119243829C>T	uc001pwm.3	-	2	657	c.362G>A	c.(361-363)TGC>TAC	p.C121Y	USP2_uc001pwn.3_Intron	NM_004205	NP_004196	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2 isoform a	121	Necessary for interaction with MDM4.				cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity			ovary(2)|urinary_tract(1)|skin(1)	4		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		GTAGCTGAGGCAGTTGTTGGT	0.622			NA											14	159					0	0	0.003163	0	0
POU2F3	25833	broad.mit.edu	37	11	120176403	120176403	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:120176403G>T	uc001pxc.2	+	8	780	c.678G>T	c.(676-678)CAG>CAT	p.Q226H	POU2F3_uc010rzk.1_Missense_Mutation_p.Q180H|POU2F3_uc010rzl.1_Missense_Mutation_p.Q156H|POU2F3_uc001pxe.1_Missense_Mutation_p.Q11H	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor	226	POU-specific.				negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		ACTTCAGCCAGACCACCATCT	0.577			NA											24	98					9.57634e-11	1.15212e-10	0.00333	1	0
TECTA	7007	broad.mit.edu	37	11	120983858	120983858	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:120983858G>T	uc010rzo.1	+	4	564	c.564G>T	c.(562-564)TGG>TGT	p.W188C		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	188	NIDO.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AAATCAACTGGACCACGGGGA	0.577			NA									OREG0021430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	62					2.23348e-06	2.47634e-06	0.004007	1	0
C11orf63	79864	broad.mit.edu	37	11	122775152	122775152	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:122775152G>T	uc001pym.2	+	3	1161	c.864G>T	c.(862-864)CAG>CAT	p.Q288H	C11orf63_uc001pyl.1_Missense_Mutation_p.Q288H	NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	288										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		ATCCAGAACAGGTACGTAGTG	0.388			NA											40	151					2.26627e-22	2.93366e-22	0.007835	1	0
OR10G7	390265	broad.mit.edu	37	11	123908953	123908953	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:123908953G>A	uc001pzq.1	-	1	756	c.756C>T	c.(754-756)GGC>GGT	p.G252G		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	252	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AAAGACCAGGGCCAAAGAAGC	0.567			NA											11	59					0	0	0.000978	0	0
PKNOX2	63876	broad.mit.edu	37	11	125280187	125280187	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:125280187C>T	uc001qbu.2	+	8	998	c.684C>T	c.(682-684)ATC>ATT	p.I228I	PKNOX2_uc010saz.1_Silent_p.I199I|PKNOX2_uc010sba.1_Silent_p.I199I|PKNOX2_uc010sbb.1_Silent_p.I164I|PKNOX2_uc001qbv.2_5'Flank	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	228						nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		AGGGCAACATCGCCATGACAA	0.587			NA											27	63					0	0	0.004656	0	0
CHEK1	1111	broad.mit.edu	37	11	125525121	125525121	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:125525121G>A	uc009zbo.2	+	13	2229	c.1337G>A	c.(1336-1338)GGT>GAT	p.G446D	CHEK1_uc010sbh.1_Missense_Mutation_p.G462D|CHEK1_uc010sbi.1_Missense_Mutation_p.G412D|CHEK1_uc001qcf.3_Missense_Mutation_p.G446D|CHEK1_uc009zbp.2_Missense_Mutation_p.G446D|CHEK1_uc001qcg.3_Missense_Mutation_p.G446D|CHEK1_uc009zbq.2_Missense_Mutation_p.G402D|CHEK1_uc001qci.1_RNA|CHEK1_uc001qcj.2_Missense_Mutation_p.G94D	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	446	Autoinhibitory region.				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		CTAATATAGGGTGATGGATTG	0.338			NA						Other_conserved_DNA_damage_response_genes					9	20					0	0	0.004482	0	0
HYLS1	219844	broad.mit.edu	37	11	125769723	125769723	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:125769723T>A	uc009zbv.2	+	4	994	c.460T>A	c.(460-462)TTT>ATT	p.F154I	HYLS1_uc001qcx.3_Missense_Mutation_p.F154I|PUS3_uc001qcy.2_Intron	NM_145014	NP_659451	Q96M11	HYLS1_HUMAN	hydrolethalus syndrome 1	154						centrosome|nucleus				upper_aerodigestive_tract(1)	1	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		TTCACAAAAATTTAACCTACC	0.398	Esophageal Squamous(172;2590 2636 8884 10471)		NA											5	98					0	0	0.001168	0	0
FAM118B	79607	broad.mit.edu	37	11	126126732	126126732	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:126126732A>G	uc001qdf.2	+	7	1150	c.967A>G	c.(967-969)ACA>GCA	p.T323A	FAM118B_uc009zca.2_Missense_Mutation_p.T327A|FAM118B_uc001qdg.2_Missense_Mutation_p.T323A	NM_024556	NP_078832	Q9BPY3	F118B_HUMAN	hypothetical protein LOC79607	323											0	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		TGAGATCTCCACAAGGGGTAC	0.433			NA											44	145					0	0	0.002852	0	0
NFRKB	4798	broad.mit.edu	37	11	129742993	129742993	+	Splice_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:129742993T>C	uc001qfi.2	-	23	2752	c.2551_splice	c.e23-1	p.T851_splice	NFRKB_uc001qfg.2_Splice_Site_p.T876_splice|NFRKB_uc001qfh.2_Splice_Site_p.T874_splice|NFRKB_uc010sbw.1_Splice_Site_p.T861_splice|NFRKB_uc009zcr.2_Splice_Site_p.T137_splice	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein						DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding			ovary(3)	3	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		CATTACTGTCTAGTTGAGGGC	0.567			NA											4	8					0	0	0.000602	0	0
IGSF9B	22997	broad.mit.edu	37	11	133799598	133799598	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:133799598A>G	uc001qgx.3	-	12	1830	c.1599T>C	c.(1597-1599)TAT>TAC	p.Y533Y	IGSF9B_uc001qgy.1_Silent_p.Y375Y	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	533	Extracellular (Potential).|Fibronectin type-III 1.					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		AGCCTCCATCATAGCCTGGTT	0.602			NA											11	55					0	0	0.001855	0	0
ACAD8	27034	broad.mit.edu	37	11	134134824	134134824	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:134134824A>T	uc001qhk.2	+	11	1279	c.1218A>T	c.(1216-1218)ATA>ATT	p.I406I	ACAD8_uc001qhl.2_Silent_p.I279I	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	406					branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)		TGATGAGGATACTGATCTCTA	0.512	GBM(65;238 1125 33403 41853 48889)		NA											9	158					0	0	0.001368	0	0
FGF23	8074	broad.mit.edu	37	12	4479656	4479656	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:4479656C>A	uc001qmq.1	-	3	755	c.609G>T	c.(607-609)CCG>CCT	p.P203P		NM_020638	NP_065689	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23 precursor	203					cell differentiation|insulin receptor signaling pathway|negative regulation of bone mineralization|negative regulation of hormone secretion|negative regulation of osteoblast differentiation|positive regulation of vitamin D 24-hydroxylase activity|regulation of phosphate transport|vitamin D catabolic process	extracellular space	growth factor activity			ovary(2)|breast(1)|skin(1)	4			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			AACAGGAGGCCGGGGCCGGGG	0.706			NA											8	54					0.00307968	0.0032006	0.00308	1	0
KCNA5	3741	broad.mit.edu	37	12	5154172	5154172	+	Missense_Mutation	SNP	G	G	A	rs149582940	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:5154172G>A	uc001qni.2	+	1	1088	c.859G>A	c.(859-861)GCG>ACG	p.A287T		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	287						Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4						CCACCCTCCGGCGCCCCACCA	0.682			NA											18	91					0	0	0.007413	0	0
ANO2	57101	broad.mit.edu	37	12	5853387	5853387	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:5853387C>A	uc001qnm.2	-	12	1347	c.1275G>T	c.(1273-1275)GCG>GCT	p.A425A		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	430	Extracellular (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						GGCTGGCCTGCGCGGTCCCAC	0.557			NA											12	85					2.80697e-09	3.29422e-09	0.000978	1	0
VWF	7450	broad.mit.edu	37	12	6145658	6145658	+	Splice_Site	SNP	C	C	A	rs61748480		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:6145658C>A	uc001qnn.1	-	19	2693	c.2443_splice	c.e19-1	p.V815_splice	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CATGCCGGACCTAAGAGAAAA	0.537			NA											7	62					2.7689e-08	3.20121e-08	0.001984	1	0
CD163L1	283316	broad.mit.edu	37	12	7585029	7585029	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:7585029A>G	uc001qsy.2	-	4	775	c.749T>C	c.(748-750)GTC>GCC	p.V250A	CD163L1_uc010sge.1_Missense_Mutation_p.V260A	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	250	SRCR 2.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						AGTTAATGTGACATCCTCATT	0.393			NA											11	57					0	0	0.008291	0	0
CD163	9332	broad.mit.edu	37	12	7640238	7640238	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:7640238C>A	uc001qsz.3	-	8	1895	c.1767G>T	c.(1765-1767)AAG>AAT	p.K589N	CD163_uc001qta.3_Missense_Mutation_p.K589N|CD163_uc009zfw.2_Missense_Mutation_p.K622N	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	589	SRCR 6.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						CACACGGGGTCTTGCCATTCA	0.512			NA											11	122					6.40141e-05	6.87682e-05	0.000978	1	0
FAM90A1	55138	broad.mit.edu	37	12	8377398	8377398	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:8377398C>A	uc001qui.2	-	4	590	c.31G>T	c.(31-33)GCA>TCA	p.A11S	FAM90A1_uc001quh.2_Missense_Mutation_p.A11S	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138	11							nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)		AGTCTCTTTGCCCCAGGTTTG	0.587			NA											5	38					3.59834e-05	3.88908e-05	0.001168	1	0
CSDA	8531	broad.mit.edu	37	12	10856658	10856658	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:10856658C>T	uc001qyt.2	-	7	1113	c.870G>A	c.(868-870)AGG>AGA	p.R290R	CSDA_uc001qyu.2_Silent_p.R221R	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a	290					negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					ACCTACGGTACCTTGGGCGGT	0.488			NA											16	70					0	0	0.003163	0	0
LRP6	4040	broad.mit.edu	37	12	12315178	12315178	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:12315178A>G	uc001rah.3	-	10	2370	c.2228T>C	c.(2227-2229)GTG>GCG	p.V743A	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.V743A	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	743	Extracellular (Potential).|Beta-propeller 3.|LDL-receptor class B 12.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				GTCTTTCCACACCAAAACTTG	0.498			NA											9	136					0	0	0.008291	0	0
KIAA1467	57613	broad.mit.edu	37	12	13208754	13208754	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:13208754C>T	uc001rbi.2	+	2	330	c.307C>T	c.(307-309)CGC>TGC	p.R103C	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	103						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		GTCATATGTGCGCACGTCTGT	0.582			NA											26	85					0	0	0.005443	0	0
ATF7IP	55729	broad.mit.edu	37	12	14599920	14599920	+	Splice_Site	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:14599920A>G	uc001rbw.2	+	6	2088	c.1930_splice	c.e6-2	p.A644_splice	ATF7IP_uc010shs.1_Splice_Site_p.A643_splice|ATF7IP_uc001rbu.2_Splice_Site_p.A644_splice|ATF7IP_uc001rbv.1_Splice_Site_p.A643_splice|ATF7IP_uc001rbx.2_Splice_Site_p.A643_splice|ATF7IP_uc010sht.1_Splice_Site_p.A644_splice|ATF7IP_uc001rby.3_Splice_Site_p.A644_splice|ATF7IP_uc001rca.2_Splice_Site_p.A644_splice	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting						DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						TTTTTTTTTCAGGCCAAGATA	0.269			NA											4	21					0	0	0.009096	0	0
GYS2	2998	broad.mit.edu	37	12	21715920	21715920	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:21715920A>T	uc001rfb.2	-	7	1249	c.994T>A	c.(994-996)TAT>AAT	p.Y332N		NM_021957	NP_068776	P54840	GYS2_HUMAN	glycogen synthase 2	332					glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2						GAAAACTCATACCTCCCAGCA	0.378	Colon(149;9 1820 3690 10544 50424)		NA											52	119					0	0	0.00361	0	0
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:25398284C>A	uc001rgp.1	-	2	216	c.35G>T	c.(34-36)GGT>GTT	p.G12V	KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			14	11					7.93312e-07	8.86685e-07	0.00245	1	0
TMTC1	83857	broad.mit.edu	37	12	29689180	29689180	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:29689180C>A	uc001rjb.2	-	11	1897	c.1423G>T	c.(1423-1425)GAT>TAT	p.D475Y	TMTC1_uc001riz.2_Missense_Mutation_p.D232Y|TMTC1_uc001rja.2_Missense_Mutation_p.D319Y|TMTC1_uc001rjc.1_Missense_Mutation_p.D537Y	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	583	TPR 4.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GAATATGCATCTGCAAACTCT	0.368			NA											20	138					7.45023e-12	9.07745e-12	0.010504	1	0
TMTC1	83857	broad.mit.edu	37	12	29709802	29709802	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:29709802C>T	uc001rjb.2	-	10	1814	c.1340G>A	c.(1339-1341)GGG>GAG	p.G447E	TMTC1_uc001riz.2_Missense_Mutation_p.G204E|TMTC1_uc001rja.2_Missense_Mutation_p.G291E|TMTC1_uc001rjc.1_Missense_Mutation_p.G509E	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	555	TPR 3.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GAGGAGATTCCCCAGATTGAA	0.483			NA											13	51					0	0	0.001855	0	0
TMTC1	83857	broad.mit.edu	37	12	29709899	29709899	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:29709899G>A	uc001rjb.2	-	10	1717	c.1243C>T	c.(1243-1245)CTT>TTT	p.L415F	TMTC1_uc001riz.2_Missense_Mutation_p.L172F|TMTC1_uc001rja.2_Missense_Mutation_p.L259F|TMTC1_uc001rjc.1_Missense_Mutation_p.L477F	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	523	TPR 2.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AGTGTTCCAAGGTTGTTGAGC	0.458			NA											5	94					0	0	0.000602	0	0
KIF21A	55605	broad.mit.edu	37	12	39695300	39695300	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:39695300T>A	uc001rly.2	-	37	5059	c.4913A>T	c.(4912-4914)CAC>CTC	p.H1638L	KIF21A_uc001rlv.2_Missense_Mutation_p.H583L|KIF21A_uc001rlw.2_Missense_Mutation_p.H908L|KIF21A_uc001rlx.2_Missense_Mutation_p.H1625L|KIF21A_uc001rlz.2_Missense_Mutation_p.H1585L|KIF21A_uc010skl.1_Missense_Mutation_p.H1601L|KIF21A_uc001rlt.2_Missense_Mutation_p.H258L|KIF21A_uc001rlu.2_Missense_Mutation_p.H258L	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1638	WD 7.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				AGTAAAAATGTGGGTGGAATT	0.353			NA											31	104					0	0	0.002445	0	0
NELL2	4753	broad.mit.edu	37	12	45001014	45001014	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:45001014G>A	uc001rog.2	-	15	2196	c.1601C>T	c.(1600-1602)GCC>GTC	p.A534V	NELL2_uc001rof.3_Missense_Mutation_p.A533V|NELL2_uc001roh.2_Missense_Mutation_p.A534V|NELL2_uc009zkd.2_Missense_Mutation_p.A533V|NELL2_uc010skz.1_Missense_Mutation_p.A584V|NELL2_uc010sla.1_Missense_Mutation_p.A557V|NELL2_uc001roi.1_Missense_Mutation_p.A534V|NELL2_uc010slb.1_Missense_Mutation_p.A533V	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	534	EGF-like 4.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GGCAATACAGGCTCCTCCATT	0.383			NA											9	43					0	0	0.008291	0	0
AMIGO2	347902	broad.mit.edu	37	12	47471225	47471225	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:47471225A>G	uc001rpm.2	-	3	2216	c.1561T>C	c.(1561-1563)TCC>CCC	p.S521P	FAM113B_uc001rpn.2_5'Flank|AMIGO2_uc001rpk.2_Missense_Mutation_p.S521P|AMIGO2_uc001rpl.2_Missense_Mutation_p.S521P	NM_001143668	NP_001137140	Q86SJ2	AMGO2_HUMAN	adhesion molecule with Ig-like domain 2	521	Cytoplasmic (Potential).				heterophilic cell-cell adhesion|homophilic cell adhesion	integral to membrane|nucleus|plasma membrane				ovary(1)|skin(1)	2	Renal(347;0.138)|Lung SC(27;0.192)					AATTAAGTGGACGCCACAAAA	0.403			NA											5	37					0	0	0.001168	0	0
AMIGO2	347902	broad.mit.edu	37	12	47471601	47471601	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:47471601T>C	uc001rpm.2	-	3	1840	c.1185A>G	c.(1183-1185)GCA>GCG	p.A395A	FAM113B_uc001rpn.2_5'Flank|AMIGO2_uc001rpk.2_Silent_p.A395A|AMIGO2_uc001rpl.2_Silent_p.A395A	NM_001143668	NP_001137140	Q86SJ2	AMGO2_HUMAN	adhesion molecule with Ig-like domain 2	395	Extracellular (Potential).				heterophilic cell-cell adhesion|homophilic cell adhesion	integral to membrane|nucleus|plasma membrane				ovary(1)|skin(1)	2	Renal(347;0.138)|Lung SC(27;0.192)					CTGTGTTAAATGCCTCATGAG	0.433			NA											15	53					0	0	0.00245	0	0
FAM113B	91523	broad.mit.edu	37	12	47629134	47629134	+	Silent	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:47629134C>G	uc001rpn.2	+	4	1019	c.288C>G	c.(286-288)CGC>CGG	p.R96R	FAM113B_uc010slj.1_Intron|FAM113B_uc001rpq.2_Silent_p.R96R	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	96							hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					TCCTCACCCGCGTGTACTCCG	0.592			NA											25	144					0	0	0.00333	0	0
FAM113B	91523	broad.mit.edu	37	12	47629138	47629138	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:47629138T>A	uc001rpn.2	+	4	1023	c.292T>A	c.(292-294)TAC>AAC	p.Y98N	FAM113B_uc010slj.1_Intron|FAM113B_uc001rpq.2_Missense_Mutation_p.Y98N	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	98							hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					CACCCGCGTGTACTCCGATTA	0.587			NA											25	150					0	0	0.003954	0	0
H1FNT	341567	broad.mit.edu	37	12	48723269	48723269	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:48723269C>T	uc001rrm.2	+	1	507	c.195C>T	c.(193-195)CTC>CTT	p.L65L		NM_181788	NP_861453	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	65					chromosome condensation|multicellular organismal development|sperm chromatin condensation|spermatid nucleus elongation	nuclear chromatin	ATP binding|DNA binding			pancreas(1)	1						AGTTGGTGCTCCAGGCCATCT	0.622			NA											6	25					0	0	0.001168	0	0
WNT10B	7480	broad.mit.edu	37	12	49364124	49364124	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:49364124T>G	uc001rss.2	-	3	431	c.85A>C	c.(85-87)AAT>CAT	p.N29H	WNT10B_uc001rst.2_Missense_Mutation_p.N29H	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,	29					axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			skin(4)|lung(3)	7						AGAATCTCATTGCTTAGAGCC	0.637			NA											12	46					0	0	0.000978	0	0
RACGAP1	29127	broad.mit.edu	37	12	50386086	50386086	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:50386086T>C	uc001rvt.2	-	16	1830	c.1520A>G	c.(1519-1521)CAT>CGT	p.H507R	RACGAP1_uc009zlm.1_Missense_Mutation_p.H507R|RACGAP1_uc001rvs.2_Missense_Mutation_p.H507R|RACGAP1_uc001rvu.2_Missense_Mutation_p.H507R	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	507	Rho-GAP.				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						GGGCACAGCATGGGCCACTAT	0.448			NA											41	118					0	0	0.002852	0	0
RACGAP1	29127	broad.mit.edu	37	12	50390984	50390984	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:50390984T>A	uc001rvt.2	-	12	1193	c.883A>T	c.(883-885)ATT>TTT	p.I295F	RACGAP1_uc009zlm.1_Missense_Mutation_p.I295F|RACGAP1_uc001rvs.2_Missense_Mutation_p.I295F|RACGAP1_uc001rvu.2_Missense_Mutation_p.I295F	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	295	Phorbol-ester/DAG-type.				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						TCAGGTTTAATAACCTGGGAT	0.333			NA											11	54					0	0	0.001368	0	0
TMPRSS12	283471	broad.mit.edu	37	12	51281099	51281099	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:51281099G>T	uc001rwx.3	+	5	897	c.850G>T	c.(850-852)GTA>TTA	p.V284L	TMPRSS12_uc001rwy.2_3'UTR	NM_182559	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane protease, serine 12 precursor	284	Peptidase S1.|Extracellular (Potential).				proteolysis	integral to membrane	serine-type endopeptidase activity				0						AAGATTTTTTGTAATGGGAAT	0.403			NA											6	63					0.00116845	0.00122973	0.001168	1	0
ITGA7	3679	broad.mit.edu	37	12	56078909	56078909	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:56078909G>T	uc001shh.2	-	25	3579	c.3359C>A	c.(3358-3360)CCC>CAC	p.P1120H	ITGA7_uc001shg.2_Missense_Mutation_p.P1116H|ITGA7_uc010sps.1_Missense_Mutation_p.P1023H|ITGA7_uc001shf.2_3'UTR|ITGA7_uc009znw.2_Missense_Mutation_p.P363H|ITGA7_uc009znx.2_Missense_Mutation_p.P997H	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	1160	1.|3 X 4 AA repeats of D-X-H-P.|Cytoplasmic (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						AGCCAGGATGGGGTGTGCATC	0.682			NA											8	29					2.74318e-10	3.27811e-10	0.006214	1	0
LRP1	4035	broad.mit.edu	37	12	57599438	57599438	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:57599438G>A	uc001snd.2	+	75	12034	c.11568G>A	c.(11566-11568)ACG>ACA	p.T3856T		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3856	Extracellular (Potential).|EGF-like 15.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCATGAAGACGCACAACACCT	0.622			NA											10	47					0	0	0.006214	0	0
XRCC6BP1	91419	broad.mit.edu	37	12	58350476	58350476	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:58350476G>T	uc001sqp.2	+	6	584	c.544G>T	c.(544-546)GTG>TTG	p.V182L		NM_033276	NP_150592	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	182					double-strand break repair via nonhomologous end joining	DNA-dependent protein kinase-DNA ligase 4 complex	DNA-dependent protein kinase activity|metal ion binding|metalloendopeptidase activity			ovary(1)	1						TTAGACTTGTGTGCGAGACAG	0.303			NA											10	49					3.86212e-05	4.16694e-05	0.008291	1	0
DPY19L2	283417	broad.mit.edu	37	12	63963125	63963125	+	Silent	SNP	G	G	T	rs2942672		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:63963125G>T	uc001srp.1	-	21	2186	c.2005C>A	c.(2005-2007)CGG>AGG	p.R669R	DPY19L2_uc010sso.1_Silent_p.R116R	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	669					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		ATTTTTGTCCGAGCCCtttaa	0.244			NA											17	61					1.15088e-07	1.31589e-07	0.004007	1	0
CNOT2	4848	broad.mit.edu	37	12	70724089	70724089	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:70724089A>G	uc001svv.2	+	6	988	c.409A>G	c.(409-411)AGG>GGG	p.R137G	CNOT2_uc009zro.2_Missense_Mutation_p.R137G|CNOT2_uc009zrp.2_Missense_Mutation_p.R117G|CNOT2_uc009zrq.2_Missense_Mutation_p.R137G	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	137					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TATGAATCCTAGGAATATGAT	0.403			NA											15	85					0	0	0.004007	0	0
PTPRB	5787	broad.mit.edu	37	12	70928297	70928297	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:70928297C>T	uc001swb.3	-	29	5715	c.5685G>A	c.(5683-5685)CCG>CCA	p.P1895P	uc001svz.2_Intron|PTPRB_uc010sto.1_Silent_p.P1805P|PTPRB_uc010stp.1_Silent_p.P1805P|PTPRB_uc001swc.3_Silent_p.P2113P|PTPRB_uc001swa.3_Silent_p.P2025P	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1895	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GCCCAGCACCCGGGCTTCTGT	0.527			NA											4	26					0	0	0.009096	0	0
PTPRB	5787	broad.mit.edu	37	12	70989879	70989879	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:70989879G>T	uc001swb.3	-	3	584	c.554C>A	c.(553-555)GCT>GAT	p.A185D	PTPRB_uc010sto.1_Missense_Mutation_p.A185D|PTPRB_uc010stp.1_Missense_Mutation_p.A185D|PTPRB_uc001swc.3_Missense_Mutation_p.A403D|PTPRB_uc001swa.3_Missense_Mutation_p.A403D|PTPRB_uc001swd.3_Missense_Mutation_p.A402D|PTPRB_uc009zrr.1_Missense_Mutation_p.A282D|PTPRB_uc001swe.2_Missense_Mutation_p.A403D	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	185	Fibronectin type-III 2.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TCCAGAAACAGCTGTGATGGC	0.343			NA											12	29					5.16669e-11	6.24015e-11	0.000978	1	0
TBC1D15	64786	broad.mit.edu	37	12	72290489	72290489	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:72290489G>A	uc001swu.2	+	10	1143	c.1134G>A	c.(1132-1134)TGG>TGA	p.W378*	TBC1D15_uc009zrv.2_Nonsense_Mutation_p.W240*|TBC1D15_uc010stt.1_Nonsense_Mutation_p.W347*|TBC1D15_uc001swv.2_Nonsense_Mutation_p.W361*|TBC1D15_uc001sww.2_Nonsense_Mutation_p.W110*	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	356	Rab-GAP TBC.						protein binding|Rab GTPase activator activity				0						AGCAAGCATGGAAATTTCTTC	0.343			NA											8	47					0	0	0.006214	0	0
KCNC2	3747	broad.mit.edu	37	12	75601215	75601215	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:75601215C>T	uc001sxg.1	-	2	1093	c.549G>A	c.(547-549)GAG>GAA	p.E183E	KCNC2_uc009zry.2_Silent_p.E183E|KCNC2_uc001sxe.2_Silent_p.E183E|KCNC2_uc001sxf.2_Silent_p.E183E|KCNC2_uc010stw.1_Silent_p.E183E	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	183	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						CCGCCAGGTCCTCGTCGTCGC	0.726			NA											3	17					0	0	0.004672	0	0
PPFIA2	8499	broad.mit.edu	37	12	81762565	81762565	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:81762565G>T	uc001szo.1	-	13	1582	c.1421C>A	c.(1420-1422)ACT>AAT	p.T474N	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	400										ovary(3)|lung(2)|pancreas(1)	6						ATTGGATTCAGTCAGAAGTCT	0.353			NA											27	92					4.7796e-09	5.59344e-09	0.004656	1	0
LRRIQ1	84125	broad.mit.edu	37	12	85446027	85446027	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:85446027G>T	uc001tac.2	+	7	862	c.751G>T	c.(751-753)GAG>TAG	p.E251*	LRRIQ1_uc001tab.1_Nonsense_Mutation_p.E251*|LRRIQ1_uc001taa.1_Intron	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	251	Glu-rich.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TAAACAGCATGAGGTATCTAT	0.274			NA											14	52					1.5739e-10	1.88807e-10	0.004007	1	0
C12orf12	196477	broad.mit.edu	37	12	91347651	91347651	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:91347651T>G	uc001tbj.2	-	1	1303	c.869A>C	c.(868-870)TAT>TCT	p.Y290S		NM_152638	NP_689851	Q8TC90	CL012_HUMAN	hypothetical protein LOC196477	290	Potential.|Glu-rich.									central_nervous_system(1)|pancreas(1)	2						ctcctggtcatactcctcctc	0.224			NA											47	161					0	0	0.003214	0	0
C12orf63	374467	broad.mit.edu	37	12	97084914	97084914	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:97084914T>C	uc001tet.1	+	11	1443	c.1365T>C	c.(1363-1365)CTT>CTC	p.L455L		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	455										skin(6)|ovary(1)	7						AGGGTTTGCTTAGAACAACAC	0.333			NA											6	41					0	0	0.001984	0	0
SLC5A8	160728	broad.mit.edu	37	12	101603383	101603383	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:101603383C>T	uc001thz.3	-	1	634	c.244G>A	c.(244-246)GGG>AGG	p.G82R		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	82	Extracellular (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						AAAATGGCCCCAAAACGGTAG	0.582	GBM(60;420 1056 13605 22380 47675)		NA											7	30					0	0	0.001984	0	0
GLT8D2	83468	broad.mit.edu	37	12	104397073	104397073	+	Missense_Mutation	SNP	C	C	T	rs140897214	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:104397073C>T	uc001tkh.1	-	5	530	c.124G>A	c.(124-126)GAG>AAG	p.E42K	GLT8D2_uc001tki.1_Missense_Mutation_p.E42K	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	42	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						TCAGGAGTCTCGGATTCATCA	0.453			NA											13	83					0	0	0.001855	0	0
SELPLG	6404	broad.mit.edu	37	12	109017658	109017658	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:109017658C>T	uc001tni.2	-	2	586	c.426G>A	c.(424-426)CAG>CAA	p.Q142Q	SELPLG_uc001tnh.2_Silent_p.Q132Q|SELPLG_uc010sxe.1_Silent_p.Q158Q	NM_003006	NP_002997	Q14242	SELPL_HUMAN	selectin P ligand	142	3.|Extracellular (Potential).|12 X 10 AA tandem repeats.				blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding				0						GTGGAGTGGTCTGTGCCTCCG	0.612			NA											14	85					0	0	0.006122	0	0
UBE3B	89910	broad.mit.edu	37	12	109949024	109949024	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:109949024C>T	uc001top.2	+	18	2475	c.1872C>T	c.(1870-1872)AGC>AGT	p.S624S	UBE3B_uc001toq.2_Silent_p.S624S|UBE3B_uc001tos.2_Silent_p.S51S|UBE3B_uc001too.1_RNA|UBE3B_uc009zvj.1_Silent_p.S624S	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	624					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						TCAAACCTAGCGTGCTCTTCC	0.403			NA											4	50					0	0	0.009096	0	0
UBE3B	89910	broad.mit.edu	37	12	109972579	109972579	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:109972579C>G	uc001top.2	+	28	3802	c.3199C>G	c.(3199-3201)CTC>GTC	p.L1067V	UBE3B_uc001toq.2_Missense_Mutation_p.L1067V|UBE3B_uc001tos.2_Missense_Mutation_p.L494V|UBE3B_uc001tot.2_Missense_Mutation_p.L185V|UBE3B_uc010sxp.1_3'UTR	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	1067	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						GGGCTTTGAACTCTCCTAGCT	0.607			NA											15	58					0	0	0.003163	0	0
MMAB	326625	broad.mit.edu	37	12	110002929	110002929	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:110002929G>A	uc001tou.2	-	4	416	c.343C>T	c.(343-345)CAG>TAG	p.Q115*	MMAB_uc001tov.2_RNA|MMAB_uc001tow.2_RNA|MMAB_uc010sxq.1_Nonsense_Mutation_p.Q24*|MMAB_uc001tox.2_Nonsense_Mutation_p.Q63*	NM_052845	NP_443077	Q96EY8	MMAB_HUMAN	cob(I)alamin adenosyltransferase precursor	115					cobalamin biosynthetic process	mitochondrion	ATP binding|cob(I)yrinic acid a,c-diamide adenosyltransferase activity				0					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTCACTTTCTGAAGCTCTTCG	0.408			NA											41	153					0	0	0.002852	0	0
TRPV4	59341	broad.mit.edu	37	12	110236656	110236656	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:110236656C>T	uc001tpj.1	-	5	1010	c.915G>A	c.(913-915)ACG>ACA	p.T305T	TRPV4_uc001tpg.1_Silent_p.T271T|TRPV4_uc001tph.1_Silent_p.T258T|TRPV4_uc001tpi.1_Silent_p.T258T|TRPV4_uc001tpk.1_Silent_p.T305T|TRPV4_uc001tpl.1_Silent_p.T305T	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	305	Cytoplasmic (Potential).|ANK 2.				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GGGGGTTCTCCGTCAGGTAGT	0.647			NA											23	50					0	0	0.00278	0	0
UNC119B	84747	broad.mit.edu	37	12	121154530	121154530	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:121154530C>T	uc001tyz.2	+	3	905	c.458C>T	c.(457-459)ACA>ATA	p.T153I		NM_001080533	NP_001074002	A6NIH7	U119B_HUMAN	unc-119 homolog B	153										haematopoietic_and_lymphoid_tissue(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CGCCTCCGGACAGTCGGGGCT	0.542			NA											28	138					0	0	0.004656	0	0
KNTC1	9735	broad.mit.edu	37	12	123075220	123075220	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:123075220G>T	uc001ucv.2	+	41	4229	c.4066G>T	c.(4066-4068)GAT>TAT	p.D1356Y	KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	1356					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ACCTCAAAAAGATGTGTTTGA	0.393			NA											29	95					1.55811e-20	2.00859e-20	0.008361	1	0
DDX55	57696	broad.mit.edu	37	12	124094491	124094491	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:124094491A>T	uc001ufi.2	+	7	581	c.557A>T	c.(556-558)AAC>ATC	p.N186I	DDX55_uc001ufh.2_Missense_Mutation_p.N39I|DDX55_uc001ufj.1_Missense_Mutation_p.N39I|DDX55_uc001ufk.2_Missense_Mutation_p.N39I	NM_020936	NP_065987	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	186	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		ATCAGCATCAACACCATTCTG	0.473			NA											19	58					0	0	0.008871	0	0
TMEM132B	114795	broad.mit.edu	37	12	125834534	125834534	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:125834534G>T	uc001uhe.1	+	2	597	c.589G>T	c.(589-591)GGC>TGC	p.G197C		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	197	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GTTCAGCTCAGGCCTGGACCT	0.652			NA											9	61					2.17888e-05	2.36934e-05	0.006214	1	0
FZD10	11211	broad.mit.edu	37	12	130647987	130647987	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:130647987C>T	uc001uii.2	+	1	956	c.500C>T	c.(499-501)CCG>CTG	p.P167L	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	167	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CTGTTCCCGCCGCTGTTCCGG	0.612			NA											10	18					0	0	0.000978	0	0
EP400	57634	broad.mit.edu	37	12	132466666	132466666	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:132466666G>A	uc001ujn.2	+	4	1607	c.1572G>A	c.(1570-1572)GCG>GCA	p.A524A	EP400_uc001ujl.2_Silent_p.A523A|EP400_uc001ujm.2_Silent_p.A524A|EP400_uc001ujj.1_Silent_p.A487A|EP400_uc001ujk.2_Silent_p.A560A	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	560					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CGCAGGCCGCGCAGCTCGCTG	0.607			NA											14	237					0	0	0.001855	0	0
EP400	57634	broad.mit.edu	37	12	132546759	132546759	+	Silent	SNP	G	G	A	rs145021676		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:132546759G>A	uc001ujn.2	+	45	8024	c.7989G>A	c.(7987-7989)ACG>ACA	p.T2663T	EP400_uc001ujl.2_Silent_p.T2662T|EP400_uc001ujm.2_Silent_p.T2582T|EP400_uc001ujp.2_5'Flank	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2699	Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CCATGGCAACGACTCAGGGTG	0.687			NA											19	52					0	0	0.007413	0	0
PABPC3	5042	broad.mit.edu	37	13	25671457	25671457	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:25671457G>A	uc001upy.2	+	1	1182	c.1121G>A	c.(1120-1122)CGC>CAC	p.R374H		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	374					mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AAAGAAGAGCGCCAGGCTTAC	0.493			NA											5	71					0	0	0.000602	0	0
TRPC4	7223	broad.mit.edu	37	13	38237797	38237797	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:38237797C>A	uc001uws.2	-	6	1679	c.1444G>T	c.(1444-1446)GCT>TCT	p.A482S	TRPC4_uc010abv.2_Missense_Mutation_p.A62S|TRPC4_uc001uwt.2_Missense_Mutation_p.A482S|TRPC4_uc010tey.1_Missense_Mutation_p.A482S|TRPC4_uc010abw.2_Missense_Mutation_p.A309S|TRPC4_uc010abx.2_Missense_Mutation_p.A482S|TRPC4_uc010aby.2_Missense_Mutation_p.A482S	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	482	Helical; (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTTGCAATAGCAAATAAAGCC	0.453			NA											6	31					8.12818e-05	8.69429e-05	0.001984	1	0
KBTBD7	84078	broad.mit.edu	37	13	41767970	41767970	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:41767970G>C	uc001uxw.1	-	1	733	c.424C>G	c.(424-426)CAG>GAG	p.Q142E	uc001uxv.1_Intron	NM_032138	NP_115514	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	142							protein binding			ovary(1)	1		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		TACAGGCGCTGCACATTGGCC	0.607			NA											6	38					0	0	0.001984	0	0
KBTBD7	84078	broad.mit.edu	37	13	41767974	41767974	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:41767974A>G	uc001uxw.1	-	1	729	c.420T>C	c.(418-420)AAT>AAC	p.N140N	uc001uxv.1_Intron	NM_032138	NP_115514	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	140							protein binding			ovary(1)	1		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GGCGCTGCACATTGGCCTCAC	0.602			NA											6	37					0	0	0.001984	0	0
MTRF1	9617	broad.mit.edu	37	13	41814395	41814395	+	Splice_Site	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:41814395A>G	uc001uxx.2	-	8	1340	c.870_splice	c.e8+1	p.E290_splice	MTRF1_uc001uxy.2_Splice_Site_p.E290_splice|MTRF1_uc001uxz.2_Splice_Site_p.E126_splice|MTRF1_uc010tff.1_Splice_Site_p.E303_splice|MTRF1_uc001uyc.1_Splice_Site_p.E290_splice	NM_004294	NP_004285	O75570	RF1M_HUMAN	mitochondrial translational release factor 1						regulation of translational termination	mitochondrion	translation release factor activity, codon specific				0		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		TCCTGAGGTTACCTCATCTGG	0.493			NA											23	79					0	0	0.00333	0	0
AKAP11	11215	broad.mit.edu	37	13	42874407	42874407	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:42874407A>T	uc001uys.1	+	8	1700	c.1525A>T	c.(1525-1527)ACT>TCT	p.T509S		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	509					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TACCCACCATACTAATACCCT	0.294			NA											15	55					0	0	0.00499	0	0
CDADC1	81602	broad.mit.edu	37	13	49823042	49823042	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:49823042A>G	uc001vcu.2	+	2	194	c.118A>G	c.(118-120)ACT>GCT	p.T40A	CDADC1_uc001vcs.1_RNA|CDADC1_uc001vct.1_5'UTR|CDADC1_uc010tgk.1_5'UTR|CDADC1_uc001vcv.2_RNA	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	40							hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		CAACCTTTTCACTCTGCTCAG	0.413			NA											47	109					0	0	0.00361	0	0
LOC220429	220429	broad.mit.edu	37	13	50466114	50466114	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:50466114G>T	uc001vdk.2	+	1	1570	c.1388G>T	c.(1387-1389)TGT>TTT	p.C463F		NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						CATGATAATTGTTTGGCAGCA	0.313			NA											5	22					1.23904e-05	1.35089e-05	0.000602	1	0
LOC220429	220429	broad.mit.edu	37	13	50467031	50467031	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:50467031T>C	uc001vdk.2	+	1	2487	c.2305T>C	c.(2305-2307)TCC>CCC	p.S769P		NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						ACCTGGATTTTCCCCCCCTAC	0.522			NA											15	62					0	0	0.007413	0	0
ATP7B	540	broad.mit.edu	37	13	52511720	52511720	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:52511720C>A	uc001vfw.2	-	18	3952	c.3795G>T	c.(3793-3795)GTG>GTT	p.V1265V	ATP7B_uc010adv.2_Silent_p.V835V|ATP7B_uc001vfx.2_Silent_p.V1058V|ATP7B_uc001vfy.2_Silent_p.V1154V|ATP7B_uc010tgt.1_Silent_p.V1200V|ATP7B_uc010tgu.1_Silent_p.V1217V|ATP7B_uc010tgv.1_Silent_p.V1187V|ATP7B_uc001vfv.2_Silent_p.V537V|ATP7B_uc010tgs.1_Silent_p.V476V	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1265	Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)		CCCCATCCCCCACCATGGCGA	0.602			NA							Wilson_disease				17	74					1.67942e-08	1.94706e-08	0.006122	1	0
KLHL1	57626	broad.mit.edu	37	13	70681664	70681664	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:70681664C>A	uc001vip.2	-	1	962	c.168G>T	c.(166-168)CTG>CTT	p.L56L	KLHL1_uc010thm.1_Silent_p.L56L|ATXN8OS_uc010aej.1_RNA	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	56	Ser-rich.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GGCTTTTGAGCAGGCGACTCT	0.483			NA											14	46					1.99824e-07	2.28265e-07	0.00499	1	0
MYCBP2	23077	broad.mit.edu	37	13	77754433	77754433	+	Silent	SNP	C	C	A	rs61753811		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:77754433C>A	uc001vkf.2	-	35	4939	c.4848G>T	c.(4846-4848)GGG>GGT	p.G1616G	MYCBP2_uc010aev.2_Silent_p.G1020G	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1616					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGCTTGTCATCCCTGAGATAT	0.408			NA											19	84					1.22574e-08	1.42506e-08	0.002299	1	0
MYCBP2	23077	broad.mit.edu	37	13	77847731	77847731	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:77847731A>G	uc001vkf.2	-	6	798	c.707T>C	c.(706-708)TTA>TCA	p.L236S	MYCBP2_uc010aev.2_5'UTR	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	236					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AAGTGCTGTTAAGGACTGTCC	0.448			NA											25	83					0	0	0.005443	0	0
SLITRK1	114798	broad.mit.edu	37	13	84453836	84453836	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:84453836C>A	uc001vlk.2	-	1	2693	c.1807G>T	c.(1807-1809)GGG>TGG	p.G603W		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	603	Extracellular (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GAGTGCGTCCCGGTCTCCGCC	0.582			NA											13	9					0.00244969	0.00255871	0.00245	1	0
SLITRK1	114798	broad.mit.edu	37	13	84454373	84454373	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:84454373C>T	uc001vlk.2	-	1	2156	c.1270G>A	c.(1270-1272)GAC>AAC	p.D424N		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	424	LRR 9.|Extracellular (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CACCTGAGGTCCAAAAGGTTC	0.468			NA											45	157					0	0	0.003214	0	0
SLITRK6	84189	broad.mit.edu	37	13	86368858	86368858	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:86368858T>C	uc001vll.1	-	2	2245	c.1786A>G	c.(1786-1788)ACT>GCT	p.T596A	SLITRK6_uc010afe.1_Intron	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	596	Extracellular (Potential).					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CGTAAAATAGTATCAGCCGTA	0.413			NA											31	73					0	0	0.002096	0	0
GPC6	10082	broad.mit.edu	37	13	94482464	94482464	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:94482464G>A	uc001vlt.2	+	3	1009	c.377G>A	c.(376-378)CGG>CAG	p.R126Q	GPC6_uc010tig.1_Missense_Mutation_p.R126Q|GPC6_uc001vlu.1_Missense_Mutation_p.R56Q	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	126						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				ATGTTTGTACGGACCTATGGC	0.403			NA											10	60					0	0	0.006214	0	0
DCT	1638	broad.mit.edu	37	13	95121241	95121241	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:95121241G>A	uc001vlv.3	-	2	781	c.354C>T	c.(352-354)TGC>TGT	p.C118C	DCT_uc010afh.2_Silent_p.C118C	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	118	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TCTTCCGCTCGCAGTTGGGAC	0.498			NA											41	176					0	0	0.002852	0	0
IPO5	3843	broad.mit.edu	37	13	98641412	98641412	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:98641412T>A	uc001vnf.1	+	4	526	c.461T>A	c.(460-462)ATT>AAT	p.I154N	IPO5_uc001vne.2_Missense_Mutation_p.I172N|IPO5_uc010tik.1_Intron|IPO5_uc010til.1_Missense_Mutation_p.I94N	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5	154					interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						GCCCTTCACATTTTCTGGTAT	0.373			NA											13	20					0	0	0.001368	0	0
SLC15A1	6564	broad.mit.edu	37	13	99368211	99368211	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:99368211A>G	uc001vno.2	-	9	721	c.644T>C	c.(643-645)GTG>GCG	p.V215A		NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide	215	Helical; (Potential).				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	AAGGACAAACACAACTAGATA	0.468			NA											15	50					0	0	0.006122	0	0
TM9SF2	9375	broad.mit.edu	37	13	100204544	100204544	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:100204544G>A	uc001voj.1	+	13	1585	c.1452G>A	c.(1450-1452)CTG>CTA	p.L484L	TM9SF2_uc010afz.1_Silent_p.L319L	NM_004800	NP_004791	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2 precursor	484	Helical; (Potential).				transport	endosome membrane|integral to plasma membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					CTGTGCCTCTGACGTTTATTG	0.398			NA											12	94					0	0	0.001855	0	0
NALCN	259232	broad.mit.edu	37	13	101795488	101795488	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:101795488G>A	uc001vox.1	-	17	2250	c.2061C>T	c.(2059-2061)TCC>TCT	p.S687S	NALCN_uc001voy.2_Silent_p.S402S	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	687	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGTCGCAGGAGGAGGAAGAGG	0.463			NA											24	70					0	0	0.00333	0	0
NALCN	259232	broad.mit.edu	37	13	101795498	101795498	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:101795498G>A	uc001vox.1	-	17	2240	c.2051C>T	c.(2050-2052)ACC>ATC	p.T684I	NALCN_uc001voy.2_Missense_Mutation_p.T399I	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	684	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGAGGAAGAGGTGGTCGGGAG	0.468			NA											20	60					0	0	0.008871	0	0
C13orf39	196541	broad.mit.edu	37	13	103338753	103338753	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:103338753A>T	uc001vpj.2	-	4	429	c.423T>A	c.(421-423)GAT>GAA	p.D141E	C13orf39_uc001vpk.2_Missense_Mutation_p.D141E	NM_001010977	NP_001010977	Q5VZV1	MT21C_HUMAN	hypothetical protein LOC196541	141							methyltransferase activity				0						CATCAGGCAAATCTGTTGCTG	0.423			NA											14	56					0	0	0.003163	0	0
ERCC5	2073	broad.mit.edu	37	13	103515012	103515012	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:103515012A>C	uc001vpw.2	+	8	1956	c.1513A>C	c.(1513-1515)AGT>CGT	p.S505R	ERCC5_uc001vpu.1_Missense_Mutation_p.S959R|ERCC5_uc010tjb.1_Missense_Mutation_p.S505R|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.S337R	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	505					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GCCTCTGGAGAGTGCAGTGGT	0.468			NA	Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				14	53					0	0	0.00245	0	0
ATP11A	23250	broad.mit.edu	37	13	113530213	113530213	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:113530213C>T	uc001vsi.3	+	28	3373	c.3285C>T	c.(3283-3285)GTC>GTT	p.V1095V	ATP11A_uc001vsj.3_Silent_p.V1095V|ATP11A_uc010ago.2_RNA	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	1095	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TCAAGAAAGTCCTGTGCCGGC	0.642			NA											25	67					0	0	0.005443	0	0
ADPRHL1	113622	broad.mit.edu	37	13	114077278	114077278	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr13:114077278C>A	uc001vtq.1	-	7	1011	c.924G>T	c.(922-924)ACG>ACT	p.T308T	ADPRHL1_uc001vtp.1_Silent_p.T226T	NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1 isoform 1	308					protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			CAATGGTGCCCGTGGCCGCGC	0.647			NA											8	90					0.000157383	0.000167912	0.00308	1	0
OR4M1	441670	broad.mit.edu	37	14	20248712	20248712	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:20248712A>T	uc010tku.1	+	1	231	c.231A>T	c.(229-231)ACA>ACT	p.T77T		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	77	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTCCATTACAGCCCCTAAAA	0.438			NA											57	413					0	0	0.00361	0	0
OR4K15	81127	broad.mit.edu	37	14	20444032	20444032	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:20444032G>C	uc010tkx.1	+	1	355	c.355G>C	c.(355-357)GAT>CAT	p.D119H		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	119	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATTTCTTTTGATGCCTGCCT	0.433			NA											38	147					0	0	0.004878	0	0
G2E3	55632	broad.mit.edu	37	14	31077152	31077152	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:31077152C>T	uc001wqk.2	+	12	1531	c.1377C>T	c.(1375-1377)CAC>CAT	p.H459H	G2E3_uc010tpe.1_3'UTR|G2E3_uc010tpf.1_Silent_p.H413H	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	459	HECT.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						CTTTAGTTCACGGTGGTCCTT	0.348			NA											10	42					0	0	0.00245	0	0
HECTD1	25831	broad.mit.edu	37	14	31597942	31597942	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:31597942C>T	uc001wrc.1	-	25	5124	c.4635G>A	c.(4633-4635)TTG>TTA	p.L1545L	HECTD1_uc001wrb.1_5'UTR|HECTD1_uc001wrd.1_Silent_p.L1013L	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	1545	Ser-rich.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CAAAACTCTCCAAGCTAGATG	0.458			NA											11	46					0	0	0.000978	0	0
HEATR5A	25938	broad.mit.edu	37	14	31778294	31778294	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:31778294A>T	uc001wrf.3	-	23	3734	c.3657T>A	c.(3655-3657)CTT>CTA	p.L1219L	HEATR5A_uc010ami.2_Silent_p.L1117L	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1506							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		CCGTGCTTGTAAGCCACAATG	0.463			NA											48	131					0	0	0.00361	0	0
SRP54	6729	broad.mit.edu	37	14	35468792	35468792	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:35468792G>C	uc001wso.2	+	3	458	c.107G>C	c.(106-108)TGT>TCT	p.C36S	SRP54_uc010tpp.1_Intron|SRP54_uc010tpq.1_Intron	NM_003136	NP_003127	P61011	SRP54_HUMAN	signal recognition particle 54kDa isoform 1	36	G-domain.				GTP catabolic process|response to drug|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition|SRP-dependent cotranslational protein targeting to membrane, translocation	cytosol|nuclear speck|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|drug binding|endoplasmic reticulum signal peptide binding|GDP binding|GTP binding|nucleoside-triphosphatase activity|ribonucleoprotein binding			ovary(1)	1	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		AAAGAAGTCTGTACCGCTTTG	0.303			NA											6	91					0	0	0.001168	0	0
LRFN5	145581	broad.mit.edu	37	14	42356095	42356095	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:42356095T>C	uc001wvm.2	+	3	1465	c.267T>C	c.(265-267)TTT>TTC	p.F89F	LRFN5_uc010ana.2_Silent_p.F89F	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	89	Extracellular (Potential).|LRR 2.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CAATAAGTTTTATTACACCTC	0.363			NA								HNSCC(30;0.082)			14	64					0	0	0.004007	0	0
MDGA2	161357	broad.mit.edu	37	14	47504297	47504297	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:47504297G>T	uc001wwj.3	-	8	1725	c.1529C>A	c.(1528-1530)TCA>TAA	p.S510*	MDGA2_uc001wwi.3_Nonsense_Mutation_p.S281*|MDGA2_uc010ani.2_Nonsense_Mutation_p.S70*	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	510	Ig-like 5.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						GTACATTCCTGACATTTCCCT	0.423			NA											22	105					2.89027e-11	3.49756e-11	0.002299	1	0
C14orf104	55172	broad.mit.edu	37	14	50100073	50100073	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:50100073C>T	uc001wws.3	-	1	1876	c.1795G>A	c.(1795-1797)GCA>ACA	p.A599T	SDCCAG1_uc010anj.1_Intron|C14orf104_uc001wwt.3_Missense_Mutation_p.A599T	NM_018139	NP_060609	Q9NVR5	KTU_HUMAN	kintoun isoform 1	599					axonemal dynein complex assembly|ciliary cell motility|flagellar cell motility	cytoplasm					0	all_epithelial(31;0.0021)|Breast(41;0.0124)					GGAGATTTTGCCAGTTCTATC	0.383			NA							Kartagener_syndrome				14	39					0	0	0.00245	0	0
SOS2	6655	broad.mit.edu	37	14	50666524	50666524	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:50666524G>A	uc001wxs.3	-	4	493	c.395C>T	c.(394-396)GCT>GTT	p.A132V	SOS2_uc010tql.1_Missense_Mutation_p.A132V	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2	132					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					CTCTAGTACAGCCACAATATA	0.318			NA											20	122					0	0	0.001882	0	0
TXNDC16	57544	broad.mit.edu	37	14	52957649	52957649	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:52957649A>T	uc001wzs.2	-	10	1280	c.831T>A	c.(829-831)GTT>GTA	p.V277V	TXNDC16_uc010tqu.1_Silent_p.V272V|TXNDC16_uc010aoe.2_RNA	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16 isoform 1	277					cell redox homeostasis	extracellular region					0	Breast(41;0.0716)					CCTGTTGGCTAACAATAAAAA	0.388			NA											15	58					0	0	0.003163	0	0
TXNDC16	57544	broad.mit.edu	37	14	52957674	52957674	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:52957674A>G	uc001wzs.2	-	10	1255	c.806T>C	c.(805-807)CTG>CCG	p.L269P	TXNDC16_uc010tqu.1_Missense_Mutation_p.L264P|TXNDC16_uc010aoe.2_RNA	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16 isoform 1	269					cell redox homeostasis	extracellular region					0	Breast(41;0.0716)					TGGTAAGCCCAGTTGGAGATG	0.388			NA											11	56					0	0	0.000978	0	0
KIAA0586	9786	broad.mit.edu	37	14	58965577	58965577	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:58965577T>C	uc001xdv.3	+	26	4112	c.3839T>C	c.(3838-3840)ATG>ACG	p.M1280T	KIAA0586_uc010trr.1_Missense_Mutation_p.M1397T|KIAA0586_uc001xdt.3_Missense_Mutation_p.M1312T|KIAA0586_uc001xdu.3_Missense_Mutation_p.M1341T|KIAA0586_uc010trs.1_Missense_Mutation_p.M1271T|KIAA0586_uc010trt.1_Missense_Mutation_p.M1216T	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	1280										ovary(1)	1						AACATCTTAATGGGACATTCT	0.413			NA											9	31					0	0	0.006214	0	0
PRKCH	5583	broad.mit.edu	37	14	62014573	62014573	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:62014573G>A	uc001xfn.2	+	13	2179	c.1874G>A	c.(1873-1875)CGC>CAC	p.R625H	PRKCH_uc010tsa.1_Missense_Mutation_p.R464H|PRKCH_uc010tsb.1_Missense_Mutation_p.R193H|PRKCH_uc001xfo.2_RNA	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta	625	AGC-kinase C-terminal.				intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTGAACCATCGCCAAATAGAA	0.522	Melanoma(135;863 1779 8064 14443 26348)		NA											58	196					0	0	0.00361	0	0
SYNE2	23224	broad.mit.edu	37	14	64580082	64580082	+	Silent	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:64580082T>G	uc001xgm.2	+	66	12863	c.12633T>G	c.(12631-12633)GCT>GCG	p.A4211A	SYNE2_uc001xgl.2_Silent_p.A4211A|SYNE2_uc010apy.2_Silent_p.A596A|SYNE2_uc010apz.1_Silent_p.A103A	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4211	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTATTGAGGCTGACACTCTGG	0.552			NA											10	53					0	0	0.000978	0	0
ZBTB25	7597	broad.mit.edu	37	14	64957119	64957119	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:64957119A>G	uc001xhf.2	-	2	316	c.133T>C	c.(133-135)TTT>CTT	p.F45L	ZBTB25_uc001xhc.2_Missense_Mutation_p.F45L|ZBTB25_uc001xhg.2_Missense_Mutation_p.F45L	NM_006977	NP_008908	P24278	ZBT25_HUMAN	zinc finger protein 46	45	BTB.					cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		TAGTTAGAAAAAGCAGCAAGC	0.338			NA											19	58					0	0	0.008871	0	0
PCNX	22990	broad.mit.edu	37	14	71575562	71575562	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:71575562C>T	uc001xmo.2	+	34	6989	c.6543C>T	c.(6541-6543)AGC>AGT	p.S2181S	PCNX_uc010are.1_Silent_p.S2070S|PCNX_uc010arf.1_Silent_p.S969S|PCNX_uc001xmp.2_Silent_p.S265S	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	2181	Ser-rich.					integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CAGGTCAGAGCGGCCTGGCCT	0.567			NA											5	48					0	0	0.001168	0	0
SIPA1L1	26037	broad.mit.edu	37	14	72054904	72054904	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:72054904C>G	uc001xms.2	+	2	663	c.315C>G	c.(313-315)TGC>TGG	p.C105W	SIPA1L1_uc001xmt.2_Missense_Mutation_p.C105W|SIPA1L1_uc001xmu.2_Missense_Mutation_p.C105W|SIPA1L1_uc001xmv.2_Missense_Mutation_p.C105W	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	105					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CCTCAAGTTGCCTTGATAGCC	0.463			NA											22	110					0	0	0.001882	0	0
COQ6	51004	broad.mit.edu	37	14	74428590	74428590	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:74428590C>T	uc001xph.2	+	11	1441	c.1361C>T	c.(1360-1362)GCA>GTA	p.A454V	ENTPD5_uc001xpi.2_Intron|COQ6_uc001xpe.2_Missense_Mutation_p.A379V|COQ6_uc001xpf.2_Missense_Mutation_p.A379V|COQ6_uc010tuk.1_Missense_Mutation_p.A429V|COQ6_uc001xpg.2_Intron	NM_182476	NP_872282	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 homolog isoform a	454					ubiquinone biosynthetic process	mitochondrion	flavin adenine dinucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.00337)		GCCACAAATGCAGTGTCTCCA	0.393			NA											15	131					0	0	0.004007	0	0
C14orf115	55237	broad.mit.edu	37	14	74824469	74824469	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:74824469G>A	uc001xpw.3	+	2	1174	c.983G>A	c.(982-984)GGC>GAC	p.G328D		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	328					transposition, DNA-mediated		DNA binding|transposase activity	p.V329fs*25(2)			0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		CACCGGGGGGGCGTCGTGCCA	0.657			NA											7	64					0	0	0.008291	0	0
SNW1	22938	broad.mit.edu	37	14	78198920	78198920	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:78198920G>A	uc001xuf.2	-	9	826	c.799C>T	c.(799-801)CGT>TGT	p.R267C	SNW1_uc010tvm.1_Missense_Mutation_p.R192C|SNW1_uc010asu.2_Missense_Mutation_p.R105C|SNW1_uc010tvn.1_Missense_Mutation_p.R267C	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	267	SNW.				negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GCAGCCAGACGTTTGTCTAAT	0.388			NA											4	56					0	0	0.009096	0	0
EML5	161436	broad.mit.edu	37	14	89220988	89220988	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:89220988C>T	uc001xxg.2	-	3	411	c.225G>A	c.(223-225)TTG>TTA	p.L75L		NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	75	WD 1.					cytoplasm|microtubule				ovary(3)	3						CTGTTGCTACCAACACTCGTT	0.333			NA											4	9					0	0	0.000602	0	0
C14orf102	55051	broad.mit.edu	37	14	90769341	90769341	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:90769341C>A	uc001xyi.1	-	6	1165	c.1134G>T	c.(1132-1134)CAG>CAT	p.Q378H	C14orf102_uc010atp.1_Intron|C14orf102_uc001xyj.1_Missense_Mutation_p.Q147H	NM_017970	NP_060440	Q9H7Z3	CN102_HUMAN	hypothetical protein LOC55051 isoform 1	378	Potential.						protein binding			ovary(2)|lung(1)	3		all_cancers(154;0.118)		COAD - Colon adenocarcinoma(157;0.218)		CCACACTGCTCTGGTTGCTCT	0.522			NA											6	83					0.00116845	0.00122973	0.001168	1	0
C14orf184	650662	broad.mit.edu	37	14	92040779	92040779	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:92040779G>A	uc010aua.1	-	1	605	c.178C>T	c.(178-180)CCC>TCC	p.P60S		NM_001080113	NP_001073582	Q8WYT3	CN184_HUMAN	hypothetical protein LOC650662	60											0						CGCCGCTCGGGTGTACTGTTC	0.657			NA											5	9					0	0	0.001984	0	0
DICER1	23405	broad.mit.edu	37	14	95572020	95572020	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:95572020T>C	uc001ydw.2	-	20	3270	c.3088A>G	c.(3088-3090)AAA>GAA	p.K1030E	DICER1_uc010avh.1_Translation_Start_Site|DICER1_uc001ydv.2_Missense_Mutation_p.K1020E|DICER1_uc001ydx.2_Missense_Mutation_p.K1030E|DICER1_uc001ydy.1_5'Flank	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1030	PAZ.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		ATTACCTGTTTATTCTGCAGA	0.333			NA	Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				17	40					0	0	0.004007	0	0
CDC42BPB	9578	broad.mit.edu	37	14	103416123	103416123	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:103416123G>A	uc001ymi.1	-	26	3660	c.3428C>T	c.(3427-3429)GCG>GTG	p.A1143V	CDC42BPB_uc001ymj.1_Missense_Mutation_p.A245V	NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	1143	PH.				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GACTTGGCTCGCAATGACACC	0.517			NA											6	74					0	0	0.00308	0	0
TDRD9	122402	broad.mit.edu	37	14	104508420	104508420	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:104508420G>T	uc001yom.3	+	34	3900	c.3870G>T	c.(3868-3870)AGG>AGT	p.R1290S	TDRD9_uc001yon.3_Missense_Mutation_p.R837S	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	1290					cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ATATTCTCAGGGCTGCTATTA	0.433			NA											20	28					1.15919e-05	1.26716e-05	0.008871	1	0
Unknown	0	broad.mit.edu	37	15	20666449	20666449	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:20666449A>G	uc001ytg.2	-	7	889	c.180T>C	c.(178-180)TGT>TGC	p.C60C	uc010tyx.1_RNA|uc001yth.3_Silent_p.C60C|uc010tyy.1_Silent_p.C60C|uc010tyz.1_Intron					RecName: Full=Putative HERC2-like protein 3;												NA						TCTTACTGGCACATTCAATCT	0.378			NA											5	50					0	0	0.004482	0	0
OR4M2	390538	broad.mit.edu	37	15	22369029	22369029	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:22369029G>T	uc010tzu.1	+	1	454	c.454G>T	c.(454-456)GGC>TGC	p.G152C	LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	152	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTGGAGGGGGGGCTTCATTCA	0.502			NA											14	269					7.93312e-07	8.86685e-07	0.00245	1	0
OR4N4	283694	broad.mit.edu	37	15	22382941	22382941	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:22382941A>G	uc001yuc.1	+	7	1450	c.469A>G	c.(469-471)ATT>GTT	p.I157V	LOC727924_uc001yub.1_Intron|OR4N4_uc010tzv.1_Missense_Mutation_p.I157V	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGTCCACTCCATTATCCAGGT	0.537			NA											20	125					0	0	0.004656	0	0
Unknown	0	broad.mit.edu	37	15	22440403	22440403	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:22440403T>C	uc001yug.2	-	1	463	c.444A>G	c.(442-444)AAA>AAG	p.K148K						full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).												NA						TTTCATGATATTTCTTCTGAA	0.483			NA											3	17					0	0	0.009096	0	0
NDN	4692	broad.mit.edu	37	15	23931868	23931868	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:23931868G>A	uc001ywk.2	-	1	583	c.497C>T	c.(496-498)GCG>GTG	p.A166V		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	166	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TTTGACCAGCGCAAACTCCAT	0.632			NA							Prader-Willsyndrome				9	28					0	0	0.006214	0	0
MTMR15	22909	broad.mit.edu	37	15	31197648	31197648	+	Missense_Mutation	SNP	C	C	T	rs137920161		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:31197648C>T	uc001zff.2	+	2	1073	c.782C>T	c.(781-783)GCG>GTG	p.A261V	MTMR15_uc001zfc.3_Missense_Mutation_p.A261V|MTMR15_uc010azw.2_Missense_Mutation_p.A261V|MTMR15_uc001zfd.3_Missense_Mutation_p.A261V|MTMR15_uc001zfe.2_5'UTR	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	261					double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)		TCAGATAATGCGATCATGTTA	0.403			NA						Direct_reversal_of_damage|Editing_and_processing_nucleases					13	38					0	0	0.001855	0	0
RYR3	6263	broad.mit.edu	37	15	33873837	33873837	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:33873837A>T	uc001zhi.2	+	14	1636	c.1566A>T	c.(1564-1566)AAA>AAT	p.K522N	RYR3_uc010bar.2_Missense_Mutation_p.K522N	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	522	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCCTCTACAAATTGCTGGGTA	0.458			NA											7	60					0	0	0.00308	0	0
GPR176	11245	broad.mit.edu	37	15	40093574	40093574	+	Missense_Mutation	SNP	G	G	A	rs150836804		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:40093574G>A	uc001zkj.1	-	3	2173	c.1307C>T	c.(1306-1308)CCG>CTG	p.P436L	GPR176_uc010uck.1_Missense_Mutation_p.P376L	NM_007223	NP_009154	Q14439	GP176_HUMAN	G protein-coupled receptor 176	436	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		AGGGGCTGCCGGTGCCACCTG	0.577			NA											35	82					0	0	0.003755	0	0
EIF2AK4	440275	broad.mit.edu	37	15	40284431	40284431	+	Splice_Site	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:40284431G>A	uc001zkm.1	+	17	2736	c.2686_splice	c.e17+1	p.G896_splice	EIF2AK4_uc010bbj.1_Splice_Site_p.G597_splice|EIF2AK4_uc001zkn.1_5'UTR	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GACCCTTCAGGTAAACCCAGA	0.348			NA											18	37					0	0	0.010504	0	0
UBR1	197131	broad.mit.edu	37	15	43378291	43378291	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:43378291A>T	uc001zqq.2	-	2	295	c.229T>A	c.(229-231)TAC>AAC	p.Y77N	UBR1_uc010udk.1_Missense_Mutation_p.Y77N	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	77					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CCAAATAAGTACCATTCCAGT	0.413			NA											25	65					0	0	0.003954	0	0
MAP1A	4130	broad.mit.edu	37	15	43814596	43814596	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:43814596A>G	uc001zrt.2	+	4	1392	c.925A>G	c.(925-927)AAG>GAG	p.K309E		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	309	Lys-rich (basic).					cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TACCAACCTCAAGCCCAGCAA	0.572			NA											4	32					0	0	0.000602	0	0
DUOXA1	90527	broad.mit.edu	37	15	45412380	45412380	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:45412380G>T	uc001zuq.1	-	5	722	c.693C>A	c.(691-693)ACC>ACA	p.T231T	DUOXA1_uc010uem.1_Silent_p.T186T|DUOXA1_uc001zup.2_Silent_p.T231T|DUOXA1_uc010bec.2_Silent_p.T231T|DUOXA1_uc001zur.1_Silent_p.T186T|DUOXA1_uc010bed.1_Silent_p.T186T	NM_144565	NP_653166	Q1HG43	DOXA1_HUMAN	Numb-interacting protein	231	Extracellular (Potential).				protein transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		GACAGGGTGAGGTGAGTGATG	0.562			NA											12	114					1.05317e-09	1.25014e-09	0.00245	1	0
FBN1	2200	broad.mit.edu	37	15	48755289	48755289	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:48755289G>A	uc001zwx.1	-	42	5542	c.5214C>T	c.(5212-5214)ATC>ATT	p.I1738I	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1738	TB 7.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CTGTACTTGGGATGGGACACT	0.428			NA											23	92					0	0	0.00333	0	0
LDHAL6B	92483	broad.mit.edu	37	15	59499746	59499746	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:59499746C>T	uc002agb.2	+	1	705	c.607C>T	c.(607-609)CCC>TCC	p.P203S	MYO1E_uc002aga.2_Intron	NM_033195	NP_149972	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	203					glycolysis	cytoplasm	L-lactate dehydrogenase activity|protein binding				0					NADH(DB00157)	GAGTGCATTTCCCAAAAACCG	0.418			NA											34	97					0	0	0.002836	0	0
ZNF609	23060	broad.mit.edu	37	15	64792230	64792230	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:64792230G>A	uc002ann.2	+	1	612	c.612G>A	c.(610-612)GTG>GTA	p.V204V	ZNF609_uc010bgy.2_Silent_p.V204V	NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	204						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						GTGCAGGGGTGGATACAGGAG	0.567			NA											6	31					0	0	0.001168	0	0
THSD4	79875	broad.mit.edu	37	15	71952986	71952986	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:71952986A>G	uc002atb.1	+	7	1349	c.1270A>G	c.(1270-1272)AGC>GGC	p.S424G	THSD4_uc002atd.1_Missense_Mutation_p.S98G|THSD4_uc010ukg.1_Missense_Mutation_p.S64G|THSD4_uc002ate.2_Missense_Mutation_p.S64G	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	424						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TGCCCTCACCAGCCTGGGCTA	0.542			NA											9	76					0	0	0.004482	0	0
PARP6	56965	broad.mit.edu	37	15	72553991	72553991	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:72553991C>A	uc002auc.2	-	8	912	c.453G>T	c.(451-453)AAG>AAT	p.K151N	PARP6_uc002aua.2_Missense_Mutation_p.K16N|PARP6_uc002aub.2_RNA|PARP6_uc002aud.3_RNA|PARP6_uc002auf.1_Missense_Mutation_p.K151N	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	151							NAD+ ADP-ribosyltransferase activity				0						CCTGCTGGGTCTTCAAGAAAT	0.483			NA											46	301					8.00217e-19	1.02099e-18	0.00361	1	0
ARIH1	25820	broad.mit.edu	37	15	72873113	72873113	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:72873113T>C	uc002aut.3	+	12	1571	c.1257T>C	c.(1255-1257)AAT>AAC	p.N419N		NM_005744	NP_005735	Q9Y4X5	ARI1_HUMAN	ariadne ubiquitin-conjugating enzyme E2 binding	419					ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding				0						TCTACTGTAATCGCTATATGA	0.433			NA											11	25					0	0	0.000978	0	0
ADPGK	83440	broad.mit.edu	37	15	73048687	73048687	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:73048687T>C	uc002avg.3	-	5	839	c.745A>G	c.(745-747)AGC>GGC	p.S249G	ADPGK_uc002ave.3_5'UTR|ADPGK_uc010ukw.1_Missense_Mutation_p.S191G|ADPGK_uc002avf.3_Missense_Mutation_p.S249G|ADPGK_uc002avi.3_Missense_Mutation_p.S127G|ADPGK_uc002avh.3_Missense_Mutation_p.S10G	NM_031284	NP_112574	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	249	ADPK.				glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding				0						TCCTCCAGGCTAGACACAAAC	0.537			NA											13	66					0	0	0.001368	0	0
CLK3	1198	broad.mit.edu	37	15	74919983	74919983	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:74919983A>G	uc010uln.1	+	9	1921	c.1460A>G	c.(1459-1461)CAC>CGC	p.H487R	CLK3_uc002ayg.3_Missense_Mutation_p.H339R|CLK3_uc002ayh.3_Missense_Mutation_p.H118R|CLK3_uc002ayj.3_Missense_Mutation_p.H316R|CLK3_uc002ayk.3_Missense_Mutation_p.H266R|CLK3_uc002ayl.3_Missense_Mutation_p.H172R	NM_001130028	NP_001123500	P49761	CLK3_HUMAN	CDC-like kinase 3 isoform a	487	Protein kinase.					acrosomal vesicle|nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)	2						GCCACCCGTCACTATCGCCCG	0.547	Ovarian(133;694 1754 28950 29027 31859)		NA											24	94					0	0	0.005443	0	0
MESP2	145873	broad.mit.edu	37	15	90319996	90319996	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:90319996G>A	uc002bon.2	+	1	408	c.408G>A	c.(406-408)TCG>TCA	p.S136S	MESP2_uc010uqa.1_Intron	NM_001039958	NP_001035047	Q0VG99	MESP2_HUMAN	mesoderm posterior 2 homolog	136	Helix-loop-helix motif.				Notch signaling pathway	nucleus	DNA binding				0	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			GCCACCTATCGGCCGTGCTGG	0.721			NA											8	9					0	0	0.008291	0	0
IQGAP1	8826	broad.mit.edu	37	15	91035793	91035793	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:91035793G>T	uc002bpl.1	+	35	4579	c.4478G>T	c.(4477-4479)CGG>CTG	p.R1493L	IQGAP1_uc010uqg.1_Missense_Mutation_p.R114L	NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1493	C2.				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CGGAATCAGCGGAGGTACCGA	0.428			NA											14	18					4.3838e-07	4.96219e-07	0.001855	1	0
IQGAP1	8826	broad.mit.edu	37	15	91038012	91038012	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:91038012G>A	uc002bpl.1	+	36	4797	c.4696G>A	c.(4696-4698)GCA>ACA	p.A1566T	IQGAP1_uc010uqg.1_Missense_Mutation_p.A187T	NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1566	C2.				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			ATATACAGCAGCAAGACTACA	0.308			NA											13	78					0	0	0.003163	0	0
LRRK1	79705	broad.mit.edu	37	15	101606267	101606267	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:101606267C>T	uc002bwr.2	+	32	5944	c.5625C>T	c.(5623-5625)TGC>TGT	p.C1875C	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1875					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCACCGACTGCGAGGACTCAG	0.642			NA											10	83					0	0	0.008291	0	0
AXIN1	8312	broad.mit.edu	37	16	347134	347134	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:347134G>A	uc002cgp.1	-	7	2054	c.1877C>T	c.(1876-1878)GCG>GTG	p.A626V	AXIN1_uc002cgq.1_Missense_Mutation_p.A626V	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a	626	Interaction with RNF111.|Interaction with PPP2CA.				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GTTCTTCTCCGCATCCTCCGA	0.617			NA											39	191					0	0	0.00874	0	0
C16orf79	283870	broad.mit.edu	37	16	2260194	2260194	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:2260194G>A	uc010bsh.2	-	3	446	c.269C>T	c.(268-270)GCG>GTG	p.A90V	C16orf79_uc002cpi.1_Missense_Mutation_p.A90V	NM_182563	NP_872369	Q6PL45	CP079_HUMAN	hypothetical protein LOC283870	90						integral to membrane				central_nervous_system(1)	1						GATGGTCGCCGCGTTCCGGGC	0.677			NA											3	7					0	0	0.004672	0	0
PKMYT1	9088	broad.mit.edu	37	16	3025598	3025598	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:3025598A>G	uc002csn.2	-	4	1037	c.594T>C	c.(592-594)TGT>TGC	p.C198C	PKMYT1_uc010uwn.1_RNA|PKMYT1_uc002csm.2_Silent_p.C198C|PKMYT1_uc002cso.2_Silent_p.C129C|PKMYT1_uc002csp.2_Silent_p.C189C|PKMYT1_uc002csq.2_Silent_p.C189C|PKMYT1_uc010bsy.1_Silent_p.C189C	NM_004203	NP_004194	Q99640	PMYT1_HUMAN	protein kinase Myt1 isoform 1	198	Protein kinase.				G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis	endoplasmic reticulum membrane|Golgi membrane|membrane fraction|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)	1						CCCAGGCCTCACAGTGTTGCT	0.706			NA											6	14					0	0	0.001168	0	0
ZNF75A	7627	broad.mit.edu	37	16	3363159	3363159	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:3363159G>A	uc002cut.3	+	4	610	c.84G>A	c.(82-84)GAG>GAA	p.E28E	ZNF75A_uc002cuv.3_Intron	NM_153028	NP_694573	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	28	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						AAAACTATGAGACTGTCATCT	0.428			NA											13	36					0	0	0.00245	0	0
CREBBP	1387	broad.mit.edu	37	16	3777990	3777990	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:3777990C>A	uc002cvv.2	-	31	7262	c.7058G>T	c.(7057-7059)CGG>CTG	p.R2353L	CREBBP_uc002cvw.2_Missense_Mutation_p.R2315L	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	2353					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGACTGGGGCCGTGGAGACTG	0.657			NA	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybsyndrome				27	67					1.55811e-20	2.00859e-20	0.008361	1	0
PPL	5493	broad.mit.edu	37	16	4941903	4941903	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:4941903T>C	uc002cyd.1	-	16	1967	c.1877A>G	c.(1876-1878)GAG>GGG	p.E626G		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	626	Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GGCCAGCAACTCCCAGCTCTG	0.627			NA											10	124					0	0	0.008291	0	0
ABCC1	4363	broad.mit.edu	37	16	16215926	16215926	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:16215926T>C	uc010bvi.2	+	24	3660	c.3485T>C	c.(3484-3486)GTC>GCC	p.V1162A	ABCC1_uc010bvj.2_Missense_Mutation_p.V1103A|ABCC1_uc010bvk.2_Missense_Mutation_p.V1106A|ABCC1_uc010bvl.2_Missense_Mutation_p.V1162A|ABCC1_uc010bvm.2_Missense_Mutation_p.V1047A|ABCC1_uc002del.3_Missense_Mutation_p.V1056A	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1162	Cytoplasmic.|ABC transmembrane type-1 2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TTGCTGGGGGTCAGCGTCATT	0.612			NA											13	42					0	0	0.001368	0	0
XYLT1	64131	broad.mit.edu	37	16	17353197	17353197	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:17353197A>G	uc002dfa.2	-	3	646	c.561T>C	c.(559-561)AGT>AGC	p.S187S		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	187	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						CCTTCTGTCTACTCGGTGGCT	0.537			NA											31	93					0	0	0.002096	0	0
GPR139	124274	broad.mit.edu	37	16	20043764	20043764	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:20043764T>C	uc002dgu.1	-	2	517	c.355A>G	c.(355-357)ACT>GCT	p.T119A	GPR139_uc010vaw.1_Missense_Mutation_p.T26A	NM_001002911	NP_001002911	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	119	Helical; Name=3; (Potential).					integral to membrane|plasma membrane				ovary(2)	2						AACGGTACAGTAATCCATATG	0.493			NA											7	87					0	0	0.001984	0	0
PDILT	204474	broad.mit.edu	37	16	20386170	20386170	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:20386170G>C	uc002dhc.1	-	5	878	c.655C>G	c.(655-657)CTT>GTT	p.L219V		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	219					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						ACGCTGTCAAGGGTGACGTGG	0.383			NA											21	82					0	0	0.002299	0	0
ACSM5	54988	broad.mit.edu	37	16	20442632	20442632	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:20442632A>G	uc002dhe.2	+	10	1444	c.1297A>G	c.(1297-1299)AAT>GAT	p.N433D		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	433					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						CTGTTTCTTCAATTGCTATTT	0.383			NA											17	65					0	0	0.008871	0	0
RRN3P1	730092	broad.mit.edu	37	16	21817457	21817457	+	Silent	SNP	G	G	A	rs150520281	by1000genomes	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:21817457G>A	uc010vbl.1	-	7	603	c.106C>T	c.(106-108)CTG>TTG	p.L36L	uc002diq.3_Intron	NR_003370				SubName: Full=Putative uncharacterized protein ENSP00000219758;												0						CTTACATCCAGCTTGAGTAGT	0.254			NA											5	15					0	0	0.000602	0	0
EEF2K	29904	broad.mit.edu	37	16	22277709	22277709	+	Splice_Site	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:22277709A>C	uc002dki.2	+	14	1926	c.1441_splice	c.e14-2	p.V481_splice	EEF2K_uc002dkh.2_Splice_Site	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase						insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)		CTTTCCCTTCAGGTATGTGTA	0.612	NSCLC(195;1411 2157 20319 27471 51856)		NA											15	171					0	0	0.004007	0	0
USP31	57478	broad.mit.edu	37	16	23096295	23096295	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:23096295A>G	uc002dll.2	-	11	1716	c.1716T>C	c.(1714-1716)ACT>ACC	p.T572T	USP31_uc010bxm.2_5'UTR	NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	572					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		ACTCATCCTCAGTATTTACAA	0.408			NA											43	190					0	0	0.00361	0	0
PLK1	5347	broad.mit.edu	37	16	23693478	23693479	+	Splice_Site	DNP	GG	GG	TT			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:23693478_23693479GG>TT	uc002dlz.1	+	4	869	c.816_splice	c.e4+1	p.K272_splice		NM_005030	NP_005021	P53350	PLK1_HUMAN	polo-like kinase 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G2/M transition DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic prophase|negative regulation of cyclin-dependent protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|protein localization to chromatin|protein ubiquitination|regulation of mitotic anaphase|regulation of protein binding	centrosome|condensed nuclear chromosome outer kinetochore|cytosol|nucleoplasm|spindle microtubule|spindle midzone|spindle pole	anaphase-promoting complex binding|ATP binding|polo kinase kinase activity|protein kinase binding			lung(1)|skin(1)	2				GBM - Glioblastoma multiforme(48;0.0156)		GTATTCCCAAGGTGACTAATGA	0.411	Colon(12;240 564 27038 33155)		NA											10	56					0	0	0.004672	0	0
SETD1A	9739	broad.mit.edu	37	16	30976134	30976134	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:30976134T>C	uc002ead.1	+	7	1757	c.1071T>C	c.(1069-1071)TCT>TCC	p.S357S		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	357	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						cctcgtcctcTCAGTTTCGTA	0.393			NA											54	151					0	0	0.00361	0	0
PYCARD	29108	broad.mit.edu	37	16	31213972	31213972	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:31213972T>C	uc010cak.2	-	1	280	c.40A>G	c.(40-42)AAC>GAC	p.N14D	PYCARD_uc002ebm.2_Missense_Mutation_p.N14D	NM_013258	NP_037390	Q9ULZ3	ASC_HUMAN	PYD and CARD domain containing isoform a	14	DAPIN.				induction of apoptosis|positive regulation of interleukin-1 beta secretion|positive regulation of NF-kappaB transcription factor activity|proteolysis|tumor necrosis factor-mediated signaling pathway	IkappaB kinase complex	caspase activator activity|cysteine-type endopeptidase activity|protein homodimerization activity|Pyrin domain binding				0						GCGGTCAGGTTCTCCAGCGCA	0.716			NA											14	50					0	0	0.003163	0	0
TOX3	27324	broad.mit.edu	37	16	52484375	52484375	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:52484375C>T	uc002egw.2	-	4	663	c.492G>A	c.(490-492)GCG>GCA	p.A164A	TOX3_uc010vgt.1_Silent_p.A159A|TOX3_uc010vgu.1_Silent_p.A164A	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	164					apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						CCCCAGAACGCGCAGCATCGG	0.582			NA											31	118					0	0	0.002445	0	0
MMP2	4313	broad.mit.edu	37	16	55532222	55532222	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:55532222C>A	uc002ehz.3	+	11	1942	c.1631C>A	c.(1630-1632)TCA>TAA	p.S544*	MMP2_uc010vhd.1_Nonsense_Mutation_p.S468*|MMP2_uc010ccc.2_Nonsense_Mutation_p.S494*|MMP2_uc002eia.3_Nonsense_Mutation_p.S41*	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a	544	Required for inhibitor TIMP2 binding.|Hemopexin-like 2.				angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	TGGATCTACTCAGCCAGCACC	0.587			NA											17	40					9.16793e-09	1.06787e-08	0.00499	1	0
SLC6A2	6530	broad.mit.edu	37	16	55690629	55690629	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:55690629C>T	uc002eif.2	+	2	134	c.23C>T	c.(22-24)CCG>CTG	p.P8L	SLC6A2_uc010ccd.2_Missense_Mutation_p.P8L|SLC6A2_uc002eig.2_Missense_Mutation_p.P8L|SLC6A2_uc002eih.2_Missense_Mutation_p.P8L	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2	8	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CGGATGAACCCGCAGGTGCAG	0.652			NA											13	34					0	0	0.003163	0	0
CDH11	1009	broad.mit.edu	37	16	65022183	65022183	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:65022183A>G	uc002eoi.2	-	7	1310	c.876T>C	c.(874-876)GCT>GCC	p.A292A	CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Silent_p.A292A|CDH11_uc010vin.1_Silent_p.A166A	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	292	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CTGGATCTTTAGCTTTCACTC	0.408			NA	T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			25	87					0	0	0.004656	0	0
AP1G1	164	broad.mit.edu	37	16	71772945	71772945	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:71772945C>A	uc010cgg.2	-	21	2482	c.2168G>T	c.(2167-2169)CGG>CTG	p.R723L	AP1G1_uc002fba.2_Missense_Mutation_p.R726L|AP1G1_uc002fbb.2_Missense_Mutation_p.R746L|AP1G1_uc002faz.2_Missense_Mutation_p.R140L	NM_001128	NP_001119	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1	723	GAE.				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)				GGTATTTGACCGTTCAAAGGT	0.443			NA											40	100					6.5261e-18	8.29262e-18	0.00874	1	0
AP1G1	164	broad.mit.edu	37	16	71807199	71807199	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:71807199G>A	uc010cgg.2	-	4	707	c.393C>T	c.(391-393)TCC>TCT	p.S131S	AP1G1_uc002fba.2_Silent_p.S131S|AP1G1_uc002fbb.2_Silent_p.S154S|AP1G1_uc010vmg.1_RNA|AP1G1_uc010vmh.1_Silent_p.S213S	NM_001128	NP_001119	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1	131					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)				ACATCTCTGAGGAGCCCATGC	0.438			NA											14	52					0	0	0.003163	0	0
ZFHX3	463	broad.mit.edu	37	16	72993377	72993377	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:72993377C>A	uc002fck.2	-	2	1341	c.668G>T	c.(667-669)GGG>GTG	p.G223V	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	223					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GGGGCTGAGCCCCGCCAGGGC	0.562			NA											27	81					2.79863e-10	3.34117e-10	0.004656	1	0
MON1B	22879	broad.mit.edu	37	16	77229460	77229460	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:77229460G>A	uc002fez.2	+	5	1654	c.1324G>A	c.(1324-1326)GAG>AAG	p.E442K	MON1B_uc010vnf.1_Missense_Mutation_p.E333K|MON1B_uc010vng.1_Missense_Mutation_p.E296K|MON1B_uc002ffa.2_Missense_Mutation_p.E322K	NM_014940	NP_055755	Q7L1V2	MON1B_HUMAN	MON1 homolog B	442							protein binding				0						CTACAGCAGAGAGGAGGAGCG	0.632			NA											15	29					0	0	0.004007	0	0
TAF1C	9013	broad.mit.edu	37	16	84213680	84213680	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:84213680G>A	uc002fhn.2	-	13	1799	c.1571C>T	c.(1570-1572)GCG>GTG	p.A524V	TAF1C_uc002fhm.2_Missense_Mutation_p.A430V|TAF1C_uc010vnx.1_Missense_Mutation_p.A498V|TAF1C_uc010vny.1_Missense_Mutation_p.A115V|TAF1C_uc010vnz.1_Missense_Mutation_p.A192V|TAF1C_uc002fho.2_Missense_Mutation_p.A47V|TAF1C_uc010voa.1_Missense_Mutation_p.A192V|TAF1C_uc002fhp.1_Intron	NM_005679	NP_005670	Q15572	TAF1C_HUMAN	TBP-associated factor 1C isoform 1	524					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding			ovary(1)	1						GGGCACCGACGCCCCTTCTCC	0.687			NA											10	19					0	0	0.00245	0	0
ANKRD11	29123	broad.mit.edu	37	16	89345689	89345689	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:89345689C>T	uc002fmx.1	-	9	7722	c.7261G>A	c.(7261-7263)GCC>ACC	p.A2421T	ANKRD11_uc002fmy.1_Missense_Mutation_p.A2421T|ANKRD11_uc002fnc.1_Missense_Mutation_p.A2421T|ANKRD11_uc002fna.1_Missense_Mutation_p.A86T|ANKRD11_uc002fnb.1_Missense_Mutation_p.A2378T	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2421						nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGCTTGATGGCGTCCACGATG	0.612			NA											7	17					0	0	0.00308	0	0
SPG7	6687	broad.mit.edu	37	16	89598357	89598357	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:89598357G>A	uc002fnj.2	+	8	1054	c.1033G>A	c.(1033-1035)GCA>ACA	p.A345T	SPG7_uc002fni.2_Missense_Mutation_p.A345T	NM_003119	NP_003110	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 isoform 1	345	Mitochondrial matrix (Potential).				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		CCCAAAGGGCGCACTGCTGCT	0.627			NA											6	57					0	0	0.001168	0	0
SPG7	6687	broad.mit.edu	37	16	89614444	89614444	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:89614444C>T	uc002fnj.2	+	12	1607	c.1586C>T	c.(1585-1587)GCG>GTG	p.A529V	SPG7_uc002fnk.1_RNA|SPG7_uc002fnl.2_5'Flank	NM_003119	NP_003110	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 isoform 1	529	Mitochondrial matrix (Potential).				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		AATGAGGCTGCGCTGCACGCG	0.632			NA											26	106					0	0	0.008361	0	0
CPNE7	27132	broad.mit.edu	37	16	89661895	89661895	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:89661895G>A	uc002fnp.2	+	16	1778	c.1648G>A	c.(1648-1650)GCC>ACC	p.A550T	CPNE7_uc002fnq.2_Missense_Mutation_p.A475T	NM_014427	NP_055242	Q9UBL6	CPNE7_HUMAN	copine 7 isoform b	550	VWFA.				lipid metabolic process		transporter activity				0		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		CGTGGGCAACGCCGACTTCAC	0.677			NA											14	25					0	0	0.001855	0	0
FAM57A	79850	broad.mit.edu	37	17	641168	641168	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:641168T>A	uc002frp.2	+	3	330	c.289T>A	c.(289-291)TGC>AGC	p.C97S	FAM57A_uc002frq.2_Missense_Mutation_p.C97S|FAM57A_uc002frr.2_Missense_Mutation_p.C7S	NM_024792	NP_079068	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	97	TLC.|Helical; (Potential).					integral to membrane|plasma membrane					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		CTGTGAATGGTGCCGAACCAG	0.493			NA											18	99					0	0	0.008871	0	0
KIAA0664	23277	broad.mit.edu	37	17	2601632	2601632	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:2601632T>C	uc002fuy.1	-	10	1491	c.1405A>G	c.(1405-1407)ACG>GCG	p.T469A	KIAA0664_uc002fux.1_Missense_Mutation_p.T401A	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	469							binding			breast(2)	2						GTGCCCAGCGTGTACAGCCCC	0.667			NA											5	18					0	0	0.000602	0	0
OR1A2	26189	broad.mit.edu	37	17	3100858	3100858	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:3100858G>T	uc002fvd.1	+	1	46	c.46G>T	c.(46-48)GGA>TGA	p.G16*		NM_012352	NP_036484	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TATTCTCCTGGGAGTTACTAG	0.398			NA											19	37					0.00074312	0.000785422	0.006122	1	0
WSCD1	23302	broad.mit.edu	37	17	5984019	5984019	+	Missense_Mutation	SNP	G	G	A	rs148296936		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:5984019G>A	uc010cli.2	+	2	420	c.41G>A	c.(40-42)CGA>CAA	p.R14Q	WSCD1_uc002gcn.2_Missense_Mutation_p.R14Q|WSCD1_uc002gco.2_Missense_Mutation_p.R14Q|WSCD1_uc010clj.2_5'UTR	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN	WSC domain containing 1	14						integral to membrane	sulfotransferase activity				0						TTTCTCCGCCGAACACAGTTC	0.672			NA											4	38					0	0	0.009096	0	0
NLGN2	57555	broad.mit.edu	37	17	7320373	7320373	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:7320373G>A	uc002ggt.1	+	7	1836	c.1763G>A	c.(1762-1764)CGC>CAC	p.R588H		NM_020795	NP_065846	Q8NFZ4	NLGN2_HUMAN	neuroligin 2 precursor	588	Extracellular (Potential).				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity			central_nervous_system(1)	1		Prostate(122;0.157)				CTGAAGCCACGCGTGCGTGAC	0.587			NA											4	27					0	0	0.009096	0	0
FXR2	9513	broad.mit.edu	37	17	7496106	7496106	+	Silent	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:7496106G>C	uc002gia.1	-	14	1862	c.1635C>G	c.(1633-1635)CGC>CGG	p.R545R	MPDU1_uc010vuc.1_3'UTR|SOX15_uc002ghy.1_5'Flank|SOX15_uc002ghz.1_5'Flank	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related	545	Poly-Arg.					cytosolic large ribosomal subunit	protein binding|RNA binding				0				READ - Rectum adenocarcinoma(115;0.17)		GGGAGCGGCGGCGCCTGGCAC	0.617			NA											4	33					0	0	0.009096	0	0
TP53	7157	broad.mit.edu	37	17	7578236	7578236	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:7578236A>G	uc002gim.2	-	6	807	c.613T>C	c.(613-615)TAT>CAT	p.Y205H	TP53_uc002gig.1_Missense_Mutation_p.Y205H|TP53_uc002gih.2_Missense_Mutation_p.Y205H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y73H|TP53_uc010cng.1_Missense_Mutation_p.Y73H|TP53_uc002gii.1_Missense_Mutation_p.Y73H|TP53_uc010cnh.1_Missense_Mutation_p.Y205H|TP53_uc010cni.1_Missense_Mutation_p.Y205H|TP53_uc002gij.2_Missense_Mutation_p.Y205H|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y112H|TP53_uc002gio.2_Missense_Mutation_p.Y73H|TP53_uc010vug.1_Missense_Mutation_p.Y166H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	205	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> C (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y205C(53)|p.Y205D(13)|p.Y205S(11)|p.Y205F(8)|p.0?(7)|p.Y205H(5)|p.Y205*(4)|p.Y205N(2)|p.K164_P219del(1)|p.Y205fs*43(1)|p.Y205fs*42(1)|p.E204fs*39(1)|p.G199fs*42(1)|p.E204_N210delEYLDDRN(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCATCCAAATACTCCACACGC	0.542	Pancreas(47;798 1329 9957 10801)		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			24	20					0	0	0.00632	0	0
WRAP53	55135	broad.mit.edu	37	17	7606341	7606341	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:7606341G>T	uc010vuh.1	+	10	1454	c.1299G>T	c.(1297-1299)ACG>ACT	p.T433T	WRAP53_uc010vui.1_Silent_p.T433T|WRAP53_uc002gip.2_Silent_p.T433T|WRAP53_uc002gir.2_Silent_p.T433T|WRAP53_uc002giq.2_RNA|WRAP53_uc010cnl.2_Silent_p.T400T|EFNB3_uc002gis.2_5'Flank	NM_001143990	NP_001137462	Q9BUR4	WAP53_HUMAN	WD repeat domain 79 isoform 2	433	WD 6.				positive regulation of telomerase activity|telomere formation via telomerase	Cajal body|cytoplasm|telomerase holoenzyme complex	protein binding|RNA binding				0						GTGGCAGCACGAGCGGGGCTG	0.637			NA											10	32					0.000673444	0.000712385	0.008291	1	0
MYH8	4626	broad.mit.edu	37	17	10318842	10318842	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:10318842C>A	uc002gmm.2	-	7	690	c.595G>T	c.(595-597)GCA>TCA	p.A199S	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	199	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GCAATTGTTGCAAAGTATTGG	0.463			NA							Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				50	49					6.30371e-39	8.25454e-39	0.00361	1	0
TEKT3	64518	broad.mit.edu	37	17	15212074	15212074	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:15212074T>A	uc002gon.2	-	8	1350	c.1163A>T	c.(1162-1164)GAC>GTC	p.D388V		NM_031898	NP_114104	Q9BXF9	TEKT3_HUMAN	tektin 3	388					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		GGCAGTCTTGTCCTTGATGGC	0.517			NA											39	58					0	0	0.005524	0	0
TRIM16	10626	broad.mit.edu	37	17	15532258	15532258	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:15532258G>A	uc002gox.2	-	9	1923	c.1366C>T	c.(1366-1368)CGC>TGC	p.R456C	TRIM16_uc002gor.1_Intron|TRIM16_uc002gow.2_Missense_Mutation_p.R240C|TRIM16_uc002goy.2_Missense_Mutation_p.R326C	NM_006470	NP_006461	O95361	TRI16_HUMAN	tripartite motif-containing 16	456	B30.2/SPRY.				histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		CAACTGTTGCGCTCCTCCCCT	0.552			NA											19	74					0	0	0.007413	0	0
NCOR1	9611	broad.mit.edu	37	17	15942809	15942809	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:15942809T>C	uc002gpo.2	-	44	7133	c.6893A>G	c.(6892-6894)AAC>AGC	p.N2298S	NCOR1_uc002gpn.2_Missense_Mutation_p.N2195S|NCOR1_uc002gpl.2_Missense_Mutation_p.N313S|NCOR1_uc002gpm.2_Missense_Mutation_p.N818S|NCOR1_uc010vwb.1_Missense_Mutation_p.N882S|NCOR1_uc010coy.2_Missense_Mutation_p.N1206S	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	2298	Interaction with C1D (By similarity).				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AACTGAGGTGTTGGCAGTACC	0.488			NA											7	44					0	0	0.00308	0	0
TAOK1	57551	broad.mit.edu	37	17	27849414	27849414	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:27849414T>C	uc002hdz.1	+	17	2219	c.2025T>C	c.(2023-2025)TGT>TGC	p.C675C	TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Silent_p.C675C	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	675					mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			AGATGCGCTGTGAGTTGATCA	0.448			NA											16	82					0	0	0.00499	0	0
SLFN13	146857	broad.mit.edu	37	17	33772338	33772338	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:33772338C>T	uc002hjk.1	-	1	692	c.362G>A	c.(361-363)GGT>GAT	p.G121D	SLFN13_uc010wch.1_Missense_Mutation_p.G121D|SLFN13_uc002hjl.2_Missense_Mutation_p.G121D|SLFN13_uc010ctt.2_Intron|SLFN13_uc002hjm.2_Intron	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	121						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		ATTGAAAGAACCATCTTTAAG	0.393			NA											26	37					0	0	0.003954	0	0
TBC1D3B	414059	broad.mit.edu	37	17	34499264	34499264	+	Silent	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:34499264T>G	uc002hky.2	-	7	597	c.447A>C	c.(445-447)ATA>ATC	p.I149I	uc002hla.1_5'Flank|uc002hlc.2_5'Flank	NM_001001417	NP_001001417	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3B	149	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATGTCCCGCTTATGTCCCGGT	0.547			NA											35	408					0	0	0.00361	0	0
SYNRG	11276	broad.mit.edu	37	17	35928998	35928998	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:35928998T>C	uc002hoa.2	-	11	1459	c.1376A>G	c.(1375-1377)CAG>CGG	p.Q459R	SYNRG_uc010wde.1_Missense_Mutation_p.Q381R|SYNRG_uc010wdf.1_Missense_Mutation_p.Q381R|SYNRG_uc002hoc.2_Missense_Mutation_p.Q380R|SYNRG_uc002hoe.2_Missense_Mutation_p.Q381R|SYNRG_uc002hod.2_Missense_Mutation_p.Q381R|SYNRG_uc010wdg.1_Missense_Mutation_p.Q298R|SYNRG_uc002hob.2_Missense_Mutation_p.Q459R|SYNRG_uc002hof.2_Missense_Mutation_p.Q171R|SYNRG_uc010cvd.1_Missense_Mutation_p.Q259R|SYNRG_uc002hog.1_Missense_Mutation_p.Q593R	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	459	DFXDF motif 1.				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						TTGAAAATCCTGGAAGTCATC	0.363			NA											17	78					0	0	0.007413	0	0
GPR179	440435	broad.mit.edu	37	17	36495347	36495347	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:36495347G>T	uc002hpz.2	-	2	877	c.856C>A	c.(856-858)CCA>ACA	p.P286T		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	286	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TACCAGCCTGGGCCACTTGCA	0.552			NA											24	57					7.92952e-12	9.65198e-12	0.003954	1	0
LASP1	3927	broad.mit.edu	37	17	37074986	37074986	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:37074986C>T	uc002hra.2	+	7	1072	c.741C>T	c.(739-741)ACC>ACT	p.T247T	LASP1_uc010cvq.2_Missense_Mutation_p.P125L|LASP1_uc010wdz.1_Silent_p.T191T	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	247	SH3.					cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1						TGGAGCGCACCGGCGACACGG	0.662			NA	T	MLL	AML								24	86					0	0	0.00333	0	0
PNMT	5409	broad.mit.edu	37	17	37826287	37826287	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:37826287T>C	uc002hsi.1	+	3	716	c.494T>C	c.(493-495)CTG>CCG	p.L165P		NM_002686	NP_002677	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	165					catecholamine biosynthetic process|hormone biosynthetic process	cytosol	phenylethanolamine N-methyltransferase activity			ovary(1)	1	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCCCAGCCCCTGGGTGCTGGG	0.662			NA											5	64					0	0	0.000602	0	0
TNS4	84951	broad.mit.edu	37	17	38633940	38633940	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:38633940T>C	uc010cxb.2	-	13	2212	c.2048A>G	c.(2047-2049)GAG>GGG	p.E683G	TNS4_uc002huu.3_Missense_Mutation_p.E96G	NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor	683	Phosphatase tensin-type.				apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GCATACGTTCTCCTGAGGCTC	0.607			NA											5	83					0	0	0.001168	0	0
KRT38	8687	broad.mit.edu	37	17	39596688	39596688	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:39596688T>A	uc002hwq.1	-	1	909	c.486A>T	c.(484-486)CAA>CAT	p.Q162H		NM_006771	NP_006762	O76015	KRT38_HUMAN	keratin 38	162	Rod.|Coil 1B.					intermediate filament	structural molecule activity			skin(2)	2		Breast(137;0.000496)				TCACCTTCTGTTGGAGCTCCT	0.567			NA											15	91					0	0	0.003163	0	0
HAP1	9001	broad.mit.edu	37	17	39884470	39884470	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:39884470G>T	uc002hxm.1	-	7	1195	c.1183C>A	c.(1183-1185)CAG>AAG	p.Q395K	JUP_uc010wfs.1_Intron|HAP1_uc002hxn.1_Missense_Mutation_p.Q395K|HAP1_uc002hxo.1_Missense_Mutation_p.Q403K|HAP1_uc002hxp.1_Missense_Mutation_p.Q395K	NM_177977	NP_817084	P54257	HAP1_HUMAN	huntingtin-associated protein 1 isoform 2	395	Glu-rich.|HAP1 N-terminal.				brain development|protein localization|synaptic transmission	actin cytoskeleton	protein binding			ovary(2)	2		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CAGCGCTGCTGCAGCTTCAGC	0.632			NA											10	68					2.17888e-05	2.36934e-05	0.006214	1	0
DNAJC7	7266	broad.mit.edu	37	17	40135644	40135644	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:40135644T>G	uc002hyo.2	-	10	1258	c.1021A>C	c.(1021-1023)ACA>CCA	p.T341P	DNAJC7_uc010cxu.2_Missense_Mutation_p.T285P|DNAJC7_uc010cxv.2_Intron|DNAJC7_uc010wgb.1_Missense_Mutation_p.T285P|DNAJC7_uc010wgc.1_Missense_Mutation_p.T199P|DNAJC7_uc002hyp.2_Missense_Mutation_p.T285P	NM_003315	NP_003306	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	341	TPR 9.				chaperone cofactor-dependent protein refolding	cytoplasm|cytoskeleton|nucleus	heat shock protein binding|unfolded protein binding			ovary(1)	1		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				TACTGTTCTGTGTCCATGTAA	0.393	Colon(63;618 1117 8600 10857 19751)		NA											6	14					0	0	0.001168	0	0
VPS25	84313	broad.mit.edu	37	17	40925499	40925499	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:40925499G>A	uc002ibi.2	+	1	46	c.6G>A	c.(4-6)GCG>GCA	p.A2A		NM_032353	NP_115729	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25	2					cellular membrane organization|endosome transport|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endosome membrane|nucleoplasm					0		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		CTACGATGGCGATGAGTTTCG	0.617			NA											13	138					0	0	0.00245	0	0
DBF4B	80174	broad.mit.edu	37	17	42807349	42807349	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:42807349G>T	uc002ihf.2	+	4	515	c.302G>T	c.(301-303)GGG>GTG	p.G101V	DBF4B_uc002ihd.1_Missense_Mutation_p.G101V|DBF4B_uc010wjb.1_RNA|DBF4B_uc002ihe.2_5'UTR|DBF4B_uc010wjc.1_Missense_Mutation_p.G85V|DBF4B_uc002ihg.2_Missense_Mutation_p.G85V	NM_145663	NP_663696	Q8NFT6	DBF4B_HUMAN	DBF4 homolog B isoform 1	101	BRCT.				cell cycle	nucleus	nucleic acid binding|zinc ion binding				0		Prostate(33;0.0322)				GAGAGCAGTGGGAAAAGCCAT	0.537			NA											5	83					5.9392e-07	6.67422e-07	0.001168	1	0
MAP3K14	9020	broad.mit.edu	37	17	43343939	43343939	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:43343939C>A	uc002iiw.1	-	15	2652	c.2543G>T	c.(2542-2544)CGG>CTG	p.R848L	LOC100133991_uc010dah.2_Intron|LOC100133991_uc002iit.3_Intron|LOC100133991_uc010dai.2_Intron|MAP3K14_uc002iiu.1_Missense_Mutation_p.R378L|MAP3K14_uc010daj.1_RNA|MAP3K14_uc002iiv.1_Missense_Mutation_p.R432L	NM_003954	NP_003945	Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase	848					cellular response to mechanical stimulus|I-kappaB kinase/NF-kappaB cascade|immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade|T cell costimulation	cytosol	ATP binding|MAP kinase kinase kinase activity|NF-kappaB-inducing kinase activity|protein binding			central_nervous_system(3)|breast(2)|lung(1)|ovary(1)|stomach(1)	8						GGGCCGCCCCCGGGCCAGCAC	0.632			NA											17	124					5.3912e-06	5.9351e-06	0.006122	1	0
HSF5	124535	broad.mit.edu	37	17	56536135	56536135	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:56536135A>G	uc002iwi.1	-	5	1838	c.1714T>C	c.(1714-1716)TCC>CCC	p.S572P		NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	572						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTACCAGGGGACTTTCCTTGT	0.423			NA											9	63					0	0	0.004482	0	0
CLTC	1213	broad.mit.edu	37	17	57721770	57721770	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:57721770G>A	uc002ixq.1	+	2	619	c.176G>A	c.(175-177)AGT>AAT	p.S59N	CLTC_uc002ixp.2_Missense_Mutation_p.S59N|CLTC_uc002ixr.1_Missense_Mutation_p.S59N	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	59	Globular terminal domain.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					AATGACCCAAGTAATCCAATT	0.418			NA	T	ALK|TFE3	ALCL|renal 								13	53					0	0	0.001855	0	0
CLTC	1213	broad.mit.edu	37	17	57725762	57725762	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:57725762G>T	uc002ixq.1	+	4	1124	c.681G>T	c.(679-681)AAG>AAT	p.K227N	CLTC_uc002ixp.2_Missense_Mutation_p.K227N|CLTC_uc002ixr.1_Missense_Mutation_p.K231N	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	227	Globular terminal domain.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CTGGAGGGAAGGTAAGTTTTG	0.383			NA	T	ALK|TFE3	ALCL|renal 								23	114					2.98393e-07	3.39306e-07	0.00278	1	0
DHX40P1	653645	broad.mit.edu	37	17	58066671	58066671	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:58066671T>A	uc002iyf.2	-	9	701	c.466A>T	c.(466-468)ATT>TTT	p.I156F	uc002iye.1_Intron	NR_002924				Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 40 pseudogene, mRNA (cDNA clone IMAGE:5170263).												0						GCTTCTAAAATAAGTCTCTCA	0.318			NA											2	6					0	0	0.004672	0	0
USP32	84669	broad.mit.edu	37	17	58343443	58343443	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:58343443T>A	uc002iyo.1	-	8	1107	c.821A>T	c.(820-822)AAG>ATG	p.K274M	USP32_uc010wov.1_Missense_Mutation_p.K274M	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	274	EF-hand 3.				protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			ATCAAATACCTTGAAGCAAAC	0.368			NA											20	95					0	0	0.010504	0	0
TBX4	9496	broad.mit.edu	37	17	59560342	59560342	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:59560342G>A	uc002izi.2	+	8	1148	c.1103G>A	c.(1102-1104)CGT>CAT	p.R368H	TBX4_uc010ddo.2_Missense_Mutation_p.R369H|TBX4_uc010woy.1_Missense_Mutation_p.R369H	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4	368					leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						CACTATTTCCGTTCCCCCCCT	0.562			NA											20	30					0	0	0.010504	0	0
TANC2	26115	broad.mit.edu	37	17	61492920	61492920	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:61492920A>G	uc002jal.3	+	23	3823	c.3800A>G	c.(3799-3801)TAC>TGC	p.Y1267C	TANC2_uc010wpe.1_Missense_Mutation_p.Y1177C|TANC2_uc002jao.3_Missense_Mutation_p.Y378C	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1267	TPR 1.						binding			ovary(2)	2						GCCCAGCGCTACCAGTACGCC	0.512			NA											3	31					0	0	0.009096	0	0
STRADA	92335	broad.mit.edu	37	17	61787867	61787867	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:61787867T>C	uc002jbm.2	-	8	724	c.565A>G	c.(565-567)ATG>GTG	p.M189V	STRADA_uc002jbn.2_Missense_Mutation_p.M131V|STRADA_uc002jbo.2_Missense_Mutation_p.M152V|STRADA_uc002jbp.2_Missense_Mutation_p.M152V|STRADA_uc002jbq.2_Missense_Mutation_p.M131V|STRADA_uc010wpq.1_Missense_Mutation_p.M145V|STRADA_uc010wpr.1_Missense_Mutation_p.M160V|STRADA_uc010ddw.2_Missense_Mutation_p.M160V|STRADA_uc002jbr.2_Missense_Mutation_p.M131V	NM_001003787	NP_001003787	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha isoform 1	189	Protein kinase.				activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|kinase binding|protein kinase activity			ovary(1)	1						ACATATCCCATGTGGTGGATG	0.498			NA											5	85					0	0	0.001168	0	0
GH1	2688	broad.mit.edu	37	17	61995822	61995822	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:61995822G>A	uc002jdj.2	-	2	117	c.55C>T	c.(55-57)CCC>TCC	p.P19S	GH1_uc002jdi.2_Missense_Mutation_p.P19S|GH1_uc002jdk.2_Missense_Mutation_p.P19S|GH1_uc002jdl.2_Missense_Mutation_p.P19S|GH1_uc002jdm.2_Intron|GH1_uc002jdn.2_Missense_Mutation_p.P19S	NM_000515	NP_000506	P01241	SOMA_HUMAN	growth hormone 1 isoform 1	19					glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding				0						TGAAGCCAGGGCAGGCAGAGC	0.612			NA											28	126					0	0	0.00632	0	0
SMURF2	64750	broad.mit.edu	37	17	62574681	62574681	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:62574681C>T	uc002jep.1	-	9	1174	c.786G>A	c.(784-786)ACG>ACA	p.T262T	SMURF2_uc002jeq.1_Silent_p.T21T|SMURF2_uc002jer.1_Silent_p.T21T	NM_022739	NP_073576	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	262	WW 2.			Missing: Abolishes interaction with SMAD2 and SMAD7.	BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity			skin(3)|lung(1)	4	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			GGCCTTGTTGCGTTGTCCTCT	0.373			NA											7	41					0	0	0.00308	0	0
RGS9	8787	broad.mit.edu	37	17	63221362	63221362	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:63221362G>A	uc002jfe.2	+	18	1760	c.1650G>A	c.(1648-1650)GGG>GGA	p.G550G	RGS9_uc010dem.2_Silent_p.G547G|RGS9_uc002jfd.2_Silent_p.G547G|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Silent_p.G321G	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	550					intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						CCCCCCGTGGGCCCTCTGTCA	0.682			NA											19	119					0	0	0.007413	0	0
SLC16A6	9120	broad.mit.edu	37	17	66267675	66267675	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:66267675G>A	uc002jgz.1	-	5	814	c.626C>T	c.(625-627)GCG>GTG	p.A209V	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Missense_Mutation_p.A209V	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	209	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	TTTCGGTGACGCTGGTCCTCT	0.463			NA											16	89					0	0	0.00499	0	0
ABCA6	23460	broad.mit.edu	37	17	67082829	67082829	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:67082829C>A	uc002jhw.1	-	30	4042	c.3867G>T	c.(3865-3867)CAG>CAT	p.Q1289H		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	1289	ABC transporter 2.				transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					AACTTTTCTTCTGGCCTGCAT	0.353			NA											16	63					5.01169e-05	5.40255e-05	0.00499	1	0
KCNJ2	3759	broad.mit.edu	37	17	68171776	68171776	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:68171776C>T	uc010dfg.2	+	2	997	c.596C>T	c.(595-597)GCC>GTC	p.A199V	KCNJ2_uc002jir.2_Missense_Mutation_p.A199V	NM_000891	NP_000882	P63252	IRK2_HUMAN	potassium inwardly-rectifying channel J2	199	Cytoplasmic (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding				0	Breast(10;1.64e-08)					AGTCACAATGCCGTGATTGCC	0.512			NA											11	78					0	0	0.008291	0	0
CDC42EP4	23580	broad.mit.edu	37	17	71282358	71282358	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:71282358C>A	uc002jjn.2	-	2	429	c.282G>T	c.(280-282)AGG>AGT	p.R94S	CDC42EP4_uc002jjo.2_Missense_Mutation_p.R94S|CDC42EP4_uc002jjp.1_Intron	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	94					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			CCCGCTCCCCCCTGGTCACCG	0.622			NA											18	69					5.3912e-06	5.9351e-06	0.006122	1	0
SDK2	54549	broad.mit.edu	37	17	71386573	71386573	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:71386573T>C	uc010dfm.2	-	29	4045	c.4045A>G	c.(4045-4047)ACT>GCT	p.T1349A	SDK2_uc002jjt.3_Missense_Mutation_p.T508A|SDK2_uc010dfn.2_Missense_Mutation_p.T1028A	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	1349	Fibronectin type-III 8.|Extracellular (Potential).				cell adhesion	integral to membrane				ovary(2)	2						ACCTCCACAGTGGCGGTGTTG	0.622			NA											3	25					0	0	0.004672	0	0
KIF19	124602	broad.mit.edu	37	17	72348278	72348278	+	Splice_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:72348278T>C	uc002jkm.3	+	13	1996	c.1858_splice	c.e13+2	p.D620_splice	KIF19_uc002jkl.2_Splice_Site_p.D578_splice	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						TCATCGACGGTAGGGCCCACG	0.721			NA											4	22					0	0	0.009096	0	0
C17orf77	146723	broad.mit.edu	37	17	72588262	72588262	+	Missense_Mutation	SNP	C	C	T	rs139741461		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:72588262C>T	uc002jla.1	+	3	439	c.77C>T	c.(76-78)CCG>CTG	p.P26L	CD300LD_uc002jkz.2_Intron	NM_152460	NP_689673	Q96MU5	CQ077_HUMAN	hypothetical protein LOC146723	26						extracellular region					0						CCAAGCCAGCCGCTGTCATTC	0.527			NA											13	89					0	0	0.00245	0	0
C17orf77	146723	broad.mit.edu	37	17	72588589	72588589	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:72588589A>T	uc002jla.1	+	3	766	c.404A>T	c.(403-405)GAA>GTA	p.E135V	CD300LD_uc002jkz.2_5'Flank	NM_152460	NP_689673	Q96MU5	CQ077_HUMAN	hypothetical protein LOC146723	135						extracellular region					0						TGTGGAAAAGAAAATGTGTCC	0.483			NA											18	107					0	0	0.008871	0	0
NUP85	79902	broad.mit.edu	37	17	73228076	73228076	+	Splice_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:73228076T>C	uc002jng.1	+	14	1656	c.1396_splice	c.e14+2	p.V466_splice	NUP85_uc010dgd.1_Splice_Site_p.V421_splice|NUP85_uc010wrv.1_Splice_Site_p.V420_splice|NUP85_uc002jnh.1_Splice_Site_p.V69_splice	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CTGAACAAGGTGAGCTGGCCC	0.592			NA											4	33					0	0	0.009096	0	0
SLC25A19	60386	broad.mit.edu	37	17	73273474	73273474	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:73273474T>G	uc002jns.3	-	5	1644	c.734A>C	c.(733-735)CAG>CCG	p.Q245P	SLC25A19_uc010dge.2_Missense_Mutation_p.Q188P|SLC25A19_uc002jnv.3_Missense_Mutation_p.Q245P|SLC25A19_uc002jnu.3_Missense_Mutation_p.Q245P|SLC25A19_uc002jnw.3_Missense_Mutation_p.Q245P|SLC25A19_uc002jnt.3_Missense_Mutation_p.Q245P	NM_021734	NP_068380	Q9HC21	TPC_HUMAN	solute carrier family 25, member 19	245	Solcar 3.|Substrate recognition (By similarity).					integral to membrane|mitochondrial inner membrane	binding|deoxynucleotide transmembrane transporter activity			ovary(1)	1	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			CCCTCCAACCTGTAGCCGCTT	0.567			NA											5	63					0	0	0.001168	0	0
LGALS3BP	3959	broad.mit.edu	37	17	76972045	76972045	+	Splice_Site	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:76972045A>T	uc002jwh.2	-	3	423	c.244_splice	c.e3+1	p.G82_splice	LGALS3BP_uc002jwi.2_Intron|LGALS3BP_uc010dhr.2_Intron	NM_005567	NP_005558	Q08380	LG3BP_HUMAN	galectin 3 binding protein						cell adhesion|cellular defense response	extracellular space|membrane|proteinaceous extracellular matrix	protein binding|scavenger receptor activity			central_nervous_system(3)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AGCAGGCCCTACCTTGCCCGA	0.622	GBM(89;1105 1755 18102 21513)		NA											4	18					0	0	0.009096	0	0
AZI1	22994	broad.mit.edu	37	17	79180632	79180632	+	Missense_Mutation	SNP	G	G	A	rs146148645	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:79180632G>A	uc002jzp.1	-	5	627	c.427C>T	c.(427-429)CGG>TGG	p.R143W	AZI1_uc002jzn.1_Missense_Mutation_p.R143W|AZI1_uc002jzo.1_Missense_Mutation_p.R143W|AZI1_uc010wum.1_Missense_Mutation_p.R143W	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	143					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTGGAACTCCGGGCATTGGAT	0.632			NA											17	65					0	0	0.007413	0	0
TSPAN10	83882	broad.mit.edu	37	17	79612332	79612332	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:79612332C>T	uc010die.2	+	2	441	c.351C>T	c.(349-351)CCC>CCT	p.P117P	TSPAN10_uc002kaw.1_Silent_p.P117P|TSPAN10_uc010did.1_RNA	NM_031945	NP_114151	Q9H1Z9	TSN10_HUMAN	tetraspanin 10	117						integral to membrane				ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GGCCCCTGCCCGCAGACCCCA	0.687			NA											14	54					0	0	0.003163	0	0
CLUL1	27098	broad.mit.edu	37	18	633357	633357	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:633357G>T	uc002kkp.2	+	6	1061	c.916G>T	c.(916-918)GGG>TGG	p.G306W	CLUL1_uc010wys.1_Missense_Mutation_p.G358W|CLUL1_uc002kkq.2_Missense_Mutation_p.G306W	NM_014410	NP_055225	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal) precursor	306					cell death	extracellular region				ovary(2)	2						AGGACTGTGTGGGGAACTTGA	0.403			NA											8	33					0.00307968	0.0032006	0.00308	1	0
C18orf8	29919	broad.mit.edu	37	18	21106650	21106650	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:21106650A>G	uc010xax.1	+	14	1231	c.1110A>G	c.(1108-1110)TTA>TTG	p.L370L	C18orf8_uc002kul.2_RNA|C18orf8_uc010xay.1_5'UTR	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1	370										ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TAAATCTCTTACCAGACAAAG	0.428			NA											8	56					0	0	0.00308	0	0
CABYR	26256	broad.mit.edu	37	18	21736785	21736785	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:21736785T>C	uc002kux.2	+	4	1472	c.1320T>C	c.(1318-1320)TCT>TCC	p.S440S	CABYR_uc010xbb.1_Silent_p.S342S|CABYR_uc002kuy.2_Intron|CABYR_uc002kuz.2_Intron|CABYR_uc002kva.2_Silent_p.S422S|CABYR_uc002kvb.2_Intron|CABYR_uc002kvc.2_Intron|CABYR_uc010dlw.2_RNA	NM_012189	NP_036321	O75952	CABYR_HUMAN	calcium-binding tyrosine	440					ciliary or flagellar motility|signal transduction|sperm capacitation	cytoplasm|cytoskeleton|flagellum|motile cilium|nucleus	calcium ion binding|cAMP-dependent protein kinase regulator activity|enzyme binding|protein heterodimerization activity|SH3 domain binding				0	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					GGGAAAACTCTGTACCCCAGG	0.498			NA											12	67					0	0	0.000978	0	0
MCART2	147407	broad.mit.edu	37	18	29340530	29340530	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:29340530T>A	uc002kxa.2	-	1	314	c.95A>T	c.(94-96)AAG>ATG	p.K32M		NM_001034172	NP_001029344	Q3SY17	MCAR2_HUMAN	mitochondrial carrier triple repeat 2	32	Solcar 1.				transport	integral to membrane|mitochondrial inner membrane				skin(1)	1			OV - Ovarian serous cystadenocarcinoma(10;0.0539)			CAAGTAATGCTTCATTTCACC	0.413			NA											25	51					0	0	0.00278	0	0
KLHL14	57565	broad.mit.edu	37	18	30350097	30350097	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:30350097G>A	uc002kxm.1	-	2	846	c.458C>T	c.(457-459)ACG>ATG	p.T153M		NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	153						cytosol|endoplasmic reticulum membrane				ovary(1)	1						CTCCTCCACCGTGTCCAGGGA	0.622			NA											8	76					0	0	0.00308	0	0
ASXL3	80816	broad.mit.edu	37	18	31319230	31319230	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:31319230C>G	uc010dmg.1	+	11	1917	c.1862C>G	c.(1861-1863)GCC>GGC	p.A621G	ASXL3_uc002kxq.2_Missense_Mutation_p.A328G	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	621	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						CCAGAGGGAGCCTGTACCAGC	0.478			NA											23	15					0	0	0.003954	0	0
ASXL3	80816	broad.mit.edu	37	18	31325513	31325513	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:31325513C>A	uc010dmg.1	+	12	5756	c.5701C>A	c.(5701-5703)CTC>ATC	p.L1901I	ASXL3_uc002kxq.2_Missense_Mutation_p.L1608I	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1901					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						AAAGCGGCTGCTCCCCTCGTG	0.493			NA											17	239					9.16793e-09	1.06787e-08	0.00499	1	0
ELP2	55250	broad.mit.edu	37	18	33736468	33736468	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:33736468T>C	uc002kzk.1	+	13	1325	c.1315T>C	c.(1315-1317)TAT>CAT	p.Y439H	ELP2_uc010xcg.1_Missense_Mutation_p.Y504H|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Missense_Mutation_p.Y413H|ELP2_uc010xch.1_Missense_Mutation_p.Y434H|ELP2_uc002kzn.1_Missense_Mutation_p.Y369H|ELP2_uc002kzo.1_Missense_Mutation_p.Y369H	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	439	WD 9.				regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						GATACATGGGTATGACCTGAA	0.378			NA											321	68					0	0	0.00361	0	0
HAUS1	115106	broad.mit.edu	37	18	43698246	43698246	+	Missense_Mutation	SNP	C	C	T	rs145196614	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:43698246C>T	uc002lbu.2	+	3	385	c.305C>T	c.(304-306)GCG>GTG	p.A102V	HAUS1_uc002lbv.2_Missense_Mutation_p.A26V	NM_138443	NP_612452	Q96CS2	HAUS1_HUMAN	coiled-coil domain containing 5	102					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole				ovary(1)	1						GTTGACAGTGCGGTGGCCCTT	0.428	NSCLC(79;183 1423 5813 15597 38427)		NA											5	72					0	0	0.000602	0	0
SMAD2	4087	broad.mit.edu	37	18	45372173	45372173	+	Splice_Site	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:45372173T>A	uc002lcy.2	-	9	1246	c.998_splice	c.e9-1	p.G333_splice	SMAD2_uc002lcz.2_Splice_Site_p.G333_splice|SMAD2_uc010xdc.1_Splice_Site_p.G303_splice|SMAD2_uc010xdd.1_Splice_Site_p.G303_splice	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1						anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5						CTCCTCTTCCTGAAACAAAAT	0.348			NA											15	43					0	0	0.004007	0	0
ATP8B1	5205	broad.mit.edu	37	18	55342077	55342077	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:55342077A>G	uc002lgw.2	-	15	1808	c.1808T>C	c.(1807-1809)ATG>ACG	p.M603T	uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1	603	Cytoplasmic (Potential).				ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				AATGATAGACATTCGCTTCCG	0.473			NA							Byler_disease				4	52					0	0	0.009096	0	0
SERPINB10	5273	broad.mit.edu	37	18	61602088	61602088	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:61602088C>A	uc010xev.1	+	8	896	c.806C>A	c.(805-807)ACC>AAC	p.T269N	SERPINB10_uc010xew.1_Missense_Mutation_p.T269N	NM_005024	NP_005015	P48595	SPB10_HUMAN	serine (or cysteine) proteinase inhibitor, clade	269						cytoplasm|nucleus	serine-type endopeptidase inhibitor activity			lung(1)|kidney(1)|skin(1)	3		Esophageal squamous(42;0.131)				AAGGCCATCACCTATGAGAAG	0.438			NA											16	44					1.33834e-09	1.5826e-09	0.007413	1	0
DOK6	220164	broad.mit.edu	37	18	67344982	67344982	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr18:67344982A>G	uc002lkl.2	+	4	492	c.302A>G	c.(301-303)GAG>GGG	p.E101G		NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6	101	PH.						insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				CTGGAGGCCGAGGAGTGGTGC	0.532			NA											5	61					0	0	0.001168	0	0
POLRMT	5442	broad.mit.edu	37	19	619702	619702	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:619702A>C	uc002lpf.1	-	13	3006	c.2950T>G	c.(2950-2952)TTC>GTC	p.F984V		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	984	Mediates interaction with TEFM.				transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGTGATGAAACCTTCCAGC	0.692			NA											14	180					0	0	0.004007	0	0
ABCA7	10347	broad.mit.edu	37	19	1047358	1047358	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:1047358C>T	uc002lqw.3	+	15	2279	c.2048C>T	c.(2047-2049)GCG>GTG	p.A683V	ABCA7_uc010dsb.1_Missense_Mutation_p.A545V	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	683					phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCTGCCCGCGGGTGGCCGC	0.741			NA											6	12					0	0	0.001168	0	0
BTBD2	55643	broad.mit.edu	37	19	1987200	1987200	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:1987200T>G	uc002lup.1	-	7	1234	c.1234A>C	c.(1234-1236)ATC>CTC	p.I412L	BTBD2_uc002luo.1_Missense_Mutation_p.I91L	NM_017797	NP_060267	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	412						cytoplasmic mRNA processing body	protein binding			ovary(1)|skin(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCCGTGGATGGATCCATAC	0.597			NA											4	33					0	0	0.009096	0	0
AP3D1	8943	broad.mit.edu	37	19	2132509	2132509	+	Silent	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:2132509T>G	uc002luz.2	-	5	646	c.423A>C	c.(421-423)CCA>CCC	p.P141P	AP3D1_uc002luy.2_Silent_p.P141P|AP3D1_uc002lva.2_Silent_p.P141P	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1	141					eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCAAGGTCTGGGGTGACGA	0.572			NA											29	114					0	0	0.002096	0	0
DIRAS1	148252	broad.mit.edu	37	19	2717219	2717219	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:2717219T>C	uc002lwf.3	-	2	744	c.586A>G	c.(586-588)ACC>GCC	p.T196A		NM_145173	NP_660156	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	196					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGAGGGTGCATTTGCCC	0.682			NA											8	104					0	0	0.004482	0	0
MLLT1	4298	broad.mit.edu	37	19	6222511	6222511	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:6222511G>A	uc002mek.2	-	6	895	c.731C>T	c.(730-732)GCG>GTG	p.A244V		NM_005934	NP_005925	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	244					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|protein binding			skin(1)	1						GGGCGGTGGCGCCTTCTCCTC	0.582			NA	T	MLL	AL								10	15					0	0	0.006214	0	0
C3	718	broad.mit.edu	37	19	6718320	6718320	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:6718320C>G	uc002mfm.2	-	3	433	c.371G>C	c.(370-372)AGC>ACC	p.S124T		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	124					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		GCTCTGCAGGCTGACCAGCAC	0.632			NA											5	50					0	0	0.001168	0	0
OR2Z1	284383	broad.mit.edu	37	19	8842180	8842180	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:8842180G>A	uc010xkg.1	+	1	790	c.790G>A	c.(790-792)GCC>ACC	p.A264T		NM_001004699	NP_001004699	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2						GGTGCCTTGCGCCTACCACAG	0.552			NA											12	107					0	0	0.001368	0	0
MUC16	94025	broad.mit.edu	37	19	9028257	9028257	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9028257A>T	uc002mkp.2	-	11	36739	c.36535T>A	c.(36535-36537)TAC>AAC	p.Y12179N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12181	SEA 1.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCCAGGGTGTAGGGGCCCAGC	0.567			NA											39	325					0	0	0.002522	0	0
MUC16	94025	broad.mit.edu	37	19	9062971	9062971	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9062971T>C	uc002mkp.2	-	3	24679	c.24475A>G	c.(24475-24477)ACC>GCC	p.T8159A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8161	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTAGAGGAGGTGACTTCTGTC	0.542			NA											17	77					0	0	0.00499	0	0
MUC16	94025	broad.mit.edu	37	19	9077354	9077354	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9077354T>C	uc002mkp.2	-	3	10296	c.10092A>G	c.(10090-10092)ACA>ACG	p.T3364T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3365	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TATTGGAAGATGTGCTCAGAG	0.473			NA											30	233					0	0	0.002096	0	0
MUC16	94025	broad.mit.edu	37	19	9085517	9085517	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9085517C>A	uc002mkp.2	-	1	6502	c.6298G>T	c.(6298-6300)GCT>TCT	p.A2100S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2100	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGCTTAGCAGCAGATGTGGAT	0.473			NA											29	198					8.88839e-20	1.14109e-19	0.002096	1	0
MUC16	94025	broad.mit.edu	37	19	9087193	9087193	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9087193G>T	uc002mkp.2	-	1	4826	c.4622C>A	c.(4621-4623)ACA>AAA	p.T1541K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1541	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCACGTGGTTGTCAGTGGGGT	0.473			NA											25	181					6.12954e-19	7.82869e-19	0.004656	1	0
OR7E24	26648	broad.mit.edu	37	19	9362502	9362502	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9362502T>C	uc002mlb.1	+	1	783	c.783T>C	c.(781-783)TCT>TCC	p.S261S		NM_001079935	NP_001073404	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E,	261	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CCTGTGGCTCTCACCTGGCAG	0.458			NA											10	24					0	0	0.008291	0	0
ZNF699	374879	broad.mit.edu	37	19	9406610	9406610	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9406610G>A	uc002mlc.1	-	5	1470	c.1470C>T	c.(1468-1470)CTC>CTT	p.L490L		NM_198535	NP_940937	Q32M78	ZN699_HUMAN	zinc finger protein 699	490	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGTGTTCGGTGAGGGATGAGG	0.448			NA											9	55					0	0	0.006214	0	0
ZNF426	79088	broad.mit.edu	37	19	9646885	9646885	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:9646885A>G	uc002mlq.2	-	3	288	c.24T>C	c.(22-24)CAT>CAC	p.H8H	ZNF426_uc010dws.2_Missense_Mutation_p.M1T|uc002mlr.2_5'Flank|uc002mls.2_5'Flank	NM_024106	NP_077011	Q9BUY5	ZN426_HUMAN	zinc finger protein 426	8					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGAGCTTACCATGGGACAAAT	0.453			NA											10	41					0	0	0.004007	0	0
PPAN-P2RY11	692312	broad.mit.edu	37	19	10225288	10225288	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:10225288A>G	uc002mna.2	+	13	2259	c.2259A>G	c.(2257-2259)CGA>CGG	p.R753R	PPAN-P2RY11_uc010xla.1_3'UTR|P2RY11_uc002mnc.2_Silent_p.R333R	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	PPAN-P2RY11 protein	Error:Variant_position_missing_in_Q9NQ55_after_alignment					RNA splicing	nucleolus	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			GCTGCTGCCGACACTGCCCCG	0.662			NA											14	38					0	0	0.00245	0	0
CDC37	11140	broad.mit.edu	37	19	10506666	10506666	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:10506666G>A	uc002mof.1	-	2	432	c.316C>T	c.(316-318)CGC>TGC	p.R106C	CDC37_uc002moe.1_5'Flank|CDC37_uc010dxf.1_5'UTR|CDC37_uc002mog.1_Missense_Mutation_p.R106C|CDC37_uc002moh.2_Missense_Mutation_p.R106C	NM_007065	NP_008996	Q16543	CDC37_HUMAN	cell division cycle 37 protein	106					protein targeting|regulation of cyclin-dependent protein kinase activity|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway		unfolded protein binding				0			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		TCCTTCTTGCGCATCTCCTCC	0.682			NA											36	130					0	0	0.004878	0	0
LPPR2	64748	broad.mit.edu	37	19	11473281	11473281	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:11473281C>T	uc002mre.1	+	7	1093	c.756C>T	c.(754-756)GGC>GGT	p.G252G	LPPR2_uc002mrf.1_Silent_p.G227G|LPPR2_uc010dxy.1_Silent_p.G59G	NM_022737	NP_073574	Q96GM1	LPPR2_HUMAN	lipid phosphate phosphatase-related protein type	252	Helical; (Potential).					integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1						TCCTGGTGGGCGTGGTCCGCG	0.657	Esophageal Squamous(164;1817 2610 12941 25548)		NA											11	38					0	0	0.000978	0	0
ZNF625	90589	broad.mit.edu	37	19	12256520	12256520	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:12256520A>G	uc002mth.2	-	4	863	c.513T>C	c.(511-513)CAT>CAC	p.H171H	ZNF20_uc002mtg.1_Intron|ZNF625_uc010dyn.1_RNA|ZNF625_uc010dyo.1_Silent_p.H205H	NM_145233	NP_660276	Q96I27	ZN625_HUMAN	zinc finger protein 625	171	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGTTCTTTCATGTATTCGAA	0.413			NA											21	81					0	0	0.001882	0	0
ZNF625	90589	broad.mit.edu	37	19	12256740	12256740	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:12256740T>A	uc002mth.2	-	4	643	c.293A>T	c.(292-294)GAT>GTT	p.D98V	ZNF20_uc002mtg.1_Intron|ZNF625_uc010dyn.1_RNA|ZNF625_uc010dyo.1_Missense_Mutation_p.D132V	NM_145233	NP_660276	Q96I27	ZN625_HUMAN	zinc finger protein 625	98	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCCTCACAATCATAAGGTTT	0.433			NA											25	85					0	0	0.00632	0	0
EPHX3	79852	broad.mit.edu	37	19	15341864	15341864	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:15341864A>G	uc002nap.2	-	4	734	c.525T>C	c.(523-525)GGT>GGC	p.G175G	EPHX3_uc002naq.2_Silent_p.G175G	NM_024794	NP_079070	Q9H6B9	EPHX3_HUMAN	abhydrolase domain containing 9 precursor	175						extracellular region	hydrolase activity				0						CAAGGAGGGCACCCCAGTCAT	0.577			NA											6	38					0	0	0.001168	0	0
AKAP8L	26993	broad.mit.edu	37	19	15514383	15514383	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:15514383C>A	uc002naw.1	-	4	364	c.265G>T	c.(265-267)GAT>TAT	p.D89Y	AKAP8L_uc002nax.1_Intron|AKAP8L_uc010xoh.1_Intron|AKAP8L_uc002nay.1_Missense_Mutation_p.D89Y|AKAP8L_uc002naz.2_5'Flank	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	89						cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding			ovary(1)	1						AAAACGGAATCGGCACTGGCG	0.512			NA											7	72					8.12818e-05	8.69429e-05	0.001984	1	0
CYP4F22	126410	broad.mit.edu	37	19	15636257	15636257	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:15636257G>A	uc002nbh.3	+	3	277	c.110G>A	c.(109-111)CGC>CAC	p.R37H		NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,	37						endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						TTCCTGTTCCGCCTGCTGCTG	0.652			NA											5	63					0	0	0.000602	0	0
CYP4F3	4051	broad.mit.edu	37	19	15769082	15769082	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:15769082T>C	uc002nbj.2	+	10	1174	c.1124T>C	c.(1123-1125)CTG>CCG	p.L375P	CYP4F3_uc010xok.1_Missense_Mutation_p.L375P|CYP4F3_uc010xol.1_Missense_Mutation_p.L375P|CYP4F3_uc010xom.1_Missense_Mutation_p.L226P|CYP4F3_uc002nbk.2_Missense_Mutation_p.L375P|CYP4F3_uc010xon.1_Missense_Mutation_p.L85P	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	375					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						AGGGACGACCTGGCCCAGCTG	0.562			NA											28	126					0	0	0.002445	0	0
C19orf44	84167	broad.mit.edu	37	19	16612359	16612359	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:16612359T>G	uc002neh.1	+	2	829	c.756T>G	c.(754-756)TTT>TTG	p.F252L	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Missense_Mutation_p.F252L|C19orf44_uc002neg.2_Missense_Mutation_p.F252L|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	252											0						GAAAACTATTTTCGGTGAGAt	0.229			NA											7	12					0	0	0.004482	0	0
SIN3B	23309	broad.mit.edu	37	19	16980396	16980396	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:16980396G>C	uc002ney.1	+	14	2042	c.2028G>C	c.(2026-2028)CAG>CAC	p.Q676H	SIN3B_uc002nez.1_Missense_Mutation_p.Q644H|SIN3B_uc010xpi.1_Missense_Mutation_p.Q234H	NM_015260	NP_056075	O75182	SIN3B_HUMAN	SIN3 homolog B, transcription regulator	676					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	protein binding			ovary(2)	2						TGAAGCGGCAGCCGGCCATCC	0.642			NA											6	49					0	0	0.001168	0	0
USE1	55850	broad.mit.edu	37	19	17330029	17330029	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:17330029G>A	uc002nfo.2	+	7	490	c.430G>A	c.(430-432)GCA>ACA	p.A144T	USE1_uc010eal.1_Intron	NM_018467	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog	144	Cytoplasmic (Potential).				lysosomal transport|protein catabolic process|protein transport|secretion by cell|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	protein binding				0						CAGTGGAGTGGCAGGGTCCCA	0.493			NA											11	28					0	0	0.001855	0	0
ARMC6	93436	broad.mit.edu	37	19	19162560	19162560	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:19162560T>C	uc002nld.2	+	5	757	c.409T>C	c.(409-411)TAC>CAC	p.Y137H	ARMC6_uc002nlc.2_Missense_Mutation_p.Y112H|ARMC6_uc010xql.1_Missense_Mutation_p.Y44H|ARMC6_uc002nle.2_Missense_Mutation_p.Y112H|ARMC6_uc010xqm.1_Missense_Mutation_p.Y137H	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	137							protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			GAAGGGGGCCTACCCCATCAT	0.637			NA											17	77					0	0	0.004007	0	0
HAPLN4	404037	broad.mit.edu	37	19	19369631	19369631	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:19369631C>A	uc002nmb.2	-	4	573	c.518G>T	c.(517-519)CGA>CTA	p.R173L	HAPLN4_uc002nmc.2_Missense_Mutation_p.R173L	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	173	Link 1.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			CAGCTTGTATCGGCCTCCACG	0.701			NA											6	9					3.59834e-05	3.88908e-05	0.001168	1	0
TM6SF2	53345	broad.mit.edu	37	19	19381855	19381855	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:19381855C>A	uc002nmd.1	-	2	225	c.175G>T	c.(175-177)GTC>TTC	p.V59F	HAPLN4_uc002nmc.2_5'UTR	NM_001001524	NP_001001524	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	59						integral to membrane					0			Epithelial(12;0.0151)			TCATAGGAGACCTCGCCATGG	0.587			NA											50	82					2.48254e-18	3.15775e-18	0.00361	1	0
ZNF93	81931	broad.mit.edu	37	19	20044841	20044841	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:20044841T>C	uc002non.2	+	4	1188	c.1077T>C	c.(1075-1077)CAT>CAC	p.H359H		NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93	359	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1						TTAGTAGACATGAGTTCATTC	0.373			NA											14	72					0	0	0.003163	0	0
ZNF536	9745	broad.mit.edu	37	19	30935669	30935669	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:30935669G>T	uc002nsu.1	+	2	1338	c.1200G>T	c.(1198-1200)TCG>TCT	p.S400S	ZNF536_uc010edd.1_Silent_p.S400S	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	400					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					ACAAGCTGTCGGTGAAGAACA	0.612			NA											25	88					1.1804e-14	1.47431e-14	0.003954	1	0
ZNF536	9745	broad.mit.edu	37	19	31039043	31039043	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:31039043G>T	uc002nsu.1	+	4	2655	c.2517G>T	c.(2515-2517)AGG>AGT	p.R839S	ZNF536_uc010edd.1_Missense_Mutation_p.R839S	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	839					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					ACATCCTGAGGGGGGCCTTCA	0.582			NA											38	92					5.43694e-19	6.95838e-19	0.005524	1	0
RHPN2	85415	broad.mit.edu	37	19	33486947	33486947	+	Missense_Mutation	SNP	C	C	T	rs143674321	by1000genomes	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:33486947C>T	uc002nuf.2	-	11	1471	c.1405G>A	c.(1405-1407)GCC>ACC	p.A469T	RHPN2_uc010xro.1_Missense_Mutation_p.A318T|RHPN2_uc002nue.2_Missense_Mutation_p.A199T	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	469					signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					ACACTGGGGGCGTCGATCAGG	0.627			NA											7	77					0	0	0.00308	0	0
UBA2	10054	broad.mit.edu	37	19	34949785	34949785	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:34949785C>T	uc002nvk.2	+	13	1427	c.1357C>T	c.(1357-1359)CGG>TGG	p.R453W	UBA2_uc010xrx.1_Missense_Mutation_p.R326W|UBA2_uc002nvl.2_Missense_Mutation_p.R357W	NM_005499	NP_005490	Q9UBT2	SAE2_HUMAN	SUMO-1 activating enzyme subunit 2	453					protein sumoylation	nucleus	ATP binding|enzyme activator activity|ligase activity|metal ion binding|protein heterodimerization activity|SUMO activating enzyme activity			ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GGTGACTGTGCGGCTGAATGT	0.458			NA											14	102					0	0	0.00245	0	0
ZNF792	126375	broad.mit.edu	37	19	35451185	35451185	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:35451185A>G	uc002nxh.1	-	3	624	c.237T>C	c.(235-237)GAT>GAC	p.D79D		NM_175872	NP_787068	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	79	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CTGATGTCATATCCACACTGT	0.537	GBM(1;7 183 21053 22581 22847)		NA											10	31					0	0	0.000978	0	0
U2AF1L4	199746	broad.mit.edu	37	19	36233696	36233696	+	Nonsense_Mutation	SNP	G	G	A	rs146316690		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:36233696G>A	uc002obg.2	-	8	793	c.484C>T	c.(484-486)CGA>TGA	p.R162*	TMEM149_uc002obb.2_5'Flank|TMEM149_uc002obc.2_5'Flank|TMEM149_uc002obd.3_5'Flank|TMEM149_uc010xsy.1_5'Flank|TMEM149_uc010eej.2_Intron|U2AF1L4_uc002obh.1_3'UTR|U2AF1L4_uc002obe.2_Missense_Mutation_p.P157L|U2AF1L4_uc002obf.2_Nonsense_Mutation_p.R138*|PSENEN_uc002obi.1_5'Flank|PSENEN_uc002obj.1_5'Flank|PSENEN_uc002obk.1_5'Flank			Q8WU68	U2AF4_HUMAN	Homo sapiens cDNA FLJ35525 fis, clone SPLEN2001650.	Error:Variant_position_missing_in_Q8WU68_after_alignment					mRNA processing|RNA splicing	nuclear speck|spliceosomal complex	nucleotide binding|RNA binding|zinc ion binding				0	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ATGGAACCTCGGGGGTGACCT	0.607			NA											12	69					0	0	0.001855	0	0
NPHS1	4868	broad.mit.edu	37	19	36342575	36342575	+	Splice_Site	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:36342575C>T	uc002oby.2	-	2	59	c.59_splice	c.e2-1	p.G20_splice		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor						cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCGCCAGGCCTGAGGACACA	0.642			NA											5	6					0	0	0.001984	0	0
ZNF585A	199704	broad.mit.edu	37	19	37644495	37644495	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:37644495C>T	uc002ofo.1	-	5	537	c.306G>A	c.(304-306)TGG>TGA	p.W102*	ZNF585A_uc002ofm.1_Nonsense_Mutation_p.W47*|ZNF585A_uc002ofn.1_Nonsense_Mutation_p.W47*	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	102					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATTATGGTCCCATAATTTCT	0.318			NA											25	114					0	0	0.003954	0	0
RASGRP4	115727	broad.mit.edu	37	19	38905617	38905617	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:38905617G>C	uc002oir.2	-	9	1315	c.1101C>G	c.(1099-1101)GAC>GAG	p.D367E	RASGRP4_uc010efz.1_RNA|RASGRP4_uc010ega.1_RNA|RASGRP4_uc010xua.1_Intron|RASGRP4_uc010xub.1_Missense_Mutation_p.D333E|RASGRP4_uc010xuc.1_Intron|RASGRP4_uc010xud.1_Missense_Mutation_p.D270E|RASGRP4_uc010xue.1_Intron|RASGRP4_uc010egb.2_Missense_Mutation_p.D353E	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	367	Ras-GEF.				activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAGGCAACCTGTCGGGCTGTG	0.682			NA											3	26					0	0	0.004672	0	0
PAK4	10298	broad.mit.edu	37	19	39664348	39664348	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:39664348G>A	uc002okj.1	+	6	1257	c.796G>A	c.(796-798)GCC>ACC	p.A266T	PAK4_uc002okl.1_Missense_Mutation_p.A266T|PAK4_uc002okn.1_Missense_Mutation_p.A266T|PAK4_uc002okm.1_Missense_Mutation_p.A113T|PAK4_uc002oko.1_Missense_Mutation_p.A113T|PAK4_uc002okp.1_Missense_Mutation_p.A176T	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1	266	Linker.				cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GGGACCCCACGCCTCAGAGCC	0.756			NA											3	9					0	0	0.004672	0	0
PSMC4	5704	broad.mit.edu	37	19	40487098	40487098	+	Splice_Site	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:40487098G>T	uc002omq.2	+	11	1181	c.1144_splice	c.e11-1	p.S382_splice	PSMC4_uc002omr.2_Splice_Site_p.S351_splice	NM_006503	NP_006494	P43686	PRS6B_HUMAN	proteasome 26S ATPase subunit 4 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding			ovary(1)	1	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TCCTTCAACAGAGTGGAATGT	0.313	Colon(105;1478 1543 4034 6132 38638)		NA											6	53					0.00116845	0.00122973	0.001168	1	0
HIPK4	147746	broad.mit.edu	37	19	40895596	40895596	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:40895596C>T	uc002onp.2	-	1	499	c.214G>A	c.(214-216)GTC>ATC	p.V72I		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	72	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			AAGCGGATGACGTGGGCCTCT	0.522			NA											15	163					0	0	0.00245	0	0
SPTBN4	57731	broad.mit.edu	37	19	40996054	40996054	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:40996054G>C	uc002ony.2	+	4	480	c.394G>C	c.(394-396)GAG>CAG	p.E132Q	SPTBN4_uc002onx.2_Missense_Mutation_p.E132Q|SPTBN4_uc002onz.2_Missense_Mutation_p.E132Q	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	132	CH 1.|Actin-binding.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTTTCTGAAGGAGCAGCGCGT	0.652			NA											4	54					0	0	0.009096	0	0
ADCK4	79934	broad.mit.edu	37	19	41211353	41211353	+	Splice_Site	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:41211353C>G	uc002oor.2	-	6	670	c.368_splice	c.e6-1	p.E123_splice	ADCK4_uc002ooq.1_Intron|ADCK4_uc002oos.2_Intron	NM_024876	NP_079152	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4 isoform a							integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			GAACCACCCTCTGGGGAGAGA	0.403			NA											13	50					0	0	0.001368	0	0
CYP2A6	1548	broad.mit.edu	37	19	41355874	41355874	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:41355874G>T	uc002opl.3	-	2	213	c.192C>A	c.(190-192)CGC>CGA	p.R64R	CYP2A6_uc010ehe.1_Intron|CYP2A6_uc010ehf.1_RNA	NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,	64					coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)	CGGGGCCATAGCGCTCACTGA	0.617			NA											15	101					4.93089e-13	6.08535e-13	0.00245	1	0
GRIK5	2901	broad.mit.edu	37	19	42558011	42558011	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:42558011C>T	uc002osj.1	-	9	1162	c.1127G>A	c.(1126-1128)CGC>CAC	p.R376H	GRIK5_uc010eib.1_Missense_Mutation_p.R295H	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor	376	Extracellular (Potential).					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)	TTCTAGGATGCGCAGGGTGTA	0.662			NA											4	39					0	0	0.000602	0	0
ZNF574	64763	broad.mit.edu	37	19	42584388	42584388	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:42584388A>T	uc002osm.3	+	2	1799	c.1630A>T	c.(1630-1632)ACA>TCA	p.T544S	ZNF574_uc002osk.3_Missense_Mutation_p.T634S	NM_022752	NP_073589	Q6ZN55	ZN574_HUMAN	zinc finger protein 574	544	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.059)				CCACCGGCTCACACACACAGG	0.647			NA											35	191					0	0	0.003271	0	0
PSG9	5678	broad.mit.edu	37	19	43763165	43763165	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:43763165G>A	uc002owd.3	-	4	931	c.832C>T	c.(832-834)CAG>TAG	p.Q278*	PSG9_uc002owe.3_Intron|PSG9_uc010xwm.1_Nonsense_Mutation_p.Q185*|PSG9_uc002owf.3_Intron|PSG9_uc002owg.2_Intron|PSG9_uc002owh.2_Intron	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	278	Ig-like C2-type 2.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				GGGAGGCTCTGACCGTTTAGC	0.478			NA											71	318					0	0	0.00361	0	0
ZNF230	7773	broad.mit.edu	37	19	44515277	44515277	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:44515277A>G	uc002oyb.1	+	5	1337	c.1086A>G	c.(1084-1086)AAA>AAG	p.K362K		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	362					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				GTGGAGAAAAACCATACAGAT	0.438	GBM(175;914 2069 22996 47111 52600)		NA											31	95					0	0	0.009535	0	0
ZNF230	7773	broad.mit.edu	37	19	44515285	44515285	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:44515285G>A	uc002oyb.1	+	5	1345	c.1094G>A	c.(1093-1095)AGA>AAA	p.R365K		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	365	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				AAACCATACAGATGTGAGGAG	0.443	GBM(175;914 2069 22996 47111 52600)		NA											29	102					0	0	0.007291	0	0
APOC1	341	broad.mit.edu	37	19	45419501	45419501	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:45419501A>G	uc002pac.1	+	4	365	c.113A>G	c.(112-114)AAG>AGG	p.K38R	APOC1_uc002pad.1_Missense_Mutation_p.K38R|APOC1_uc002pae.1_Missense_Mutation_p.K38R|APOC1_uc002paf.1_RNA	NM_001645	NP_001636	P02654	APOC1_HUMAN	apolipoprotein C-I precursor	38					cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle remodeling|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of fatty acid biosynthetic process|negative regulation of lipoprotein lipase activity|negative regulation of phosphatidylcholine catabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of cholesterol esterification|very-low-density lipoprotein particle assembly|very-low-density lipoprotein particle clearance	chylomicron|endoplasmic reticulum|high-density lipoprotein particle|very-low-density lipoprotein particle	fatty acid binding|phosphatidylcholine binding|phosphatidylcholine-sterol O-acyltransferase activator activity|phospholipase inhibitor activity				0	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		GATAAGCTGAAGGAGTTTGGA	0.522			NA											7	80					0	0	0.00308	0	0
GRLF1	2909	broad.mit.edu	37	19	47424279	47424279	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:47424279C>T	uc010ekv.2	+	1	2347	c.2347C>T	c.(2347-2349)CGA>TGA	p.R783*		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	783					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		TGTTGATCTGCGAATTGTTAT	0.423			NA											5	33					0	0	0.000602	0	0
GRIN2D	2906	broad.mit.edu	37	19	48945587	48945587	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:48945587G>A	uc002pjc.3	+	12	2709	c.2621G>A	c.(2620-2622)CGG>CAG	p.R874Q	GRIN2D_uc010elx.2_Missense_Mutation_p.R109Q	NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D	874	Cytoplasmic (Potential).					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	TGGCGCCTGCGGCACTGCCTG	0.532			NA											26	90					0	0	0.004656	0	0
CYTH2	9266	broad.mit.edu	37	19	48981711	48981711	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:48981711A>G	uc002pjj.3	+	12	1277	c.977A>G	c.(976-978)TAC>TGC	p.Y326C	CYTH2_uc002pji.2_RNA	NM_017457	NP_059431	Q99418	CYH2_HUMAN	cytohesin 2 isoform 1	326	PH.				actin cytoskeleton organization|endocytosis|regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|membrane fraction|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						TTTGAACTTTACATCCCCAAC	0.607			NA											15	78					0	0	0.007413	0	0
PRMT1	3276	broad.mit.edu	37	19	50185191	50185191	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:50185191A>G	uc010enf.1	+	4	259	c.217A>G	c.(217-219)ACC>GCC	p.T73A	PRMT1_uc002ppc.1_RNA|PRMT1_uc002ppd.2_Missense_Mutation_p.T49A|PRMT1_uc002ppe.2_Missense_Mutation_p.T55A|PRMT1_uc002ppf.2_RNA|PRMT1_uc002ppg.2_Missense_Mutation_p.T20A|PRMT1_uc010yba.1_RNA	NM_001536	NP_001527	Q8WUW5	Q8WUW5_HUMAN	HMT1 hnRNP methyltransferase-like 2 isoform 1	54						cytoplasm	protein methyltransferase activity			ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)		CGAGGTGCGCACCCTCACTTA	0.597			NA											10	27					0	0	0.006214	0	0
FPR3	2359	broad.mit.edu	37	19	52327399	52327399	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:52327399C>A	uc002pxt.1	+	2	582	c.398C>A	c.(397-399)GCC>GAC	p.A133D		NM_002030	NP_002021	P25089	FPR3_HUMAN	formyl peptide receptor-like 2	133	Cytoplasmic (Potential).				cellular component movement|chemotaxis	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(4)|breast(1)|skin(1)	6						CCAGCCTGGGCCCAGAACCAT	0.473			NA											6	66					3.59834e-05	3.88908e-05	0.001168	1	0
ZNF649	65251	broad.mit.edu	37	19	52394472	52394472	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:52394472A>G	uc002pxy.2	-	5	1185	c.917T>C	c.(916-918)GTT>GCT	p.V306A	ZNF577_uc010ydf.1_5'Flank	NM_023074	NP_075562	Q9BS31	ZN649_HUMAN	zinc finger protein 649	306	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		CTGATGTACAACGAGTAGTGA	0.438			NA											8	33					0	0	0.00308	0	0
ZNF320	162967	broad.mit.edu	37	19	53384157	53384157	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:53384157T>C	uc002qag.2	-	4	1413	c.1222A>G	c.(1222-1224)ACT>GCT	p.T408A	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.T354A|ZNF320_uc002qai.2_Missense_Mutation_p.T408A	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	408					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		TTCTCTCCAGTATGAAGTTTT	0.388			NA											8	58					0	0	0.00308	0	0
NLRP12	91662	broad.mit.edu	37	19	54314394	54314394	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:54314394C>A	uc002qch.3	-	3	739	c.519G>T	c.(517-519)CAG>CAT	p.Q173H	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.Q173H|NLRP12_uc002qcj.3_Missense_Mutation_p.Q173H|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.Q173H	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	173					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GAAGCTGCTGCTGGACCTGCA	0.627			NA											15	47					0.00244969	0.00255871	0.00245	1	0
CNOT3	4849	broad.mit.edu	37	19	54649361	54649361	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:54649361C>T	uc002qdj.1	+	8	822	c.511C>T	c.(511-513)CGG>TGG	p.R171W	CNOT3_uc010yel.1_Missense_Mutation_p.R171W|CNOT3_uc002qdi.2_Missense_Mutation_p.R84W|CNOT3_uc002qdk.1_Missense_Mutation_p.R171W|CNOT3_uc010ere.1_RNA	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	171					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGGCTTGAAGCGGCACATCGA	0.622			NA											11	27					0	0	0.000978	0	0
LILRB5	10990	broad.mit.edu	37	19	54757905	54757905	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:54757905G>A	uc002qex.2	-	8	1441	c.1330C>T	c.(1330-1332)CCC>TCC	p.P444S	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.P436S|LILRB5_uc002qey.2_Missense_Mutation_p.P445S|LILRB5_uc002qez.2_Missense_Mutation_p.P345S|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	444	Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AACCCCGTGGGGGTGAGGGGC	0.701			NA											4	3					0	0	0.000602	0	0
LILRA3	11026	broad.mit.edu	37	19	54802050	54802050	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:54802050C>A	uc002qfd.2	-	6	1203	c.1138G>T	c.(1138-1140)GCT>TCT	p.A380S	LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Missense_Mutation_p.A316S	NM_006865	NP_006856	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor,	380	Ig-like C2-type 4.				defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGAATTCAGCCTGGTACTTA	0.572			NA											35	132					2.47316e-13	3.0613e-13	0.003271	1	0
NLRP2	55655	broad.mit.edu	37	19	55494830	55494830	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:55494830C>T	uc002qij.2	+	6	1850	c.1764C>T	c.(1762-1764)TGC>TGT	p.C588C	NLRP2_uc010yfp.1_Silent_p.C565C|NLRP2_uc010esn.2_Silent_p.C564C|NLRP2_uc010eso.2_Silent_p.C585C|NLRP2_uc010esp.2_Silent_p.C566C	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	588					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGCTGCGATGCGACATAAGTT	0.547			NA											11	42					0	0	0.008291	0	0
TNNT1	7138	broad.mit.edu	37	19	55656924	55656924	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:55656924C>T	uc002qjb.3	-	6	205	c.116G>A	c.(115-117)CGC>CAC	p.R39H	TNNT1_uc002qiz.3_5'UTR|TNNT1_uc002qja.3_5'UTR|TNNT1_uc002qjc.3_Missense_Mutation_p.R39H|TNNT1_uc002qje.3_Missense_Mutation_p.R28H|TNNT1_uc002qjd.3_Missense_Mutation_p.R28H|TNNT1_uc002qjf.2_Missense_Mutation_p.R35H	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a	39					muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		TGGTTTGGGGCGTTCCTCTTC	0.542			NA											46	132					0	0	0.00361	0	0
NLRP11	204801	broad.mit.edu	37	19	56303748	56303748	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:56303748C>A	uc010ygf.1	-	9	3143	c.2432G>T	c.(2431-2433)TGT>TTT	p.C811F	NLRP11_uc002qlz.2_Missense_Mutation_p.C658F|NLRP11_uc002qmb.2_Missense_Mutation_p.C712F|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	811	LRR 4.						ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		GCGATTCACACACAGGTCTAG	0.468			NA											22	67					0.000229342	0.000244474	0.001882	1	0
ZNF543	125919	broad.mit.edu	37	19	57840569	57840569	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:57840569A>G	uc002qoi.1	+	4	2084	c.1739A>G	c.(1738-1740)AAC>AGC	p.N580S		NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543	580					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ACTTCAGTCAACATCCAGGAA	0.418			NA											17	70					0	0	0.004007	0	0
ZSCAN4	201516	broad.mit.edu	37	19	58187749	58187749	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:58187749G>A	uc002qpu.2	+	3	933	c.236G>A	c.(235-237)AGC>AAC	p.S79N		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	79	SCAN box.				telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAAAAGCACAGCAAGGATGAA	0.403			NA											26	53					0	0	0.005443	0	0
RSAD2	91543	broad.mit.edu	37	2	7036001	7036001	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:7036001T>C	uc002qyp.1	+	6	1150	c.1014T>C	c.(1012-1014)TTT>TTC	p.F338F		NM_080657	NP_542388	Q8WXG1	RSAD2_HUMAN	radical S-adenosyl methionine domain containing	338					defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		TCAGTGGATTTGATGAAAAGA	0.433			NA											12	59					0	0	0.000978	0	0
ODC1	4953	broad.mit.edu	37	2	10584717	10584717	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:10584717C>T	uc010exg.1	-	4	593	c.159G>A	c.(157-159)CTG>CTA	p.L53L	ODC1_uc002ran.1_5'Flank|ODC1_uc002rao.1_Silent_p.L53L|ODC1_uc010yjd.1_Intron	NM_002539	NP_002530	P11926	DCOR_HUMAN	ornithine decarboxylase 1	53					polyamine biosynthetic process|regulation of cellular amino acid metabolic process|response to virus	cytosol	ornithine decarboxylase activity|protein binding			ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Pyridoxal Phosphate(DB00114)|Spermine(DB00127)	TTAACCACCTCAGATGTTTCT	0.483			NA											19	57					0	0	0.006122	0	0
NOL10	79954	broad.mit.edu	37	2	10717815	10717815	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:10717815T>C	uc002raq.2	-	20	2019	c.1894A>G	c.(1894-1896)AGT>GGT	p.S632G	NOL10_uc010yje.1_Missense_Mutation_p.S606G|NOL10_uc010yjf.1_Missense_Mutation_p.S582G|NOL10_uc002rap.2_Missense_Mutation_p.S582G	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	632						nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		TCGGATACACTCAATGTCCCA	0.318			NA											5	14					0	0	0.001984	0	0
GREB1	9687	broad.mit.edu	37	2	11735467	11735467	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:11735467T>C	uc002rbk.1	+	12	2087	c.1787T>C	c.(1786-1788)GTA>GCA	p.V596A	GREB1_uc002rbo.1_Missense_Mutation_p.V230A	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	596						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ACGGGGAAGGTAGACTCGCTG	0.448	Ovarian(39;850 945 2785 23371 33093)		NA											8	59					0	0	0.008291	0	0
NBAS	51594	broad.mit.edu	37	2	15468400	15468400	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:15468400T>C	uc002rcc.1	-	37	4410	c.4384A>G	c.(4384-4386)ACA>GCA	p.T1462A	NBAS_uc010exl.1_Missense_Mutation_p.T534A|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1462										ovary(2)|liver(1)|skin(1)	4						TCATTGGCTGTAGTTCCGATT	0.299			NA											33	196					0	0	0.00623	0	0
APOB	338	broad.mit.edu	37	2	21229034	21229034	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:21229034T>G	uc002red.2	-	26	10834	c.10706A>C	c.(10705-10707)AAC>ACC	p.N3569T		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3569					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTGTAAGTGGTTTTTCGTACT	0.448			NA											15	58					0	0	0.003163	0	0
HADHB	3032	broad.mit.edu	37	2	26486254	26486254	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:26486254A>T	uc002rgz.2	+	4	367	c.116A>T	c.(115-117)CAG>CTG	p.Q39L	HADHB_uc010yku.1_RNA|HADHB_uc010ykv.1_Missense_Mutation_p.Q17L|HADHB_uc010ykw.1_Missense_Mutation_p.Q39L|HADHB_uc002rha.2_Missense_Mutation_p.Q39L	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta	39					fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAGCTGTCCAGACCAAAACG	0.299			NA											17	61					0	0	0.00499	0	0
DNAJC5G	285126	broad.mit.edu	37	2	27501077	27501077	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:27501077C>G	uc002rjl.1	+	5	815	c.397C>G	c.(397-399)CTG>GTG	p.L133V	SLC30A3_uc010ylh.1_5'Flank|DNAJC5G_uc010yli.1_Silent_p.L45L|DNAJC5G_uc002rjm.1_Missense_Mutation_p.L133V	NM_173650	NP_775921	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	133	Cys-rich.				protein folding	membrane	heat shock protein binding|unfolded protein binding			skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGTGTACTCTGCTCACttg	0.398			NA											22	37					0	0	0.001882	0	0
C2orf16	84226	broad.mit.edu	37	2	27801984	27801984	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:27801984C>T	uc002rkz.3	+	1	2596	c.2545C>T	c.(2545-2547)CGA>TGA	p.R849*		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	849										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CTGGAGATCACGATCTAGGAC	0.473			NA											26	55					0	0	0.003954	0	0
XDH	7498	broad.mit.edu	37	2	31600099	31600099	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:31600099T>C	uc002rnv.1	-	14	1326	c.1247A>G	c.(1246-1248)GAG>GGG	p.E416G		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	416					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	TGAGAAATACTCCCCCTAAAA	0.517	Colon(66;682 1445 30109 40147)		NA											18	64					0	0	0.007413	0	0
XDH	7498	broad.mit.edu	37	2	31621554	31621554	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:31621554G>T	uc002rnv.1	-	5	397	c.318C>A	c.(316-318)GCC>GCA	p.A106A		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	106					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	CGTGGCTTTTGGCAATTCTCT	0.557	Colon(66;682 1445 30109 40147)		NA											27	124					3.65163e-15	4.58388e-15	0.00632	1	0
GALM	130589	broad.mit.edu	37	2	38960634	38960634	+	Missense_Mutation	SNP	G	G	A	rs116100345	by1000genomes	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:38960634G>A	uc002rqy.2	+	7	1208	c.956G>A	c.(955-957)CGC>CAC	p.R319H		NM_138801	NP_620156	Q96C23	GALM_HUMAN	galactose mutarotase	319					hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)				TCACAGCCCCGCTTCCCTCCT	0.512			NA											33	130					0	0	0.004289	0	0
THADA	63892	broad.mit.edu	37	2	43779453	43779453	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:43779453A>G	uc002rsw.3	-	18	3052	c.2700T>C	c.(2698-2700)CTT>CTC	p.L900L	THADA_uc010far.2_Silent_p.L169L|THADA_uc002rsx.3_Silent_p.L900L|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Silent_p.L610L|THADA_uc010fat.1_Silent_p.L48L|THADA_uc002rta.2_Silent_p.L610L|THADA_uc002rtb.1_Silent_p.L900L	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	900	Potential.						binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CTTCTTCCTCAAGATTTTCCA	0.368			NA											7	27					0	0	0.00308	0	0
THADA	63892	broad.mit.edu	37	2	43793906	43793906	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:43793906A>G	uc002rsw.3	-	15	2594	c.2242T>C	c.(2242-2244)TCC>CCC	p.S748P	THADA_uc010far.2_Missense_Mutation_p.S17P|THADA_uc002rsx.3_Missense_Mutation_p.S748P|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Missense_Mutation_p.S458P|THADA_uc010fat.1_Missense_Mutation_p.S17P|THADA_uc002rta.2_Missense_Mutation_p.S458P|THADA_uc002rtb.1_Missense_Mutation_p.S748P|THADA_uc002rtc.3_Missense_Mutation_p.S748P|THADA_uc002rtd.2_Missense_Mutation_p.S748P	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	748							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GTCGAGTAGGAAGATCCAGGA	0.303			NA											4	12					0	0	0.009096	0	0
ABCG5	64240	broad.mit.edu	37	2	44050063	44050063	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:44050063G>A	uc002rtn.2	-	10	1476	c.1336C>T	c.(1336-1338)CGA>TGA	p.R446*	ABCG5_uc002rtm.2_Nonsense_Mutation_p.R51*|ABCG5_uc002rto.2_Nonsense_Mutation_p.R275*|ABCG5_uc002rtp.2_Nonsense_Mutation_p.R51*	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	446	ABC transmembrane type-2.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGACAGCTCGCAGCACGGGA	0.582			NA											4	23					0	0	0.009096	0	0
SPRED2	200734	broad.mit.edu	37	2	65541245	65541245	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:65541245C>T	uc002sdr.3	-	6	1182	c.647G>A	c.(646-648)CGC>CAC	p.R216H	SPRED2_uc010fcw.2_Missense_Mutation_p.R213H	NM_181784	NP_861449	Q7Z698	SPRE2_HUMAN	sprouty-related protein with EVH-1 domain 2	216	KBD.				inactivation of MAPK activity|multicellular organismal development	transport vesicle membrane	stem cell factor receptor binding			ovary(1)|lung(1)|central_nervous_system(1)	3						GGGGTTGATGCGCACGATCTC	0.637			NA											6	39					0	0	0.001168	0	0
PNO1	56902	broad.mit.edu	37	2	68389725	68389725	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:68389725G>A	uc002seh.2	+	5	612	c.550G>A	c.(550-552)GCT>ACT	p.A184T		NM_020143	NP_064528	Q9NRX1	PNO1_HUMAN	partner of NOB1	184	KH.					nucleolus	RNA binding				0						AGGAAGAATCGCTGGCAAAGG	0.418	NSCLC(83;642 1410 13044 32832 40058)		NA											12	65					0	0	0.001368	0	0
ATP6V1B1	525	broad.mit.edu	37	2	71191570	71191570	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:71191570C>A	uc002shj.2	+	12	1233	c.1146C>A	c.(1144-1146)ATC>ATA	p.I382I	ATP6V1B1_uc010fdv.2_Silent_p.I365I|ATP6V1B1_uc010fdw.2_RNA|ATP6V1B1_uc010fdx.2_Silent_p.I340I	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1	382					ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1						TCCCTCAGATCTACCCCCCCA	0.542			NA									OREG0014686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	85					4.87955e-14	6.07017e-14	0.005443	1	0
LOXL3	84695	broad.mit.edu	37	2	74763974	74763974	+	Nonsense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:74763974A>T	uc002smp.1	-	5	846	c.774T>A	c.(772-774)TGT>TGA	p.C258*	LOXL3_uc002smo.1_Intron|LOXL3_uc010ffm.1_Nonsense_Mutation_p.C258*|LOXL3_uc002smq.1_Intron|LOXL3_uc010ffn.1_Intron	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	258	SRCR 2.					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						ACTCCAGGGAACAGAGGGAGA	0.657			NA											19	64					0	0	0.007413	0	0
HK2	3099	broad.mit.edu	37	2	75100444	75100444	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:75100444A>T	uc002snd.2	+	5	2463	c.537A>T	c.(535-537)GGA>GGT	p.G179G		NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2	179	Regulatory.				apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						AGTCCAGTGGAGTGGAAGGCA	0.532			NA											16	122					0	0	0.00499	0	0
CTNNA2	1496	broad.mit.edu	37	2	80801393	80801393	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:80801393T>A	uc010ysh.1	+	12	1852	c.1847T>A	c.(1846-1848)GTG>GAG	p.V616E	CTNNA2_uc010yse.1_Missense_Mutation_p.V616E|CTNNA2_uc010ysf.1_Missense_Mutation_p.V616E|CTNNA2_uc010ysg.1_Missense_Mutation_p.V616E|CTNNA2_uc010ysi.1_Missense_Mutation_p.V248E	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	616					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TCTCGCCTGGTGTATGATGGC	0.517			NA											23	101					0	0	0.00278	0	0
CTNNA2	1496	broad.mit.edu	37	2	80808944	80808944	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:80808944G>T	uc010ysh.1	+	13	2012	c.2007G>T	c.(2005-2007)CGG>CGT	p.R669R	CTNNA2_uc010yse.1_Silent_p.R669R|CTNNA2_uc010ysf.1_Silent_p.R669R|CTNNA2_uc010ysg.1_Silent_p.R669R|CTNNA2_uc010ysi.1_Silent_p.R301R	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	669					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AGAGCGCACGGGTGAGTGGAC	0.493			NA											7	40					0.00198382	0.00207558	0.001984	1	0
MGAT4A	11320	broad.mit.edu	37	2	99261962	99261962	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:99261962A>G	uc002sze.2	-	9	1132	c.818T>C	c.(817-819)ATA>ACA	p.I273T	C2orf64_uc002sza.2_RNA|MGAT4A_uc010yvm.1_Missense_Mutation_p.I145T|MGAT4A_uc010fil.2_Missense_Mutation_p.I27T	NM_012214	NP_036346	Q9UM21	MGT4A_HUMAN	alpha-1,3-mannosyl-glycoprotein	273	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1						AAAATTTTTTATGGTATTAAA	0.299			NA											7	42					0	0	0.00308	0	0
REV1	51455	broad.mit.edu	37	2	100020219	100020219	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:100020219C>T	uc002tad.2	-	19	3317	c.3105G>A	c.(3103-3105)GCG>GCA	p.A1035A	REV1_uc002tac.2_Silent_p.A1034A	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	1035					DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding	p.A1035A(1)		ovary(2)	2						TTTGATCATACGCTGCTTTCA	0.498			NA						DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					12	91					0	0	0.000978	0	0
SLC9A4	389015	broad.mit.edu	37	2	103148849	103148849	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:103148849G>A	uc002tbz.3	+	12	2556	c.2099G>A	c.(2098-2100)GGG>GAG	p.G700E		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	700	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						TCTCGGATAGGGTCACTTCAG	0.458			NA											9	74					0	0	0.006214	0	0
TMEM182	130827	broad.mit.edu	37	2	103414332	103414332	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:103414332T>C	uc010fjb.2	+	4	529	c.342T>C	c.(340-342)GGT>GGC	p.G114G	TMEM182_uc002tcc.3_Silent_p.G71G|TMEM182_uc002tcd.3_Silent_p.G18G|TMEM182_uc010ywe.1_RNA	NM_144632	NP_653233	Q6ZP80	TM182_HUMAN	transmembrane protein 182 precursor	114	Extracellular (Potential).					integral to membrane					0						TTTACCGTGGTTTCTGGGCAG	0.463			NA											10	62					0	0	0.006214	0	0
GPR45	11250	broad.mit.edu	37	2	105858858	105858858	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:105858858G>T	uc002tco.1	+	1	659	c.543G>T	c.(541-543)CAG>CAT	p.Q181H		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	181	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						GGGCCCCACAGTGCGTGCTGG	0.692			NA											9	25					0.00448238	0.00464673	0.004482	1	0
SLC5A7	60482	broad.mit.edu	37	2	108626899	108626899	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:108626899G>T	uc002tdv.2	+	9	1601	c.1325G>T	c.(1324-1326)GGC>GTC	p.G442V	SLC5A7_uc010ywm.1_Missense_Mutation_p.G195V|SLC5A7_uc010fjj.2_Missense_Mutation_p.G442V|SLC5A7_uc010ywn.1_Missense_Mutation_p.G329V	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	442	Helical; (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	TATGTTTCTGGCCTCTTCCTG	0.453			NA											40	67					1.49673e-21	1.93548e-21	0.00623	1	0
GCC2	9648	broad.mit.edu	37	2	109085534	109085534	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:109085534G>T	uc002tec.2	+	5	469	c.315G>T	c.(313-315)GAG>GAT	p.E105D	GCC2_uc002ted.2_Missense_Mutation_p.E4D	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	105					Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						TGAAGCAAGAGGTTGAGGTAA	0.318			NA											6	81					2.0095e-06	2.23198e-06	0.001984	1	0
CCDC138	165055	broad.mit.edu	37	2	109432411	109432411	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:109432411G>A	uc002ten.1	+	10	1116	c.1056G>A	c.(1054-1056)GGG>GGA	p.G352G	CCDC138_uc002teo.1_Silent_p.G352G|CCDC138_uc002tep.1_Silent_p.G36G|CCDC138_uc010fjm.1_Silent_p.G36G	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	352											0						CACTTAATGGGCAAGTTTATG	0.308			NA											12	79					0	0	0.001368	0	0
SH3RF3	344558	broad.mit.edu	37	2	110015112	110015112	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:110015112A>G	uc010ywt.1	+	4	1012	c.1012A>G	c.(1012-1014)AAT>GAT	p.N338D		NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	338							zinc ion binding			ovary(1)	1						ATCCAGCTGCAATGCCTCCCT	0.617			NA											3	11					0	0	0.009096	0	0
ACOXL	55289	broad.mit.edu	37	2	111721234	111721234	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:111721234A>C	uc002tgr.3	+	13	1317	c.1093A>C	c.(1093-1095)AAG>CAG	p.K365Q	ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2	365					fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						CTCAGGCTTAAAGTGTGACAC	0.303			NA											14	105					0	0	0.003163	0	0
DPP10	57628	broad.mit.edu	37	2	116593767	116593767	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:116593767A>T	uc002tla.1	+	22	2442	c.1985A>T	c.(1984-1986)AAA>ATA	p.K662I	DPP10_uc002tlb.1_Missense_Mutation_p.K612I|DPP10_uc002tlc.1_Missense_Mutation_p.K658I|DPP10_uc002tle.2_Missense_Mutation_p.K666I|DPP10_uc002tlf.1_Missense_Mutation_p.K655I	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	662	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						ATGATCTTAAAATCAGATGAA	0.289			NA											6	35					0	0	0.004482	0	0
CNTNAP5	129684	broad.mit.edu	37	2	125530593	125530593	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:125530593A>T	uc002tno.2	+	17	3112	c.2748A>T	c.(2746-2748)GTA>GTT	p.V916V	CNTNAP5_uc010flu.2_Silent_p.V917V	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	916	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGTTGTTTGTAGGTAGGGGAC	0.498			NA											24	107					0	0	0.00333	0	0
PLEKHB2	55041	broad.mit.edu	37	2	131883392	131883392	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:131883392A>T	uc002tsg.3	+	3	664	c.104A>T	c.(103-105)TAT>TTT	p.Y35F	PLEKHB2_uc002tsh.2_Missense_Mutation_p.Y35F|PLEKHB2_uc002tsj.3_Missense_Mutation_p.Y35F|PLEKHB2_uc002tsf.3_Missense_Mutation_p.Y35F|PLEKHB2_uc010zao.1_5'UTR|PLEKHB2_uc010zap.1_Missense_Mutation_p.Y35F|PLEKHB2_uc010zaq.1_Missense_Mutation_p.Y35F|PLEKHB2_uc002tsi.3_Missense_Mutation_p.Y76F	NM_001100623	NP_001094093	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B	35	PH.					membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		CTGATCTATTATGATGACCAG	0.453			NA											18	82					0	0	0.006122	0	0
LYPD1	116372	broad.mit.edu	37	2	133403780	133403780	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:133403780G>A	uc002ttn.2	-	3	1240	c.264C>T	c.(262-264)TGC>TGT	p.C88C	GPR39_uc002ttl.2_3'UTR|LYPD1_uc002ttm.3_Silent_p.C104C|LYPD1_uc002tto.2_Silent_p.C36C	NM_144586	NP_653187	Q8N2G4	LYPD1_HUMAN	LY6/PLAUR domain containing 1 isoform a	88	UPAR/Ly6.					anchored to membrane|plasma membrane					0						TCCCTGGGGAGCAGAAGGACT	0.567			NA											9	39					0	0	0.006214	0	0
DARS	1615	broad.mit.edu	37	2	136664929	136664929	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:136664929T>C	uc002tux.1	-	16	1647	c.1463A>G	c.(1462-1464)CAG>CGG	p.Q488R	DARS_uc010fnj.1_Missense_Mutation_p.Q388R	NM_001349	NP_001340	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	488					aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	CATGGAGGTCTGACGAACATT	0.313			NA											6	57					0	0	0.001984	0	0
THSD7B	80731	broad.mit.edu	37	2	137990553	137990553	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:137990553C>T	uc002tva.1	+	8	1907	c.1907C>T	c.(1906-1908)ACA>ATA	p.T636I	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.T526I	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CACTGGGAGACATCGCCTTGG	0.502			NA											22	43					0	0	0.001882	0	0
LRP1B	53353	broad.mit.edu	37	2	141201983	141201983	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:141201983T>A	uc002tvj.1	-	65	11182	c.10210A>T	c.(10210-10212)ACC>TCC	p.T3404S		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3404	Extracellular (Potential).|LDL-receptor class A 23.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGGTTCTTGGTACATTTGAAT	0.388	Colon(99;50 2074 2507 20106)		NA								TSP Lung(27;0.18)			20	83					0	0	0.008871	0	0
LRP1B	53353	broad.mit.edu	37	2	141641441	141641441	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:141641441G>T	uc002tvj.1	-	25	5086	c.4114C>A	c.(4114-4116)CTA>ATA	p.L1372I	LRP1B_uc010fnl.1_Missense_Mutation_p.L554I	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1372	Extracellular (Potential).|LDL-receptor class B 10.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCTGCTATTAGTGTAGTTCTT	0.438	Colon(99;50 2074 2507 20106)		NA								TSP Lung(27;0.18)			51	84					1.15181e-12	1.41306e-12	0.00361	1	0
LRP1B	53353	broad.mit.edu	37	2	141751631	141751631	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:141751631T>A	uc002tvj.1	-	16	3549	c.2577A>T	c.(2575-2577)CAA>CAT	p.Q859H	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	859	Extracellular (Potential).|LDL-receptor class A 3.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCACCGAGCTTGGATACAGT	0.423	Colon(99;50 2074 2507 20106)		NA								TSP Lung(27;0.18)			22	99					0	0	0.00278	0	0
LRP1B	53353	broad.mit.edu	37	2	141812773	141812773	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:141812773G>C	uc002tvj.1	-	10	2436	c.1464C>G	c.(1462-1464)CAC>CAG	p.H488Q	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	488	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTAGACAGATGTGTGAACAGC	0.443	Colon(99;50 2074 2507 20106)		NA								TSP Lung(27;0.18)			13	54					0	0	0.001368	0	0
LRP1B	53353	broad.mit.edu	37	2	142237972	142237972	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:142237972A>T	uc002tvj.1	-	3	1308	c.336T>A	c.(334-336)CAT>CAA	p.H112Q	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	112	Extracellular (Potential).|LDL-receptor class A 2.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACCCTGACAATGTACTCCTT	0.388	Colon(99;50 2074 2507 20106)		NA								TSP Lung(27;0.18)			5	46					0	0	0.000602	0	0
PLA2R1	22925	broad.mit.edu	37	2	160901445	160901445	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:160901445A>G	uc002ube.1	-	2	540	c.333T>C	c.(331-333)GTT>GTC	p.V111V	PLA2R1_uc010zcp.1_Silent_p.V111V|PLA2R1_uc002ubf.2_Silent_p.V111V	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	111	Extracellular (Potential).|Ricin B-type lectin.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						ACCGTAAGGAAACGAGGGTGG	0.537			NA											12	74					0	0	0.000978	0	0
ITGB6	3694	broad.mit.edu	37	2	161056554	161056554	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:161056554G>T	uc002ubh.2	-	1	37	c.21C>A	c.(19-21)TGC>TGA	p.C7*	ITGB6_uc010fow.1_Intron|ITGB6_uc010fou.2_Nonsense_Mutation_p.C7*|ITGB6_uc010zcq.1_5'UTR|ITGB6_uc010fov.1_Nonsense_Mutation_p.C7*	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	7					cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						GAAAGAACAGGCAAAGCAGTT	0.398			NA											7	74					3.09899e-07	3.51746e-07	0.004482	1	0
FAP	2191	broad.mit.edu	37	2	163074565	163074565	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:163074565T>C	uc002ucd.2	-	9	901	c.693A>G	c.(691-693)ATA>ATG	p.I231M	FAP_uc010zct.1_Missense_Mutation_p.I206M|FAP_uc010fpd.2_Intron|FAP_uc010fpe.1_Missense_Mutation_p.I198M	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	231	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						CAATAACTGGTATATCCGTAT	0.348			NA											18	94					0	0	0.006122	0	0
FIGN	55137	broad.mit.edu	37	2	164467255	164467255	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:164467255T>C	uc002uck.1	-	3	1398	c.1087A>G	c.(1087-1089)AAT>GAT	p.N363D		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	363						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						TCAAAGCCATTCCCCCGATTT	0.453			NA											7	97					0	0	0.00308	0	0
SCN2A	6326	broad.mit.edu	37	2	166187980	166187980	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:166187980G>A	uc002udc.2	+	14	2580	c.2290G>A	c.(2290-2292)GCC>ACC	p.A764T	SCN2A_uc002udd.2_Missense_Mutation_p.A764T|SCN2A_uc002ude.2_Missense_Mutation_p.A764T	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	764	II.|Helical; Name=S1 of repeat II; (Potential).				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	TGTTGACCTGGCCATCACCAT	0.428			NA											14	115					0	0	0.00245	0	0
GALNT3	2591	broad.mit.edu	37	2	166627100	166627100	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:166627100C>T	uc010fph.1	-	2	498	c.111G>A	c.(109-111)ATG>ATA	p.M37I	GALNT3_uc010fpi.1_Missense_Mutation_p.M37I|GALNT3_uc002udi.2_Missense_Mutation_p.M37I	NM_004482	NP_004473	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	37	Helical; Signal-anchor for type II membrane protein; (Potential).				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(2)|ovary(1)	3						CTTCTCTTTGCATTAAAACCA	0.299			NA											10	36					0	0	0.008291	0	0
SCN1A	6323	broad.mit.edu	37	2	166848817	166848817	+	Silent	SNP	G	G	T	rs121917955		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:166848817G>T	uc010zcz.1	-	26	4953	c.4935C>A	c.(4933-4935)ATC>ATA	p.I1645I		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1656	Helical; Voltage-sensor; Name=S4 of repeat IV; (By similarity).|IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	GCAGCGTGCGGATCCCCTTTG	0.493			NA											41	70					3.09479e-21	3.99783e-21	0.006999	1	0
SCN7A	6332	broad.mit.edu	37	2	167304181	167304181	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:167304181G>A	uc002udu.1	-	11	1455	c.1328C>T	c.(1327-1329)CCA>CTA	p.P443L	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	443					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TGTGGAAATTGGTGACCTTTT	0.378			NA											6	80					0	0	0.00308	0	0
XIRP2	129446	broad.mit.edu	37	2	168096393	168096393	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:168096393C>T	uc002udx.2	+	5	905	c.887C>T	c.(886-888)ACT>ATT	p.T296I	XIRP2_uc010fpn.2_Missense_Mutation_p.T329I|XIRP2_uc010fpo.2_Missense_Mutation_p.T296I|XIRP2_uc010fpp.2_Missense_Mutation_p.T296I|XIRP2_uc002udy.2_Missense_Mutation_p.T121I|XIRP2_uc010fpq.2_Missense_Mutation_p.T74I|XIRP2_uc010fpr.2_Missense_Mutation_p.T74I	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	121					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CAGGTTGGCACTTCAAGAAGC	0.373			NA											36	42					0	0	0.007835	0	0
XIRP2	129446	broad.mit.edu	37	2	168099218	168099218	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:168099218C>A	uc002udx.2	+	8	1334	c.1316C>A	c.(1315-1317)GCA>GAA	p.A439E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.A264E|XIRP2_uc010fpq.2_Missense_Mutation_p.A217E|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	264					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TCAACTCTGGCACAAATTAAT	0.443			NA											13	61					2.27111e-07	2.58487e-07	0.001368	1	0
LASS6	253782	broad.mit.edu	37	2	169551539	169551539	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:169551539A>G	uc002ueb.1	+	6	711	c.587A>G	c.(586-588)CAG>CGG	p.Q196R	LASS6_uc002uec.1_Missense_Mutation_p.Q196R	NM_203463	NP_982288	Q6ZMG9	CERS6_HUMAN	longevity assurance homolog 6	196	Helical; (Potential).|TLC.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1						ATGTTTTCTCAGTTCACTGAT	0.398			NA											22	92					0	0	0.002299	0	0
LRP2	4036	broad.mit.edu	37	2	170101223	170101223	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:170101223C>T	uc002ues.2	-	22	3623	c.3410G>A	c.(3409-3411)GGA>GAA	p.G1137E	LRP2_uc010zdf.1_Missense_Mutation_p.G1000E	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1137	LDL-receptor class A 10.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTCATCAGATCCATCCCCACA	0.458			NA											26	105					0	0	0.005443	0	0
HAT1	8520	broad.mit.edu	37	2	172809466	172809466	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:172809466A>C	uc002uhi.2	+	4	332	c.256A>C	c.(256-258)ATG>CTG	p.M86L	HAT1_uc010fqi.2_Intron|HAT1_uc002uhj.2_Missense_Mutation_p.M1L	NM_003642	NP_003633	O14929	HAT1_HUMAN	histone acetyltransferase 1	86					chromatin silencing at telomere|DNA packaging	cytoplasm|nuclear matrix|nucleoplasm	histone acetyltransferase activity|protein binding			large_intestine(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CCTGTCAACAATGTTCCGTGT	0.318			NA											11	45					0	0	0.001368	0	0
ITGA6	3655	broad.mit.edu	37	2	173352323	173352323	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:173352323T>C	uc002uhp.1	+	16	2412	c.2209T>C	c.(2209-2211)TGT>CGT	p.C737R	ITGA6_uc010zdy.1_Missense_Mutation_p.C618R|ITGA6_uc002uho.1_Missense_Mutation_p.C737R|ITGA6_uc010fqm.1_Missense_Mutation_p.C383R	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	776	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GCAAGCTGACTGTGAGCTCGG	0.403			NA											10	59					0	0	0.006214	0	0
RAPGEF4	11069	broad.mit.edu	37	2	173891410	173891410	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:173891410C>T	uc002uhv.3	+	24	2551	c.2364C>T	c.(2362-2364)TTC>TTT	p.F788F	RAPGEF4_uc002uhw.3_Silent_p.F644F	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	788	Ras-GEF.				blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GGGAACTCTTCAACTGCGTGC	0.428			NA											17	67					0	0	0.006122	0	0
EVX2	344191	broad.mit.edu	37	2	176948612	176948612	+	Translation_Start_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:176948612T>C	uc010zeu.1	-	1	79	c.-107A>G	c.(-109--105)ATAAT>ATGAT			NM_001080458	NP_001073927	Q03828	EVX2_HUMAN	even-skipped homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		TAAATATTATTATCGCTTTCG	0.493			NA											5	7					0	0	0.000602	0	0
FKBP7	51661	broad.mit.edu	37	2	179341873	179341873	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:179341873C>T	uc002umk.2	-	2	418	c.289G>A	c.(289-291)GAC>AAC	p.D97N	FKBP7_uc002umm.2_Missense_Mutation_p.D97N|FKBP7_uc002uml.2_RNA|FKBP7_uc010zff.1_Missense_Mutation_p.D93N	NM_181342	NP_851939	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7 isoform a precursor	97	PPIase FKBP-type.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			ATAGCAATGTCTAGGCCTTTT	0.398	Melanoma(26;682 927 5286 17599 46613)		NA											6	76					0	0	0.001168	0	0
TTN	7273	broad.mit.edu	37	2	179402290	179402290	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:179402290C>T	uc010zfg.1	-	304	92164	c.91940G>A	c.(91939-91941)CGG>CAG	p.R30647Q	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R24342Q|TTN_uc010zfi.1_Missense_Mutation_p.R24275Q|TTN_uc010zfj.1_Missense_Mutation_p.R24150Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31574							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACATGAAGCCGAAGTGTGGA	0.433			NA											7	31					0	0	0.00308	0	0
TTN	7273	broad.mit.edu	37	2	179428787	179428787	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:179428787T>C	uc010zfg.1	-	275	74592	c.74368A>G	c.(74368-74370)AAG>GAG	p.K24790E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K18485E|TTN_uc010zfi.1_Missense_Mutation_p.K18418E|TTN_uc010zfj.1_Missense_Mutation_p.K18293E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	25717							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTATAGACTTTGTACCACCA	0.418			NA											32	125					0	0	0.009535	0	0
TTN	7273	broad.mit.edu	37	2	179457128	179457128	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:179457128G>A	uc010zfg.1	-	250	52124	c.51900C>T	c.(51898-51900)GTC>GTT	p.V17300V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.V10995V|TTN_uc010zfi.1_Silent_p.V10928V|TTN_uc010zfj.1_Silent_p.V10803V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18227							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTTACTGAGACAGTTTTTG	0.323			NA											15	132					0	0	0.003163	0	0
TTN	7273	broad.mit.edu	37	2	179468719	179468719	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:179468719T>G	uc010zfg.1	-	231	47215	c.46991A>C	c.(46990-46992)AAT>ACT	p.N15664T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.N9359T|TTN_uc010zfi.1_Missense_Mutation_p.N9292T|TTN_uc010zfj.1_Missense_Mutation_p.N9167T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16591							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACGAGGAACATTAAATTCCAC	0.468			NA											49	225					0	0	0.00361	0	0
TTN	7273	broad.mit.edu	37	2	179468741	179468741	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:179468741C>T	uc010zfg.1	-	231	47193	c.46969G>A	c.(46969-46971)GGA>AGA	p.G15657R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G9352R|TTN_uc010zfi.1_Missense_Mutation_p.G9285R|TTN_uc010zfj.1_Missense_Mutation_p.G9160R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16584							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTTCAATCCCACTTTGGTT	0.473			NA											55	266					0	0	0.00361	0	0
TTN	7273	broad.mit.edu	37	2	179593385	179593385	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:179593385T>A	uc010zfg.1	-	63	15760	c.15536A>T	c.(15535-15537)AAA>ATA	p.K5179I	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.K1840I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6106							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACTATTTGTTTCCCGTCTTT	0.403			NA											8	40					0	0	0.00308	0	0
SESTD1	91404	broad.mit.edu	37	2	180008389	180008389	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:180008389C>T	uc002uni.3	-	9	929	c.779G>A	c.(778-780)CGC>CAC	p.R260H		NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	260					regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTCCTGGTAGCGGGTATATTG	0.438			NA											6	109					0	0	0.001984	0	0
CERKL	375298	broad.mit.edu	37	2	182438611	182438611	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:182438611C>A	uc002unx.2	-	3	583	c.482G>T	c.(481-483)GGC>GTC	p.G161V	CERKL_uc002uny.2_Missense_Mutation_p.G161V|CERKL_uc010zfm.1_Intron|CERKL_uc002unz.2_5'UTR|CERKL_uc002uoa.2_Missense_Mutation_p.G161V|CERKL_uc002uob.2_Intron|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_Intron|CERKL_uc002uod.1_5'UTR|CERKL_uc002uoe.2_Missense_Mutation_p.G161V	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	161					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GTTTGGAAAGCCTAAGAAGAA	0.338			NA											12	61					1.05317e-09	1.25014e-09	0.00245	1	0
NCKAP1	10787	broad.mit.edu	37	2	183848087	183848087	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:183848087C>T	uc002upc.2	-	11	1430	c.1028G>A	c.(1027-1029)CGC>CAC	p.R343H	NCKAP1_uc002upb.2_Missense_Mutation_p.R349H	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	343					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding	p.R349L(1)		ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TAAAAACTTGCGTCTTTCTCT	0.343			NA											10	48					0	0	0.001855	0	0
FAM171B	165215	broad.mit.edu	37	2	187627130	187627130	+	Missense_Mutation	SNP	C	C	G	rs142301733	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:187627130C>G	uc002ups.2	+	8	2173	c.2061C>G	c.(2059-2061)CAC>CAG	p.H687Q	FAM171B_uc002upr.1_Missense_Mutation_p.H654Q|FAM171B_uc002upt.2_Missense_Mutation_p.H156Q	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	687	Cytoplasmic (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						AAGTGAGGCACTCCTTTATAG	0.522			NA											37	53					0	0	0.004878	0	0
ZSWIM2	151112	broad.mit.edu	37	2	187702270	187702270	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:187702270C>A	uc002upu.1	-	5	546	c.506G>T	c.(505-507)GGC>GTC	p.G169V		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	169	RING-type 1.				apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AATACTATTGCCACAGCCAAA	0.289			NA											11	40					1.5842e-08	1.83838e-08	0.001855	1	0
PMS1	5378	broad.mit.edu	37	2	190738243	190738243	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:190738243A>T	uc002urh.3	+	12	3024	c.2495A>T	c.(2494-2496)TAC>TTC	p.Y832F	PMS1_uc002urk.3_Missense_Mutation_p.Y793F|PMS1_uc002uri.3_Missense_Mutation_p.Y670F|PMS1_uc010zgc.1_Missense_Mutation_p.Y656F|PMS1_uc010zgd.1_Missense_Mutation_p.Y656F|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.T665S|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Missense_Mutation_p.Y455F|PMS1_uc002urm.2_RNA	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	832					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			ACTGAAAATTACTTGGAAATA	0.279			NA	Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					14	34					0	0	0.00499	0	0
DNAH7	56171	broad.mit.edu	37	2	196661411	196661411	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:196661411C>T	uc002utj.3	-	56	10505	c.10404G>A	c.(10402-10404)GGG>GGA	p.G3468G	DNAH7_uc002uti.3_5'Flank	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3468	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TAGCAATGGGCCCTTGGCCTT	0.408			NA											8	28					0	0	0.004482	0	0
DNAH7	56171	broad.mit.edu	37	2	196749432	196749432	+	Silent	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:196749432T>A	uc002utj.3	-	35	5741	c.5640A>T	c.(5638-5640)CCA>CCT	p.P1880P		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1880					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						GATCTGAAATTGGACTTTCCA	0.363			NA											17	56					0	0	0.00499	0	0
SGOL2	151246	broad.mit.edu	37	2	201437494	201437494	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:201437494A>G	uc002uvw.2	+	7	2538	c.2425A>G	c.(2425-2427)AGA>GGA	p.R809G	SGOL2_uc010zhd.1_Missense_Mutation_p.R809G|SGOL2_uc010zhe.1_Missense_Mutation_p.R809G	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	809					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						TAAGAAGCCTAGACTAAATGT	0.333			NA											15	58					0	0	0.004007	0	0
AOX1	316	broad.mit.edu	37	2	201485502	201485502	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:201485502T>C	uc002uvx.2	+	17	1935	c.1834T>C	c.(1834-1836)TTG>CTG	p.L612L	AOX1_uc010zhf.1_Silent_p.L168L|AOX1_uc010fsu.2_Intron	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	612					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GGAACTTTTCTTGACTTTTGT	0.453			NA											9	45					0	0	0.006214	0	0
AOX1	316	broad.mit.edu	37	2	201507471	201507471	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:201507471A>G	uc002uvx.2	+	25	2895	c.2794A>G	c.(2794-2796)ACC>GCC	p.T932A	AOX1_uc010zhf.1_Missense_Mutation_p.T488A|AOX1_uc010fsu.2_Missense_Mutation_p.T298A	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	932					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	AGCGCTGATCACCGAATCTTG	0.463			NA											17	56					0	0	0.010504	0	0
ALS2	57679	broad.mit.edu	37	2	202626489	202626489	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:202626489C>A	uc002uyo.2	-	4	584	c.228G>T	c.(226-228)GAG>GAT	p.E76D	ALS2_uc002uyp.3_Missense_Mutation_p.E76D|ALS2_uc002uyq.2_Missense_Mutation_p.E76D|ALS2_uc002uyr.2_Missense_Mutation_p.E76D	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	76	RCC1 1.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						TTGGACAAATCTCCACTGGTC	0.413			NA											25	107					3.28513e-13	4.06232e-13	0.003954	1	0
FASTKD2	22868	broad.mit.edu	37	2	207631781	207631781	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:207631781C>T	uc002vbu.2	+	2	774	c.364C>T	c.(364-366)CCT>TCT	p.P122S	MDH1B_uc010ziw.1_5'Flank|MDH1B_uc002vbs.2_5'Flank|MDH1B_uc010fui.2_5'Flank|MDH1B_uc010fuj.2_5'Flank|MDH1B_uc002vbt.2_5'Flank|FASTKD2_uc002vbv.2_Missense_Mutation_p.P122S|FASTKD2_uc002vbx.2_Missense_Mutation_p.P122S|FASTKD2_uc002vbw.1_Missense_Mutation_p.P122S	NM_001136193	NP_001129665	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	122					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|skin(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		GTCTCTTGTCCCTGTTGATAA	0.363			NA											19	30					0	0	0.006122	0	0
CPO	130749	broad.mit.edu	37	2	207804357	207804357	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:207804357G>T	uc002vby.2	+	1	80	c.34G>T	c.(34-36)GGG>TGG	p.G12W		NM_173077	NP_775100	Q8IVL8	CBPO_HUMAN	carboxypeptidase O precursor	12					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		TTATCTTTTGGGGATGCTGGT	0.418			NA											22	105					8.24728e-16	1.03842e-15	0.004656	1	0
C2orf67	151050	broad.mit.edu	37	2	210993811	210993811	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:210993811G>A	uc002vds.2	-	3	1382	c.1174C>T	c.(1174-1176)CTA>TTA	p.L392L	C2orf67_uc002vdt.2_Silent_p.L392L|C2orf67_uc002vdw.2_Silent_p.L392L|C2orf67_uc002vdv.2_Silent_p.L392L|C2orf67_uc002vdx.1_Silent_p.L392L	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	392										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		TTGCATTCTAGGTCTGAAATC	0.408			NA											26	82					0	0	0.003954	0	0
CPS1	1373	broad.mit.edu	37	2	211456690	211456690	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:211456690T>C	uc002vee.3	+	10	1215	c.1083T>C	c.(1081-1083)AAT>AAC	p.N361N	CPS1_uc010fur.2_Silent_p.N367N|CPS1_uc010fus.2_5'Flank	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	361	Glutamine amidotransferase type-1.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		ATCAAACAAATGAGGTAAATG	0.338			NA											4	15					0	0	0.001168	0	0
CPS1	1373	broad.mit.edu	37	2	211457612	211457612	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:211457612C>T	uc002vee.3	+	11	1228	c.1096C>T	c.(1096-1098)CAT>TAT	p.H366Y	CPS1_uc010fur.2_Missense_Mutation_p.H372Y|CPS1_uc010fus.2_5'Flank	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	366	Glutamine amidotransferase type-1.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		GGGGATTATGCATGAGAGCAA	0.428			NA											30	83					0	0	0.002445	0	0
ERBB4	2066	broad.mit.edu	37	2	212293190	212293190	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:212293190C>T	uc002veg.1	-	22	2760	c.2662G>A	c.(2662-2664)GCT>ACT	p.A888T	ERBB4_uc002veh.1_Missense_Mutation_p.A888T|ERBB4_uc010zji.1_Missense_Mutation_p.A878T|ERBB4_uc010zjj.1_Missense_Mutation_p.A878T	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	888	Protein kinase.|Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CACTCCAGAGCCATCCATTTA	0.308			NA								TSP Lung(8;0.080)			12	79					0	0	0.001855	0	0
ABCA12	26154	broad.mit.edu	37	2	215876787	215876787	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:215876787G>A	uc002vew.2	-	16	2249	c.2029C>T	c.(2029-2031)CTC>TTC	p.L677F	ABCA12_uc002vev.2_Missense_Mutation_p.L359F|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	677					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATCTGATTGAGAATCTCTTTT	0.403	Ovarian(66;664 1488 5121 34295)		NA											9	164					0	0	0.001368	0	0
PRKAG3	53632	broad.mit.edu	37	2	219691724	219691724	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:219691724T>C	uc002vjb.1	-	10	1114	c.1095A>G	c.(1093-1095)ACA>ACG	p.T365T	PRKAG3_uc010zkn.1_RNA|PRKAG3_uc010fvy.1_Missense_Mutation_p.Q407R	NM_017431	NP_059127	Q9UGI9	AAKG3_HUMAN	AMP-activated protein kinase, non-catalytic	365	CBS 3.				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding			ovary(1)|lung(1)	2		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGATGGGTGCTGTCTCCAGCA	0.597			NA											19	110					0	0	0.007413	0	0
PAX3	5077	broad.mit.edu	37	2	223085040	223085040	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:223085040G>T	uc010fwo.2	-	7	1358	c.992C>A	c.(991-993)CCT>CAT	p.P331H	PAX3_uc002vmt.1_Missense_Mutation_p.P331H|PAX3_uc002vmy.1_Missense_Mutation_p.P330H|PAX3_uc002vmv.1_Missense_Mutation_p.P331H|PAX3_uc002vmw.1_Missense_Mutation_p.P331H|PAX3_uc002vmx.1_Missense_Mutation_p.P331H	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	331					apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGCGGTTGAGGTCTGTGAAC	0.498			NA	T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						19	76					1.01871e-10	1.22324e-10	0.008871	1	0
SLC19A3	80704	broad.mit.edu	37	2	228563570	228563570	+	Silent	SNP	G	G	A	rs137869730		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:228563570G>A	uc002vpi.2	-	3	950	c.861C>T	c.(859-861)TTC>TTT	p.F287F	SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_Silent_p.F283F	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN	solute carrier family 19, member 3	287	Helical; (Potential).				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	CTGCTGTGGCGAAAGCCCACC	0.458			NA											20	78					0	0	0.008871	0	0
UGT1A10	54575	broad.mit.edu	37	2	234545503	234545503	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:234545503C>T	uc002vur.2	+	1	381	c.335C>T	c.(334-336)TCA>TTA	p.S112L	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Missense_Mutation_p.S112L	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	112					flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTAATGAGTTCATCCAGTGGT	0.383			NA											27	113					0	0	0.004656	0	0
TRPM8	79054	broad.mit.edu	37	2	234869468	234869469	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:234869468_234869469CC>AA	uc002vvh.2	+	12	1451_1452	c.1411_1412CC>AA	c.(1411-1413)CCC>AAC	p.P471N	TRPM8_uc010fyj.2_Missense_Mutation_p.P159N	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	471	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	AAAGGACAGACCCAAGTTTGTC	0.436			NA											22	65					0	0	0.004672	0	0
ASB18	401036	broad.mit.edu	37	2	237103581	237103582	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:237103581_237103582GG>TT	uc010znh.1	-	6	1334_1335	c.1334_1335CC>AA	c.(1333-1335)CCC>CAA	p.P445Q		NM_212556	NP_997721	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box-containing 18	445	SOCS box.				intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		AGGGTAACAGGGGGATGAGGTC	0.54			NA											4	26					0	0	0.004672	0	0
COL6A3	1293	broad.mit.edu	37	2	238249452	238249452	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:238249452T>G	uc002vwl.2	-	38	8392	c.8107A>C	c.(8107-8109)AGC>CGC	p.S2703R	COL6A3_uc002vwo.2_Missense_Mutation_p.S2497R|COL6A3_uc010znj.1_Missense_Mutation_p.S2096R|COL6A3_uc002vwj.2_Missense_Mutation_p.S84R	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2703	VWFA 12.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ATTCCCCTGCTGAGGAAGTCC	0.552			NA											6	81					0	0	0.001168	0	0
AGXT	189	broad.mit.edu	37	2	241808422	241808422	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:241808422G>T	uc002waa.3	+	1	261	c.140G>T	c.(139-141)GGG>GTG	p.G47V	AGXT_uc010zoi.1_Missense_Mutation_p.G47V	NM_000030	NP_000021	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	47					glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	CAGATGATCGGGTCCATGAGC	0.642			NA											19	82					3.73194e-20	4.80593e-20	0.010504	1	0
ANO7	50636	broad.mit.edu	37	2	242128062	242128062	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:242128062A>T	uc002wax.2	+	1	139	c.36A>T	c.(34-36)CAA>CAT	p.Q12H	ANO7_uc002waw.2_Missense_Mutation_p.Q12H	NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	12	Cytoplasmic (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						CGGGGCTCCAAGGGCCACCCC	0.677			NA											12	55					0	0	0.001368	0	0
SCRT2	85508	broad.mit.edu	37	20	644454	644454	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:644454T>C	uc002wec.2	-	2	1363	c.785A>G	c.(784-786)CAC>CGC	p.H262R	SRXN1_uc002web.2_Intron	NM_033129	NP_149120	Q9NQ03	SCRT2_HUMAN	scratch 2 protein	262	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAAGGCCGAGTGCGTCTGCAT	0.682			NA											3	11					0	0	0.004672	0	0
MACROD2	140733	broad.mit.edu	37	20	15480436	15480436	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:15480436G>T	uc002wou.2	+	8	853	c.589G>T	c.(589-591)GCT>TCT	p.A197S	MACROD2_uc002wot.2_Missense_Mutation_p.A197S|MACROD2_uc002woz.2_5'UTR	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	197	Macro.										0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CAACGAGCCTGCTGCAGTCAT	0.438			NA											33	24					1.57351e-24	2.04754e-24	0.003755	1	0
CST11	140880	broad.mit.edu	37	20	23433365	23433365	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:23433365C>T	uc002wtf.1	-	1	118	c.84G>A	c.(82-84)AAG>AAA	p.K28K	CST11_uc002wtg.1_Silent_p.K28K	NM_130794	NP_570612	Q9H112	CST11_HUMAN	cystatin 11 isoform 1 precursor	28					defense response to bacterium	cytoplasm|nucleus	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					GAAAGGTTTTCTTCCTTGCTT	0.507			NA											22	86					0	0	0.010504	0	0
TTLL9	164395	broad.mit.edu	37	20	30497577	30497577	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:30497577G>A	uc010gdx.1	+	6	609	c.356G>A	c.(355-357)CGG>CAG	p.R119Q	TTLL9_uc002wwy.1_RNA|TTLL9_uc002wwz.1_RNA|TTLL9_uc002wxa.1_RNA|TTLL9_uc002wxb.1_RNA|TTLL9_uc010zto.1_RNA|TTLL9_uc002wxc.2_Intron|TTLL9_uc010ztp.1_RNA|TTLL9_uc010ztq.1_RNA	NM_001008409	NP_001008409	Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	119	TTL.				protein modification process	cilium|microtubule|microtubule basal body	ATP binding|tubulin-tyrosine ligase activity			ovary(2)	2			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AACCTGAAGCGGTTCCGGAAG	0.597			NA											10	30					0	0	0.006214	0	0
PHF20	51230	broad.mit.edu	37	20	34526967	34526967	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:34526967G>T	uc002xek.1	+	16	2760	c.2649G>T	c.(2647-2649)CTG>CTT	p.L883L		NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	883					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					CCCCGCGCCTGGGCTGGCCTC	0.607			NA											11	51					2.27111e-07	2.58487e-07	0.001368	1	0
C20orf4	25980	broad.mit.edu	37	20	34828453	34828453	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:34828453G>A	uc002xfc.1	+	2	756	c.663G>A	c.(661-663)ACG>ACA	p.T221T	C20orf4_uc002xfd.1_Silent_p.T221T|C20orf4_uc002xfe.1_Silent_p.T221T	NM_015511	NP_056326	Q9Y312	CT004_HUMAN	hypothetical protein LOC25980	221											0	Breast(12;0.0162)	Myeloproliferative disorder(115;0.0393)				AGGGTGCCACGCCAGCTGAGA	0.607			NA											14	96					0	0	0.001855	0	0
PLCG1	5335	broad.mit.edu	37	20	39795149	39795149	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:39795149T>C	uc002xjp.1	+	18	2155	c.2034T>C	c.(2032-2034)GCT>GCC	p.A678A	PLCG1_uc002xjo.1_Silent_p.A678A|PLCG1_uc010zwe.1_Silent_p.A304A|PLCG1_uc010ggf.2_Silent_p.A28A	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	678	SH2 2.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				GAGCACAGGCTGAGCACATGC	0.637			NA											5	48					0	0	0.000602	0	0
CHD6	84181	broad.mit.edu	37	20	40074364	40074364	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:40074364G>A	uc002xka.1	-	25	3996	c.3818C>T	c.(3817-3819)CCA>CTA	p.P1273L	CHD6_uc002xkb.1_Missense_Mutation_p.P39L	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1273					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CCAGTCCACTGGGATCTCCAT	0.498			NA											19	51					0	0	0.00278	0	0
IFT52	51098	broad.mit.edu	37	20	42271134	42271134	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:42271134T>G	uc002xkw.2	+	13	1258	c.1136T>G	c.(1135-1137)CTG>CGG	p.L379R	IFT52_uc002xky.2_Missense_Mutation_p.L379R|IFT52_uc002xkx.2_RNA|IFT52_uc010ggn.2_Missense_Mutation_p.L355R|IFT52_uc002xkz.2_Intron	NM_016004	NP_057088	Q9Y366	IFT52_HUMAN	intraflagellar transport 52 homolog	379						intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding			ovary(2)	2		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GAAGAAGACCTGGAATTTTAT	0.413			NA											12	72					0	0	0.001368	0	0
MYBL2	4605	broad.mit.edu	37	20	42341662	42341662	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:42341662G>A	uc002xlb.1	+	12	1955	c.1740G>A	c.(1738-1740)AAG>AAA	p.K580K	MYBL2_uc010zwj.1_Silent_p.K556K	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	580	Bipartite nuclear localization signal.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GCCCCATCAAGAAAGTCCGGA	0.552			NA											8	17					0	0	0.006214	0	0
SERINC3	10955	broad.mit.edu	37	20	43132458	43132458	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:43132458A>G	uc002xme.2	-	8	1187	c.1053T>C	c.(1051-1053)TCT>TCC	p.S351S	SERINC3_uc002xmf.1_Silent_p.S351S|SERINC3_uc010ggs.1_Silent_p.S344S|SERINC3_uc010zwp.1_Silent_p.S296S	NM_198941	NP_945179	Q13530	SERC3_HUMAN	tumor differentially expressed protein 1	351	Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			skin(3)	3		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			TAACTTACCTAGAATACAAGA	0.363			NA											19	90					0	0	0.010504	0	0
DDX27	55661	broad.mit.edu	37	20	47858627	47858627	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:47858627A>G	uc002xuh.2	+	18	2154	c.2093A>G	c.(2092-2094)GAA>GGA	p.E698G		NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	698						nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TAGGCAGAGGAAAGGTCTCAG	0.602			NA											22	152					0	0	0.002299	0	0
PFDN4	5203	broad.mit.edu	37	20	52831911	52831911	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:52831911T>C	uc002xwx.2	+	3	343	c.205T>C	c.(205-207)TAT>CAT	p.Y69H		NM_002623	NP_002614	Q9NQP4	PFD4_HUMAN	prefoldin subunit 4	69					'de novo' posttranslational protein folding	prefoldin complex	chaperone binding|unfolded protein binding				0	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		Colorectal(105;0.124)|STAD - Stomach adenocarcinoma(23;0.206)			AATGATACCTTATCAAATTGG	0.328			NA											6	90					0	0	0.001168	0	0
GNAS	2778	broad.mit.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:57484421G>A	uc002xzw.2	+	8	2816	c.2531G>A	c.(2530-2532)CGT>CAT	p.R844H	GNAS_uc002xzt.2_3'UTR|GNAS_uc010gjq.2_Missense_Mutation_p.R142H|GNAS_uc002xzx.2_Missense_Mutation_p.R142H|GNAS_uc010gjr.2_Missense_Mutation_p.R92H|GNAS_uc002xzy.2_Missense_Mutation_p.R127H|GNAS_uc002yaa.2_Missense_Mutation_p.R187H|GNAS_uc010zzt.1_Missense_Mutation_p.R202H|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_Missense_Mutation_p.R92H|GNAS_uc002yae.2_Missense_Mutation_p.R126H	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	201	GTP (By similarity).		R -> L (in non-MAS endocrine tumors).|R -> S (in AIMAH, pituitary tumor and polyostotic fibrous dysplasia).|R -> H (in MAS, somatotrophinoma and AIMAH).|R -> G (in MAS).		activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	p.R201H(37)|p.R201L(1)|p.R844H(1)		pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423	Colon(117;935 1597 6045 8307 46442)		NA	Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			20	82					0	0	0.002299	0	0
HRH3	11255	broad.mit.edu	37	20	60791154	60791154	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:60791154G>T	uc002ycf.2	-	3	1543	c.1246C>A	c.(1246-1248)CAC>AAC	p.H416N	HRH3_uc002ycg.2_Missense_Mutation_p.H336N|HRH3_uc002ych.2_Intron|HRH3_uc002yci.2_Missense_Mutation_p.H416N	NM_007232	NP_009163	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	416	Helical; Name=7; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|neurotransmitter secretion	integral to plasma membrane	histamine receptor activity				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Histamine Phosphate(DB00667)	AAGCTGTGGTGGCACAGAGGG	0.627			NA											4	22					0.00024832	0.000264478	0.009096	1	0
COL9A3	1299	broad.mit.edu	37	20	61458629	61458629	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:61458629G>A	uc002ydm.2	+	16	832	c.829G>A	c.(829-831)GGC>AGC	p.G277S		NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor	277	Triple-helical region 3 (COL3).				axon guidance	collagen type IX					0	Breast(26;5.68e-08)					AGGGTTCCGCGGCCCCAAGGG	0.602			NA											13	48					0	0	0.00245	0	0
COL9A3	1299	broad.mit.edu	37	20	61468525	61468525	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:61468525C>A	uc002ydm.2	+	30	1697	c.1694C>A	c.(1693-1695)CCA>CAA	p.P565Q	COL9A3_uc002ydn.2_Missense_Mutation_p.P59Q	NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor	565	Triple-helical region 2 (COL2).		Missing.|Missing.		axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CCTGGGCCCCCAGGACCCCCA	0.667			NA											13	191					5.50884e-06	6.04854e-06	0.001368	1	0
DIDO1	11083	broad.mit.edu	37	20	61510873	61510873	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:61510873C>A	uc002ydr.1	-	16	6699	c.6435G>T	c.(6433-6435)CGG>CGT	p.R2145R	DIDO1_uc002yds.1_Silent_p.R2145R	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	2145	Arg-rich.				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					tgtcccagtcccggctggagt	0.219	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)		NA											14	30					2.32078e-09	2.73137e-09	0.003163	1	0
TPTE	7179	broad.mit.edu	37	21	10942989	10942989	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:10942989T>A	uc002yip.1	-	12	966	c.598A>T	c.(598-600)ATT>TTT	p.I200F	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.I182F|TPTE_uc002yir.1_Missense_Mutation_p.I162F|TPTE_uc010gkv.1_Missense_Mutation_p.I62F	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	200					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AACAGAATAATAAGTCGTAGA	0.303			NA											7	68					0	0	0.001984	0	0
SAMSN1	64092	broad.mit.edu	37	21	15870868	15870868	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:15870868C>A	uc002yju.1	-	7	896	c.814G>T	c.(814-816)GAT>TAT	p.D272Y	SAMSN1_uc010gky.1_Missense_Mutation_p.D104Y|SAMSN1_uc002yjv.1_Missense_Mutation_p.D340Y	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	272	SAM.				negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TCTTTTAAATCTTCTAGAGTC	0.303			NA											13	45					7.93312e-07	8.86685e-07	0.00245	1	0
GABPA	2551	broad.mit.edu	37	21	27136661	27136661	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:27136661G>T	uc002ylx.3	+	8	1470	c.943G>T	c.(943-945)GGA>TGA	p.G315*	GABPA_uc002yly.3_Nonsense_Mutation_p.G315*	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha	315					positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						GAACAGAACAGGTATTTTTGT	0.323			NA											14	21					3.27435e-08	3.77506e-08	0.00245	1	0
CYYR1	116159	broad.mit.edu	37	21	27840881	27840881	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:27840881G>T	uc002ymd.2	-	4	726	c.404C>A	c.(403-405)ACC>AAC	p.T135N	CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_Missense_Mutation_p.T136N	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN	cysteine and tyrosine-rich 1 protein precursor	135	Cytoplasmic (Potential).					integral to membrane					0						ACCCTGTGGGGTGGGGGAGTA	0.532			NA											29	67					7.01153e-11	8.45189e-11	0.007291	1	0
RNF160	26046	broad.mit.edu	37	21	30325585	30325585	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:30325585G>A	uc002ymr.2	-	17	3344	c.3331C>T	c.(3331-3333)CGT>TGT	p.R1111C		NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	1065							ligase activity|zinc ion binding				0						CCAAGTACACGTAAGTTATCA	0.318			NA											12	106					0	0	0.001368	0	0
KRTAP6-3	337968	broad.mit.edu	37	21	31964831	31964831	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:31964831G>T	uc002yom.2	+	1	73	c.67G>T	c.(67-69)GGG>TGG	p.G23W		NM_181605	NP_853636			keratin associated protein 6-3												0						CCATGGCTATGggtgctgtgg	0.244			NA											13	70					3.41278e-10	4.07047e-10	0.00499	1	0
KRTAP11-1	337880	broad.mit.edu	37	21	32253380	32253380	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:32253380C>T	uc002yov.2	-	1	495	c.464G>A	c.(463-465)TGC>TAC	p.C155Y		NM_175858	NP_787054	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	155						keratin filament	structural molecule activity			pancreas(1)	1						GCTGGACACGCAGGACTGCTG	0.582			NA											22	62					0	0	0.00278	0	0
SFRS15	57466	broad.mit.edu	37	21	33068519	33068519	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:33068519A>G	uc002ypd.2	-	9	1401	c.975T>C	c.(973-975)GAT>GAC	p.D325D	SFRS15_uc002ype.2_Silent_p.D325D|SFRS15_uc010glu.2_Silent_p.D310D|SFRS15_uc002ypf.1_5'UTR	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	325						nucleus	nucleotide binding|RNA binding				0						GCTGCATGCCATCTCCAGGAA	0.423			NA											24	123					0	0	0.00333	0	0
C21orf62	56245	broad.mit.edu	37	21	34166092	34166092	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:34166092A>G	uc010glz.2	-	4	1013	c.641T>C	c.(640-642)GTT>GCT	p.V214A	C21orf49_uc002yqs.2_Intron|C21orf49_uc002yqu.3_Intron|C21orf49_uc002yqt.2_Intron|C21orf62_uc011adt.1_Missense_Mutation_p.V214A|C21orf62_uc011adu.1_Missense_Mutation_p.V214A	NM_001162495	NP_001155967	Q9NYP8	CU062_HUMAN	hypothetical protein LOC56245	214										ovary(1)	1		Myeloproliferative disorder(46;0.0255)				AAATGTGACAACATAGCTTTT	0.368			NA											26	70					0	0	0.005443	0	0
UMODL1	89766	broad.mit.edu	37	21	43547904	43547904	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:43547904G>A	uc002zaf.1	+	20	3653	c.3653G>A	c.(3652-3654)CGC>CAC	p.R1218H	UMODL1_uc002zad.1_Missense_Mutation_p.R1146H|UMODL1_uc002zae.1_Missense_Mutation_p.R1274H|UMODL1_uc002zag.1_Missense_Mutation_p.R1346H|UMODL1_uc002zal.1_Missense_Mutation_p.R168H|UMODL1_uc010gpa.1_RNA	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	1218	Extracellular (Potential).|ZP.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						TGCAAACTCCGCGTCTGCATG	0.468	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)		NA											17	50					0	0	0.00499	0	0
TRPM2	7226	broad.mit.edu	37	21	45811243	45811243	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:45811243T>C	uc002zet.1	+	12	1742	c.1529T>C	c.(1528-1530)CTG>CCG	p.L510P	TRPM2_uc002zeu.1_Missense_Mutation_p.L510P|TRPM2_uc002zew.1_Missense_Mutation_p.L510P|TRPM2_uc010gpt.1_Missense_Mutation_p.L510P|TRPM2_uc002zex.1_Missense_Mutation_p.L296P|TRPM2_uc002zey.1_Missense_Mutation_p.L23P	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	510	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GGGGTGCAGCTGAAGGAGTTT	0.562			NA											7	89					0	0	0.001984	0	0
KRTAP10-2	386679	broad.mit.edu	37	21	45971263	45971263	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:45971263A>G	uc002zfi.1	-	1	126	c.79T>C	c.(79-81)TGT>CGT	p.C27R	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2	27	22 X 5 AA repeats of C-C-X(3).|1.					keratin filament				large_intestine(1)	1						GGGAGCTCACAGCAGCTCTCT	0.687			NA											22	75					0	0	0.002299	0	0
PCBP3	54039	broad.mit.edu	37	21	47360050	47360050	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:47360050G>T	uc002zhq.1	+	13	1141	c.1016G>T	c.(1015-1017)CGT>CTT	p.R339L	PCBP3_uc002zhp.1_Missense_Mutation_p.R319L|PCBP3_uc002zhs.1_Missense_Mutation_p.R313L|PCBP3_uc002zhr.1_Missense_Mutation_p.R338L|PCBP3_uc002zht.1_Missense_Mutation_p.R329L	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	339	KH 3.				mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		TCCTCAGAGCGTCAGATCACC	0.557			NA											11	55					5.50884e-06	6.04854e-06	0.001368	1	0
PCNT	5116	broad.mit.edu	37	21	47777012	47777012	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:47777012A>C	uc002zji.3	+	13	2167	c.2060A>C	c.(2059-2061)GAG>GCG	p.E687A	PCNT_uc002zjj.2_Missense_Mutation_p.E569A	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	687	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CTTCAGACTGAGCTCAAAGAA	0.478			NA											16	35					0	0	0.003163	0	0
PCNT	5116	broad.mit.edu	37	21	47783492	47783492	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr21:47783492A>T	uc002zji.3	+	14	2359	c.2252A>T	c.(2251-2253)GAC>GTC	p.D751V	PCNT_uc002zjj.2_Missense_Mutation_p.D633V	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	751	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					AAAGAAACGGACTGGAAAGTT	0.408			NA											11	92					0	0	0.008291	0	0
GAB4	128954	broad.mit.edu	37	22	17447184	17447184	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:17447184C>G	uc002zlw.2	-	6	1202	c.1094G>C	c.(1093-1095)GGC>GCC	p.G365A	GAB4_uc010gqs.1_3'UTR	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	365										large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GGTAGGGGAGCCTGGGTTCAT	0.577			NA											11	36					0	0	0.000978	0	0
SLC25A18	83733	broad.mit.edu	37	22	18064154	18064154	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:18064154G>T	uc002zmp.1	+	5	668	c.174G>T	c.(172-174)GCG>GCT	p.A58A	SLC25A18_uc010gqx.2_Silent_p.A58A|SLC25A18_uc002zmq.1_Silent_p.A58A	NM_031481	NP_113669	Q9H1K4	GHC2_HUMAN	solute carrier	58	Solcar 1.					integral to membrane|mitochondrial inner membrane	binding|symporter activity				0				Lung(27;0.124)	L-Glutamic Acid(DB00142)	CGGCTCGGGCGGAGGGCTTCT	0.642	Colon(118;1560 1625 18964 29606 50093)		NA											14	120					2.5808e-16	3.2594e-16	0.006122	1	0
COMT	1312	broad.mit.edu	37	22	19950324	19950324	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:19950324T>G	uc002zqu.2	+	3	524	c.275T>G	c.(274-276)GTG>GGG	p.V92G	COMT_uc002zqt.2_Missense_Mutation_p.V92G|COMT_uc002zqv.2_Missense_Mutation_p.V92G|COMT_uc002zqw.2_Missense_Mutation_p.V92G|COMT_uc011ahd.1_Missense_Mutation_p.V92G|COMT_uc002zqx.2_Missense_Mutation_p.V92G	NM_000754	NP_000745	P21964	COMT_HUMAN	catechol-O-methyltransferase isoform MB-COMT	92		S-adenosyl-L-methionine; via amide nitrogen.			neurotransmitter biosynthetic process|neurotransmitter catabolic process|xenobiotic metabolic process	cytosol|integral to membrane|intracellular membrane-bounded organelle|microsome|plasma membrane|soluble fraction	catechol O-methyltransferase activity|magnesium ion binding|protein binding			ovary(1)	1	Colorectal(54;0.0993)				Carbidopa(DB00190)|Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Folic Acid(DB00158)|L-Valine(DB00161)|Levodopa(DB01235)|Methyldopa(DB00968)|Modafinil(DB00745)|Morphine(DB00295)|S-Adenosylmethionine(DB00118)|Tolcapone(DB00323)	GCCATGAACGTGGGCGACAAG	0.612			NA											7	31					0	0	0.00308	0	0
DGCR8	54487	broad.mit.edu	37	22	20079413	20079413	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:20079413G>T	uc002zri.2	+	7	1876	c.1526G>T	c.(1525-1527)GGG>GTG	p.G509V	DGCR8_uc010grz.2_Missense_Mutation_p.G509V|DGCR8_uc002zrj.2_Missense_Mutation_p.G152V	NM_022720	NP_073557	Q8WYQ5	DGCR8_HUMAN	DiGeorge syndrome critical region gene 8	509	Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.				primary miRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding				0	Colorectal(54;0.0993)					AACCCCAACGGGAAATCCGAG	0.473			NA											11	21					1.58986e-06	1.77063e-06	0.008291	1	0
PI4KA	5297	broad.mit.edu	37	22	21157563	21157563	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:21157563C>T	uc002zsz.3	-	13	1564	c.1333G>A	c.(1333-1335)GTG>ATG	p.V445M	PI4KA_uc010gsq.1_Missense_Mutation_p.V503M	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	445					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GACGGTGTCACAGAGTGCACC	0.552	GBM(136;1332 1831 3115 23601 50806)		NA											15	81					0	0	0.00245	0	0
SLC7A4	6545	broad.mit.edu	37	22	21385901	21385901	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:21385901A>T	uc002zud.2	-	2	269	c.201T>A	c.(199-201)GCT>GCA	p.A67A	SLC7A4_uc002zue.2_Silent_p.A67A	NM_004173	NP_004164	O43246	CTR4_HUMAN	solute carrier family 7 (cationic amino acid	67	Helical; (Potential).				cellular amino acid metabolic process	integral to membrane	basic amino acid transmembrane transporter activity			ovary(1)|lung(1)	2	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CAGCAGGGCCAGCCACCTCCT	0.662			NA											12	37					0	0	0.001368	0	0
CCDC157	550631	broad.mit.edu	37	22	30771484	30771484	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:30771484C>T	uc011aku.1	+	10	2349	c.1689C>T	c.(1687-1689)AGC>AGT	p.S563S	CCDC157_uc011akv.1_Silent_p.S563S|uc003aho.1_5'Flank	NM_001017437	NP_001017437	Q569K6	CC157_HUMAN	coiled-coil domain containing 157	563										central_nervous_system(1)	1						GATCCAGCAGCGTGGAATCCC	0.582			NA											12	71					0	0	0.001855	0	0
PES1	23481	broad.mit.edu	37	22	30985197	30985197	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:30985197G>C	uc003aij.1	-	2	159	c.85C>G	c.(85-87)CTG>GTG	p.L29V	PES1_uc003aik.1_Missense_Mutation_p.L29V|PES1_uc003ail.1_Missense_Mutation_p.L29V|PES1_uc003aim.1_Missense_Mutation_p.L29V|PES1_uc003ain.1_5'UTR|PES1_uc003aio.1_5'UTR	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	29	Sufficient for nucleolar localization.|Required for 28S ribosomal RNA processing.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						GCCAAGCTCAGCTGGAGCTTC	0.498			NA											3	27					0	0	0.004672	0	0
LARGE	9215	broad.mit.edu	37	22	33700296	33700296	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:33700296G>A	uc003and.3	-	13	2228	c.1649C>T	c.(1648-1650)GCC>GTC	p.A550V	LARGE_uc011amd.1_Missense_Mutation_p.A349V|LARGE_uc003ane.3_Missense_Mutation_p.A550V|LARGE_uc010gwp.2_Missense_Mutation_p.A498V|LARGE_uc011ame.1_Missense_Mutation_p.A482V|LARGE_uc011amf.1_Missense_Mutation_p.A550V	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	550	Lumenal (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				GTGCTTCATGGCCACGTTGCG	0.572	Colon(70;397 1175 4573 19089 45288)		NA											7	112					0	0	0.001984	0	0
LGALS1	3956	broad.mit.edu	37	22	38075703	38075703	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:38075703A>G	uc003atn.2	+	4	452	c.355A>G	c.(355-357)AAC>GAC	p.N119D		NM_002305	NP_002296	P09382	LEG1_HUMAN	galectin-1	119	Galectin.				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of apoptosis	cytoplasm|extracellular space|proteinaceous extracellular matrix	galactoside binding|signal transducer activity				0	Melanoma(58;0.0574)					GGAGGCCATCAACTACATGGC	0.562	Pancreas(23;406 890 14304 26016)		NA											21	76					0	0	0.00333	0	0
BAIAP2L2	80115	broad.mit.edu	37	22	38503887	38503887	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:38503887C>T	uc003auw.2	-	4	392	c.248G>A	c.(247-249)CGG>CAG	p.R83Q		NM_025045	NP_079321	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	83	IMD.				filopodium assembly|signal transduction		cytoskeletal adaptor activity|SH3 domain binding			pancreas(1)	1	Melanoma(58;0.045)					GTTCAAGTGCCGCTGGGTGTC	0.622			NA											20	89					0	0	0.010504	0	0
DNAL4	10126	broad.mit.edu	37	22	39176983	39176983	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:39176983T>G	uc003awj.2	-	3	329	c.101A>C	c.(100-102)GAG>GCG	p.E34A	SUN2_uc010gxr.1_Intron	NM_005740	NP_005731	O96015	DNAL4_HUMAN	dynein light chain 4, axonemal	34					microtubule-based movement|nerve growth factor receptor signaling pathway	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|plasma membrane	ATPase activity, coupled|microtubule motor activity				0	Melanoma(58;0.04)					CTCCATGGTCTCCACGCGCAT	0.577			NA											9	38					0	0	0.008291	0	0
EP300	2033	broad.mit.edu	37	22	41556648	41556648	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:41556648A>T	uc003azl.3	+	20	3988	c.3593A>T	c.(3592-3594)TAT>TTT	p.Y1198F		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1198					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	p.Y1198_L1243del(1)		haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						GCCGACAGGTATCATTTCTGT	0.502			NA	T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybsyndrome				13	50					0	0	0.00245	0	0
MCAT	27349	broad.mit.edu	37	22	43533109	43533109	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:43533109C>A	uc003bdl.1	-	3	756	c.707G>T	c.(706-708)AGG>ATG	p.R236M	MCAT_uc003bdm.1_Intron	NM_173467	NP_775738	Q8IVS2	FABD_HUMAN	mitochondrial malonyltransferase isoform a	236					fatty acid biosynthetic process	mitochondrion	[acyl-carrier-protein] S-malonyltransferase activity|binding			ovary(1)	1		Ovarian(80;0.0694)				TGAAATCACCCTGCAATCTGG	0.527			NA									OREG0026613	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	223					8.00594e-06	8.78253e-06	0.007413	1	0
IL17REL	400935	broad.mit.edu	37	22	50437719	50437719	+	Splice_Site	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:50437719C>T	uc003bje.1	-	9	833	c.601_splice	c.e9+1	p.D201_splice		NM_001001694	NP_001001694	Q6ZVW7	I17EL_HUMAN	interleukin 17 receptor E-like											pancreas(1)	1		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		AGGACACTTGCCGTTTTCAAA	0.647			NA											18	58					0	0	0.008871	0	0
CNTN6	27255	broad.mit.edu	37	3	1424651	1424651	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:1424651G>T	uc003boz.2	+	18	2459	c.2192G>T	c.(2191-2193)GGG>GTG	p.G731V	CNTN6_uc011asj.1_Missense_Mutation_p.G659V|CNTN6_uc003bpa.2_Missense_Mutation_p.G731V	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	731	Fibronectin type-III 2.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CTGCAGAATGGGGAGGGATTT	0.393			NA											13	49					9.31168e-06	1.0188e-05	0.001855	1	0
CNTN4	152330	broad.mit.edu	37	3	3084680	3084680	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:3084680A>G	uc003bpc.2	+	21	2752	c.2531A>G	c.(2530-2532)GAA>GGA	p.E844G	CNTN4_uc003bpb.1_Missense_Mutation_p.E515G|CNTN4_uc003bpe.2_Missense_Mutation_p.E516G|CNTN4_uc003bpf.2_Missense_Mutation_p.E515G|CNTN4_uc003bpg.2_Missense_Mutation_p.E100G	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	844	Fibronectin type-III 3.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TGGAGACATGAAGACAAAGAA	0.363			NA											3	18					0	0	0.009096	0	0
BRPF1	7862	broad.mit.edu	37	3	9781262	9781262	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:9781262C>T	uc003bse.2	+	3	1578	c.1179C>T	c.(1177-1179)GGC>GGT	p.G393G	BRPF1_uc003bsf.2_Silent_p.G393G|BRPF1_uc003bsg.2_Silent_p.G393G|BRPF1_uc011ati.1_Silent_p.G393G	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	393	C4-type.				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					AACAACGGGGCTCAGGGGCCT	0.557			NA											9	82					0	0	0.004482	0	0
HACL1	26061	broad.mit.edu	37	3	15621450	15621450	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:15621450T>C	uc003caf.2	-	9	930	c.770A>G	c.(769-771)AAC>AGC	p.N257S	HACL1_uc011avr.1_RNA|HACL1_uc011avs.1_Missense_Mutation_p.N230S|HACL1_uc011avt.1_Missense_Mutation_p.N231S|HACL1_uc003cag.2_5'UTR|HACL1_uc011avu.1_Missense_Mutation_p.N175S|HACL1_uc010hep.2_Intron	NM_012260	NP_036392	Q9UJ83	HACL1_HUMAN	2-hydroxyphytanoyl-CoA lyase	257					fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0						GTATGGATGGTTGTCAGGGAC	0.428			NA											20	71					0	0	0.001882	0	0
SATB1	6304	broad.mit.edu	37	3	18458546	18458546	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:18458546A>G	uc003cbh.2	-	3	1971	c.236T>C	c.(235-237)GTG>GCG	p.V79A	SATB1_uc003cbi.2_Missense_Mutation_p.V79A|SATB1_uc003cbj.2_Missense_Mutation_p.V79A	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1	79					cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						ATGTTCCACCACACAGAAAAC	0.428			NA											19	69					0	0	0.010504	0	0
THRB	7068	broad.mit.edu	37	3	24231827	24231827	+	Splice_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:24231827T>C	uc003ccx.3	-	5	372	c.23_splice	c.e5-1	p.E8_splice	THRB_uc010hfe.2_Splice_Site_p.E8_splice|THRB_uc003ccy.3_Splice_Site_p.E8_splice|THRB_uc003ccz.3_Splice_Site_p.E3_splice|THRB_uc003cdc.2_Splice_Site_p.E3_splice|THRB_uc003cdd.2_Splice_Site_p.E3_splice|THRB_uc003cde.1_Splice_Site_p.E3_splice	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)	GGCCATTTTCTAAAGGGTTGA	0.463	Melanoma(21;896 1043 15021 37958)		NA											21	54					0	0	0.010504	0	0
TOP2B	7155	broad.mit.edu	37	3	25668743	25668743	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:25668743C>A	uc011awn.1	-	16	1994	c.1951G>T	c.(1951-1953)GAT>TAT	p.D651Y	TOP2B_uc003cdj.2_Missense_Mutation_p.D646Y	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	651					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						CTTTCCATATCAGCAAAATAT	0.333			NA											30	93					4.34311e-12	5.29689e-12	0.003271	1	0
ZNF860	344787	broad.mit.edu	37	3	32031830	32031830	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:32031830A>G	uc011axg.1	+	2	1808	c.1259A>G	c.(1258-1260)CAT>CGT	p.H420R		NM_001137674	NP_001131146	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	420	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGGAGAATCCATAATGAAGAG	0.358			NA											16	42					0	0	0.003163	0	0
OXSR1	9943	broad.mit.edu	37	3	38294360	38294360	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:38294360T>C	uc003chy.2	+	18	1904	c.1562T>C	c.(1561-1563)TTT>TCT	p.F521S	OXSR1_uc010hhb.2_Missense_Mutation_p.F455S	NM_005109	NP_005100	O95747	OXSR1_HUMAN	oxidative-stress responsive 1	521					intracellular protein kinase cascade|response to oxidative stress		ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTGATAGGATTTGCCCAGCTC	0.433			NA											16	42					0	0	0.006122	0	0
SCN10A	6336	broad.mit.edu	37	3	38835492	38835492	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:38835492G>T	uc003ciq.2	-	1	10	c.10C>A	c.(10-12)CCC>ACC	p.P4T		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	4					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GATCCAATGGGGAATTCCATC	0.473			NA											20	87					1.37657e-19	1.76541e-19	0.001882	1	0
ULK4	54986	broad.mit.edu	37	3	41831195	41831195	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:41831195C>A	uc003ckv.3	-	21	2352	c.2151G>T	c.(2149-2151)ATG>ATT	p.M717I	ULK4_uc003ckw.2_Missense_Mutation_p.M717I	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4	717							ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CACAGGACAACATGGCAGCGA	0.378			NA											23	64					9.86323e-18	1.25203e-17	0.003954	1	0
TRAK1	22906	broad.mit.edu	37	3	42264609	42264609	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:42264609G>T	uc003cky.2	+	16	2458	c.2242G>T	c.(2242-2244)GGC>TGC	p.G748C	TRAK1_uc011azi.1_Missense_Mutation_p.G727C	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein	748					endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1						GAAGGAGCGGGGCATTTCTGC	0.637	GBM(44;195 884 22595 31865 41850)		NA											11	36					3.07112e-06	3.39597e-06	0.000978	1	0
C3orf39	84892	broad.mit.edu	37	3	43122848	43122848	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:43122848G>A	uc003cmq.1	-	2	217	c.76C>T	c.(76-78)CGT>TGT	p.R26C	C3orf39_uc003cmr.1_Missense_Mutation_p.R26C	NM_032806	NP_116195	Q8NAT1	AGO61_HUMAN	glycosyltransferase precursor	26						extracellular region	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0571)|Kidney(284;0.0718)		GCATGCTCACGCAGCCGCACA	0.637			NA											5	28					0	0	0.000602	0	0
CELSR3	1951	broad.mit.edu	37	3	48680236	48680236	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:48680236A>C	uc003cul.2	-	30	8769	c.8488T>G	c.(8488-8490)TCT>GCT	p.S2830A	CELSR3_uc003cuf.1_Missense_Mutation_p.S2928A|CELSR3_uc010hkf.2_Missense_Mutation_p.S120A|CELSR3_uc010hkg.2_Missense_Mutation_p.S813A	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2830	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTGCTCACAGAGGAGACGGTG	0.652			NA											7	35					0	0	0.001984	0	0
CELSR3	1951	broad.mit.edu	37	3	48697504	48697504	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:48697504C>T	uc003cul.2	-	1	2845	c.2564G>A	c.(2563-2565)CGG>CAG	p.R855Q	CELSR3_uc003cuf.1_Missense_Mutation_p.R925Q	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	855	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AAAGACCGGCCGATGAGTGTT	0.348			NA											23	85					0	0	0.005443	0	0
LAMB2	3913	broad.mit.edu	37	3	49166678	49166678	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:49166678T>C	uc003cwe.2	-	12	1897	c.1598A>G	c.(1597-1599)CAG>CGG	p.Q533R	LAMB2_uc003cwf.1_Missense_Mutation_p.Q533R	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	533	Laminin EGF-like 5; truncated.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CAACACTTACTGGGGATCCAA	0.592			NA											7	70					0	0	0.006214	0	0
APEH	327	broad.mit.edu	37	3	49720357	49720357	+	Silent	SNP	G	G	A	rs41290718	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:49720357G>A	uc003cxf.2	+	20	2365	c.1965G>A	c.(1963-1965)TCG>TCA	p.S655S	APEH_uc010hkw.1_Silent_p.S660S	NM_001640	NP_001631	P13798	ACPH_HUMAN	N-acylaminoacyl-peptide hydrolase	655					proteolysis	cytoplasm|nuclear membrane	serine-type endopeptidase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGGACAAATCGCCCATCAGAT	0.597			NA											5	23					0	0	0.001168	0	0
TEX264	51368	broad.mit.edu	37	3	51733556	51733556	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:51733556T>C	uc010hls.2	+	5	784	c.615T>C	c.(613-615)CTT>CTC	p.L205L	TEX264_uc003dbk.3_Silent_p.L205L|TEX264_uc010hlt.2_Silent_p.L25L|TEX264_uc003dbl.3_Silent_p.L205L|TEX264_uc003dbm.3_Silent_p.L244L	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor	205						extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		GGCGGGGGCTTGTGGAGGCCA	0.577			NA											11	110					0	0	0.008291	0	0
ITIH1	3697	broad.mit.edu	37	3	52825838	52825838	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:52825838G>T	uc003dfs.2	+	22	2671	c.2647G>T	c.(2647-2649)GCC>TCC	p.A883S	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Missense_Mutation_p.G474V|ITIH1_uc010hmo.1_Missense_Mutation_p.A437S|ITIH1_uc003dfu.2_Missense_Mutation_p.A249S|ITIH3_uc003dfv.2_5'Flank|ITIH3_uc011bek.1_5'Flank	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	883	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GTGGCATGGGGCCGAGGTGTC	0.577			NA											7	19					0.00448238	0.00464673	0.004482	1	0
PRKCD	5580	broad.mit.edu	37	3	53218942	53218942	+	Silent	SNP	C	C	T	rs145324216		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:53218942C>T	uc003dgl.2	+	10	1193	c.840C>T	c.(838-840)TGC>TGT	p.C280C	PRKCD_uc003dgm.2_Silent_p.C280C|PRKCD_uc010hmt.1_Silent_p.C52C	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta	280	Phorbol-ester/DAG-type 2.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		CCAACCTCTGCGGCATCAACC	0.612			NA											16	67					0	0	0.003163	0	0
CACNA2D3	55799	broad.mit.edu	37	3	54798282	54798282	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:54798282G>A	uc003dhf.2	+	13	1332	c.1284G>A	c.(1282-1284)CAG>CAA	p.Q428Q	CACNA2D3_uc011beu.1_RNA|CACNA2D3_uc003dhg.1_Silent_p.Q334Q|CACNA2D3_uc003dhh.1_RNA|CACNA2D3_uc010hmv.1_Silent_p.Q162Q	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	428	Extracellular (Potential).|VWFA.					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CTGATGTGCAGGAGAATGTCA	0.483			NA											26	101					0	0	0.008361	0	0
ADAMTS9	56999	broad.mit.edu	37	3	64582668	64582668	+	Splice_Site	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:64582668C>T	uc003dmg.2	-	27	4050	c.4018_splice	c.e27-1	p.C1340_splice	ADAMTS9_uc011bfo.1_Splice_Site_p.C1312_splice|ADAMTS9_uc003dmh.1_Splice_Site_p.C1169_splice|ADAMTS9_uc011bfp.1_Splice_Site_p.C251_splice	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1						glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TACTGGAACACTAAACACATC	0.463			NA											14	52					0	0	0.004007	0	0
PDZRN3	23024	broad.mit.edu	37	3	73433717	73433717	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:73433717G>A	uc003dpl.1	-	10	2096	c.2000C>T	c.(1999-2001)CCT>CTT	p.P667L	PDZRN3_uc011bgh.1_Missense_Mutation_p.P324L|PDZRN3_uc010hoe.1_Missense_Mutation_p.P365L|PDZRN3_uc011bgf.1_Missense_Mutation_p.P384L|PDZRN3_uc011bgg.1_Missense_Mutation_p.P387L	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	667							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GGGGCCGCTAGGGTAGTACAG	0.652			NA											18	63					0	0	0.007413	0	0
ROBO2	6092	broad.mit.edu	37	3	77623817	77623817	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:77623817G>T	uc003dpy.3	+	14	2782	c.2139G>T	c.(2137-2139)CGG>CGT	p.R713R	ROBO2_uc003dpz.2_Silent_p.R717R|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.R717R	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	713	Fibronectin type-III 2.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TTAAAGTACGGCCATATTTTA	0.388			NA											4	58					0.00909568	0.00938228	0.009096	1	0
CADM2	253559	broad.mit.edu	37	3	86114764	86114764	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:86114764C>T	uc003dqj.2	+	9	1699	c.1073C>T	c.(1072-1074)GCT>GTT	p.A358V	CADM2_uc003dqk.2_Missense_Mutation_p.A327V|CADM2_uc003dql.2_Missense_Mutation_p.A360V	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	358	Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		GATCCTAATGCTTTGGCTGGC	0.368			NA											4	42					0	0	0.001168	0	0
CD47	961	broad.mit.edu	37	3	107778323	107778323	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:107778323G>T	uc003dwt.1	-	5	847	c.667C>A	c.(667-669)CTT>ATT	p.L223I	CD47_uc003dwu.1_Missense_Mutation_p.L223I|CD47_uc003dwv.1_Missense_Mutation_p.L223I|CD47_uc003dww.1_Missense_Mutation_p.L223I	NM_001777	NP_001768	Q08722	CD47_HUMAN	CD47 antigen isoform 1 precursor	223	Helical; (Potential).				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			TAGTAGTGAAGTAATATTAAT	0.289			NA											5	56					2.0095e-06	2.23198e-06	0.001984	1	0
DZIP3	9666	broad.mit.edu	37	3	108363619	108363619	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:108363619T>C	uc003dxd.2	+	14	2172	c.1750T>C	c.(1750-1752)TAT>CAT	p.Y584H	DZIP3_uc003dxf.1_Missense_Mutation_p.Y584H|DZIP3_uc011bhm.1_Missense_Mutation_p.Y35H|DZIP3_uc003dxe.1_Missense_Mutation_p.Y584H|DZIP3_uc003dxg.1_Missense_Mutation_p.Y307H	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	584					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GTTATCCTGCTATCAACAAGG	0.244			NA											4	62					0	0	0.009096	0	0
MORC1	27136	broad.mit.edu	37	3	108813783	108813783	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:108813783G>T	uc003dxl.2	-	7	643	c.556C>A	c.(556-558)CAG>AAG	p.Q186K	MORC1_uc011bhn.1_Missense_Mutation_p.Q186K	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	186					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						ACATCAAACTGCTGCATCAAT	0.333			NA											5	21					1.024e-07	1.17623e-07	0.000602	1	0
CD200	4345	broad.mit.edu	37	3	112066479	112066479	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:112066479C>A	uc003dyw.2	+	5	715	c.571C>A	c.(571-573)CCA>ACA	p.P191T	CD200_uc010hqd.1_Missense_Mutation_p.P50T|CD200_uc003dyx.2_Missense_Mutation_p.P166T|CD200_uc003dyy.2_Missense_Mutation_p.P50T|CD200_uc003dyz.2_Missense_Mutation_p.P92T	NM_001004196	NP_001004196	P41217	OX2G_HUMAN	CD200 antigen isoform b	166	Ig-like C2-type.|Extracellular (Potential).				regulation of immune response	integral to plasma membrane					0		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				CACTGCCCGCCCAGCCCCCAT	0.483			NA											40	96					2.32173e-10	2.77982e-10	0.004878	1	0
CCDC80	151887	broad.mit.edu	37	3	112324355	112324355	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:112324355T>C	uc003dzf.2	-	8	2980	c.2762A>G	c.(2761-2763)TAT>TGT	p.Y921C	CCDC80_uc011bhv.1_Missense_Mutation_p.Y894C|CCDC80_uc003dzg.2_Missense_Mutation_p.Y921C	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	921										ovary(2)	2						ATGGTAACCATAGCCTGCATA	0.458			NA											12	63					0	0	0.001368	0	0
C3orf30	152405	broad.mit.edu	37	3	118865972	118865972	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:118865972C>A	uc003ecb.1	+	1	976	c.936C>A	c.(934-936)GGC>GGA	p.G312G	IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Silent_p.G312G	NM_152539	NP_689752	Q96M34	CC030_HUMAN	hypothetical protein LOC152405	312										ovary(2)	2				GBM - Glioblastoma multiforme(114;0.222)		AAGTGTACGGCCAAGCCACTG	0.493			NA											6	46					2.7689e-08	3.20121e-08	0.001984	1	0
ITGB5	3693	broad.mit.edu	37	3	124482530	124482530	+	Silent	SNP	C	C	T	rs150931917	by1000genomes	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:124482530C>T	uc003eho.2	-	15	2637	c.2340G>A	c.(2338-2340)ACG>ACA	p.T780T	ITGB5_uc010hrx.2_RNA	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor	780	Cytoplasmic (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		CCACAGTGTGCGTGGAGATAG	0.498			NA											18	34					0	0	0.007413	0	0
PLXNA1	5361	broad.mit.edu	37	3	126751317	126751317	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:126751317G>T	uc003ejg.2	+	29	5254	c.5250G>T	c.(5248-5250)TTG>TTT	p.L1750F	PLXNA1_uc003ejh.2_Missense_Mutation_p.L418F	NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	1773	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		ACGCCTGCTTGTCGGTGGTGG	0.582			NA											5	96					0.00116845	0.00122973	0.001168	1	0
ACAD9	28976	broad.mit.edu	37	3	128623263	128623263	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:128623263T>C	uc003ela.3	+	11	1266	c.1064T>C	c.(1063-1065)GTC>GCC	p.V355A	ACAD9_uc010hsw.1_Missense_Mutation_p.V232A|ACAD9_uc011bks.1_Missense_Mutation_p.V232A|ACAD9_uc003elb.2_Missense_Mutation_p.V232A|ACAD9_uc003eld.1_RNA|ACAD9_uc003ele.2_Missense_Mutation_p.V7A	NM_014049	NP_054768	Q9H845	ACAD9_HUMAN	acyl-Coenzyme A dehydrogenase family, member 9	355						mitochondrion	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding			ovary(2)|central_nervous_system(1)	3						AAGGCTTACGTCATGGAGAGT	0.498			NA											26	80					0	0	0.004656	0	0
Unknown	0	broad.mit.edu	37	3	129134220	129134220	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:129134220C>A	uc003emg.2	-	4	869	c.706G>T	c.(706-708)GAG>TAG	p.E236*		NM_207307	NP_997190			hypothetical protein LOC90288												NA						TCCTCCACCTCTTGGTTCTTC	0.522			NA											6	19					5.9392e-07	6.67422e-07	0.001168	1	0
PLXND1	23129	broad.mit.edu	37	3	129291755	129291755	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:129291755C>T	uc003emx.2	-	14	2967	c.2867G>A	c.(2866-2868)GGA>GAA	p.G956E		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	956	IPT/TIG 1.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						TGAGAGTGGTCCTGGGGCTGG	0.667	Ovarian(97;366 1484 3738 22084 39045)		NA											4	29					0	0	0.000602	0	0
PIK3R4	30849	broad.mit.edu	37	3	130409378	130409378	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:130409378A>G	uc003enj.2	-	14	3800	c.3219T>C	c.(3217-3219)GCT>GCC	p.A1073A		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1073	WD 2.				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						GCAGCTTAGAAGCCTCAATTC	0.423			NA											8	79					0	0	0.00308	0	0
TOPBP1	11073	broad.mit.edu	37	3	133363056	133363056	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:133363056T>C	uc003eps.2	-	11	1788	c.1656A>G	c.(1654-1656)TTA>TTG	p.L552L		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	552	BRCT 4.				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						TTTGGCTAAATAAGCCTTCTT	0.358	Ovarian(21;193 658 4424 15423 17362)		NA						Other_conserved_DNA_damage_response_genes					12	20					0	0	0.000978	0	0
PRR23A	729627	broad.mit.edu	37	3	138724634	138724634	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:138724634G>A	uc011bms.1	-	1	477	c.477C>T	c.(475-477)GAC>GAT	p.D159D		NM_001134659	NP_001128131	A6NEV1	PR23A_HUMAN	proline rich 23A	159											0						CGGGGTCCGCGTCCTCCTCGT	0.642			NA											4	19					0	0	0.009096	0	0
ZIC4	84107	broad.mit.edu	37	3	147114079	147114079	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:147114079G>T	uc003ewd.1	-	3	521	c.248C>A	c.(247-249)GCG>GAG	p.A83E	ZIC4_uc003ewc.1_Missense_Mutation_p.A13E|ZIC4_uc011bno.1_Missense_Mutation_p.A133E	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	83						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GCTGCGGGCCGCAGGCCCTGG	0.716			NA											7	13					8.12818e-05	8.69429e-05	0.001984	1	0
SIAH2	6478	broad.mit.edu	37	3	150460419	150460419	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:150460419C>G	uc003eyi.2	-	2	1111	c.484G>C	c.(484-486)GAA>CAA	p.E162Q		NM_005067	NP_005058	O43255	SIAH2_HUMAN	seven in absentia homolog 2	162	SIAH-type.|SBD.				apoptosis|axon guidance|cell cycle|negative regulation of canonical Wnt receptor signaling pathway|small GTPase mediated signal transduction|ubiquitin-dependent protein catabolic process	cytosol|nucleus	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GGACGGTATTCACATATGTCT	0.542			NA											20	53					0	0	0.010504	0	0
CLRN1	7401	broad.mit.edu	37	3	150659515	150659515	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:150659515C>T	uc003eyk.1	-	2	578	c.287G>A	c.(286-288)AGC>AAC	p.S96N	CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Missense_Mutation_p.S20N|CLRN1_uc010hvj.1_RNA	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a	96					equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GACGTGGATGCTCACTGGGAT	0.383			NA											9	23					0	0	0.004482	0	0
CLRN1	7401	broad.mit.edu	37	3	150659548	150659548	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:150659548A>C	uc003eyk.1	-	2	545	c.254T>G	c.(253-255)TTT>TGT	p.F85C	CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Missense_Mutation_p.V9G|CLRN1_uc010hvj.1_RNA	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a	85					equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATCTGGAAAAACTGAAGATAA	0.368			NA											7	28					0	0	0.001984	0	0
MME	4311	broad.mit.edu	37	3	154832920	154832920	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:154832920G>T	uc010hvr.1	+	4	545	c.334G>T	c.(334-336)GAT>TAT	p.D112Y	MME_uc003fab.1_Missense_Mutation_p.D112Y|MME_uc003fac.1_Missense_Mutation_p.D112Y|MME_uc003fad.1_Missense_Mutation_p.D112Y|MME_uc003fae.1_Missense_Mutation_p.D112Y	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	112	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	CATTTTAAGAGATGAACTAGA	0.378			NA											19	59					1.00905e-13	1.25275e-13	0.008871	1	0
GOLIM4	27333	broad.mit.edu	37	3	167750317	167750317	+	Silent	SNP	C	C	T	rs137967362	by1000genomes	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:167750317C>T	uc003ffe.2	-	9	1511	c.1167G>A	c.(1165-1167)GCG>GCA	p.A389A	GOLIM4_uc011bpe.1_Silent_p.A389A|GOLIM4_uc011bpf.1_Silent_p.A361A|GOLIM4_uc011bpg.1_Silent_p.A361A	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	389	Glu-rich.|Lumenal (Potential).				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						CCTCAGCACGCGCGTGCCCTT	0.483			NA											41	162					0	0	0.00361	0	0
MYNN	55892	broad.mit.edu	37	3	169500335	169500335	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:169500335C>T	uc003fft.2	+	5	1732	c.1303C>T	c.(1303-1305)CGT>TGT	p.R435C	MYNN_uc011bpm.1_Missense_Mutation_p.R321C|MYNN_uc003ffu.2_Missense_Mutation_p.R435C|MYNN_uc003ffv.2_Missense_Mutation_p.R162C|MYNN_uc010hwo.2_Missense_Mutation_p.R435C|MYNN_uc003ffw.1_RNA	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin	435	C2H2-type 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			CTATCATGTCCGTAGGCATAC	0.423			NA											33	109					0	0	0.004289	0	0
LRRC31	79782	broad.mit.edu	37	3	169569568	169569568	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:169569568A>G	uc003fgc.1	-	7	1075	c.998T>C	c.(997-999)GTC>GCC	p.V333A	LRRC31_uc010hwp.1_Missense_Mutation_p.V277A	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	333										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			TAAAGGAATGACCTGGGCTGT	0.403			NA											16	82					0	0	0.004007	0	0
GNB4	59345	broad.mit.edu	37	3	179138686	179138686	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:179138686C>T	uc003fjv.3	-	3	367	c.87G>A	c.(85-87)ACG>ACA	p.T29T		NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4	29					cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			CCTGAACAAGCGTTGCATCAT	0.303	Melanoma(105;1405 1491 7265 20440 33721)		NA											10	50					0	0	0.008291	0	0
TTC14	151613	broad.mit.edu	37	3	180328098	180328098	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:180328098G>A	uc003fkk.2	+	12	2213	c.2081G>A	c.(2080-2082)CGT>CAT	p.R694H	TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	694							RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCTGGATCACGTGATTTCAGT	0.408			NA											8	84					0	0	0.006214	0	0
FXR1	8087	broad.mit.edu	37	3	180693108	180693108	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:180693108T>C	uc003fkq.2	+	16	1633	c.1611T>C	c.(1609-1611)GTT>GTC	p.V537V	FXR1_uc003fkp.2_Silent_p.V452V|FXR1_uc003fkr.2_Intron|FXR1_uc011bqj.1_Intron|FXR1_uc003fks.2_Silent_p.V480V|FXR1_uc011bqk.1_Intron|FXR1_uc011bql.1_Silent_p.V524V	NM_005087	NP_005078	P51114	FXR1_HUMAN	fragile X mental retardation-related protein 1	537					apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			CAGTCACAGTTGCAGATTATA	0.318			NA											4	22					0	0	0.009096	0	0
ATP11B	23200	broad.mit.edu	37	3	182605387	182605387	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:182605387G>A	uc003flb.2	+	24	2986	c.2729G>A	c.(2728-2730)AGC>AAC	p.S910N	ATP11B_uc003flc.2_Missense_Mutation_p.S494N|ATP11B_uc011bqm.1_Intron|ATP11B_uc010hxf.1_Missense_Mutation_p.S72N	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	910	Extracellular (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TTGTATGACAGCGTGTACCTG	0.308			NA											14	86					0	0	0.003163	0	0
MCF2L2	23101	broad.mit.edu	37	3	183036004	183036004	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:183036004G>C	uc003fli.1	-	7	695	c.605C>G	c.(604-606)GCC>GGC	p.A202G	MCF2L2_uc003flj.1_Missense_Mutation_p.A202G|MCF2L2_uc003flp.1_Missense_Mutation_p.A237G	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	202					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GTTTTCGATGGCCTGGAAGGT	0.458			NA											33	49					0	0	0.003755	0	0
RTP2	344892	broad.mit.edu	37	3	187419915	187419915	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:187419915A>G	uc003fro.1	-	1	431	c.2T>C	c.(1-3)ATG>ACG	p.M1T		NM_001004312	NP_001004312	Q5QGT7	RTP2_HUMAN	receptor transporting protein 2	1	Cytoplasmic (Potential).				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding				0	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		GCTGGTACACATGGTCCTGCT	0.532			NA											12	191					0	0	0.000978	0	0
IL1RAP	3556	broad.mit.edu	37	3	190322124	190322124	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:190322124G>A	uc003fsm.1	+	4	478	c.272G>A	c.(271-273)CGC>CAC	p.R91H	IL1RAP_uc003fsk.2_Missense_Mutation_p.R91H|IL1RAP_uc003fsl.2_Missense_Mutation_p.R91H|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Missense_Mutation_p.R91H|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Missense_Mutation_p.R91H|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Missense_Mutation_p.R91H	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform	91	Ig-like C2-type 1.|Extracellular (Potential).				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		CCCGAGAACCGCATTAGTAAG	0.527			NA											6	66					0	0	0.001168	0	0
TFRC	7037	broad.mit.edu	37	3	195798336	195798336	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr3:195798336G>A	uc003fvz.3	-	6	901	c.618C>T	c.(616-618)AAC>AAT	p.N206N	TFRC_uc003fwa.3_Silent_p.N206N|TFRC_uc010hzy.2_Silent_p.N125N|TFRC_uc011btr.1_Translation_Start_Site	NM_003234	NP_003225	P02786	TFR1_HUMAN	transferrin receptor	206	Extracellular (Potential).				cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)		CAAGTCTACCGTTCTTATCAA	0.388			NA	T	BCL6	NHL								28	127					0	0	0.002445	0	0
GAK	2580	broad.mit.edu	37	4	891922	891922	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:891922G>A	uc003gbm.3	-	6	749	c.550C>T	c.(550-552)CAA>TAA	p.Q184*	GAK_uc003gbn.3_Nonsense_Mutation_p.Q105*|GAK_uc010ibk.1_Nonsense_Mutation_p.Q78*|GAK_uc003gbl.3_Nonsense_Mutation_p.Q48*	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	184	Protein kinase.				cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		ATGGTCCCTTGGTTACTAAGC	0.537			NA											16	32					0	0	0.00499	0	0
WHSC1	7468	broad.mit.edu	37	4	1955101	1955101	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:1955101T>C	uc003gdz.3	+	12	2364	c.2188T>C	c.(2188-2190)TGT>CGT	p.C730R	WHSC1_uc003geb.3_Missense_Mutation_p.C730R|WHSC1_uc003gec.3_Missense_Mutation_p.C730R|WHSC1_uc003ged.3_Missense_Mutation_p.C730R|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_5'UTR|WHSC1_uc011bvh.1_5'UTR|WHSC1_uc010icf.2_Missense_Mutation_p.C78R	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	730	PHD-type 2.				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TGTTAAGCGCTGTGTGGTAAC	0.448			NA	T	IGH@	MM								12	155					0	0	0.001368	0	0
POLN	353497	broad.mit.edu	37	4	2083370	2083370	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:2083370G>A	uc003ger.2	-	20	2298	c.2298C>T	c.(2296-2298)TTC>TTT	p.F766F	POLN_uc010icg.1_Silent_p.F214F|POLN_uc010ich.1_Silent_p.F298F	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu	766					DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CTTGCACCACGAAGTTCACTG	0.567			NA						DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	37					0	0	0.000602	0	0
ZFYVE28	57732	broad.mit.edu	37	4	2355658	2355658	+	Splice_Site	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:2355658A>G	uc003gex.1	-	2	499	c.180_splice	c.e2+1	p.Q60_splice	ZFYVE28_uc011bvk.1_Splice_Site|ZFYVE28_uc011bvl.1_Splice_Site_p.Q60_splice|ZFYVE28_uc003gey.3_Splice_Site|ZFYVE28_uc003gez.2_Intron	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28						negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						CCCGTGGCTCACCTGACAGGA	0.672			NA											4	12					0	0	0.009096	0	0
MSX1	4487	broad.mit.edu	37	4	4864671	4864671	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:4864671T>C	uc003gif.2	+	2	948	c.713T>C	c.(712-714)CTG>CCG	p.L238P		NM_002448	NP_002439	P28360	MSX1_HUMAN	msh homeobox 1	232					apoptotic nuclear change|face morphogenesis|negative regulation of cell growth|odontogenesis of dentine-containing tooth|positive regulation of apoptosis|protein localization to nucleus|protein stabilization	nucleus	p53 binding|sequence-specific DNA binding transcription factor activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CTGGAGAAGCTGAAGATGGCC	0.652			NA											5	26					0	0	0.001168	0	0
WFS1	7466	broad.mit.edu	37	4	6303549	6303549	+	Missense_Mutation	SNP	G	G	A	rs143055296		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:6303549G>A	uc003giy.2	+	8	2193	c.2027G>A	c.(2026-2028)CGC>CAC	p.R676H	WFS1_uc003gix.2_Missense_Mutation_p.R676H|WFS1_uc003giz.2_Missense_Mutation_p.R494H	NM_001145853	NP_001139325	O76024	WFS1_HUMAN	wolframin	676					endoplasmic reticulum calcium ion homeostasis|endoplasmic reticulum unfolded protein response|ER overload response|ER-associated protein catabolic process|glucose homeostasis|kidney development|negative regulation of neuron apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|polyubiquitinated misfolded protein transport|positive regulation of calcium ion transport|positive regulation of growth|positive regulation of protein ubiquitination|positive regulation of proteolysis|protein stabilization|renal water homeostasis|sensory perception of sound|visual perception	dendrite|integral to endoplasmic reticulum membrane	activating transcription factor binding|ATPase binding|transporter activity|ubiquitin protein ligase binding			central_nervous_system(2)	2				Colorectal(103;0.0512)		TGCGGGCCACGCGCCTGGAAG	0.622			NA											14	69					0	0	0.001855	0	0
BOD1L	259282	broad.mit.edu	37	4	13617056	13617056	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:13617056A>T	uc003gmz.1	-	3	556	c.439T>A	c.(439-441)TTC>ATC	p.F147I	BOD1L_uc010idr.1_5'UTR|BOD1L_uc010ids.1_RNA	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	147							DNA binding			ovary(5)|breast(1)	6						TGAGGTCTGAATGTGTGGTTG	0.438			NA											8	63					0	0	0.004482	0	0
NCAPG	64151	broad.mit.edu	37	4	17824746	17824746	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:17824746G>A	uc003gpp.2	+	8	1435	c.1259G>A	c.(1258-1260)AGA>AAA	p.R420K	NCAPG_uc011bxj.1_5'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	420	HEAT 6.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		GAAGGAGGAAGGTATGTCTAA	0.294			NA											10	32					0	0	0.008291	0	0
PACRGL	133015	broad.mit.edu	37	4	20706396	20706396	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:20706396C>T	uc010iek.2	+	3	557	c.166C>T	c.(166-168)CCT>TCT	p.P56S	PACRGL_uc003gpu.2_RNA|PACRGL_uc010iei.1_Missense_Mutation_p.P104S|PACRGL_uc003gpz.2_Missense_Mutation_p.P56S|PACRGL_uc011bxm.1_Missense_Mutation_p.P56S|PACRGL_uc003gqa.2_Missense_Mutation_p.P56S|PACRGL_uc003gpx.3_RNA|PACRGL_uc003gpv.2_Missense_Mutation_p.P56S|PACRGL_uc003gpw.2_RNA|PACRGL_uc010iej.1_RNA|PACRGL_uc011bxn.1_Missense_Mutation_p.P56S|PACRGL_uc003gpy.2_Missense_Mutation_p.P56S	NM_145048	NP_659485	Q8N7B6	PACRL_HUMAN	PARK2 co-regulated-like isoform 1	56							binding				0						AAAACTTCATCCTAGACCAAG	0.393			NA											19	75					0	0	0.010504	0	0
PGM2	55276	broad.mit.edu	37	4	37836326	37836326	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:37836326C>T	uc011byb.1	+	3	409	c.336C>T	c.(334-336)TCC>TCT	p.S112S	PGM2_uc011bya.1_5'UTR|PGM2_uc011byc.1_Intron	NM_018290	NP_060760	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	112					glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1						CTCATCCATCCAGTGGGGGTA	0.358			NA											16	56					0	0	0.006122	0	0
ATP8A1	10396	broad.mit.edu	37	4	42509100	42509100	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:42509100C>T	uc003gwr.2	-	23	2251	c.2019G>A	c.(2017-2019)ACG>ACA	p.T673T	ATP8A1_uc003gwq.2_5'UTR|ATP8A1_uc003gws.2_Silent_p.T658T	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	673	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	CTTTCATTAGCGTTTCTATGG	0.373			NA											7	122					0	0	0.001984	0	0
FRYL	285527	broad.mit.edu	37	4	48530280	48530280	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:48530280G>A	uc003gyh.1	-	51	7582	c.6977C>T	c.(6976-6978)GCT>GTT	p.A2326V	FRYL_uc003gyg.1_Missense_Mutation_p.A1022V|FRYL_uc003gyi.1_Missense_Mutation_p.A1214V|FRYL_uc003gyj.1_Missense_Mutation_p.A621V	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2326					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TCTAGTGACAGCAATAACTTT	0.388			NA											8	46					0	0	0.00308	0	0
AASDH	132949	broad.mit.edu	37	4	57244594	57244594	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:57244594C>A	uc003hbn.2	-	4	541	c.388G>T	c.(388-390)GAT>TAT	p.D130Y	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_5'UTR|AASDH_uc003hbo.2_Missense_Mutation_p.D30Y|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Missense_Mutation_p.D130Y|AASDH_uc003hbp.2_Missense_Mutation_p.D130Y	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	130					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GTAAATGTATCATAGTTCAAT	0.303			NA											11	27					6.40141e-05	6.87682e-05	0.000978	1	0
UGT2B7	7364	broad.mit.edu	37	4	69978228	69978228	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:69978228A>G	uc003heg.3	+	6	1410	c.1364A>G	c.(1363-1365)AAG>AGG	p.K455R	UGT2B7_uc010ihq.2_3'UTR	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	455					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CAACCAGTGAAGCCCCTGGAT	0.373			NA											29	104					0	0	0.007291	0	0
UGT2B7	7364	broad.mit.edu	37	4	69978313	69978313	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:69978313C>T	uc003heg.3	+	6	1495	c.1449C>T	c.(1447-1449)CTC>CTT	p.L483L	UGT2B7_uc010ihq.2_3'UTR	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	483					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CCCACGACCTCACCTGGTTCC	0.478			NA											32	110					0	0	0.004289	0	0
UGT2B28	54490	broad.mit.edu	37	4	70152507	70152507	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:70152507G>A	uc003hej.2	+	3	910	c.908G>A	c.(907-909)GGT>GAT	p.G303D	UGT2B28_uc010ihr.2_Missense_Mutation_p.G303D	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	303					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	GGTGAAAATGGTGTTGTGGTG	0.413			NA											43	146					0	0	0.002852	0	0
AMTN	401138	broad.mit.edu	37	4	71394465	71394465	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:71394465T>G	uc003hfk.1	+	6	409	c.320T>G	c.(319-321)CTT>CGT	p.L107R	AMTN_uc010ihy.1_Missense_Mutation_p.L106R	NM_212557	NP_997722	Q6UX39	AMTN_HUMAN	amelotin precursor	107					biomineral tissue development|cell adhesion|odontogenesis of dentine-containing tooth	basal lamina|cell-cell junction				large_intestine(1)|central_nervous_system(1)	2			Lung(101;0.235)			GTCACACAACTTGGAGCCCAG	0.318			NA											3	31					0	0	0.004672	0	0
DCK	1633	broad.mit.edu	37	4	71889417	71889417	+	Silent	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:71889417T>G	uc003hfx.2	+	4	831	c.543T>G	c.(541-543)ACT>ACG	p.T181T	DCK_uc011cbb.1_Silent_p.T109T	NM_000788	NP_000779	P27707	DCK_HUMAN	deoxycytidine kinase	181					purine base metabolic process|purine-containing compound salvage|pyrimidine base metabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol|nucleus	ATP binding|deoxycytidine kinase activity|drug binding|phosphotransferase activity, alcohol group as acceptor|protein homodimerization activity			ovary(1)	1			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Decitabine(DB01262)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	TTCAAGCCACTCCAGAGGTAA	0.343			NA											9	24					0	0	0.004482	0	0
NPFFR2	10886	broad.mit.edu	37	4	72897682	72897682	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:72897682G>T	uc003hgg.2	+	1	162	c.64G>T	c.(64-66)GCA>TCA	p.A22S	NPFFR2_uc010iig.1_5'UTR	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	22	Extracellular (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			CGTCTCATCTGCACCGGACAA	0.637			NA											18	53					8.34094e-07	9.30594e-07	0.008871	1	0
CCDC158	339965	broad.mit.edu	37	4	77276548	77276548	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:77276548T>C	uc003hkb.3	-	14	2368	c.2215A>G	c.(2215-2217)AAA>GAA	p.K739E		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	739	Potential.									skin(3)|ovary(2)|pancreas(1)	6						TGACCTCTTTTGGCTGTGATT	0.423			NA											29	89					0	0	0.002096	0	0
SHROOM3	57619	broad.mit.edu	37	4	77677915	77677915	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:77677915A>C	uc011cbx.1	+	8	5976	c.5023A>C	c.(5023-5025)ATT>CTT	p.I1675L	SHROOM3_uc003hkg.2_Missense_Mutation_p.I1453L	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	1675	ASD2.				apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			GGCCAAGGAAATTGTCCACCA	0.458			NA											9	76					0	0	0.006214	0	0
SEPT11	55752	broad.mit.edu	37	4	77936159	77936159	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:77936159G>A	uc003hkj.2	+	5	838	c.676G>A	c.(676-678)GCA>ACA	p.A226T	SEPT11_uc010ijh.1_Missense_Mutation_p.A218T|SEPT11_uc011cca.1_Missense_Mutation_p.A236T|SEPT11_uc003hkk.1_Missense_Mutation_p.A26T	NM_018243	NP_060713	Q9NVA2	SEP11_HUMAN	septin 11	226					cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0						AGAGATTAACGCAACAATGAG	0.363			NA											17	48					0	0	0.006122	0	0
RASGEF1B	153020	broad.mit.edu	37	4	82380611	82380611	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:82380611G>T	uc003hmi.1	-	2	196	c.52C>A	c.(52-54)CGA>AGA	p.R18R	RASGEF1B_uc003hmj.1_Silent_p.R18R|RASGEF1B_uc010ijq.1_Silent_p.R18R|RASGEF1B_uc003hmk.2_Silent_p.R18R	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	18					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						TAGAGGTTTCGATTGTAACCA	0.428			NA											5	58					1.23904e-05	1.35089e-05	0.000602	1	0
HELQ	113510	broad.mit.edu	37	4	84358134	84358134	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:84358134T>C	uc003hom.2	-	9	2104	c.1925A>G	c.(1924-1926)TAT>TGT	p.Y642C	HELQ_uc010ikb.2_Missense_Mutation_p.Y575C|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	642	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						ACTGTGGTGATAGGCAACTCC	0.448			NA						Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					7	17					0	0	0.001984	0	0
MMRN1	22915	broad.mit.edu	37	4	90856406	90856406	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:90856406G>T	uc003hst.2	+	6	1646	c.1575G>T	c.(1573-1575)CAG>CAT	p.Q525H	MMRN1_uc010iku.2_Intron|MMRN1_uc011cds.1_Missense_Mutation_p.Q267H	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	525					cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CAACTGAACAGGTATCAGACC	0.363			NA											30	76					1.74807e-11	2.11949e-11	0.002096	1	0
GRID2	2895	broad.mit.edu	37	4	94344008	94344008	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:94344008A>T	uc011cdt.1	+	10	1692	c.1434A>T	c.(1432-1434)TTA>TTT	p.L478F	GRID2_uc011cdu.1_Missense_Mutation_p.L383F	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	478	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TGGATGCCTTATCTAACTACC	0.428			NA											10	31					0	0	0.008291	0	0
BMPR1B	658	broad.mit.edu	37	4	96051154	96051154	+	Nonsense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:96051154A>T	uc003htm.3	+	9	1001	c.727A>T	c.(727-729)AGA>TGA	p.R243*	BMPR1B_uc010ilb.2_Nonsense_Mutation_p.R243*|BMPR1B_uc003htn.3_Nonsense_Mutation_p.R243*	NM_001203	NP_001194	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	243	Cytoplasmic (Potential).|Protein kinase.				BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		CAGCTGGTTCAGAGAGACAGA	0.453			NA											10	49					0	0	0.006214	0	0
C4orf37	285555	broad.mit.edu	37	4	98865118	98865118	+	Nonsense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:98865118A>C	uc003htt.1	-	8	1064	c.974T>G	c.(973-975)TTA>TGA	p.L325*		NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555	325											0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		CAAGTTAGGTAATTCATCAGA	0.338			NA											11	75					0	0	0.000978	0	0
AGXT2L1	64850	broad.mit.edu	37	4	109677636	109677636	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:109677636G>T	uc003hzc.2	-	4	529	c.348C>A	c.(346-348)AAC>AAA	p.N116K	AGXT2L1_uc010imc.2_Missense_Mutation_p.N110K|AGXT2L1_uc011cfm.1_Missense_Mutation_p.N76K|AGXT2L1_uc011cfn.1_Missense_Mutation_p.N43K|AGXT2L1_uc011cfo.1_Missense_Mutation_p.N58K	NM_031279	NP_112569	Q8TBG4	AT2L1_HUMAN	alanine-glyoxylate aminotransferase 2-like 1	116					cellular amino acid metabolic process	mitochondrion	alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000281)		AGGCTAAGTCGTTGGCTTCGG	0.383			NA											11	37					1.61879e-10	1.94005e-10	0.001368	1	0
ANK2	287	broad.mit.edu	37	4	114278693	114278694	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:114278693_114278694GG>TT	uc003ibe.3	+	38	9019_9020	c.8919_8920GG>TT	c.(8917-8922)GTGGCA>GTTTCA	p.A2974S	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.A276S|ANK2_uc011cgb.1_Missense_Mutation_p.A2989S	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2941					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACGTTGTAGTGGCAAGCTCCTC	0.411			NA											59	125					0	0	0.004672	0	0
PRSS12	8492	broad.mit.edu	37	4	119234547	119234547	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:119234547C>T	uc003ica.1	-	7	1345	c.1298G>A	c.(1297-1299)GGT>GAT	p.G433D		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	433	SRCR 3.					membrane	scavenger receptor activity			skin(1)	1						TGCTTGTTTACCATATCTGTG	0.413			NA											15	43					0	0	0.004007	0	0
ANKRD50	57182	broad.mit.edu	37	4	125631202	125631202	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:125631202G>A	uc003ifg.3	-	1	731	c.465C>T	c.(463-465)CTC>CTT	p.L155L	ANKRD50_uc011cgo.1_Intron|ANKRD50_uc010inw.2_Silent_p.L155L	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	155										central_nervous_system(1)	1						CAGGCTGTAAGAGGCTTTGGA	0.443			NA											15	47					0	0	0.004007	0	0
FAT4	79633	broad.mit.edu	37	4	126241714	126241714	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:126241714A>T	uc003ifj.3	+	1	4148	c.4148A>T	c.(4147-4149)CAG>CTG	p.Q1383L		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1383	Cadherin 13.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TTTGAAACACAGTCTTTGTAT	0.363			NA											37	89					0	0	0.003271	0	0
NR3C2	4306	broad.mit.edu	37	4	149356882	149356882	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:149356882A>G	uc003ilj.3	-	2	1465	c.1131T>C	c.(1129-1131)ACT>ACC	p.T377T	NR3C2_uc003ilk.3_Silent_p.T377T|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	377	Modulating.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	CTACTTCCTCAGTCTTAGGAA	0.498	Melanoma(27;428 957 40335 51025 51111)		NA											19	72					0	0	0.008871	0	0
LRBA	987	broad.mit.edu	37	4	151509207	151509207	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:151509207T>C	uc010ipj.2	-	41	6830	c.6356A>G	c.(6355-6357)GAC>GGC	p.D2119G	LRBA_uc003ilt.3_Missense_Mutation_p.D767G|LRBA_uc003ilu.3_Missense_Mutation_p.D2108G	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	2119						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					CACCTTGGGGTCGATTTTTTT	0.448			NA											31	258					0	0	0.002836	0	0
TDO2	6999	broad.mit.edu	37	4	156835562	156835562	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:156835562C>G	uc003ipf.1	+	8	878	c.814C>G	c.(814-816)CGT>GGT	p.R272G		NM_005651	NP_005642	P48775	T23O_HUMAN	tryptophan 2,3-dioxygenase	272					tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	L-Tryptophan(DB00150)	TGATGAGAAACGTCATGAACA	0.348	Colon(57;928 1036 2595 6946 26094)		NA											8	34					0	0	0.008291	0	0
RXFP1	59350	broad.mit.edu	37	4	159520482	159520482	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:159520482C>A	uc003ipz.2	+	4	373	c.291C>A	c.(289-291)GTC>GTA	p.V97V	RXFP1_uc010iqj.1_5'UTR|RXFP1_uc011cja.1_Silent_p.V16V|RXFP1_uc010iqo.2_Silent_p.V97V|RXFP1_uc011cjb.1_Silent_p.V43V|RXFP1_uc010iqk.2_5'UTR|RXFP1_uc011cjc.1_Silent_p.V16V|RXFP1_uc011cjd.1_Silent_p.V16V|RXFP1_uc010iql.2_5'UTR|RXFP1_uc011cje.1_Silent_p.V124V|RXFP1_uc010iqm.2_Silent_p.V64V|RXFP1_uc011cjf.1_5'UTR|RXFP1_uc010iqn.2_Silent_p.V43V	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	97	Extracellular (Potential).|LRRNT.					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		ATTCAGTGGTCGGTTCTGTGC	0.443			NA											13	26					6.31663e-08	7.26909e-08	0.003163	1	0
TLL1	7092	broad.mit.edu	37	4	166981331	166981331	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:166981331A>T	uc003irh.1	+	15	2645	c.1998A>T	c.(1996-1998)GAA>GAT	p.E666D	TLL1_uc011cjn.1_Missense_Mutation_p.E689D|TLL1_uc011cjo.1_Missense_Mutation_p.E490D	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	666	CUB 3.				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTGAATTGGAAGGCAATGAAG	0.363			NA											12	42					0	0	0.001855	0	0
CLCN3	1182	broad.mit.edu	37	4	170641086	170641086	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:170641086G>A	uc003isi.2	+	13	2904	c.2395G>A	c.(2395-2397)GAT>AAT	p.D799N	CLCN3_uc003ish.2_Missense_Mutation_p.R824K|CLCN3_uc011cjz.1_Missense_Mutation_p.D782N|CLCN3_uc011cka.1_Missense_Mutation_p.D772N|uc003isk.1_5'Flank	NM_001829	NP_001820	P51790	CLCN3_HUMAN	chloride channel 3 isoform b	799	CBS 2.|ATP (By similarity).|Cytoplasmic (By similarity).				endosomal lumen acidification	cell surface|early endosome membrane|Golgi membrane|integral to membrane|late endosome membrane|transport vesicle membrane	antiporter activity|ATP binding|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|voltage-gated chloride channel activity			breast(2)|ovary(1)	3		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		AACAAAAAAAGATATCCTCCG	0.408			NA											10	45					0	0	0.001368	0	0
ADAM29	11086	broad.mit.edu	37	4	175897731	175897731	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:175897731C>A	uc003iuc.2	+	5	1725	c.1055C>A	c.(1054-1056)CCT>CAT	p.P352H	ADAM29_uc003iud.2_Missense_Mutation_p.P352H|ADAM29_uc010irr.2_Missense_Mutation_p.P352H|ADAM29_uc011cki.1_Missense_Mutation_p.P352H	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	352	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TGTTCACAACCTAGATGCATA	0.378	Ovarian(140;1727 1835 21805 25838 41440)		NA											11	123					0.00136819	0.00143632	0.001368	1	0
VEGFC	7424	broad.mit.edu	37	4	177650751	177650751	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:177650751G>T	uc003ius.1	-	2	727	c.297C>A	c.(295-297)CTC>CTA	p.L99L		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	99					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		TCCTTGAGTTGAGGTTGGCCT	0.373			NA											13	25					4.3838e-07	4.96219e-07	0.001855	1	0
AGA	175	broad.mit.edu	37	4	178354388	178354388	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:178354388G>A	uc003iuu.1	-	8	982	c.920C>T	c.(919-921)GCC>GTC	p.A307V	AGA_uc010irt.1_Intron	NM_000027	NP_000018	P20933	ASPG_HUMAN	aspartylglucosaminidase precursor	307					asparagine catabolic process via L-aspartate|protein deglycosylation|protein maturation	endoplasmic reticulum|intermediate filament cytoskeleton|lysosome|microtubule cytoskeleton	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		AGTCACATTGGCACATATAAC	0.343			NA											16	107					0	0	0.006122	0	0
C4orf41	60684	broad.mit.edu	37	4	184626132	184626132	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:184626132G>C	uc003ivx.2	+	27	3140	c.2964G>C	c.(2962-2964)AGG>AGC	p.R988S	C4orf41_uc003ivw.2_Missense_Mutation_p.R988S|C4orf41_uc010isc.2_Missense_Mutation_p.R332S|C4orf41_uc003ivy.2_Missense_Mutation_p.R594S	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	988											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		TCTGCCACAGGACCTCAGCAA	0.373			NA											7	111					0	0	0.004482	0	0
FRG1	2483	broad.mit.edu	37	4	190876261	190876261	+	Silent	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:190876261A>C	uc003izs.2	+	5	578	c.387A>C	c.(385-387)TCA>TCC	p.S129S		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	129					rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TTGGGCGTTCAGATGCAATTG	0.348			NA											8	169					0	0	0.000978	0	0
TPPP	11076	broad.mit.edu	37	5	666182	666182	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:666182A>T	uc003jbg.3	-	2	1086	c.368T>A	c.(367-369)CTC>CAC	p.L123H	TPPP_uc003jbh.3_Missense_Mutation_p.L123H	NM_007030	NP_008961	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	123					microtubule bundle formation|microtubule polymerization|positive regulation of protein polymerization	nucleus|perinuclear region of cytoplasm|soluble fraction	calcium ion binding|microtubule binding				0		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CTTCTTGGCGAGCTCCTCCAG	0.642			NA											14	67					0	0	0.003163	0	0
IRX4	50805	broad.mit.edu	37	5	1879636	1879636	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:1879636T>C	uc003jcz.2	-	4	837	c.718A>G	c.(718-720)AAG>GAG	p.K240E	IRX4_uc011cmf.1_Missense_Mutation_p.K101E	NM_016358	NP_057442	P78413	IRX4_HUMAN	iroquois homeobox 4	240					heart development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(108;0.242)		TTGGAGCTCTTGAGGGGctcc	0.502			NA											9	37					0	0	0.006214	0	0
NSUN2	54888	broad.mit.edu	37	5	6623375	6623375	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:6623375A>T	uc003jdu.2	-	5	554	c.489T>A	c.(487-489)GCT>GCA	p.A163A	NSUN2_uc003jdt.2_5'Flank|NSUN2_uc011cmk.1_Silent_p.A128A|NSUN2_uc003jdv.2_5'UTR	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	163						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TCATGCTAACAGCTTCTTGAC	0.418			NA											5	55					0	0	0.000602	0	0
ADCY2	108	broad.mit.edu	37	5	7690828	7690828	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:7690828C>T	uc003jdz.1	+	5	812	c.745C>T	c.(745-747)CCG>TCG	p.P249S	ADCY2_uc011cmo.1_Missense_Mutation_p.P69S	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	249	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CTCCCTGCTGCCGGCCCACAT	0.562			NA											5	24					0	0	0.000602	0	0
ROPN1L	83853	broad.mit.edu	37	5	10461362	10461362	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:10461362C>A	uc003jex.3	+	4	755	c.484C>A	c.(484-486)CGC>AGC	p.R162S		NM_031916	NP_114122	Q96C74	ROP1L_HUMAN	ropporin 1-like	162					ciliary or flagellar motility|signal transduction	cytoplasm|motile cilium	cAMP-dependent protein kinase regulator activity|protein binding			ovary(1)	1						CGGGCCCGCTCGCATCCCCTT	0.562			NA											58	69					5.99346e-17	7.5848e-17	0.00361	1	0
ANKH	56172	broad.mit.edu	37	5	14749341	14749341	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:14749341A>G	uc003jfm.3	-	6	1093	c.762T>C	c.(760-762)AGT>AGC	p.S254S		NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein	254	Cytoplasmic (Potential).				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						CAATAGGCCGACTGATTCTCT	0.493			NA											5	93					0	0	0.000602	0	0
PRDM9	56979	broad.mit.edu	37	5	23527517	23527517	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:23527517A>G	uc003jgo.2	+	11	2502	c.2320A>G	c.(2320-2322)AAG>GAG	p.K774E		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	774					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						CACAGGGGAGAAGCCCTATGT	0.577			NA								HNSCC(3;0.000094)			9	166					0	0	0.008291	0	0
CDH10	1008	broad.mit.edu	37	5	24505254	24505254	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:24505254A>G	uc003jgr.1	-	8	1692	c.1360T>C	c.(1360-1362)TGG>CGG	p.W454R	CDH10_uc011cnu.1_Intron	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	454	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		AGATTATGCCACTGAGATAGT	0.318			NA								HNSCC(23;0.051)			6	46					0	0	0.001168	0	0
ADAMTS12	81792	broad.mit.edu	37	5	33561216	33561216	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:33561216G>C	uc003jia.1	-	20	4204	c.4041C>G	c.(4039-4041)GAC>GAG	p.D1347E	ADAMTS12_uc010iuq.1_Missense_Mutation_p.D1262E	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1347	TSP type-1 5.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TGGCCGCACAGTCAGAATCCA	0.572			NA								HNSCC(64;0.19)			21	55					0	0	0.008871	0	0
RANBP3L	202151	broad.mit.edu	37	5	36249757	36249757	+	Nonstop_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:36249757C>A	uc003jkh.2	-	14	1890	c.1397G>T	c.(1396-1398)TGA>TTA	p.*466L	RANBP3L_uc011cow.1_Nonstop_Mutation_p.*491L	NM_145000	NP_659437	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like isoform 2	466					intracellular transport					ovary(1)	1	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			AGGTAGTATTCATGAACAGGC	0.313			NA											18	65					1.1804e-14	1.47431e-14	0.003954	1	0
GDNF	2668	broad.mit.edu	37	5	37816117	37816117	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:37816117C>A	uc011cpi.1	-	3	472	c.272G>T	c.(271-273)CGG>CTG	p.R91L	GDNF_uc011cpc.1_Intron|GDNF_uc011cpd.1_Missense_Mutation_p.R39L|GDNF_uc011cpe.1_Missense_Mutation_p.R65L|GDNF_uc011cpf.1_Missense_Mutation_p.R65L|GDNF_uc011cpg.1_Missense_Mutation_p.R108L|GDNF_uc011cph.1_Missense_Mutation_p.R82L	NM_000514	NP_000505	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor isoform 1	91					adult locomotory behavior|anti-apoptosis|axon guidance|branching involved in ureteric bud morphogenesis|enteric nervous system development|mRNA stabilization|negative regulation of neuron apoptosis|neural crest cell migration|peristalsis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of dopamine secretion|positive regulation of monooxygenase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|postganglionic parasympathetic nervous system development|regulation of dopamine uptake|signal transduction|sympathetic nervous system development	extracellular region	growth factor activity|protein homodimerization activity				0	all_lung(31;0.00118)					CTGCCGATTCCGCTCTCTTCT	0.478			NA											7	77					0.00307968	0.0032006	0.00308	1	0
RICTOR	253260	broad.mit.edu	37	5	38950335	38950335	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:38950335T>C	uc003jlp.2	-	31	3639	c.3615A>G	c.(3613-3615)GTA>GTG	p.V1205V	RICTOR_uc003jlo.2_Silent_p.V1205V|RICTOR_uc010ivf.2_Silent_p.V920V	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	1205					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					TTGAACTTTCTACTACTAACC	0.393			NA											53	160					0	0	0.00361	0	0
C5orf34	375444	broad.mit.edu	37	5	43490815	43490815	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:43490815T>C	uc003jnz.1	-	12	1914	c.1597A>G	c.(1597-1599)ACA>GCA	p.T533A		NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	533										breast(1)	1	Lung NSC(6;2.07e-05)					CACCATGATGTTACTGTTGTC	0.313			NA											14	21					0	0	0.003163	0	0
HCN1	348980	broad.mit.edu	37	5	45267329	45267329	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:45267329G>T	uc003jok.2	-	7	1670	c.1645C>A	c.(1645-1647)CGT>AGT	p.R549S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	549	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CTGGCAGTACGACGTCCTTTG	0.408			NA											20	66					1.01871e-10	1.22324e-10	0.008871	1	0
DHX29	54505	broad.mit.edu	37	5	54563598	54563598	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:54563598C>A	uc003jpx.2	-	22	3467	c.3347G>T	c.(3346-3348)GGT>GTT	p.G1116V	DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	1116							ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				ATCTTTTCGACCAATTGGTGT	0.383			NA											13	36					2.68362e-12	3.28585e-12	0.001368	1	0
MAP3K1	4214	broad.mit.edu	37	5	56171006	56171006	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:56171006A>T	uc003jqw.3	+	10	2335	c.1834A>T	c.(1834-1836)AGC>TGC	p.S612C		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	612					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAGCAGTGGAAGCAGCCCGAG	0.587			NA											12	47					0	0	0.000978	0	0
HTR1A	3350	broad.mit.edu	37	5	63256362	63256362	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:63256362A>G	uc011cqt.1	-	1	1185	c.1185T>C	c.(1183-1185)CTT>CTC	p.L395L		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	395	Helical; Name=7; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	TGACGGGGTTAAGCAGAGAGT	0.507			NA											44	171					0	0	0.00361	0	0
ADAMTS6	11174	broad.mit.edu	37	5	64556443	64556443	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:64556443C>T	uc003jtp.2	-	14	2628	c.1814G>A	c.(1813-1815)CGC>CAC	p.R605H	ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA|ADAMTS6_uc003jtr.1_Missense_Mutation_p.R226H	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1	605	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		GTTACAGGAGCGATACCGTTT	0.289			NA											8	47					0	0	0.004482	0	0
MRPS27	23107	broad.mit.edu	37	5	71593460	71593460	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:71593460C>T	uc003kbz.3	-	3	257	c.221G>A	c.(220-222)CGG>CAG	p.R74Q	MRPS27_uc003kca.3_Missense_Mutation_p.R18Q|MRPS27_uc011cse.1_Missense_Mutation_p.R74Q|MRPS27_uc010iza.2_Missense_Mutation_p.R18Q	NM_015084	NP_055899	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27	74						mitochondrion|ribosome					0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		TTTTCTTACCCGTGATATTGT	0.318			NA											5	22					0	0	0.001168	0	0
ZNF366	167465	broad.mit.edu	37	5	71756480	71756480	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:71756480C>A	uc003kce.1	-	2	1030	c.844G>T	c.(844-846)GCG>TCG	p.A282S		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	282	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TGCGTGCACGCGTGCGGCTTG	0.637			NA											21	94					1.85244e-09	2.18845e-09	0.00333	1	0
AGGF1	55109	broad.mit.edu	37	5	76326698	76326698	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:76326698T>C	uc003ket.2	+	1	467	c.107T>C	c.(106-108)CTG>CCG	p.L36P	AGGF1_uc003kes.2_Missense_Mutation_p.L36P|AGGF1_uc003keu.1_Intron	NM_018046	NP_060516	Q8N302	AGGF1_HUMAN	angiogenic factor VG5Q	36	Potential.				angiogenesis|cell adhesion|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|RNA processing|vasculogenesis	extracellular region|perinuclear region of cytoplasm	eukaryotic cell surface binding|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		GAACGTGAACTGCGGAGCTGC	0.522			NA											10	31					0	0	0.001855	0	0
ARSB	411	broad.mit.edu	37	5	78181601	78181601	+	Silent	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:78181601T>A	uc003kfq.2	-	5	2234	c.948A>T	c.(946-948)GGA>GGT	p.G316G	ARSB_uc003kfr.3_Silent_p.G316G	NM_000046	NP_000037	P15848	ARSB_HUMAN	arylsulfatase B isoform 1 precursor	316					lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		TCCATTTTCTTCCTCGAAGGG	0.532	Melanoma(169;563 1968 25780 26156 52266)		NA											41	96					0	0	0.00874	0	0
RASGRF2	5924	broad.mit.edu	37	5	80497209	80497209	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:80497209C>T	uc003kha.1	+	19	2854	c.2854C>T	c.(2854-2856)CGA>TGA	p.R952*	RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	952					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AGAAGTTTTGCGAGACCCAGA	0.403			NA											22	80					0	0	0.004656	0	0
EDIL3	10085	broad.mit.edu	37	5	83680311	83680311	+	Translation_Start_Site	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:83680311G>A	uc003kio.1	-	1	301	c.-118C>T	c.(-120--116)AACGT>AATGT		EDIL3_uc003kip.1_Translation_Start_Site	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		TCAAGAAGACGTTCTCTTTCC	0.587			NA											5	9					0	0	0.000602	0	0
NR2F1	7025	broad.mit.edu	37	5	92923832	92923832	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:92923832C>T	uc003kkj.2	+	2	2360	c.673C>T	c.(673-675)CGC>TGC	p.R225C		NM_005654	NP_005645	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	225					negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			urinary_tract(1)|ovary(1)|lung(1)	3		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		GCTGGCCGCGCGCCTGCTCTT	0.657			NA											22	55					0	0	0.001882	0	0
CAMK4	814	broad.mit.edu	37	5	110560255	110560256	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:110560255_110560256CC>AA	uc011cvj.1	+	2	173_174	c.74_75CC>AA	c.(73-75)ACC>AAA	p.T25K	CAMK4_uc003kpf.2_Missense_Mutation_p.T25K|CAMK4_uc010jbv.2_5'UTR	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	25					activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		GCCCCGGGGACCGCGAGCCTCG	0.644			NA											5	11					0	0	0.004672	0	0
YTHDC2	64848	broad.mit.edu	37	5	112915284	112915285	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:112915284_112915285GG>TT	uc003kqn.2	+	24	3429_3430	c.3246_3247GG>TT	c.(3244-3249)GTGGAT>GTTTAT	p.D1083Y		NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	1083							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		CTTGGACAGTGGATGGCATTCC	0.376			NA											16	81					0	0	0.004672	0	0
PRR16	51334	broad.mit.edu	37	5	120022249	120022249	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:120022249A>T	uc003ksq.2	+	2	923	c.760A>T	c.(760-762)ACA>TCA	p.T254S	PRR16_uc003ksp.2_Missense_Mutation_p.T231S|PRR16_uc003ksr.2_Missense_Mutation_p.T184S	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	254	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CCTCCCTCCTACACCCCATCT	0.537			NA											12	41					0	0	0.001368	0	0
FTMT	94033	broad.mit.edu	37	5	121187760	121187760	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:121187760G>T	uc003kss.2	+	1	111	c.102G>T	c.(100-102)CCG>CCT	p.P34P		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	34					cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GTTGGGCCCCGGGGCGCCCCT	0.771			NA											6	11					5.9392e-07	6.67422e-07	0.001168	1	0
LYRM7	90624	broad.mit.edu	37	5	130535268	130535268	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:130535268T>G	uc003kvg.1	+	5	362	c.289T>G	c.(289-291)TGT>GGT	p.C97G		NM_181705	NP_859056	Q5U5X0	LYRM7_HUMAN	Lyrm7 homolog	97											0		all_cancers(142;0.0377)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGTGCCATATTGTGATGCACC	0.318			NA											10	46					0	0	0.003163	0	0
RAD50	10111	broad.mit.edu	37	5	131923333	131923333	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:131923333A>C	uc003kxi.2	+	6	1223	c.836A>C	c.(835-837)AAG>ACG	p.K279T	RAD50_uc003kxh.2_Missense_Mutation_p.K140T	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	279	Potential.				DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GATAGCCGAAAGAAGCAAATG	0.303			NA						Homologous_recombination					13	43					0	0	0.003163	0	0
SEPT8	23176	broad.mit.edu	37	5	132099497	132099497	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:132099497G>A	uc003kxr.2	-	4	673	c.435C>T	c.(433-435)TAC>TAT	p.Y145Y	SEPT8_uc003kxs.1_Silent_p.Y145Y|SEPT8_uc003kxu.2_Silent_p.Y145Y|SEPT8_uc011cxi.1_Silent_p.Y143Y|SEPT8_uc003kxv.2_Silent_p.Y143Y|SEPT8_uc003kxt.2_Silent_p.Y85Y	NM_001098811	NP_001092281	Q92599	SEPT8_HUMAN	septin 8 isoform a	145					cell cycle	septin complex	GTP binding|protein binding			ovary(2)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGTGTCATGGTAGTCGAAGA	0.502			NA									OREG0003468	type=REGULATORY REGION|Gene=LOC540614|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	42	111					0	0	0.00874	0	0
DDX46	9879	broad.mit.edu	37	5	134143555	134143555	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:134143555T>C	uc003kzw.2	+	16	2240	c.2072T>C	c.(2071-2073)GTA>GCA	p.V691A	DDX46_uc003kzv.1_RNA	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	691	Helicase C-terminal.				mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGATTCTTGTAGTAAATTAT	0.408	Colon(13;391 453 4901 21675 24897)		NA											10	34					0	0	0.008291	0	0
H2AFY	9555	broad.mit.edu	37	5	134724751	134724751	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:134724751G>T	uc003lam.1	-	2	243	c.33C>A	c.(31-33)ACC>ACA	p.T11T	H2AFY_uc003lao.1_Silent_p.T11T|H2AFY_uc003lan.1_Silent_p.T11T|H2AFY_uc003lap.1_RNA|H2AFY_uc003laq.1_RNA|H2AFY_uc003lar.1_RNA|H2AFY_uc011cxz.1_Silent_p.T11T|H2AFY_uc003las.1_Silent_p.T11T|H2AFY_uc003lat.1_Silent_p.T11T	NM_138610	NP_613258	O75367	H2AY_HUMAN	H2A histone family, member Y isoform 3	11	Histone H2A.				chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGACGTCTTGGTGGACTTCT	0.617			NA											7	39					5.18039e-06	5.7182e-06	0.00308	1	0
TRPC7	57113	broad.mit.edu	37	5	135692395	135692395	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:135692395A>G	uc003lbn.1	-	1	681	c.678T>C	c.(676-678)AGT>AGC	p.S226S	TRPC7_uc010jef.1_Silent_p.S218S|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Silent_p.S218S|TRPC7_uc010jei.1_Silent_p.S218S|TRPC7_uc010jej.1_5'UTR	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	227	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGTAGGCAGCACTCGCCAGTC	0.552			NA											3	26					0	0	0.004672	0	0
SPOCK1	6695	broad.mit.edu	37	5	136324131	136324131	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:136324131T>C	uc003lbo.2	-	7	1099	c.908A>G	c.(907-909)TAC>TGC	p.Y303C	SPOCK1_uc003lbp.2_Missense_Mutation_p.Y303C	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	303					cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGGAAGCAGTAGCACCACTC	0.522			NA											32	77					0	0	0.003755	0	0
PSD2	84249	broad.mit.edu	37	5	139193933	139193933	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:139193933C>A	uc003leu.1	+	4	1205	c.1000C>A	c.(1000-1002)CGG>AGG	p.R334R		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	334	SEC7.				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATGTGGCCCGGCAGCTGGG	0.632			NA											11	22					0.000673444	0.000712385	0.008291	1	0
PCDHA6	56142	broad.mit.edu	37	5	140209641	140209641	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:140209641T>C	uc003lho.2	+	1	1992	c.1965T>C	c.(1963-1965)GGT>GGC	p.G655G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Silent_p.G655G	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	655	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGACCACGGTGAGCCGGCGC	0.692			NA											8	57					0	0	0.006214	0	0
PCDHB6	56130	broad.mit.edu	37	5	140530476	140530476	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:140530476C>G	uc003lir.2	+	1	638	c.638C>G	c.(637-639)GCG>GGG	p.A213G	PCDHB6_uc011dah.1_Missense_Mutation_p.A77G	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	213	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGCTGATCGCGCTGGATGGC	0.602			NA											10	58					0	0	0.000978	0	0
PCDHB8	56128	broad.mit.edu	37	5	140559312	140559312	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:140559312T>A	uc011dai.1	+	1	1883	c.1697T>A	c.(1696-1698)CTG>CAG	p.L566Q	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	566	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTACCCGCTGCAGAATGGC	0.721			NA											20	163					0	0	0.002836	0	0
PCDHGC5	56097	broad.mit.edu	37	5	140870009	140870009	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:140870009A>T	uc003lla.1	+	1	1202	c.1202A>T	c.(1201-1203)GAG>GTG	p.E401V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.E401V	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	401	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCCTTCTGAGAACCACTAC	0.532			NA											32	87					0	0	0.009535	0	0
FGF1	2246	broad.mit.edu	37	5	141993670	141993670	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:141993670G>A	uc003lmm.2	-	2	103	c.23C>T	c.(22-24)ACC>ATC	p.T8I	FGF1_uc011dbi.1_Missense_Mutation_p.T8I|FGF1_uc003lmn.3_Missense_Mutation_p.T8I|FGF1_uc003lmp.3_Missense_Mutation_p.T8I|FGF1_uc003lmq.2_Missense_Mutation_p.T8I|FGF1_uc010jgj.2_Missense_Mutation_p.T8I|FGF1_uc003lmr.2_Missense_Mutation_p.T8I|FGF1_uc003lms.3_Missense_Mutation_p.T8I	NM_001144892	NP_001138364	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic) isoform 1	8					angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)	GGCTGTGAAGGTGGTGATTTC	0.507			NA											13	42					0	0	0.001855	0	0
PLAC8L1	153770	broad.mit.edu	37	5	145465023	145465023	+	Splice_Site	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:145465023C>T	uc003lnv.2	-	3	465	c.393_splice	c.e3+1	p.Q131_splice	PLAC8L1_uc011dbp.1_Splice_Site	NM_001029869	NP_001025040	A1L4L8	PL8L1_HUMAN	PLAC8-like 1												0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AACACACTTACCTGTATTTTA	0.453			NA											9	36					0	0	0.006214	0	0
PCYOX1L	78991	broad.mit.edu	37	5	148748059	148748059	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:148748059C>G	uc003lqk.2	+	6	1389	c.1327C>G	c.(1327-1329)CTC>GTC	p.L443V	PCYOX1L_uc003lql.2_Missense_Mutation_p.L426V|PCYOX1L_uc010jgz.2_Missense_Mutation_p.L367V|PCYOX1L_uc003lqm.2_Missense_Mutation_p.L325V|PCYOX1L_uc003lqn.2_Missense_Mutation_p.L353V	NM_024028	NP_076933	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like precursor	443					prenylcysteine catabolic process	extracellular region	oxidoreductase activity, acting on a sulfur group of donors, oxygen as acceptor			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCATGACCAGCTCTTCTACCT	0.612	Ovarian(62;1136 1477 27277 27495)		NA											21	58					0	0	0.010504	0	0
PDE6A	5145	broad.mit.edu	37	5	149247691	149247691	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:149247691T>C	uc003lrg.3	-	18	2286	c.2166A>G	c.(2164-2166)TCA>TCG	p.S722S		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	722					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGGTGATGGCTGAGAGATCAC	0.552			NA											5	81					0	0	0.001984	0	0
SLC26A2	1836	broad.mit.edu	37	5	149361207	149361207	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:149361207C>T	uc003lrh.2	+	3	2319	c.2051C>T	c.(2050-2052)GCT>GTT	p.A684V		NM_000112	NP_000103	P50443	S26A2_HUMAN	solute carrier family 26 member 2	684	Cytoplasmic (Potential).|STAS.					integral to plasma membrane|membrane fraction	secondary active sulfate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GTTCTGCTGGCTCAGTGCAAT	0.433			NA											11	32					0	0	0.001855	0	0
LSM11	134353	broad.mit.edu	37	5	157170864	157170864	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:157170864G>A	uc003lxe.1	+	1	110	c.106G>A	c.(106-108)GCC>ACC	p.A36T		NM_173491	NP_775762	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	36					histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCCGCTGCTGGCCCTGTACGC	0.527			NA											3	14					0	0	0.004672	0	0
ADRA1B	147	broad.mit.edu	37	5	159344042	159344042	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:159344042A>G	uc003lxt.1	+	1	303	c.130A>G	c.(130-132)AGG>GGG	p.R44G		NM_000679	NP_000670	P35368	ADA1B_HUMAN	alpha-1B-adrenergic receptor	44	Extracellular (By similarity).				cell proliferation|cell-cell signaling|G-protein signaling, coupled to cAMP nucleotide second messenger|intracellular protein kinase cascade	integral to plasma membrane	alpha1-adrenergic receptor activity			lung(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Modafinil(DB00745)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Olanzapine(DB00334)|Phendimetrazine(DB01579)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Trazodone(DB00656)	GGACATCACCAGGGCCATCTC	0.597			NA											23	52					0	0	0.001882	0	0
GABRA6	2559	broad.mit.edu	37	5	161128731	161128731	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:161128731A>T	uc003lyu.2	+	9	1652	c.1314A>T	c.(1312-1314)GTA>GTT	p.V438V	GABRA6_uc003lyv.2_Silent_p.V209V	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	438	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGTACTGGGTAGTTTATCTTT	0.428			NA								TCGA Ovarian(5;0.080)			20	52					0	0	0.002299	0	0
ODZ2	57451	broad.mit.edu	37	5	167379732	167379732	+	Silent	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:167379732C>G	uc010jjd.2	+	4	852	c.852C>G	c.(850-852)GCC>GCG	p.A284A	ODZ2_uc003lzq.2_Silent_p.A163A|ODZ2_uc003lzr.3_Silent_p.A93A	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AGATCCACGCCCCGGCCCCAG	0.622			NA											5	9					0	0	0.000602	0	0
DOCK2	1794	broad.mit.edu	37	5	169145738	169145738	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:169145738T>C	uc003maf.2	+	22	2290	c.2210T>C	c.(2209-2211)CTG>CCG	p.L737P	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.L229P	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	737					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTAAGAACGCTGAAGGCTTTG	0.398			NA											13	53					0	0	0.001855	0	0
DOCK2	1794	broad.mit.edu	37	5	169472840	169472840	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:169472840T>C	uc003maf.2	+	39	3977	c.3897T>C	c.(3895-3897)AGT>AGC	p.S1299S	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.S791S	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1299	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGCCATAAGTCTGTGCAAGG	0.567			NA											13	70					0	0	0.00245	0	0
KCNMB1	3779	broad.mit.edu	37	5	169805721	169805721	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:169805721G>C	uc003maq.1	-	4	963	c.563C>G	c.(562-564)GCG>GGG	p.A188G	KCNIP1_uc003map.2_Intron	NM_004137	NP_004128	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated	188	Cytoplasmic (Potential).				platelet activation|synaptic transmission		calcium-activated potassium channel activity|potassium channel regulator activity			ovary(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)		CTTCTGGGCCGCCAGGATGGA	0.617			NA											22	67					0	0	0.00333	0	0
SH3PXD2B	285590	broad.mit.edu	37	5	171765970	171765970	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:171765970C>A	uc003mbr.2	-	13	2310	c.2139G>T	c.(2137-2139)ACG>ACT	p.T713T		NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	713					adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTGTTTGCCCGTCCTGTCCT	0.637			NA											10	30					0.000673444	0.000712385	0.008291	1	0
DRD1	1812	broad.mit.edu	37	5	174869318	174869318	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:174869318A>T	uc003mcz.2	-	2	1730	c.785T>A	c.(784-786)ATG>AAG	p.M262K		NM_000794	NP_000785	P21728	DRD1_HUMAN	dopamine receptor D1	262	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|adult walking behavior|cerebral cortex GABAergic interneuron migration|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|mating behavior|positive regulation of cAMP biosynthetic process|positive regulation of cell migration|positive regulation of potassium ion transport|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of synaptic transmission, glutamatergic|prepulse inhibition|response to drug|synapse assembly|visual learning	endoplasmic reticulum membrane|membrane fraction	protein binding			ovary(2)|skin(1)	3	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Carphenazine(DB01038)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Cocaine(DB00907)|Dopamine(DB00988)|Fenoldopam(DB00800)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methylergonovine(DB00353)|Minaprine(DB00805)|Olanzapine(DB00334)|Pegademase bovine(DB00061)|Pergolide(DB01186)|Perphenazine(DB00850)|Prochlorperazine(DB00433)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Triflupromazine(DB00508)|Zuclopenthixol(DB01624)	TTTGAAGGACATCTTAAAAGA	0.473			NA											14	37					0	0	0.004007	0	0
C5orf25	375484	broad.mit.edu	37	5	175717418	175717418	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:175717418A>G	uc003mds.3	+	4	1241	c.834A>G	c.(832-834)TTA>TTG	p.L278L	C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Silent_p.L297L|uc003mdu.1_Silent_p.L189L			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;	278	Pro-rich.										0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		AAAGCATATTACATCCACAAG	0.542			NA											11	30					0	0	0.001368	0	0
EXOC2	55770	broad.mit.edu	37	6	576801	576801	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:576801G>A	uc003mtd.2	-	12	1408	c.1274C>T	c.(1273-1275)GCG>GTG	p.A425V	EXOC2_uc003mte.2_Missense_Mutation_p.A425V|EXOC2_uc011dho.1_Missense_Mutation_p.A20V	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein	425					exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CTTCAGGGACGCTGTCTGACT	0.507			NA											9	58					0	0	0.004482	0	0
BPHL	670	broad.mit.edu	37	6	3129350	3129350	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:3129350A>T	uc003mva.2	+	4	499	c.450A>T	c.(448-450)GCA>GCT	p.A150A	BPHL_uc003muz.2_RNA|BPHL_uc011dht.1_RNA|BPHL_uc003muy.2_Silent_p.A133A	NM_004332	NP_004323	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like precursor	150					cellular amino acid metabolic process|response to toxin	mitochondrion	hydrolase activity				0	Ovarian(93;0.0386)	all_hematologic(90;0.108)				TTGCTGCTGCAAAATATCCAT	0.507			NA											53	39					0	0	0.00361	0	0
PHACTR1	221692	broad.mit.edu	37	6	13283761	13283761	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:13283761T>C	uc010jpc.2	+	13	1949	c.1617T>C	c.(1615-1617)GAT>GAC	p.D539D	PHACTR1_uc003nah.1_Silent_p.D539D|TBC1D7_uc003naj.2_Intron|TBC1D7_uc011dis.1_Intron|uc003nak.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	539						cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GCAGGGCAGATAAGCCGTGGA	0.612			NA											21	47					0	0	0.004656	0	0
ATXN1	6310	broad.mit.edu	37	6	16326806	16326806	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:16326806A>G	uc003nbt.2	-	8	2707	c.1736T>C	c.(1735-1737)ATC>ACC	p.I579T	ATXN1_uc010jpi.2_Missense_Mutation_p.I579T|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	579	Self-association.|Interaction with USP7.|RNA-binding.|AXH.				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CAACTGGATGATGGAGCCTTT	0.572			NA											15	83					0	0	0.003163	0	0
GPX6	257202	broad.mit.edu	37	6	28473527	28473527	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:28473527C>A	uc011dlj.1	-	5	462	c.412G>T	c.(412-414)GGG>TGG	p.G138W	GPX6_uc010jrg.1_Intron	NM_182701	NP_874360	P59796	GPX6_HUMAN	glutathione peroxidase 6 precursor	138					response to oxidative stress	extracellular region	glutathione peroxidase activity			ovary(3)|pancreas(1)|skin(1)	5					Glutathione(DB00143)	TTCACATCCCCTTTCTCAAAG	0.443			NA											8	109					2.74318e-10	3.27811e-10	0.006214	1	0
OR2W1	26692	broad.mit.edu	37	6	29012595	29012595	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:29012595A>G	uc003nlw.2	-	1	358	c.358T>C	c.(358-360)TAT>CAT	p.Y120H		NM_030903	NP_112165	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W,	120	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						AAACGATCATAGGACATAACA	0.403			NA											7	88					0	0	0.001984	0	0
ABCF1	23	broad.mit.edu	37	6	30553956	30553956	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:30553956C>T	uc003nql.2	+	18	1854	c.1759C>T	c.(1759-1761)CGA>TGA	p.R587*	ABCF1_uc003nqm.2_Nonsense_Mutation_p.R549*|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1	587					inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						GCAGAAATGCCGACGGAAAAA	0.542			NA											15	73					0	0	0.004007	0	0
MICB	4277	broad.mit.edu	37	6	31474022	31474022	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:31474022A>G	uc003ntn.3	+	3	544	c.428A>G	c.(427-429)CAA>CGA	p.Q143R	MICB_uc011dnm.1_Missense_Mutation_p.Q111R|MICB_uc003nto.3_Intron	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B	143	Extracellular (Potential).				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0						TTCCTCTCCCAAAACCTGGAG	0.527			NA											8	74					0	0	0.006214	0	0
HSPA1L	3305	broad.mit.edu	37	6	31777849	31777849	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:31777849C>T	uc003nxh.2	-	2	2084	c.1901G>A	c.(1900-1902)GGC>GAC	p.G634D	HSPA1L_uc010jte.2_Missense_Mutation_p.G634D	NM_005527	NP_005518	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	634					response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6						AATTGTGGGGCCTGTGGCAGG	0.453			NA											9	75					0	0	0.006214	0	0
STK19	8859	broad.mit.edu	37	6	31939953	31939953	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:31939953C>A	uc003nyv.2	+	1	308	c.180C>A	c.(178-180)ATC>ATA	p.I60I	DOM3Z_uc003nyo.1_5'UTR|DOM3Z_uc003nyp.1_5'UTR|DOM3Z_uc003nyq.1_5'UTR|DOM3Z_uc003nyr.1_5'UTR|DOM3Z_uc003nys.1_5'Flank|DOM3Z_uc010jtl.1_5'UTR|STK19_uc003nyt.2_5'UTR|DOM3Z_uc003nyu.1_5'UTR|STK19_uc011dow.1_Silent_p.I60I|STK19_uc011dox.1_5'UTR|STK19_uc003nyw.2_Silent_p.I60I|STK19_uc010jtn.1_5'Flank	NM_032454	NP_115830	P49842	STK19_HUMAN	serine/threonine kinase 19 isoform 2	60						nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			skin(4)	4						GGGAGCCAATCCGCGGCCGGC	0.706			NA											12	52					5.50884e-06	6.04854e-06	0.001368	1	0
LRFN2	57497	broad.mit.edu	37	6	40400486	40400486	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:40400486G>T	uc003oph.1	-	2	832	c.367C>A	c.(367-369)CTG>ATG	p.L123M		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	123	Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGGTTGACCAGGCCCCGGAGG	0.587			NA											26	16					4.72057e-08	5.4374e-08	0.003954	1	0
SLC22A7	10864	broad.mit.edu	37	6	43270068	43270068	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:43270068C>T	uc003out.2	+	8	1291	c.1192C>T	c.(1192-1194)CGC>TGC	p.R398C	SLC22A7_uc010jyl.1_Missense_Mutation_p.R399C|SLC22A7_uc003ous.2_Missense_Mutation_p.R396C	NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	solute carrier family 22 member 7 isoform b	398						basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			CTTGTCGGTGCGCTACGCAGG	0.637			NA											4	33					0	0	0.009096	0	0
XPO5	57510	broad.mit.edu	37	6	43496605	43496605	+	Silent	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:43496605T>C	uc003ovp.2	-	24	2947	c.2736A>G	c.(2734-2736)GTA>GTG	p.V912V	POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5	912					gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GGATGGGGGATACCAGGGCTT	0.468			NA											3	22					0	0	0.004672	0	0
GPR116	221395	broad.mit.edu	37	6	46836805	46836805	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:46836805G>A	uc003oyo.3	-	12	1725	c.1436C>T	c.(1435-1437)CCA>CTA	p.P479L	GPR116_uc011dwj.1_Missense_Mutation_p.P34L|GPR116_uc011dwk.1_5'UTR|GPR116_uc003oyp.3_Missense_Mutation_p.P337L|GPR116_uc003oyq.3_Missense_Mutation_p.P479L|GPR116_uc010jzi.1_Missense_Mutation_p.P151L	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	479	Ig-like 3.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			AACAGAAATTGGGTCCGGGGT	0.353	NSCLC(59;410 1274 8751 36715 50546)		NA											17	17					0	0	0.006122	0	0
GPR115	221393	broad.mit.edu	37	6	47681570	47681570	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:47681570G>A	uc003oza.1	+	6	847	c.589G>A	c.(589-591)GCA>ACA	p.A197T	GPR115_uc003oyz.1_Missense_Mutation_p.A254T|GPR115_uc003ozb.1_Missense_Mutation_p.A195T	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	197	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						CCTCGACACAGCAGCCATTTC	0.413	GBM(22;431 510 9010 26644 32828)		NA											71	57					0	0	0.00361	0	0
PGK2	5232	broad.mit.edu	37	6	49753867	49753867	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:49753867C>A	uc003ozu.2	-	1	1141	c.1034G>T	c.(1033-1035)TGG>TTG	p.W345L		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	345					glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					AAAGGCATCCCATTCAAATAC	0.478			NA											113	109					2.20344e-50	2.88839e-50	0.00361	1	0
PGK2	5232	broad.mit.edu	37	6	49754423	49754423	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:49754423C>A	uc003ozu.2	-	1	585	c.478G>T	c.(478-480)GTC>TTC	p.V160F		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	160					glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					TTGACATAGACGTCCCCTAGC	0.488			NA											15	113					2.32078e-09	2.73137e-09	0.003163	1	0
HCRTR2	3062	broad.mit.edu	37	6	55113517	55113517	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:55113517C>A	uc003pcl.2	+	2	619	c.304C>A	c.(304-306)CTC>ATC	p.L102I	HCRTR2_uc010jzv.2_RNA|HCRTR2_uc010jzw.1_Missense_Mutation_p.L37I	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	102	Helical; Name=2; (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GGCTGATGTGCTCGTGACCAT	0.458			NA											46	104					6.48837e-15	8.12025e-15	0.002522	1	0
DST	667	broad.mit.edu	37	6	56371299	56371299	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:56371299C>A	uc003pdf.2	-	71	13077	c.13049G>T	c.(13048-13050)CGG>CTG	p.R4350L	DST_uc003pcz.3_Missense_Mutation_p.R4172L|DST_uc011dxj.1_Missense_Mutation_p.R4201L|DST_uc011dxk.1_Missense_Mutation_p.R4212L|DST_uc003pcy.3_Missense_Mutation_p.R3846L	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6258	Spectrin 13.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTGTCAATCCGGTCTTTCCA	0.413			NA											4	17					5.9392e-07	6.67422e-07	0.001168	1	0
DST	667	broad.mit.edu	37	6	56400064	56400064	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:56400064C>A	uc003pdf.2	-	57	10468	c.10440G>T	c.(10438-10440)CAG>CAT	p.Q3480H	DST_uc003pcz.3_Missense_Mutation_p.Q3302H|DST_uc011dxj.1_Missense_Mutation_p.Q3331H|DST_uc011dxk.1_Missense_Mutation_p.Q3342H|DST_uc003pcy.3_Missense_Mutation_p.Q2976H	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5388	Spectrin 7.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCAAGGCCTCCTGCAGCTGGG	0.517			NA											22	33					8.10497e-08	9.31847e-08	0.010504	1	0
BCKDHB	594	broad.mit.edu	37	6	80910666	80910666	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:80910666T>A	uc003pjd.2	+	7	825	c.758T>A	c.(757-759)ATA>AAA	p.I253K	BCKDHB_uc003pje.2_Missense_Mutation_p.I253K	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta	253					branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		GAAGTCCCTATAGAACCATAC	0.428			NA											13	49					0	0	0.003163	0	0
IBTK	25998	broad.mit.edu	37	6	82927845	82927845	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:82927845A>T	uc003pjl.1	-	10	1785	c.1258T>A	c.(1258-1260)TGG>AGG	p.W420R	IBTK_uc011dyv.1_Missense_Mutation_p.W420R|IBTK_uc011dyw.1_Missense_Mutation_p.W420R|IBTK_uc010kbi.1_Missense_Mutation_p.W114R|IBTK_uc003pjm.2_Missense_Mutation_p.W420R	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	420					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		ACTGATCTCCAGCAAAACACC	0.348			NA											14	21					0	0	0.003163	0	0
FUT9	10690	broad.mit.edu	37	6	96651162	96651162	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:96651162C>T	uc003pop.3	+	3	472	c.131C>T	c.(130-132)GCC>GTC	p.A44V		NM_006581	NP_006572	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3)	44	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			skin(4)|ovary(1)	5		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		ATGGAATCAGCCAGCTCTGTG	0.403	Melanoma(98;1369 1476 6592 22940 26587)		NA											6	62					0	0	0.001168	0	0
ASCC3	10973	broad.mit.edu	37	6	101049771	101049771	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:101049771C>T	uc003pqk.2	-	34	5547	c.5218G>A	c.(5218-5220)GCT>ACT	p.A1740T		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1740					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GTACCACCAGCAATCTCTGCA	0.383			NA											26	79					0	0	0.00632	0	0
CDC40	51362	broad.mit.edu	37	6	110528759	110528759	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:110528759A>T	uc003pua.2	+	4	481	c.457A>T	c.(457-459)ATT>TTT	p.I153F		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	153					mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TGCTAAATATATTGGTTCTGT	0.289			NA											7	83					0	0	0.00308	0	0
CDC40	51362	broad.mit.edu	37	6	110533348	110533348	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:110533348A>G	uc003pua.2	+	7	764	c.740A>G	c.(739-741)TAT>TGT	p.Y247C		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	247					mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		AAAGAAATGTATGACTATCAA	0.338			NA											21	43					0	0	0.010504	0	0
HDAC2	3066	broad.mit.edu	37	6	114279863	114279863	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:114279863C>A	uc003pwd.1	-	3	515	c.515G>T	c.(514-516)CGG>CTG	p.R172L	HDAC2_uc003pwc.1_Missense_Mutation_p.R48L|HDAC2_uc003pwe.1_Missense_Mutation_p.R48L	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2	78	Histone deacetylase.				blood coagulation|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of proteolysis|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|transcription factor binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)	TCTTATTGACCGTAGAAATTT	0.348			NA											28	98					8.16721e-17	1.03252e-16	0.002096	1	0
C6orf174	387104	broad.mit.edu	37	6	127836062	127836062	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:127836062T>C	uc003qbd.2	-	3	2097	c.1232A>G	c.(1231-1233)TAC>TGC	p.Y411C		NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor	411	Potential.					integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		GCGGAGGCGGTACTGCAGGAT	0.602			NA											12	114					0	0	0.000978	0	0
LAMA2	3908	broad.mit.edu	37	6	129835636	129835636	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:129835636G>A	uc003qbn.2	+	63	9212	c.9107G>A	c.(9106-9108)CGC>CAC	p.R3036H	LAMA2_uc003qbo.2_Missense_Mutation_p.R3032H|uc003qbq.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	3036	Laminin G-like 5.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATCAAACACCGCATTGAGCTC	0.507			NA											6	61					0	0	0.001984	0	0
SAMD3	154075	broad.mit.edu	37	6	130530745	130530745	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:130530745T>C	uc003qbv.2	-	6	604	c.278A>G	c.(277-279)GAT>GGT	p.D93G	SAMD3_uc003qbx.2_Missense_Mutation_p.D93G|SAMD3_uc003qbw.2_Missense_Mutation_p.D93G|SAMD3_uc010kfg.1_Missense_Mutation_p.D93G|SAMD3_uc003qby.2_Missense_Mutation_p.D93G|SAMD3_uc003qbz.1_Missense_Mutation_p.D52G	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform	93										ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		GGACTCTTCATCCCTGTAACT	0.463			NA											17	20					0	0	0.00499	0	0
VTA1	51534	broad.mit.edu	37	6	142539636	142539636	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:142539636G>A	uc003qiw.2	+	8	795	c.780G>A	c.(778-780)GGG>GGA	p.G260G	VTA1_uc011edt.1_RNA|VTA1_uc011edu.1_Silent_p.G175G	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog	260	Interaction with VPS4B (By similarity).				cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		TTCTTCTAGGGGATGTTCGTC	0.368			NA											9	28					0	0	0.008291	0	0
RAB32	10981	broad.mit.edu	37	6	146870795	146870795	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:146870795A>G	uc003qln.1	+	2	626	c.446A>G	c.(445-447)AAG>AGG	p.K149R		NM_006834	NP_006825	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	149					protein transport|small GTPase mediated signal transduction	mitochondrion	GTP binding				0		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		GACCAGAACAAGGACAGTAGC	0.463			NA											18	58					0	0	0.006122	0	0
STXBP5	134957	broad.mit.edu	37	6	147635025	147635025	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:147635025C>A	uc003qlz.2	+	12	1312	c.1151C>A	c.(1150-1152)CCT>CAT	p.P384H	STXBP5_uc010khz.1_Missense_Mutation_p.P384H|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.P55H	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	384					exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TAAAGATATCCTATATTTGAA	0.279			NA											5	30					1.23904e-05	1.35089e-05	0.000602	1	0
SASH1	23328	broad.mit.edu	37	6	148869642	148869642	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:148869642T>G	uc003qme.1	+	20	4167	c.3692T>G	c.(3691-3693)CTC>CGC	p.L1231R	SASH1_uc003qmf.1_Missense_Mutation_p.L641R	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1231	SAM 2.						protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		ATAAGAAAGCTCCTATCTGCA	0.587			NA											15	55					0	0	0.003163	0	0
TIAM2	26230	broad.mit.edu	37	6	155465914	155465914	+	Splice_Site	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:155465914T>C	uc003qqb.2	+	8	3076	c.1803_splice	c.e8+2	p.Q601_splice	TIAM2_uc003qqe.2_Splice_Site_p.Q601_splice|TIAM2_uc010kjj.2_Splice_Site_p.Q134_splice	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CTTTTCCAGGTACTGCTGGTA	0.393			NA											17	82					0	0	0.008871	0	0
FNDC1	84624	broad.mit.edu	37	6	159653935	159653935	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:159653935C>T	uc010kjv.2	+	11	2591	c.2391C>T	c.(2389-2391)GGC>GGT	p.G797G	FNDC1_uc010kjw.1_Silent_p.G682G	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	797						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GGGAAGACGGCGGAAGGCAGG	0.637			NA											3	16					0	0	0.004672	0	0
PNLDC1	154197	broad.mit.edu	37	6	160238159	160238159	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:160238159A>G	uc003qsx.1	+	15	1271	c.1100A>G	c.(1099-1101)CAC>CGC	p.H367R	PNLDC1_uc003qsy.1_Missense_Mutation_p.H378R	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	367	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AAAGTGGCACACTTGCTTCTA	0.393			NA											8	53					0	0	0.006214	0	0
LPA	4018	broad.mit.edu	37	6	160999570	160999570	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:160999570C>A	uc003qtl.2	-	28	4576	c.4456G>T	c.(4456-4458)GCT>TCT	p.A1486S		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3994	Kringle 35.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TCAGAAGGAGCCTCTGTGCTT	0.483			NA											30	81					1.06801e-11	1.29874e-11	0.009535	1	0
MAP3K4	4216	broad.mit.edu	37	6	161519335	161519335	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:161519335C>T	uc003qtn.2	+	17	3692	c.3550C>T	c.(3550-3552)CGG>TGG	p.R1184W	MAP3K4_uc010kkc.1_Missense_Mutation_p.R1180W|MAP3K4_uc003qto.2_Intron|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.R637W|MAP3K4_uc003qtp.2_Intron|MAP3K4_uc003qtq.2_5'Flank	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1184					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TTCCGACGCGCGGAGCCATGG	0.418			NA											37	188					0	0	0.00623	0	0
PARK2	5071	broad.mit.edu	37	6	162206910	162206910	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:162206910G>A	uc003qtx.3	-	7	899	c.765C>T	c.(763-765)TCC>TCT	p.S255S	PARK2_uc003qtv.3_RNA|PARK2_uc010kkd.2_Silent_p.S64S|PARK2_uc003qtw.3_Silent_p.S64S|PARK2_uc003qty.3_Silent_p.S227S|PARK2_uc003qtz.3_Silent_p.S106S|PARK2_uc010kke.1_Silent_p.S255S|PARK2_uc011egf.1_5'UTR	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	255	RING-type 1; atypical.				aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TCACGTGGCGGGAGTTGCACT	0.502			NA											5	22					0	0	0.001168	0	0
HEATR2	54919	broad.mit.edu	37	7	769461	769461	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:769461C>T	uc010krz.1	+	2	777	c.757C>T	c.(757-759)CGA>TGA	p.R253*	PRKAR1B_uc003siw.1_5'Flank|HEATR2_uc003siz.2_Nonsense_Mutation_p.R121*	NM_017802	NP_060272	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	253	HEAT 3.						protein binding			skin(1)	1		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		TTTTGCTCAGCGACTGTTTGA	0.547			NA											10	49					0	0	0.001368	0	0
SNX8	29886	broad.mit.edu	37	7	2311559	2311559	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:2311559C>T	uc003slw.2	-	4	509	c.466G>A	c.(466-468)GTC>ATC	p.V156I		NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	156	PX.				cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		ACCAGGTTGACGAAGCGCTTC	0.642			NA											11	39					0	0	0.008291	0	0
LFNG	3955	broad.mit.edu	37	7	2565886	2565886	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:2565886A>G	uc003smf.2	+	6	847	c.830A>G	c.(829-831)CAC>CGC	p.H277R	LFNG_uc003smg.2_Missense_Mutation_p.H277R	NM_001040167	NP_001035257	Q8NES3	LFNG_HUMAN	lunatic fringe isoform a	277	Lumenal (Potential).				organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		AGCGGGGGTCACTTCATGAAT	0.677			NA											32	41					0	0	0.002836	0	0
WIPI2	26100	broad.mit.edu	37	7	5265457	5265457	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:5265457C>T	uc003snv.2	+	9	960	c.744C>T	c.(742-744)TGC>TGT	p.C248C	WIPI2_uc003snw.2_Silent_p.C248C|WIPI2_uc003snx.2_Silent_p.C230C|WIPI2_uc003sny.2_Silent_p.C230C|WIPI2_uc010ksv.2_Silent_p.C104C|WIPI2_uc003soa.2_Silent_p.C189C|WIPI2_uc003sob.2_5'UTR	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	248	WD 2.				autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		TCCCCAGGTGCGTGAGCATCT	0.617			NA											6	14					0	0	0.001168	0	0
FBXL18	80028	broad.mit.edu	37	7	5541135	5541135	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:5541135G>A	uc003soo.2	-	3	859	c.765C>T	c.(763-765)AGC>AGT	p.S255S	FBXL18_uc003son.3_Silent_p.S255S	NM_024963	NP_079239	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	255										central_nervous_system(2)|ovary(1)	3		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GAGTGCGGTCGCTAAGCACAG	0.652			NA											4	27					0	0	0.009096	0	0
ACTB	60	broad.mit.edu	37	7	5568949	5568949	+	Missense_Mutation	SNP	T	T	C	rs11546912		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:5568949T>C	uc003sos.3	-	2	242	c.206A>G	c.(205-207)TAC>TGC	p.Y69C	ACTB_uc003sor.3_5'UTR|ACTB_uc003sot.3_Missense_Mutation_p.Y69C|ACTB_uc003soq.3_5'UTR|ACTB_uc010ksy.2_Intron	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin	69					'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CTCGATGGGGTACTTCAGGGT	0.587			NA											14	104					0	0	0.004007	0	0
RNF216	54476	broad.mit.edu	37	7	5769176	5769176	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:5769176G>A	uc003soy.1	-	7	1295	c.1105C>T	c.(1105-1107)CGC>TGC	p.R369C	RNF216_uc010ksz.1_5'UTR|RNF216_uc010kta.1_5'UTR|RNF216_uc011jwj.1_5'UTR|RNF216_uc003sox.1_Missense_Mutation_p.R426C	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	369					apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ATGAAGCAGCGCTGGTCAAGA	0.478			NA											15	81					0	0	0.006122	0	0
BZW2	28969	broad.mit.edu	37	7	16744220	16744220	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:16744220A>G	uc003stl.2	+	11	1335	c.1157A>G	c.(1156-1158)CAT>CGT	p.H386R	BZW2_uc003stm.2_Missense_Mutation_p.H192R|BZW2_uc003stj.2_Missense_Mutation_p.H386R|BZW2_uc003stk.2_Missense_Mutation_p.H310R|BZW2_uc003stp.2_Missense_Mutation_p.H234R|BZW2_uc010kua.2_Intron	NM_001159767	NP_001153239	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	386	W2.				cell differentiation|nervous system development|RNA metabolic process		protein binding			ovary(2)	2	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		AAGGAAGCACATGTTGCTAAA	0.328			NA											7	43					0	0	0.001984	0	0
PRPS1L1	221823	broad.mit.edu	37	7	18066925	18066925	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:18066925C>G	uc003stz.2	-	1	562	c.481G>C	c.(481-483)GAG>CAG	p.E161Q		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	161					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					TTCTTCCACTCAGGGATATTC	0.443			NA											18	65					0	0	0.006122	0	0
FERD3L	222894	broad.mit.edu	37	7	19184928	19184928	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:19184928G>T	uc003suo.1	-	1	117	c.58C>A	c.(58-60)CTG>ATG	p.L20M	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	20					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						GCCAGGGACAGGTCTGCGACG	0.672			NA											12	36					2.80697e-09	3.29422e-09	0.000978	1	0
ITGB8	3696	broad.mit.edu	37	7	20420306	20420306	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:20420306G>C	uc003suu.2	+	5	1358	c.653G>C	c.(652-654)TGC>TCC	p.C218S	ITGB8_uc011jyh.1_Missense_Mutation_p.C83S|ITGB8_uc003sut.2_Missense_Mutation_p.C218S	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	218	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						AATTTAGACTGCATGCCTCCC	0.378			NA											8	82					0	0	0.006214	0	0
DNAH11	8701	broad.mit.edu	37	7	21609753	21609753	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:21609753C>G	uc003svc.2	+	7	1292	c.1261C>G	c.(1261-1263)CAG>GAG	p.Q421E		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	421	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGAAAAGGTGCAGGTGGCTGT	0.393			NA							Kartagener_syndrome				6	21					0	0	0.001168	0	0
STK31	56164	broad.mit.edu	37	7	23809301	23809301	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:23809301G>A	uc003sws.3	+	13	1706	c.1639G>A	c.(1639-1641)GCA>ACA	p.A547T	STK31_uc003swt.3_Missense_Mutation_p.A524T|STK31_uc011jze.1_Missense_Mutation_p.A547T|STK31_uc010kuq.2_Missense_Mutation_p.A524T	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	547							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TTCAGAAGACGCAATGGATAA	0.353			NA											51	93					0	0	0.00361	0	0
MPP6	51678	broad.mit.edu	37	7	24727207	24727207	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:24727207T>C	uc003swx.2	+	13	1896	c.1597T>C	c.(1597-1599)TGG>CGG	p.W533R	MPP6_uc003swy.2_Missense_Mutation_p.W533R|MPP6_uc010kur.2_Missense_Mutation_p.W201R	NM_016447	NP_057531	Q9NZW5	MPP6_HUMAN	membrane protein, palmitoylated 6	533					protein complex assembly		protein binding				0						GGAACCACAGTGGGTCCCAAT	0.343			NA											36	125					0	0	0.00623	0	0
HOXA1	3198	broad.mit.edu	37	7	27134073	27134073	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:27134073T>C	uc003sye.2	-	2	1088	c.994A>G	c.(994-996)ACT>GCT	p.T332A	HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	NM_005522	NP_005513	P49639	HXA1_HUMAN	homeobox A1 isoform a	332						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						TGGGAGGTAGTCAGAGTGTCT	0.577			NA											4	58					0	0	0.000602	0	0
GLI3	2737	broad.mit.edu	37	7	42005962	42005962	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:42005962C>A	uc011kbh.1	-	15	2800	c.2709G>T	c.(2707-2709)TCG>TCT	p.S903S	GLI3_uc011kbg.1_Silent_p.S844S	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	903				S->A: Loss of proteolytic processing.	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						TGGAGCGGCGCGAGGCGTCGG	0.721			NA							Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				7	29					8.12818e-05	8.69429e-05	0.001984	1	0
POLR2J4	84820	broad.mit.edu	37	7	44005532	44005532	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:44005532A>G	uc003tjd.2	-	7	603	c.158T>C	c.(157-159)GTG>GCG	p.V53A	POLR2J4_uc003tjc.2_RNA					Homo sapiens cDNA FLJ58900 complete cds, weakly similar to Uroplakin-3B precursor.												0						CTGCTGCGCCACCCGCAGTCT	0.607			NA											13	31					0	0	0.003163	0	0
NPC1L1	29881	broad.mit.edu	37	7	44579292	44579292	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:44579292G>T	uc003tlb.2	-	2	760	c.704C>A	c.(703-705)CCT>CAT	p.P235H	NPC1L1_uc003tlc.2_Missense_Mutation_p.P235H|NPC1L1_uc011kbw.1_Missense_Mutation_p.P235H|NPC1L1_uc003tld.2_Missense_Mutation_p.P235H	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	235	Extracellular (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	CTCATTCAGAGGCTGAATCCC	0.612			NA											13	78					9.31168e-06	1.0188e-05	0.001855	1	0
MYO1G	64005	broad.mit.edu	37	7	45011817	45011817	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:45011817C>A	uc003tmh.2	-	6	770	c.626G>T	c.(625-627)AGA>ATA	p.R209I	MYO1G_uc003tmg.2_5'UTR|MYO1G_uc010kym.2_Missense_Mutation_p.R94I|MYO1G_uc003tmi.1_Missense_Mutation_p.R121I|MYO1G_uc003tmj.2_5'UTR	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG	209	Myosin head-like.					myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						CTCACTGCCTCTCAGCAACTA	0.512			NA											11	87					6.40141e-05	6.87682e-05	0.000978	1	0
C7orf57	136288	broad.mit.edu	37	7	48080957	48080957	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:48080957C>T	uc003toh.3	+	3	294	c.82C>T	c.(82-84)CGC>TGC	p.R28C	C7orf57_uc003toi.3_5'UTR	NM_001100159	NP_001093629	Q8NEG2	CG057_HUMAN	hypothetical protein LOC136288	28										ovary(1)	1						CCCAGTGAAGCGCTCTGAGAA	0.582			NA											6	54					0	0	0.00308	0	0
ABCA13	154664	broad.mit.edu	37	7	48349667	48349667	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:48349667C>A	uc003toq.2	+	24	9470	c.9445C>A	c.(9445-9447)CCA>ACA	p.P3149T	ABCA13_uc010kys.1_Missense_Mutation_p.P223T|ABCA13_uc003tos.1_5'Flank	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3149					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTGTAGCCTGCCAGGGTCAAA	0.488			NA											103	140					1.04275e-50	1.36833e-50	0.00361	1	0
ZNF716	441234	broad.mit.edu	37	7	57529293	57529294	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:57529293_57529294GG>CT	uc011kdi.1	+	4	1238_1239	c.1126_1127GG>CT	c.(1126-1128)GGA>CTA	p.G376L		NM_001159279	NP_001152751			zinc finger protein 716											ovary(2)	2						GATTCATACTGGAGAGAAACCC	0.411			NA											6	23					0	0	0.004672	0	0
ZNF117	51351	broad.mit.edu	37	7	64439817	64439817	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:64439817A>G	uc003ttr.2	-	4	1417	c.132T>C	c.(130-132)TAT>TAC	p.Y44Y		NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117	44				GY -> RH (in Ref. 4; AAA58666).		nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				GTAAATTCTCATATCCACATT	0.353			NA											5	46					0	0	0.001168	0	0
NSUN5	55695	broad.mit.edu	37	7	72717935	72717935	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:72717935C>T	uc003txw.2	-	8	1069	c.1033G>A	c.(1033-1035)GCG>ACG	p.A345T	FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Missense_Mutation_p.A345T|NSUN5_uc003txx.2_Missense_Mutation_p.A307T|NSUN5_uc011kev.1_Missense_Mutation_p.A345T	NM_018044	NP_060514	Q96P11	NSUN5_HUMAN	NOL1/NOP2/Sun domain family, member 5 isoform 2	345							methyltransferase activity				0		Lung NSC(55;0.163)				AAAGTGAGCGCGTGGCACAGG	0.657			NA											15	45					0	0	0.004007	0	0
PCLO	27445	broad.mit.edu	37	7	82585510	82585510	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:82585510T>A	uc003uhx.2	-	5	5048	c.4759A>T	c.(4759-4761)AGC>TGC	p.S1587C	PCLO_uc003uhv.2_Missense_Mutation_p.S1587C	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1518					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TCAGTACTGCTACTAATCTCT	0.408			NA											34	117					0	0	0.003271	0	0
DMTF1	9988	broad.mit.edu	37	7	86811589	86811589	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:86811589G>A	uc003uih.2	+	10	1082	c.756G>A	c.(754-756)GCG>GCA	p.A252A	DMTF1_uc003uii.2_5'UTR|DMTF1_uc003uij.2_5'UTR|DMTF1_uc011khb.1_Silent_p.A164A|DMTF1_uc003uik.2_RNA|DMTF1_uc003uil.2_Silent_p.A252A|DMTF1_uc003uin.2_5'UTR	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	252	Interaction with CCND1, CCND2 and CCND3 (By similarity).|Myb-like 1.|Required for DNA-binding (By similarity).				cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					TAGGGGCGGCGCTAGGAAGAA	0.458			NA											5	74					0	0	0.000602	0	0
ABCB1	5243	broad.mit.edu	37	7	87195421	87195421	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:87195421G>T	uc003uiz.1	-	8	1085	c.667C>A	c.(667-669)CCT>ACT	p.P223T	ABCB1_uc011khc.1_Missense_Mutation_p.P159T	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	223	ABC transmembrane type-1 1.|Helical; (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	CCAAGAACAGGACTGATGGCC	0.463			NA											19	53					2.39187e-15	3.00555e-15	0.008871	1	0
ANKIB1	54467	broad.mit.edu	37	7	92020624	92020624	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:92020624G>C	uc003ulw.2	+	16	2573	c.2197G>C	c.(2197-2199)GCT>CCT	p.A733P	ANKIB1_uc010lew.1_Missense_Mutation_p.S19T	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	733							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCGGGGAGTAGCTCCTGCAGA	0.512			NA											10	40					0	0	0.008291	0	0
SAMD9L	219285	broad.mit.edu	37	7	92762906	92762906	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:92762906C>T	uc003umh.1	-	5	3595	c.2379G>A	c.(2377-2379)CAG>CAA	p.Q793Q	SAMD9L_uc003umj.1_Silent_p.Q793Q|SAMD9L_uc003umi.1_Silent_p.Q793Q|SAMD9L_uc010lfb.1_Silent_p.Q793Q|SAMD9L_uc003umk.1_Silent_p.Q793Q|SAMD9L_uc010lfc.1_Silent_p.Q793Q|SAMD9L_uc010lfd.1_Silent_p.Q793Q|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	793										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GAATGTAATCCTGATGGCTCT	0.378			NA											30	108					0	0	0.009535	0	0
CALCR	799	broad.mit.edu	37	7	93098038	93098038	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:93098038G>T	uc003umv.1	-	7	825	c.564C>A	c.(562-564)TTC>TTA	p.F188L	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.F170L|CALCR_uc003umw.2_Missense_Mutation_p.F170L	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	170	Helical; Name=1; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	TGAAAAACACGAAAATCCCCA	0.398			NA											35	24					2.52449e-32	3.29534e-32	0.006999	1	0
CALCR	799	broad.mit.edu	37	7	93108766	93108766	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:93108766C>T	uc003umv.1	-	4	420	c.159G>A	c.(157-159)GAG>GAA	p.E53E	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Silent_p.E35E|CALCR_uc003umw.2_Silent_p.E35E	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	35	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	ATGGCTTGGGCTCTATTGTTG	0.423			NA											33	137					0	0	0.002836	0	0
CALCR	799	broad.mit.edu	37	7	93108804	93108804	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:93108804G>T	uc003umv.1	-	4	382	c.121C>A	c.(121-123)CTT>ATT	p.L41I	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.L23I|CALCR_uc003umw.2_Missense_Mutation_p.L23I	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	23					activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding	p.Y41*(1)		ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	AAGGCAGGAAGAATTGGGGTT	0.378			NA											24	118					9.57634e-11	1.15212e-10	0.00333	1	0
TECPR1	25851	broad.mit.edu	37	7	97862899	97862899	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:97862899C>T	uc003upg.2	-	11	1711	c.1506G>A	c.(1504-1506)TCG>TCA	p.S502S	TECPR1_uc003uph.1_Silent_p.S432S	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	502						integral to membrane	protein binding			pancreas(1)	1						AGCCAGCGGCCGAGTGGCTGG	0.687			NA											8	12					0	0	0.004482	0	0
TRRAP	8295	broad.mit.edu	37	7	98543387	98543387	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:98543387C>T	uc003upp.2	+	32	4700	c.4491C>T	c.(4489-4491)TGC>TGT	p.C1497C	TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Silent_p.C1189C	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	1497					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTTCCGAGTGCGGGAGATGTC	0.373			NA											11	54					0	0	0.000978	0	0
ZAN	7455	broad.mit.edu	37	7	100345264	100345264	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:100345264G>A	uc003uwj.2	+	9	1188	c.1023G>A	c.(1021-1023)CAG>CAA	p.Q341Q	ZAN_uc003uwk.2_Silent_p.Q341Q|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	341	MAM 2.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GACGGATACAGGTACAGAGAA	0.433			NA											13	50					0	0	0.001855	0	0
CUX1	1523	broad.mit.edu	37	7	101747700	101747700	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:101747700A>T	uc003uyx.3	+	6	529	c.491A>T	c.(490-492)AAG>ATG	p.K164M	CUX1_uc003uys.3_Missense_Mutation_p.K175M|CUX1_uc003uyt.2_Missense_Mutation_p.K175M|CUX1_uc011kkn.1_Missense_Mutation_p.K138M|CUX1_uc003uyw.2_Missense_Mutation_p.K129M|CUX1_uc003uyv.2_Missense_Mutation_p.K159M|CUX1_uc003uyu.2_Missense_Mutation_p.K175M	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	164	Potential.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						GCTCTTGAGAAGGAACAGAAG	0.418			NA											7	109					0	0	0.001984	0	0
CUX1	1523	broad.mit.edu	37	7	101755043	101755043	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:101755043G>A	uc003uyx.3	+	7	634	c.596G>A	c.(595-597)AGC>AAC	p.S199N	CUX1_uc003uys.3_Missense_Mutation_p.S210N|CUX1_uc003uyt.2_Missense_Mutation_p.S210N|CUX1_uc011kkn.1_Missense_Mutation_p.S173N|CUX1_uc003uyw.2_Missense_Mutation_p.S164N|CUX1_uc003uyv.2_Missense_Mutation_p.S194N|CUX1_uc003uyu.2_Missense_Mutation_p.S210N	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	199	Potential.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						AAGGTTCAGAGCCTACAAACA	0.562			NA											8	33					0	0	0.00308	0	0
RELN	5649	broad.mit.edu	37	7	103276722	103276722	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:103276722G>A	uc003vca.2	-	18	2423	c.2263C>T	c.(2263-2265)CGT>TGT	p.R755C	RELN_uc010liz.2_Missense_Mutation_p.R755C	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	755					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATTAGCTGACGCCGCCCATCT	0.433	NSCLC(146;835 1944 15585 22231 52158)		NA											7	37					0	0	0.006214	0	0
PUS7	54517	broad.mit.edu	37	7	105142882	105142882	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:105142882T>C	uc003vcx.2	-	5	934	c.715A>G	c.(715-717)AAA>GAA	p.K239E	PUS7_uc010lji.2_Missense_Mutation_p.K239E|PUS7_uc003vcy.2_Missense_Mutation_p.K239E|PUS7_uc003vcz.1_Missense_Mutation_p.K239E	NM_019042	NP_061915	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 homolog	239					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			breast(1)	1						AAAGCCTTTTTCCCAGCTGCG	0.532	Colon(138;2387 3051 17860)		NA											21	91					0	0	0.004656	0	0
LAMB4	22798	broad.mit.edu	37	7	107743616	107743616	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:107743616G>A	uc010ljo.1	-	10	1137	c.1053C>T	c.(1051-1053)AGC>AGT	p.S351S	LAMB4_uc003vey.2_Silent_p.S351S	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	351	Laminin EGF-like 2.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TGAGGCCACCGCTTGCCAGGT	0.587			NA											4	12					0	0	0.009096	0	0
C7orf60	154743	broad.mit.edu	37	7	112555439	112555439	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:112555439G>A	uc003vgo.1	-	2	351	c.224C>T	c.(223-225)GCC>GTC	p.A75V	C7orf60_uc011kms.1_Missense_Mutation_p.A101V	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	75										ovary(2)|skin(1)	3						CATTGCAACGGCATATTCACA	0.358			NA											5	67					0	0	0.000602	0	0
FOXP2	93986	broad.mit.edu	37	7	114269985	114269985	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:114269985A>G	uc003vhb.2	+	5	896	c.522A>G	c.(520-522)CAA>CAG	p.Q174Q	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Silent_p.Q199Q|FOXP2_uc003vha.2_Silent_p.Q82Q|FOXP2_uc011kmu.1_Silent_p.Q191Q|FOXP2_uc011kmv.1_Silent_p.Q174Q|FOXP2_uc010ljz.1_Silent_p.Q82Q|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Silent_p.Q174Q|FOXP2_uc003vgx.2_Silent_p.Q174Q|FOXP2_uc003vhd.2_Silent_p.Q174Q|FOXP2_uc003vhc.2_Silent_p.Q199Q	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	174	Gln-rich.				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	p.Q174*(1)		ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						aacaacaacaacagcagcaac	0.164			NA											10	37					0	0	0.000978	0	0
PTPRZ1	5803	broad.mit.edu	37	7	121650420	121650420	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:121650420C>T	uc003vjy.2	+	12	1715	c.1320C>T	c.(1318-1320)GGC>GGT	p.G440G	PTPRZ1_uc003vjz.2_Silent_p.G440G|PTPRZ1_uc011knt.1_5'UTR	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	440	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TTGAAGAAGGCGCTATTGTGA	0.378			NA											14	89					0	0	0.004007	0	0
RNF133	168433	broad.mit.edu	37	7	122338851	122338851	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:122338851T>A	uc003vkj.1	-	1	358	c.122A>T	c.(121-123)TAT>TTT	p.Y41F	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron	NM_139175	NP_631914	Q8WVZ7	RN133_HUMAN	ring finger protein 133	41						endoplasmic reticulum membrane|integral to membrane	ligase activity|zinc ion binding			skin(1)	1						TATGTTCATATAAGCCATCCA	0.433	Colon(198;1778 2057 7449 19869 45985)		NA											11	116					0	0	0.001368	0	0
FLNC	2318	broad.mit.edu	37	7	128486101	128486101	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:128486101C>T	uc003vnz.3	+	22	4057	c.3848C>T	c.(3847-3849)ACA>ATA	p.T1283I	FLNC_uc003voa.3_Missense_Mutation_p.T1283I	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1283	Filamin 11.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						CTAACAGCCACAGGCGGCAAC	0.632			NA											11	33					0	0	0.001855	0	0
NRF1	4899	broad.mit.edu	37	7	129394889	129394889	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:129394889G>C	uc003voz.2	+	11	1497	c.1380G>C	c.(1378-1380)CAG>CAC	p.Q460H	NRF1_uc003vpa.2_Missense_Mutation_p.Q479H|NRF1_uc011kpa.1_Missense_Mutation_p.Q299H|NRF1_uc003vpb.2_Missense_Mutation_p.Q460H	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	460	Required for transcriptional activation.				generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						GCATGTACCAGACTGTGGTGA	0.627			NA											11	74					0	0	0.001368	0	0
KLF14	136259	broad.mit.edu	37	7	130417921	130417921	+	Missense_Mutation	SNP	C	C	T	rs145868754		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:130417921C>T	uc003vqk.1	-	1	940	c.940G>A	c.(940-942)GGC>AGC	p.G314S		NM_138693	NP_619638	Q8TD94	KLF14_HUMAN	Kruppel-like factor 14	314					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(18;0.0435)					GGCGCCGGGCCGGGACCGGAG	0.627			NA											3	20					0	0	0.000602	0	0
NUP205	23165	broad.mit.edu	37	7	135286203	135286203	+	Silent	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:135286203C>G	uc003vsw.2	+	17	2491	c.2460C>G	c.(2458-2460)CTC>CTG	p.L820L		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	820					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						AGCTTGCTCTCAGTTTACTGG	0.403			NA											26	126					0	0	0.005443	0	0
SLC13A4	26266	broad.mit.edu	37	7	135376328	135376328	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:135376328G>A	uc003vta.2	-	12	1975	c.1286C>T	c.(1285-1287)GCG>GTG	p.A429V	SLC13A4_uc003vtb.2_Missense_Mutation_p.A430V|PL-5283_uc003vsz.3_RNA	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate	429	Helical; (Potential).					integral to plasma membrane	sodium:sulfate symporter activity				0						GGGCTTCTTCGCTGGAATGAG	0.473			NA											4	59					0	0	0.001168	0	0
TRY6	154754	broad.mit.edu	37	7	142480049	142480049	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:142480049G>A	uc011ksq.1	+	2	264	c.181G>A	c.(181-183)GCA>ACA	p.A61T	uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_RNA|uc003wan.1_Intron|TRY6_uc011kso.1_RNA|TRY6_uc011ksr.1_RNA	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						GGTGGTGTCAGCAGGTCACTG	0.577			NA											14	61					0	0	0.007413	0	0
TRPV6	55503	broad.mit.edu	37	7	142569486	142569486	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:142569486C>T	uc003wbx.1	-	15	2368	c.2152G>A	c.(2152-2154)GGG>AGG	p.G718R	TRPV6_uc003wbw.1_Missense_Mutation_p.G504R|TRPV6_uc010lou.1_Missense_Mutation_p.G589R	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	718	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CAGCTCTCCCCGTCCTCCAGA	0.527			NA											7	104					0	0	0.00308	0	0
OR9A2	135924	broad.mit.edu	37	7	142724022	142724022	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:142724022A>T	uc003wcc.1	-	1	198	c.198T>A	c.(196-198)TCT>TCA	p.S66S		NM_001001658	NP_001001658	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A,	66	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	Melanoma(164;0.059)					TCTCCAGGGTAGAGAGGTGGC	0.458			NA											29	95					0	0	0.007291	0	0
CLCN1	1180	broad.mit.edu	37	7	143018908	143018908	+	Silent	SNP	G	G	A	rs147317366	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:143018908G>A	uc003wcr.1	+	5	750	c.663G>A	c.(661-663)GCG>GCA	p.A221A	CLCN1_uc011ktc.1_5'UTR|CLCN1_uc003wcs.1_RNA|CLCN1_uc010lox.1_RNA|CLCN1_uc010loy.1_Silent_p.A69A	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	221	Helical; (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					CCCTGACTGCGGGCCTGGGCA	0.587			NA											4	60					0	0	0.009096	0	0
CLCN1	1180	broad.mit.edu	37	7	143028329	143028329	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:143028329C>A	uc003wcr.1	+	9	1071	c.984C>A	c.(982-984)ACC>ACA	p.T328T	CLCN1_uc011ktc.1_5'UTR	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	328					muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					CTACAGTCACCATCACTGCTC	0.493			NA											36	63					5.71845e-15	7.17112e-15	0.005524	1	0
ZYX	7791	broad.mit.edu	37	7	143079711	143079711	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:143079711A>T	uc003wcw.2	+	4	589	c.434A>T	c.(433-435)GAT>GTT	p.D145V	ZYX_uc011ktd.1_5'UTR|ZYX_uc003wcx.2_Missense_Mutation_p.D145V|ZYX_uc011kte.1_Intron|ZYX_uc011ktf.1_5'UTR	NM_001010972	NP_001010972	Q15942	ZYX_HUMAN	zyxin	145					cell adhesion|cell-cell signaling|interspecies interaction between organisms|signal transduction	cell-cell adherens junction|cytoplasm|focal adhesion|integral to plasma membrane|nucleus|stress fiber	protein binding|zinc ion binding				0	Melanoma(164;0.205)					AGCAGTATTGATTTGGAGATC	0.557			NA											14	217					0	0	0.003163	0	0
OR2A12	346525	broad.mit.edu	37	7	143792215	143792215	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:143792215G>T	uc011kty.1	+	1	15	c.15G>T	c.(13-15)CAG>CAT	p.Q5H		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	5	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					AAAGCAATCAGACCTGGATCA	0.398			NA											8	34					0.00307968	0.0032006	0.00308	1	0
CNTNAP2	26047	broad.mit.edu	37	7	147183130	147183130	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:147183130A>G	uc003weu.1	+	11	2290	c.1774A>G	c.(1774-1776)AAC>GAC	p.N592D		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	592	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CACCTGCCACAACTGTGAGTG	0.453			NA								HNSCC(39;0.1)			19	40					0	0	0.00278	0	0
C7orf33	202865	broad.mit.edu	37	7	148311279	148311279	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:148311279G>C	uc003wew.2	+	2	711	c.350G>C	c.(349-351)AGG>ACG	p.R117T		NM_145304	NP_660347	Q8WU49	CG033_HUMAN	hypothetical protein LOC202865	117										central_nervous_system(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CCAGGCACCAGGATGGGCTTG	0.537			NA											13	71					0	0	0.00245	0	0
ZNF777	27153	broad.mit.edu	37	7	149129388	149129388	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:149129388T>C	uc003wfv.2	-	6	2138	c.1975A>G	c.(1975-1977)ACG>GCG	p.T659A		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	659					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			CGCTCACCCGTGTGCGTGATC	0.632			NA											30	194					0	0	0.002096	0	0
KRBA1	84626	broad.mit.edu	37	7	149426440	149426440	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:149426440T>C	uc003wfz.2	+	14	2189	c.1790T>C	c.(1789-1791)GTG>GCG	p.V597A	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_Intron|KRBA1_uc003wgb.2_Intron	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	597										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGCCAGGAGTGTGGAGGTGG	0.617			NA											6	11					0	0	0.001168	0	0
SSPO	23145	broad.mit.edu	37	7	149474866	149474866	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:149474866C>T	uc010lpk.2	+	5	665	c.665C>T	c.(664-666)GCG>GTG	p.A222V	SSPO_uc010lpl.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	222	VWFD 1.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TACCTGCTGGCGGGTGCTGCG	0.687			NA											3	11					0	0	0.009096	0	0
GIMAP6	474344	broad.mit.edu	37	7	150325462	150325462	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:150325462A>G	uc003whn.2	-	3	648	c.224T>C	c.(223-225)GTG>GCG	p.V75A	GIMAP6_uc003whm.2_Intron	NM_024711	NP_078987	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	75							GTP binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGTCTTGGTCACGGGTCTGGT	0.577			NA											46	202					0	0	0.002522	0	0
GIMAP2	26157	broad.mit.edu	37	7	150389519	150389519	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:150389519G>C	uc003who.2	+	3	233	c.145G>C	c.(145-147)GAA>CAA	p.E49Q	GIMAP1_uc003whp.2_Intron	NM_015660	NP_056475	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	49						integral to membrane	GTP binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCAAGCATTTGAATCGAAGCT	0.478			NA											7	57					0	0	0.001984	0	0
ABCF2	10061	broad.mit.edu	37	7	150921105	150921105	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:150921105C>A	uc003wjp.2	-	4	574	c.463G>T	c.(463-465)GAC>TAC	p.D155Y	ABCF2_uc003wjo.1_Missense_Mutation_p.D155Y	NM_007189	NP_009120	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F, member 2	155	ABC transporter 1.					ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGTGTCTTGTCACTAGGGGGC	0.557			NA											16	69					1.15088e-07	1.31589e-07	0.004007	1	0
MLL3	58508	broad.mit.edu	37	7	151921652	151921652	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:151921652A>G	uc003wla.2	-	19	3245	c.3026T>C	c.(3025-3027)GTG>GCG	p.V1009A	MLL3_uc003wkz.2_Missense_Mutation_p.V70A	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1009	PHD-type 5.|PHD-type 4.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GGCCTCACACACAGTGCACTC	0.448	Colon(68;14 1149 1884 27689 34759)		NA	N		medulloblastoma								5	31					0	0	0.000602	0	0
ESYT2	57488	broad.mit.edu	37	7	158552753	158552753	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr7:158552753T>A	uc003wob.1	-	12	1529	c.1463A>T	c.(1462-1464)GAC>GTC	p.D488V	ESYT2_uc003woc.1_Missense_Mutation_p.D312V|ESYT2_uc003wod.1_Missense_Mutation_p.D488V|ESYT2_uc003woa.1_Missense_Mutation_p.D44V	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain	516						integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3						CAGCACCTTGTCGAGGTTTGA	0.448			NA											10	49					0	0	0.000978	0	0
ARHGEF10	9639	broad.mit.edu	37	8	1824883	1824883	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:1824883A>C	uc003wpr.2	+	8	1004	c.826A>C	c.(826-828)AGC>CGC	p.S276R	ARHGEF10_uc003wpq.1_Missense_Mutation_p.S301R|ARHGEF10_uc003wps.2_Missense_Mutation_p.S277R|ARHGEF10_uc003wpt.2_Missense_Mutation_p.S191R|ARHGEF10_uc003wpv.2_Missense_Mutation_p.S48R	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	301					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CTTCCTGCGCAGCAACCACAA	0.502			NA											9	104					0	0	0.008291	0	0
MYOM2	9172	broad.mit.edu	37	8	2041800	2041800	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:2041800C>T	uc003wpx.3	+	17	2145	c.2007C>T	c.(2005-2007)TTC>TTT	p.F669F	MYOM2_uc011kwi.1_Silent_p.F94F	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	669	Fibronectin type-III 3.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TTCTCAGGTTCGTGGTGCACG	0.498			NA											11	86					0	0	0.000978	0	0
CSMD1	64478	broad.mit.edu	37	8	2857501	2857501	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:2857501C>A	uc011kwk.1	-	53	8575	c.8185G>T	c.(8185-8187)GGA>TGA	p.G2729*	CSMD1_uc011kwj.1_Nonsense_Mutation_p.G2058*|CSMD1_uc010lrg.2_Nonsense_Mutation_p.G739*	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2729	Extracellular (Potential).|Sushi 18.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCGTTTGTCCAGACCACTTG	0.473			NA											36	127					8.69298e-16	1.09343e-15	0.006999	1	0
SGK223	157285	broad.mit.edu	37	8	8234784	8234784	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:8234784C>T	uc003wsh.3	-	2	1135	c.1135G>A	c.(1135-1137)GGC>AGC	p.G379S		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	379							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						CCTGGGCAGCCAGGGTCCTGC	0.682	GBM(34;731 755 10259 33573 33867)		NA											12	32					0	0	0.001368	0	0
RP1L1	94137	broad.mit.edu	37	8	10470481	10470481	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:10470481A>G	uc003wtc.2	-	4	1356	c.1127T>C	c.(1126-1128)TTC>TCC	p.F376S		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	376					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		AGGCTCTGAGAAGCCCCAAGG	0.677			NA											22	125					0	0	0.00278	0	0
SOX7	83595	broad.mit.edu	37	8	10583693	10583693	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:10583693G>A	uc003wtf.2	-	2	801	c.722C>T	c.(721-723)CCG>CTG	p.P241L	SOX7_uc011kwz.1_Missense_Mutation_p.P293L	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	241					endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)		CGGTGAGTACGGGTGCCCTGG	0.687			NA											12	31					0	0	0.004007	0	0
XKR6	286046	broad.mit.edu	37	8	10756150	10756150	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:10756150C>T	uc003wtk.1	-	3	1265	c.1238G>A	c.(1237-1239)TGG>TAG	p.W413*		NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related	413	Helical; (Potential).					integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		GATCTCCTCCCACTTGGACAT	0.488			NA											9	30					0	0	0.004482	0	0
PCM1	5108	broad.mit.edu	37	8	17823602	17823602	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:17823602C>A	uc003wyi.3	+	19	3372	c.2950C>A	c.(2950-2952)CTT>ATT	p.L984I	PCM1_uc011kyh.1_Missense_Mutation_p.L984I|PCM1_uc003wyj.3_Missense_Mutation_p.L985I	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1	984					centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		GCAAGAAAACCTTCGTTGGGT	0.403			NA	T	RET|JAK2	papillary thyroid|CML|MPD								5	30					0.000602214	0.000638666	0.000602	1	0
PCM1	5108	broad.mit.edu	37	8	17823622	17823622	+	Silent	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:17823622C>G	uc003wyi.3	+	19	3392	c.2970C>G	c.(2968-2970)CTC>CTG	p.L990L	PCM1_uc011kyh.1_Silent_p.L990L|PCM1_uc003wyj.3_Silent_p.L991L	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1	990					centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		TGTCAGAGCTCTCTTACGTAG	0.413			NA	T	RET|JAK2	papillary thyroid|CML|MPD								3	21					0	0	0.004672	0	0
NEFM	4741	broad.mit.edu	37	8	24776003	24776003	+	Missense_Mutation	SNP	G	G	A	rs140995374		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:24776003G>A	uc003xed.3	+	3	2668	c.2635G>A	c.(2635-2637)GTC>ATC	p.V879I	NEFM_uc011lac.1_Missense_Mutation_p.V661I|NEFM_uc010lue.2_Missense_Mutation_p.V503I	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	879	Tail.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		ATCTGTAACCGTCACTCAAAA	0.413			NA											10	64					0	0	0.008291	0	0
GOT1L1	137362	broad.mit.edu	37	8	37794833	37794833	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:37794833G>C	uc011lbj.1	-	4	581	c.481C>G	c.(481-483)CTA>GTA	p.L161V		NM_152413	NP_689626	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	161					biosynthetic process|cellular amino acid metabolic process	cytoplasm	pyridoxal phosphate binding|transaminase activity			ovary(1)	1	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			TCCATGCATAGCTTCTTGGGG	0.542			NA											4	9					0	0	0.000602	0	0
SNTG1	54212	broad.mit.edu	37	8	51617225	51617225	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:51617225G>A	uc010lxy.1	+	17	1475	c.1104G>A	c.(1102-1104)CTG>CTA	p.L368L	SNTG1_uc003xqs.1_Silent_p.L368L|SNTG1_uc010lxz.1_Silent_p.L368L|SNTG1_uc011ldl.1_RNA	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	368	PH.				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GGGAGGACCTGTACTTCTCAG	0.547			NA											38	31					0	0	0.006999	0	0
PXDNL	137902	broad.mit.edu	37	8	52359577	52359577	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:52359577A>G	uc003xqu.3	-	12	1613	c.1512T>C	c.(1510-1512)ACT>ACC	p.T504T		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	504	Ig-like C2-type 3.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGGGTTTTACAGTCAGCTGCA	0.438			NA											35	102					0	0	0.005524	0	0
SOX17	64321	broad.mit.edu	37	8	55370831	55370831	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:55370831A>G	uc003xsb.3	+	1	337	c.133A>G	c.(133-135)AAG>GAG	p.K45E		NM_022454	NP_071899	Q9H6I2	SOX17_HUMAN	SRY-box 17	45					angiogenesis|cardiac cell fate determination|endocardial cell differentiation|endocardium formation|endoderm formation|heart formation|heart looping|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|outflow tract morphogenesis|positive regulation of transcription, DNA-dependent|protein destabilization|protein stabilization|regulation of embryonic development|renal system development|vasculogenesis|Wnt receptor signaling pathway	transcription factor complex	beta-catenin binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			lung(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			CATGAAGGTGAAGGGCGAGGC	0.736			NA											4	12					0	0	0.009096	0	0
TGS1	96764	broad.mit.edu	37	8	56715024	56715024	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:56715024A>G	uc003xsj.3	+	9	2245	c.1858A>G	c.(1858-1860)AAA>GAA	p.K620E	TGS1_uc010lyh.2_Missense_Mutation_p.K524E	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase homolog	620	Lys-rich.				cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity			ovary(1)|lung(1)|breast(1)	3		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AGCTGAAGTgaaaaagaagaa	0.308	Esophageal Squamous(34;275 823 4842 34837 48447)		NA											11	43					0	0	0.000978	0	0
NKAIN3	286183	broad.mit.edu	37	8	63492148	63492148	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:63492148G>T	uc010lyq.1	+	2	237	c.105G>T	c.(103-105)GCG>GCT	p.A35A		NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	35	Helical; (Potential).					integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				TCCAGTGGGCGCCTATTCTTG	0.378			NA											49	71					6.31075e-24	8.20332e-24	0.00361	1	0
CSPP1	79848	broad.mit.edu	37	8	68062151	68062151	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:68062151T>G	uc003xxi.2	+	18	2230	c.2199T>G	c.(2197-2199)GAT>GAG	p.D733E	CSPP1_uc003xxg.1_Missense_Mutation_p.D725E|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.D698E|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	733						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ACCTAGAAGATGCTGCAAATA	0.323			NA											41	114					0	0	0.00623	0	0
KCNB2	9312	broad.mit.edu	37	8	73480526	73480526	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:73480526C>A	uc003xzb.2	+	2	1145	c.557C>A	c.(556-558)CCT>CAT	p.P186H		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	186	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			CTGGAGAAACCTAACTCATCA	0.448			NA											12	103					0.00010058	0.000107493	0.001368	1	0
HNF4G	3174	broad.mit.edu	37	8	76470886	76470886	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:76470886A>T	uc003yaq.2	+	8	996	c.726A>T	c.(724-726)GCA>GCT	p.A242A	HNF4G_uc003yar.2_Silent_p.A279A	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	242					endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			GTTTAAAGGCAATTGTATTTT	0.318			NA											22	233					0	0	0.00278	0	0
ZFHX4	79776	broad.mit.edu	37	8	77617020	77617020	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:77617020C>G	uc003yav.2	+	2	1084	c.697C>G	c.(697-699)CGA>GGA	p.R233G	ZFHX4_uc003yat.1_Missense_Mutation_p.R233G|ZFHX4_uc003yau.1_Missense_Mutation_p.R233G|ZFHX4_uc003yaw.1_Missense_Mutation_p.R233G	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	233						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTATGATCTCCGACACAAGAG	0.468			NA								HNSCC(33;0.089)			10	37					0	0	0.008291	0	0
ZFHX4	79776	broad.mit.edu	37	8	77765790	77765790	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:77765790G>C	uc003yav.2	+	10	6885	c.6498G>C	c.(6496-6498)CAG>CAC	p.Q2166H	ZFHX4_uc003yau.1_Missense_Mutation_p.Q2211H|ZFHX4_uc003yaw.1_Missense_Mutation_p.Q2166H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2166						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTGATCCACAGCCCACCTCTT	0.373			NA								HNSCC(33;0.089)			23	129					0	0	0.001882	0	0
ZFHX4	79776	broad.mit.edu	37	8	77766839	77766839	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:77766839C>A	uc003yav.2	+	10	7934	c.7547C>A	c.(7546-7548)CCT>CAT	p.P2516H	ZFHX4_uc003yau.1_Missense_Mutation_p.P2561H|ZFHX4_uc003yaw.1_Missense_Mutation_p.P2516H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2516						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAAATGCCCCCTCAGGCCAGT	0.488			NA								HNSCC(33;0.089)			13	91					7.93312e-07	8.86685e-07	0.00245	1	0
ZFHX4	79776	broad.mit.edu	37	8	77768303	77768303	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:77768303A>G	uc003yav.2	+	10	9398	c.9011A>G	c.(9010-9012)TAC>TGC	p.Y3004C	ZFHX4_uc003yau.1_Missense_Mutation_p.Y3049C|ZFHX4_uc003yaw.1_Missense_Mutation_p.Y3004C	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3004						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GAGAAAGATTACTTGGCTCCG	0.517			NA								HNSCC(33;0.089)			14	109					0	0	0.00245	0	0
ZFHX4	79776	broad.mit.edu	37	8	77775752	77775752	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:77775752C>A	uc003yav.2	+	11	10054	c.9667C>A	c.(9667-9669)CCT>ACT	p.P3223T		NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3219						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATACTTTATCCCTGGGTTTGC	0.493			NA								HNSCC(33;0.089)			22	165					4.26978e-12	5.21256e-12	0.00333	1	0
Unknown	0	broad.mit.edu	37	8	86567320	86567320	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:86567320C>T	uc003ydl.1	-	1	586	c.499G>A	c.(499-501)GAC>AAC	p.D167N		NM_172239	NP_758439			exonuclease GOR												NA						ATGTCGGCGTCCACCACGGTG	0.587			NA											7	126					0	0	0.001984	0	0
PSKH2	85481	broad.mit.edu	37	8	87076615	87076615	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:87076615T>C	uc011lfy.1	-	2	431	c.431A>G	c.(430-432)GAG>GGG	p.E144G		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	144	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			ATCAAAGAGCTCCCCTCCGGT	0.522			NA											11	50					0	0	0.001368	0	0
NBN	4683	broad.mit.edu	37	8	90965679	90965679	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:90965679T>A	uc003yej.1	-	11	1748	c.1638A>T	c.(1636-1638)AGA>AGT	p.R546S	NBN_uc003yei.1_Missense_Mutation_p.R464S|NBN_uc011lgb.1_Missense_Mutation_p.R546S	NM_002485	NP_002476	O60934	NBN_HUMAN	nibrin	546					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding			central_nervous_system(3)|kidney(3)|lung(1)	7			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTTTATTTGATCTTAGCTTTT	0.333			NA						Direct_reversal_of_damage|Homologous_recombination	Nijmegen_Breakage_syndrome				49	42					0	0	0.00361	0	0
NBN	4683	broad.mit.edu	37	8	90976659	90976659	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:90976659G>A	uc003yej.1	-	8	1083	c.973C>T	c.(973-975)CCT>TCT	p.P325S	NBN_uc003yei.1_Missense_Mutation_p.P243S|NBN_uc011lgb.1_Missense_Mutation_p.P325S	NM_002485	NP_002476	O60934	NBN_HUMAN	nibrin	325					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding			central_nervous_system(3)|kidney(3)|lung(1)	7			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TGGCCCTGAGGATCACAGTAA	0.333			NA						Direct_reversal_of_damage|Homologous_recombination	Nijmegen_Breakage_syndrome				22	56					0	0	0.00278	0	0
TMEM67	91147	broad.mit.edu	37	8	94793932	94793932	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:94793932A>T	uc011lgk.1	+	10	1096	c.1025A>T	c.(1024-1026)AAT>ATT	p.N342I	TMEM67_uc010mat.1_Missense_Mutation_p.N257I|TMEM67_uc010maw.2_Intron|TMEM67_uc003yga.3_Missense_Mutation_p.N261I	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	342					cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ATAAGAGGAAATTTTCTCAAG	0.323			NA											9	31					0	0	0.006214	0	0
VPS13B	157680	broad.mit.edu	37	8	100712139	100712139	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:100712139A>G	uc003yiv.2	+	36	6619	c.6508A>G	c.(6508-6510)AAG>GAG	p.K2170E	VPS13B_uc003yiw.2_Missense_Mutation_p.K2145E	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2170					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCTTAGTGTCAAGGCAACACA	0.423	Colon(161;2205 2542 7338 31318)		NA											11	40					0	0	0.000978	0	0
VPS13B	157680	broad.mit.edu	37	8	100844718	100844718	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:100844718A>G	uc003yiv.2	+	52	9638	c.9527A>G	c.(9526-9528)GAT>GGT	p.D3176G	VPS13B_uc003yiw.2_Missense_Mutation_p.D3151G	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3176					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCAGTACTGGATGCATCCCTG	0.532	Colon(161;2205 2542 7338 31318)		NA											6	17					0	0	0.001168	0	0
VPS13B	157680	broad.mit.edu	37	8	100844812	100844812	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:100844812A>G	uc003yiv.2	+	52	9732	c.9621A>G	c.(9619-9621)AGA>AGG	p.R3207R	VPS13B_uc003yiw.2_Silent_p.R3182R	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3207					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTATAGTTAGACCAGAGTTTC	0.483	Colon(161;2205 2542 7338 31318)		NA											10	58					0	0	0.000978	0	0
UBR5	51366	broad.mit.edu	37	8	103273473	103273473	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:103273473A>G	uc003ykr.1	-	56	7890	c.7857T>C	c.(7855-7857)CCT>CCC	p.P2619P	UBR5_uc003yks.1_Silent_p.P2618P|UBR5_uc003ykq.2_Silent_p.P130P	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	2619	HECT.				cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TTACACCATTAGGAATGAGTT	0.348	Ovarian(131;96 1741 5634 7352 27489)		NA											17	101					0	0	0.006122	0	0
ZFPM2	23414	broad.mit.edu	37	8	106456593	106456593	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:106456593C>A	uc003ymd.2	+	3	308	c.285C>A	c.(283-285)GAC>GAA	p.D95E		NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	95					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TTGAGACAGACGACTGGGATG	0.433			NA											7	10					0.00198382	0.00207558	0.001984	1	0
ZFPM2	23414	broad.mit.edu	37	8	106813864	106813864	+	Silent	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:106813864T>A	uc003ymd.2	+	8	1577	c.1554T>A	c.(1552-1554)GCT>GCA	p.A518A	ZFPM2_uc011lhs.1_Silent_p.A249A	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	518					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGATCTTAGCTAAGATGTCTG	0.502			NA											33	125					0	0	0.009535	0	0
EIF3E	3646	broad.mit.edu	37	8	109241348	109241348	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:109241348T>C	uc003ymu.2	-	6	576	c.548A>G	c.(547-549)GAT>GGT	p.D183G	EIF3E_uc003ymt.2_Missense_Mutation_p.D134G|EIF3E_uc003ymv.2_Missense_Mutation_p.D90G|EIF3E_uc010mci.1_Missense_Mutation_p.D183G	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	183	Sufficient for interaction with TRIM27.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			CATGGCTGCATCCCAATTCTG	0.368	GBM(15;360 410 8460 34179 52246)		NA											13	83					0	0	0.00245	0	0
KCNV1	27012	broad.mit.edu	37	8	110980804	110980804	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:110980804A>G	uc003ynr.3	-	3	1358	c.1016T>C	c.(1015-1017)ATC>ACC	p.I339T	KCNV1_uc010mcw.2_Missense_Mutation_p.I339T	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	339	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			ACACTGGGTGATTGTCATCCC	0.348			NA											5	72					0	0	0.001168	0	0
CSMD3	114788	broad.mit.edu	37	8	113299373	113299373	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:113299373G>T	uc003ynu.2	-	58	9410	c.9251C>A	c.(9250-9252)ACT>AAT	p.T3084N	CSMD3_uc003yns.2_Missense_Mutation_p.T2286N|CSMD3_uc003ynt.2_Missense_Mutation_p.T3044N|CSMD3_uc011lhx.1_Missense_Mutation_p.T2915N	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3084	Extracellular (Potential).|Sushi 22.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GATGTAACCAGTATCACAAGC	0.458			NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			53	34					5.39261e-20	6.93734e-20	0.00361	1	0
CSMD3	114788	broad.mit.edu	37	8	113301759	113301759	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:113301759A>T	uc003ynu.2	-	57	9142	c.8983T>A	c.(8983-8985)TGT>AGT	p.C2995S	CSMD3_uc003yns.2_Missense_Mutation_p.C2197S|CSMD3_uc003ynt.2_Missense_Mutation_p.C2955S|CSMD3_uc011lhx.1_Missense_Mutation_p.C2826S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2995	Sushi 21.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGGTGTCCACAGTCAATCACT	0.373			NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			6	24					0	0	0.001168	0	0
CSMD3	114788	broad.mit.edu	37	8	113304920	113304920	+	Silent	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:113304920A>T	uc003ynu.2	-	55	8793	c.8634T>A	c.(8632-8634)CCT>CCA	p.P2878P	CSMD3_uc003yns.2_Silent_p.P2080P|CSMD3_uc003ynt.2_Silent_p.P2838P|CSMD3_uc011lhx.1_Silent_p.P2709P	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2878	Extracellular (Potential).|Sushi 19.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTGGACTACCAGGGTGACCAC	0.368			NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			10	48					0	0	0.006214	0	0
CSMD3	114788	broad.mit.edu	37	8	113418912	113418912	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:113418912G>C	uc003ynu.2	-	35	5809	c.5650C>G	c.(5650-5652)CCA>GCA	p.P1884A	CSMD3_uc003yns.2_Missense_Mutation_p.P1086A|CSMD3_uc003ynt.2_Missense_Mutation_p.P1844A|CSMD3_uc011lhx.1_Missense_Mutation_p.P1780A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1884	Sushi 10.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCGAATCTTGGTTCAGGCACA	0.343			NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			51	31					0	0	0.00361	0	0
CSMD3	114788	broad.mit.edu	37	8	113657345	113657345	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:113657345A>T	uc003ynu.2	-	20	3462	c.3303T>A	c.(3301-3303)CAT>CAA	p.H1101Q	CSMD3_uc003yns.2_Missense_Mutation_p.H373Q|CSMD3_uc003ynt.2_Missense_Mutation_p.H1061Q|CSMD3_uc011lhx.1_Missense_Mutation_p.H997Q	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1101	Extracellular (Potential).|CUB 6.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TACCTTTTCCATGGGTTACAT	0.353			NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			9	43					0	0	0.006214	0	0
CSMD3	114788	broad.mit.edu	37	8	113678554	113678554	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:113678554C>T	uc003ynu.2	-	17	2927	c.2768G>A	c.(2767-2769)TGG>TAG	p.W923*	CSMD3_uc003yns.2_Nonsense_Mutation_p.W195*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.W883*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.W819*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	923	Extracellular (Potential).|CUB 5.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTCAATCACCCACTCACAATT	0.378			NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			5	29					0	0	0.000602	0	0
TRPS1	7227	broad.mit.edu	37	8	116631829	116631829	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:116631829C>A	uc003ynz.2	-	2	916	c.457G>T	c.(457-459)GAT>TAT	p.D153Y	TRPS1_uc011lhy.1_Missense_Mutation_p.D157Y|TRPS1_uc003yny.2_Missense_Mutation_p.D166Y|TRPS1_uc010mcy.2_Missense_Mutation_p.D153Y	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	153					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATCTTCTGATCTTCCTTTGTC	0.522			NA							Langer-Giedion_syndrome				15	91					0.00316338	0.00328484	0.003163	1	0
ZHX1	11244	broad.mit.edu	37	8	124266208	124266208	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:124266208C>A	uc003yqe.2	-	3	2409	c.1979G>T	c.(1978-1980)AGT>ATT	p.S660I	C8orf76_uc003yqd.2_Intron|ZHX1_uc003yqf.2_Missense_Mutation_p.S660I|ZHX1_uc003yqg.2_Intron|ZHX1_uc010mdi.2_Missense_Mutation_p.S660I	NM_007222	NP_009153	Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	660	Homeobox 4.				negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CTTGCCTGTACTCCCTGACTT	0.438			NA											20	132					3.51602e-12	4.30081e-12	0.008871	1	0
ATAD2	29028	broad.mit.edu	37	8	124382167	124382167	+	Missense_Mutation	SNP	A	A	T	rs149531312	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:124382167A>T	uc003yqh.3	-	7	933	c.825T>A	c.(823-825)GAT>GAA	p.D275E	ATAD2_uc011lii.1_Missense_Mutation_p.D66E|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.D275E	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	275	Asp-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			cttcatcatcatcatcatcat	0.179			NA											8	25					0	0	0.00308	0	0
KCNQ3	3786	broad.mit.edu	37	8	133192474	133192474	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:133192474C>T	uc003ytj.2	-	4	932	c.707G>A	c.(706-708)CGC>CAC	p.R236H	KCNQ3_uc010mdt.2_Missense_Mutation_p.R236H	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	236	Helical; Voltage-sensor; Name=Segment S4; (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			CCGCAGCATGCGCAGGATCTG	0.582			NA											19	106					0	0	0.007413	0	0
COL22A1	169044	broad.mit.edu	37	8	139620214	139620214	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:139620214C>T	uc003yvd.2	-	57	4444	c.3997G>A	c.(3997-3999)GGA>AGA	p.G1333R	COL22A1_uc011ljo.1_Missense_Mutation_p.G613R	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1333	Pro-rich.|Gly-rich.|Collagen-like 13.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCTGGAGATCCCGGTGATCCA	0.433			NA								HNSCC(7;0.00092)			9	44					0	0	0.006214	0	0
DMRT1	1761	broad.mit.edu	37	9	968124	968124	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:968124C>A	uc003zgv.2	+	5	1256	c.1107C>A	c.(1105-1107)ATC>ATA	p.I369I		NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor	369					cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		CTCCCGTCATCGAGGAGGACG	0.522			NA											10	35					7.48243e-07	8.39327e-07	0.006214	1	0
DMRT3	58524	broad.mit.edu	37	9	990347	990347	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:990347T>A	uc003zgw.1	+	2	799	c.761T>A	c.(760-762)GTG>GAG	p.V254E		NM_021240	NP_067063	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor	254					cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity	p.V254E(1)		ovary(2)|central_nervous_system(1)	3		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		CCGCTTGAAGTGTTAAAAAAG	0.572			NA											53	41					0	0	0.00361	0	0
RCL1	10171	broad.mit.edu	37	9	4849480	4849480	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:4849480G>A	uc003zis.2	+	8	1159	c.901G>A	c.(901-903)GCG>ACG	p.A301T	RCL1_uc003zit.2_Missense_Mutation_p.A143T|RCL1_uc010mhk.1_Missense_Mutation_p.A143T|RCL1_uc010mhl.1_Missense_Mutation_p.A115T	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1	301					ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		CCAAAGCCTGGCGCTACTACT	0.438			NA											6	33					0	0	0.001984	0	0
PTPRD	5789	broad.mit.edu	37	9	8517921	8517921	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:8517921G>A	uc003zkk.2	-	20	2181	c.1470C>T	c.(1468-1470)GTC>GTT	p.V490V	PTPRD_uc003zkp.2_Silent_p.V490V|PTPRD_uc003zkq.2_Silent_p.V490V|PTPRD_uc003zkr.2_Silent_p.V484V|PTPRD_uc003zks.2_Silent_p.V480V|PTPRD_uc003zkl.2_Silent_p.V490V|PTPRD_uc003zkm.2_Silent_p.V477V|PTPRD_uc003zkn.2_Silent_p.V490V|PTPRD_uc003zko.2_Silent_p.V487V	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	490	Fibronectin type-III 2.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCAGGACTTTGACAGAATATG	0.438			NA								TSP Lung(15;0.13)			26	83					0	0	0.003954	0	0
KIAA1797	54914	broad.mit.edu	37	9	20912903	20912903	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:20912903A>G	uc003zog.1	+	25	3120	c.2757A>G	c.(2755-2757)GGA>GGG	p.G919G	KIAA1797_uc003zoh.1_Silent_p.G355G	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	919						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		TAAAACATGGAAAAGAAGAAC	0.428			NA											20	25					0	0	0.002299	0	0
TOPORS	10210	broad.mit.edu	37	9	32542019	32542019	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:32542019T>C	uc003zrb.2	-	3	2671	c.2504A>G	c.(2503-2505)AAC>AGC	p.N835S	TOPORS_uc003zrc.2_Missense_Mutation_p.N768S	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	835	Interaction with TOP1.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		ATTTTTGTAGTTTCCATCCAA	0.413			NA											8	173					0	0	0.004482	0	0
C9orf131	138724	broad.mit.edu	37	9	35044946	35044946	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:35044946A>G	uc003zvw.2	+	2	2349	c.2320A>G	c.(2320-2322)ACC>GCC	p.T774A	C9orf131_uc003zvu.2_Missense_Mutation_p.T726A|C9orf131_uc003zvv.2_Missense_Mutation_p.T701A|C9orf131_uc003zvx.2_Missense_Mutation_p.T739A	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	774											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			AGAGTTGCTCACCCATCCTGG	0.592			NA											26	111					0	0	0.004656	0	0
TPM2	7169	broad.mit.edu	37	9	35682149	35682149	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:35682149T>C	uc003zxq.2	-	9	1023	c.784A>G	c.(784-786)AGT>GGT	p.S262G	TPM2_uc003zxr.2_3'UTR	NM_213674	NP_998839	P07951	TPM2_HUMAN	tropomyosin 2 (beta) isoform 2	262	By similarity.				muscle filament sliding|regulation of ATPase activity	cytosol|muscle thin filament tropomyosin	actin binding|structural constituent of muscle			ovary(1)	1	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCCTTGGCACTGGCCAAGGTC	0.607			NA											20	30					0	0	0.010504	0	0
FAM75A6	389730	broad.mit.edu	37	9	43626696	43626696	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:43626696C>T	uc011lrb.1	-	4	2020	c.1991G>A	c.(1990-1992)TGC>TAC	p.C664Y		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	664						integral to membrane					0						CAGATGTGGGCACAGGTCCCT	0.567			NA											67	162					0	0	0.00361	0	0
TRPM6	140803	broad.mit.edu	37	9	77397757	77397757	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:77397757A>G	uc004ajl.1	-	22	3170	c.2932T>C	c.(2932-2934)TTC>CTC	p.F978L	TRPM6_uc004ajk.1_Missense_Mutation_p.F973L|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Missense_Mutation_p.F264L	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	978	Helical; (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						ACAATATAGAACATGTTTGCT	0.443			NA											12	42					0	0	0.001368	0	0
PCSK5	5125	broad.mit.edu	37	9	78771962	78771962	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:78771962G>T	uc004ajz.2	+	11	1852	c.1314G>T	c.(1312-1314)GTG>GTT	p.V438V	PCSK5_uc004ajy.2_Silent_p.V438V|PCSK5_uc004aka.2_RNA	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	438	Catalytic.				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						TTTCCACAGTGAGCCATCTTT	0.522			NA											31	77					6.04164e-23	7.84531e-23	0.002096	1	0
VPS13A	23230	broad.mit.edu	37	9	79898509	79898509	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:79898509C>T	uc004akr.2	+	31	3542	c.3282C>T	c.(3280-3282)AAC>AAT	p.N1094N	VPS13A_uc004akp.3_Silent_p.N1094N|VPS13A_uc004akq.3_Silent_p.N1094N|VPS13A_uc004aks.2_Silent_p.N1055N	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	1094					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CTGAAATAAACGCAAAGCTAA	0.284			NA											10	22					0	0	0.000978	0	0
VPS13A	23230	broad.mit.edu	37	9	79930204	79930204	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:79930204A>C	uc004akr.2	+	38	4708	c.4448A>C	c.(4447-4449)GAC>GCC	p.D1483A	VPS13A_uc004akp.3_Missense_Mutation_p.D1483A|VPS13A_uc004akq.3_Missense_Mutation_p.D1483A|VPS13A_uc004aks.2_Missense_Mutation_p.D1444A|VPS13A_uc004akt.2_5'Flank|VPS13A_uc010mpo.1_Missense_Mutation_p.D79A	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	1483					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						GACAAAAAAGACATGATGGAT	0.348			NA											19	52					0	0	0.010504	0	0
KIF27	55582	broad.mit.edu	37	9	86474140	86474140	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:86474140C>A	uc004ana.2	-	14	3225	c.3081G>T	c.(3079-3081)AAG>AAT	p.K1027N	KIF27_uc010mpw.2_Missense_Mutation_p.K961N|KIF27_uc010mpx.2_Missense_Mutation_p.K930N	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27	1027	Potential.				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						GGAGCTGATCCTTTTCTTTCT	0.413			NA											20	103					1.55795e-14	1.94197e-14	0.001882	1	0
SLC28A3	64078	broad.mit.edu	37	9	86920183	86920184	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:86920183_86920184CC>AA	uc010mpz.2	-	4	444_445	c.319_320GG>TT	c.(319-321)GGC>TTC	p.G107F	SLC28A3_uc011lsy.1_Missense_Mutation_p.G38F|SLC28A3_uc004anu.1_Missense_Mutation_p.G107F|SLC28A3_uc010mqb.2_Missense_Mutation_p.G38F	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter	107	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						TAATAAAATGCCCCAGATGATG	0.366	Ovarian(106;425 1539 34835 42413 43572)		NA											10	57					0	0	0.004672	0	0
LOC286238	286238	broad.mit.edu	37	9	91262457	91262457	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:91262457C>A	uc010mql.1	-	2	319	c.186G>T	c.(184-186)ATG>ATT	p.M62I		NM_001100111	NP_001093581			hypothetical protein LOC286238												0						AATGAGTTATCATCTCTCCTG	0.438			NA											18	58					5.03518e-11	6.08724e-11	0.007413	1	0
C9orf102	375748	broad.mit.edu	37	9	98684621	98684621	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:98684621A>G	uc004avt.3	+	8	1755	c.1367A>G	c.(1366-1368)TAT>TGT	p.Y456C	C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Missense_Mutation_p.Y158C|C9orf102_uc010mry.1_Missense_Mutation_p.Y158C|C9orf102_uc010mrz.2_Missense_Mutation_p.Y267C|C9orf102_uc004avu.2_5'UTR	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN	RAD26L hypothetical protein	456					DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				AAAACCTTGTATCTCAGTTAC	0.388			NA											7	27					0	0	0.00308	0	0
KIAA1529	57653	broad.mit.edu	37	9	100079414	100079414	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:100079414C>T	uc011lut.1	+	21	2185	c.1412C>T	c.(1411-1413)TCC>TTC	p.S471F	KIAA1529_uc004axe.1_Missense_Mutation_p.S471F|KIAA1529_uc004axg.1_Missense_Mutation_p.S332F|KIAA1529_uc011lus.1_Missense_Mutation_p.S289F|KIAA1529_uc010msm.1_RNA|KIAA1529_uc004axf.2_Missense_Mutation_p.S332F|KIAA1529_uc011luv.1_Missense_Mutation_p.S329F	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				CTGATGGAGTCCACCCTGCAG	0.607			NA											8	105					0	0	0.006214	0	0
RNF20	56254	broad.mit.edu	37	9	104314667	104314667	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:104314667A>G	uc004bbn.2	+	13	1623	c.1533A>G	c.(1531-1533)ACA>ACG	p.T511T		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	511	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TCTCCCAGACACGCCTGCGTA	0.458			NA											46	157					0	0	0.00361	0	0
AKNA	80709	broad.mit.edu	37	9	117122002	117122002	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:117122002C>T	uc004biq.3	-	10	2499	c.2364G>A	c.(2362-2364)GAG>GAA	p.E788E	AKNA_uc004bin.3_Silent_p.E35E|AKNA_uc004bio.3_Silent_p.E248E|AKNA_uc004bip.3_Silent_p.E707E|AKNA_uc004bir.3_Silent_p.E788E|AKNA_uc004bis.3_Silent_p.E788E|AKNA_uc010mve.2_Silent_p.E669E|AKNA_uc004biu.1_Silent_p.E529E|AKNA_uc004biv.1_Silent_p.E788E	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	788	PEST.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						ccccctcttcctcctcctcct	0.458			NA											9	31					0	0	0.004482	0	0
RC3H2	54542	broad.mit.edu	37	9	125617600	125617600	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:125617600A>C	uc010mwc.1	-	15	2919	c.2678T>G	c.(2677-2679)ATA>AGA	p.I893R	RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Missense_Mutation_p.I893R|RC3H2_uc004bne.3_Missense_Mutation_p.I893R	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2	893						cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						AAAGGGAATTATTGGATCTTC	0.423			NA											9	53					0	0	0.004482	0	0
METTL11A	28989	broad.mit.edu	37	9	132396449	132396449	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:132396449G>A	uc004byd.1	+	3	473	c.279G>A	c.(277-279)ACG>ACA	p.T93T	METTL11A_uc010myw.1_RNA|METTL11A_uc011mbs.1_Silent_p.T93T	NM_014064	NP_054783	Q9BV86	NTM1A_HUMAN	methyltransferase like 11A	93	S-adenosyl-L-methionine binding.				chromosome segregation|N-terminal peptidyl-proline dimethylation|N-terminal peptidyl-serine dimethylation|N-terminal peptidyl-serine trimethylation|spindle organization	nucleus	protein binding|protein methyltransferase activity				0						TCGACATAACGGAGGACTTCC	0.602			NA											23	110					0	0	0.002299	0	0
PRDM12	59335	broad.mit.edu	37	9	133542019	133542019	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:133542019T>A	uc004bzt.1	+	2	308	c.248T>A	c.(247-249)GTG>GAG	p.V83E		NM_021619	NP_067632	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	83					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		TCCAGCCTGGTGCTGCCTGCG	0.687			NA											7	94					0	0	0.00308	0	0
ABL1	25	broad.mit.edu	37	9	133760409	133760409	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:133760409G>T	uc004bzw.2	+	11	2735	c.2732G>T	c.(2731-2733)GGA>GTA	p.G911V	ABL1_uc004bzv.2_Missense_Mutation_p.G930V	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	911	DNA-binding (By similarity).|Pro-rich.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	GGGAAGGCTGGAGGAAAGCCC	0.642			NA	T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								16	25					4.14922e-12	5.07036e-12	0.004007	1	0
POMT1	10585	broad.mit.edu	37	9	134398399	134398399	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:134398399G>A	uc004cav.2	+	20	2352	c.2150G>A	c.(2149-2151)CGC>CAC	p.R717H	POMT1_uc004cax.2_Missense_Mutation_p.R695H|POMT1_uc011mcj.1_Missense_Mutation_p.R435H|POMT1_uc004cau.2_Missense_Mutation_p.R695H|POMT1_uc004caw.2_Missense_Mutation_p.R641H|POMT1_uc011mck.1_Missense_Mutation_p.R578H|POMT1_uc011mcl.1_Missense_Mutation_p.R543H|POMT1_uc011mcm.1_Missense_Mutation_p.R665H	NM_007171	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1 isoform a	717					multicellular organismal development|protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			upper_aerodigestive_tract(1)	1		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		AACACGCTGCGCCCACTCACC	0.597			NA											4	25					0	0	0.009096	0	0
RAPGEF1	2889	broad.mit.edu	37	9	134504533	134504533	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:134504533C>T	uc004cbc.2	-	7	928	c.798G>A	c.(796-798)GCG>GCA	p.A266A	RAPGEF1_uc004cbb.2_Silent_p.A284A|RAPGEF1_uc010mzm.2_5'Flank|RAPGEF1_uc010mzn.2_Silent_p.A271A|RAPGEF1_uc004cbd.2_Silent_p.A271A	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a	266					activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GCTTGGGGGGCGCGACCTCTT	0.542			NA											17	71					0	0	0.00499	0	0
SETX	23064	broad.mit.edu	37	9	135187144	135187144	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:135187144C>T	uc004cbk.2	-	11	5557	c.5374G>A	c.(5374-5376)GTT>ATT	p.V1792I	SETX_uc004cbj.2_Missense_Mutation_p.V1411I|SETX_uc010mzt.2_Missense_Mutation_p.V1411I	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1792					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AAAAACTTACCTGCAAACTCC	0.338			NA											7	32					0	0	0.001984	0	0
GFI1B	8328	broad.mit.edu	37	9	135864570	135864570	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:135864570G>A	uc004ccg.2	+	5	784	c.633G>A	c.(631-633)ACG>ACA	p.T211T	GFI1B_uc010mzy.2_Intron	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	211	C2H2-type 2.|Mediates interaction with GATA1.|Interaction with ARIH2.				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		AGCAGCACACGCACGTCCACT	0.672			NA											14	54					0	0	0.004007	0	0
ADAMTSL2	9719	broad.mit.edu	37	9	136412196	136412196	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:136412196G>A	uc011mdl.1	+	9	1357	c.800G>A	c.(799-801)GGC>GAC	p.G267D	ADAMTSL2_uc004cei.2_Missense_Mutation_p.G267D	NM_001145320	NP_001138792	Q86TH1	ATL2_HUMAN	ADAMTS-like 2 precursor	267					negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		TTCTTCAACGGCAACTACAAG	0.562			NA											44	280					0	0	0.00361	0	0
KCNT1	57582	broad.mit.edu	37	9	138657025	138657025	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:138657025C>T	uc011mdq.1	+	12	1258	c.1184C>T	c.(1183-1185)GCC>GTC	p.A395V	KCNT1_uc011mdr.1_Missense_Mutation_p.A222V|KCNT1_uc010nbf.2_Missense_Mutation_p.A350V|KCNT1_uc004cgo.1_Missense_Mutation_p.A144V	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	395						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GAGTTCTACGCCCACCCCCGG	0.632			NA											19	98					0	0	0.002299	0	0
SDCCAG3	10807	broad.mit.edu	37	9	139301953	139301953	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:139301953A>T	uc004chi.2	-	5	668	c.463T>A	c.(463-465)TAT>AAT	p.Y155N	SDCCAG3_uc004chj.2_Missense_Mutation_p.Y132N|SDCCAG3_uc004chk.2_Missense_Mutation_p.Y82N	NM_001039707	NP_001034796	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	155						cytoplasm					0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		TCCAGGCCATACCCGCCGGTT	0.537			NA											4	24					0	0	0.009096	0	0
NOTCH1	4851	broad.mit.edu	37	9	139395128	139395128	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:139395128C>T	uc004chz.2	-	31	5810	c.5810G>A	c.(5809-5811)CGC>CAC	p.R1937H		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1937	Cytoplasmic (Potential).|ANK 1.				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCGTGAGTAGCGGGCGGCCAG	0.677			NA	T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			41	194					0	0	0.00361	0	0
WDR85	92715	broad.mit.edu	37	9	140458994	140458994	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:140458994C>A	uc004cnk.1	-	8	999	c.841G>T	c.(841-843)GTG>TTG	p.V281L	WDR85_uc004cnj.1_Missense_Mutation_p.V10L|WDR85_uc004cnl.1_Missense_Mutation_p.V105L|WDR85_uc004cnm.1_Missense_Mutation_p.V42L|WDR85_uc004cnn.1_Missense_Mutation_p.V10L|WDR85_uc010ncl.1_Missense_Mutation_p.V42L	NM_138778	NP_620133	Q9BTV6	WDR85_HUMAN	WD repeat domain 85	281					peptidyl-diphthamide biosynthetic process from peptidyl-histidine						0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.00029)|Epithelial(140;0.000509)		CCACCCTGCACAGGCGTATCT	0.527			NA											20	122					5.26018e-13	6.47246e-13	0.001882	1	0
EHMT1	79813	broad.mit.edu	37	9	140693355	140693355	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:140693355G>A	uc011mfc.1	+	17	2633	c.2596G>A	c.(2596-2598)GTC>ATC	p.V866I		NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	866	ANK 4.				DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ACAGATGGACGTCAACTGTCA	0.557			NA											12	71					0	0	0.001368	0	0
GYG2	8908	broad.mit.edu	37	X	2773172	2773172	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:2773172G>A	uc004cqs.1	+	6	838	c.556G>A	c.(556-558)GCC>ACC	p.A186T	GYG2_uc004cqt.1_Missense_Mutation_p.A155T|GYG2_uc004cqu.1_Missense_Mutation_p.A155T|GYG2_uc004cqv.1_5'UTR|GYG2_uc004cqw.1_Missense_Mutation_p.A146T|GYG2_uc004cqx.1_Missense_Mutation_p.A155T|GYG2_uc010ndc.1_5'UTR	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	186					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCTACAGCACGCCATGGAACA	0.443			NA											22	22					0	0	0.00278	0	0
GRPR	2925	broad.mit.edu	37	X	16168617	16168617	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:16168617C>T	uc004cxj.2	+	2	1256	c.603C>T	c.(601-603)CAC>CAT	p.H201H		NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	201	Extracellular (Potential).				cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					CATACCCACACTCTAATGAGC	0.483			NA											11	61					0	0	0.001368	0	0
IL1RAPL1	11141	broad.mit.edu	37	X	29417281	29417281	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:29417281A>T	uc004dby.2	+	5	1067	c.559A>T	c.(559-561)ACA>TCA	p.T187S		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	187	Ig-like C2-type 2.|Extracellular (Potential).				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						GGAATGCAGGACAAAAACATG	0.284			NA											10	21					0	0	0.008291	0	0
FAM47B	170062	broad.mit.edu	37	X	34961569	34961569	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:34961569G>T	uc004ddi.1	+	1	639	c.621G>T	c.(619-621)CCG>CCT	p.P207P		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	207	Pro-rich.									ovary(3)|breast(1)	4						CCAAGACTCCGGTGTCCAGTC	0.652			NA											32	32					1.30897e-18	1.66669e-18	0.009535	1	0
MAGEB16	139604	broad.mit.edu	37	X	35820879	35820879	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:35820879C>G	uc010ngt.1	+	2	845	c.566C>G	c.(565-567)ACC>AGC	p.T189S		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	189	MAGE.									lung(3)|ovary(2)|breast(1)|skin(1)	7						CTGGGCCTCACCTATGATGGG	0.527			NA											7	16					0	0	0.001984	0	0
MID1IP1	58526	broad.mit.edu	37	X	38664362	38664362	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:38664362G>T	uc004dei.3	+	3	587	c.163G>T	c.(163-165)GAG>TAG	p.E55*	MID1IP1_uc010ngz.2_Nonsense_Mutation_p.E55*|MID1IP1_uc004dej.3_Nonsense_Mutation_p.E55*	NM_001098790	NP_001092260	Q9NPA3	M1IP1_HUMAN	MID1 interacting G12-like protein	55					lipid biosynthetic process|negative regulation of microtubule depolymerization|positive regulation of fatty acid biosynthetic process|positive regulation of ligase activity|protein polymerization	cytosol|microtubule|nucleus					0						TGTTGGCGTGGAGGTAGGCGG	0.657			NA											9	7					7.48243e-07	8.39327e-07	0.006214	1	0
HUWE1	10075	broad.mit.edu	37	X	53564572	53564572	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:53564572C>G	uc004dsp.2	-	78	12484	c.12082G>C	c.(12082-12084)GAA>CAA	p.E4028Q	HUWE1_uc004dsn.2_Missense_Mutation_p.E2836Q|HUWE1_uc004dsq.1_Missense_Mutation_p.E328Q	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	4028					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TAGGAGTCTTCAAACACATGG	0.527			NA											4	9					0	0	0.009096	0	0
ITIH5L	347365	broad.mit.edu	37	X	54785244	54785244	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:54785244C>A	uc004dtj.2	-	8	1293	c.1263G>T	c.(1261-1263)AGG>AGT	p.R421S		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	421	VWFA.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						AAAGGGATACCCTGTGGCCTA	0.597			NA											11	9					0.00185496	0.00194567	0.001855	1	0
ATP7A	538	broad.mit.edu	37	X	77286968	77286968	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:77286968T>C	uc004ecx.3	+	16	3342	c.3182T>C	c.(3181-3183)GTT>GCT	p.V1061A		NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1061	Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						CAAGTAAAGGTTCTAACTGAA	0.383			NA											22	66					0	0	0.001882	0	0
BRWD3	254065	broad.mit.edu	37	X	79984377	79984377	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:79984377C>A	uc004edt.2	-	14	1523	c.1260G>T	c.(1258-1260)AAG>AAT	p.K420N	BRWD3_uc004edo.2_Missense_Mutation_p.K16N|BRWD3_uc004edp.2_Missense_Mutation_p.K249N|BRWD3_uc004edq.2_Missense_Mutation_p.K16N|BRWD3_uc010nmj.1_Missense_Mutation_p.K16N|BRWD3_uc004edr.2_Missense_Mutation_p.K90N|BRWD3_uc004eds.2_Missense_Mutation_p.K16N|BRWD3_uc004edu.2_Missense_Mutation_p.K90N|BRWD3_uc004edv.2_Missense_Mutation_p.K16N|BRWD3_uc004edw.2_Missense_Mutation_p.K16N|BRWD3_uc004edx.2_Missense_Mutation_p.K16N|BRWD3_uc004edy.2_Missense_Mutation_p.K16N|BRWD3_uc004edz.2_Missense_Mutation_p.K90N|BRWD3_uc004eea.2_Missense_Mutation_p.K90N|BRWD3_uc004eeb.2_Missense_Mutation_p.K16N	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	420										ovary(4)	4						GTTTAGTGATCTTGTCTTCTC	0.333			NA											21	19					3.01185e-09	3.53133e-09	0.003954	1	0
ZNF711	7552	broad.mit.edu	37	X	84526120	84526120	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:84526120G>T	uc004eeo.2	+	9	1919	c.1572G>T	c.(1570-1572)ATG>ATT	p.M524I	ZNF711_uc004eep.2_Missense_Mutation_p.M524I|ZNF711_uc004eeq.2_Missense_Mutation_p.M570I|ZNF711_uc011mqy.1_Missense_Mutation_p.M123I	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711	524	C2H2-type 4.		M -> T.		positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						AGAAACATATGAGAACCCATA	0.393			NA											14	14					4.3838e-07	4.96219e-07	0.001855	1	0
TGIF2LX	90316	broad.mit.edu	37	X	89177480	89177480	+	Silent	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:89177480C>A	uc004efe.2	+	2	445	c.396C>A	c.(394-396)GCC>GCA	p.A132A		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	132						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						ATGCCCATGCCACCCACCTGC	0.582			NA											21	15					2.32416e-17	2.94425e-17	0.002299	1	0
PCDH19	57526	broad.mit.edu	37	X	99661862	99661862	+	Silent	SNP	G	G	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:99661862G>T	uc010nmz.2	-	1	3410	c.1734C>A	c.(1732-1734)CCC>CCA	p.P578P	PCDH19_uc004efw.3_Silent_p.P578P|PCDH19_uc004efx.3_Silent_p.P578P	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	578	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						CAGAGTTGCGGGGTATGTAGA	0.582			NA											21	20					5.26018e-13	6.47246e-13	0.001882	1	0
RNF128	79589	broad.mit.edu	37	X	106033443	106033443	+	Silent	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:106033443C>T	uc004eml.2	+	5	1165	c.915C>T	c.(913-915)GAC>GAT	p.D305D	RNF128_uc004emk.2_Silent_p.D279D	NM_194463	NP_919445	Q8TEB7	RN128_HUMAN	ring finger protein 128 isoform 1	305	RING-type; atypical.					endomembrane system|integral to membrane|perinuclear region of cytoplasm	zinc ion binding			ovary(1)|central_nervous_system(1)	2						CATGTGTTGACCCATGGCTGT	0.323			NA											7	64					0	0	0.00308	0	0
COL4A6	1288	broad.mit.edu	37	X	107412728	107412728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:107412728G>A	uc004enw.3	-	37	3794	c.3691C>T	c.(3691-3693)CGA>TGA	p.R1231*	COL4A6_uc004env.3_Nonsense_Mutation_p.R1230*|COL4A6_uc011msn.1_Nonsense_Mutation_p.R1206*|COL4A6_uc010npk.2_Nonsense_Mutation_p.R1206*	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1231	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						GACTCACCTCGATCACCTTTT	0.582	Melanoma(87;1895 1945 2589 7165)		NA							Alport_syndrome_with_Diffuse_Leiomyomatosis				18	16					0	0	0.008871	0	0
CHRDL1	91851	broad.mit.edu	37	X	110005980	110005980	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:110005980C>A	uc004eou.3	-	3	499	c.150G>T	c.(148-150)TGG>TGT	p.W50C	CHRDL1_uc004eov.2_Missense_Mutation_p.W44C|CHRDL1_uc004eow.2_Missense_Mutation_p.W50C|CHRDL1_uc010nps.2_Missense_Mutation_p.W50C|CHRDL1_uc004eot.2_Missense_Mutation_p.W50C|CHRDL1_uc011mss.1_Missense_Mutation_p.W44C|CHRDL1_uc004eox.3_Missense_Mutation_p.W44C	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor	44	VWFC 1.				BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						GGTAAGGATGCCATCTCTCAC	0.443			NA											5	40					4.096e-09	4.79795e-09	0.001168	1	0
CT47B1	643311	broad.mit.edu	37	X	120009217	120009217	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:120009217G>A	uc011muc.1	-	1	563	c.308C>T	c.(307-309)GCG>GTG	p.A103V		NM_001145718	NP_001139190	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 147, member B1	103											0						GAAGTTGGCCGcctcgttccc	0.577			NA											4	5					0	0	0.000602	0	0
SAGE1	55511	broad.mit.edu	37	X	134991033	134991033	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:134991033T>G	uc004ezh.2	+	13	1619	c.1452T>G	c.(1450-1452)ATT>ATG	p.I484M	SAGE1_uc010nry.1_Missense_Mutation_p.I453M|SAGE1_uc011mvv.1_Intron	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	484										ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					ATGCTACCATTACTCACAGTG	0.443			NA											50	20					0	0	0.00361	0	0
F9	2158	broad.mit.edu	37	X	138642967	138642967	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:138642967C>A	uc004fas.1	+	7	820	c.791C>A	c.(790-792)ACT>AAT	p.T264N	F9_uc004fat.1_Missense_Mutation_p.T226N	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	264	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	TGGATTGTAACTGCTGCCCAC	0.358			NA											55	44					1.19403e-26	1.55537e-26	0.00361	1	0
SLITRK4	139065	broad.mit.edu	37	X	142717407	142717407	+	Silent	SNP	G	G	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:142717407G>A	uc004fbx.2	-	2	1894	c.1518C>T	c.(1516-1518)AAC>AAT	p.N506N	SLITRK4_uc004fby.2_Silent_p.N506N	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	506	Extracellular (Potential).|LRR 12.					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					ACATGAATTTGTTGTTCCTCA	0.448			NA											26	91					0	0	0.004656	0	0
SLITRK4	139065	broad.mit.edu	37	X	142717510	142717510	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:142717510A>G	uc004fbx.2	-	2	1791	c.1415T>C	c.(1414-1416)ATG>ACG	p.M472T	SLITRK4_uc004fby.2_Missense_Mutation_p.M472T	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	472	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CAAATTTGGCATGGAGTCAAA	0.398			NA											55	33					0	0	0.00361	0	0
AFF2	2334	broad.mit.edu	37	X	147743755	147743755	+	Silent	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:147743755A>G	uc004fcp.2	+	3	986	c.507A>G	c.(505-507)GTA>GTG	p.V169V	AFF2_uc004fco.2_Silent_p.V165V|AFF2_uc004fcq.2_Silent_p.V165V|AFF2_uc004fcr.2_Silent_p.V165V|AFF2_uc011mxb.1_Silent_p.V169V|AFF2_uc004fcs.2_Silent_p.V165V	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	169					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CTAGCACTGTACTGGCAAGCC	0.468			NA											55	92					0	0	0.00361	0	0
AFF2	2334	broad.mit.edu	37	X	147891398	147891398	+	Splice_Site	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:147891398A>G	uc004fcp.2	+	4	1521	c.1042_splice	c.e4-2	p.V348_splice	AFF2_uc004fco.2_Splice_Site_p.V344_splice|AFF2_uc004fcq.2_Splice_Site_p.V344_splice|AFF2_uc004fcr.2_Splice_Site_p.V344_splice|AFF2_uc011mxb.1_Splice_Site_p.V348_splice|AFF2_uc004fcs.2_Splice_Site_p.V344_splice|AFF2_uc011mxc.1_Splice_Site_p.V18_splice	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2						brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					ATTTTGTTTCAGGTAAGCCTT	0.343			NA											12	65					0	0	0.001855	0	0
AFF2	2334	broad.mit.edu	37	X	148069036	148069036	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:148069036C>T	uc004fcp.2	+	20	4242	c.3763C>T	c.(3763-3765)CGG>TGG	p.R1255W	AFF2_uc004fcq.2_Missense_Mutation_p.R1245W|AFF2_uc004fcr.2_Missense_Mutation_p.R1216W|AFF2_uc011mxb.1_Missense_Mutation_p.R1220W|AFF2_uc004fcs.2_Missense_Mutation_p.R1220W|AFF2_uc011mxc.1_Missense_Mutation_p.R896W	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	1255					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CAATGTGTTACGGGGCTATGA	0.488			NA											34	70					0	0	0.002445	0	0
ATP2B3	492	broad.mit.edu	37	X	152818579	152818579	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:152818579C>T	uc004fht.1	+	11	2036	c.1910C>T	c.(1909-1911)CCG>CTG	p.P637L	ATP2B3_uc004fhs.1_Missense_Mutation_p.P637L	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	637	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATCATCGAGCCGATGGCTTGC	0.622			NA											15	33					0	0	0.003163	0	0
L1CAM	3897	broad.mit.edu	37	X	153134138	153134138	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:153134138A>G	uc004fjb.2	-	12	1532	c.1424T>C	c.(1423-1425)TTC>TCC	p.F475S	L1CAM_uc004fjc.2_Missense_Mutation_p.F475S|L1CAM_uc010nuo.2_Missense_Mutation_p.F470S|L1CAM_uc004fjd.1_Missense_Mutation_p.F289S	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	475	Extracellular (Potential).|Ig-like C2-type 5.				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGCATAGGGGAAGAAGCGTTC	0.612			NA											4	49					0	0	0.009096	0	0
Unknown	0	broad.mit.edu	37	X	155254735	155254735	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:155254735C>G	uc004fnx.3	+	8	1085	c.631C>G	c.(631-633)CTC>GTC	p.L211V		NM_182905	NP_878908			WAS protein family homolog 1												NA						GATGTCGGATCTCTTCAACAA	0.587			NA											2	4					0	0	0.004672	0	0
GABRD	2563	broad.mit.edu	37	1	1961597	1961598	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:1961597_1961598insG	uc001aip.2	+	9	1330_1331	c.1235_1236insG	c.(1234-1236)CAGfs	p.Q412fs		NM_000815	NP_000806	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	412	Cytoplasmic (Probable).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		TCAGGAGGCCAGGGGGGCATCC	0.678			NA											11	81	---	---	---	---	NA	NA	NA	NA	NA
PLK3	1263	broad.mit.edu	37	1	45266760	45266761	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:45266760_45266761insT	uc001cmn.2	+	3	471_472	c.371_372insT	c.(370-372)CGTfs	p.R124fs	PLK3_uc001cmo.2_RNA	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	124	Protein kinase.					membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					CACATCGTGCGTTTTTCGCACC	0.545			NA											7	49	---	---	---	---	NA	NA	NA	NA	NA
C1orf168	199920	broad.mit.edu	37	1	57209836	57209836	+	Frame_Shift_Del	DEL	G	G	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:57209836delG	uc001cym.3	-	10	1897	c.1491delC	c.(1489-1491)TCCfs	p.S497fs	C1orf168_uc009vzu.1_RNA|C1orf168_uc001cyl.2_RNA	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	497										ovary(3)|skin(2)	5						CCTCTTTCCTGGAGTACTCGA	0.418			NA											25	100	---	---	---	---	NA	NA	NA	NA	NA
ST6GALNAC3	256435	broad.mit.edu	37	1	76877904	76877905	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:76877904_76877905insT	uc001dhh.2	+	3	588_589	c.425_426insT	c.(424-426)TATfs	p.Y142fs	ST6GALNAC3_uc001dhg.3_Frame_Shift_Ins_p.Y142fs|ST6GALNAC3_uc010orh.1_Frame_Shift_Ins_p.Y77fs	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	142	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	p.Y142H(1)		ovary(3)|skin(2)	5						AACCCTGATTATTTTTTCAAGG	0.411			NA											19	76	---	---	---	---	NA	NA	NA	NA	NA
STXBP3	6814	broad.mit.edu	37	1	109338865	109338866	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:109338865_109338866insT	uc001dvy.2	+	14	1195_1196	c.1120_1121insT	c.(1120-1122)CTTfs	p.L374fs	STXBP3_uc001dvz.2_RNA	NM_007269	NP_009200	O00186	STXB3_HUMAN	syntaxin binding protein 3	374					negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding			ovary(3)|central_nervous_system(1)	4		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GGACCTGGCACTTGGAACTGAT	0.287			NA											18	46	---	---	---	---	NA	NA	NA	NA	NA
C1orf51	148523	broad.mit.edu	37	1	150255794	150255794	+	Frame_Shift_Del	DEL	G	G	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:150255794delG	uc001euh.2	+	2	253	c.117delG	c.(115-117)AAGfs	p.K39fs	C1orf51_uc001eui.2_Intron|C1orf51_uc001euj.2_Frame_Shift_Del_p.K39fs	NM_144697	NP_653298	Q8N365	CA051_HUMAN	hypothetical protein LOC148523	39											0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGGAGGACAAGGGGGCCCATG	0.592			NA											35	207	---	---	---	---	NA	NA	NA	NA	NA
RFX5	5993	broad.mit.edu	37	1	151318740	151318741	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:151318740_151318741insG	uc001exv.1	-	3	270_271	c.56_57insC	c.(55-57)CCAfs	p.P19fs	RFX5_uc001exw.1_Frame_Shift_Ins_p.P19fs|RFX5_uc009wmr.1_Frame_Shift_Ins_p.P19fs|RFX5_uc010pcx.1_Frame_Shift_Ins_p.P19fs	NM_001025603	NP_001020774	P48382	RFX5_HUMAN	regulatory factor X, 5	19						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CAGCACCACCTGGGGGGGCCCT	0.554			NA											8	198	---	---	---	---	NA	NA	NA	NA	NA
CD5L	922	broad.mit.edu	37	1	157803024	157803025	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:157803024_157803025insA	uc001frk.3	-	5	1139_1140	c.996_997insT	c.(994-999)TTTCACfs	p.F332fs		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	332_333	SRCR 3.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GTGCAGTCGTGAAACCCCCAAA	0.55			NA											24	150	---	---	---	---	NA	NA	NA	NA	NA
C1orf125	126859	broad.mit.edu	37	1	179399628	179399629	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:179399628_179399629insT	uc001gmo.2	+	14	1501_1502	c.1374_1375insT	c.(1372-1377)AAATGGfs	p.K458fs	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmn.1_Frame_Shift_Ins_p.K246fs|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Frame_Shift_Ins_p.K458fs	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	458_459	Potential.										0						TGACACAAAAATGGAGAAACTT	0.322			NA											18	75	---	---	---	---	NA	NA	NA	NA	NA
PTPRC	5788	broad.mit.edu	37	1	198725188	198725189	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:198725188_198725189insC	uc001gur.1	+	33	3973_3974	c.3793_3794insC	c.(3793-3795)GCCfs	p.A1265fs	PTPRC_uc001gus.1_Frame_Shift_Ins_p.A1217fs|PTPRC_uc001gut.1_Frame_Shift_Ins_p.A1104fs	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1265	Cytoplasmic (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TCCACTTGGTGCCCCAGAAAAG	0.436			NA											31	152	---	---	---	---	NA	NA	NA	NA	NA
LYST	1130	broad.mit.edu	37	1	235976278	235976279	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr1:235976278_235976279insT	uc001hxj.2	-	4	450_451	c.275_276insA	c.(274-276)AAGfs	p.K92fs	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Frame_Shift_Ins_p.K92fs	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	92					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TACCTGTTGCCTTTTCTTCTTG	0.376			NA							Chediak-Higashsyndrome				7	59	---	---	---	---	NA	NA	NA	NA	NA
CDC123	8872	broad.mit.edu	37	10	12291634	12291635	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:12291634_12291635insA	uc001ill.2	+	12	1185_1186	c.901_902insA	c.(901-903)TATfs	p.Y301fs	CDC123_uc001ilm.2_Frame_Shift_Ins_p.Y313fs	NM_006023	NP_006014	O75794	CD123_HUMAN	cell division cycle 123	301					cell cycle arrest|cell division|positive regulation of cell proliferation|regulation of mitotic cell cycle	cytoplasm				central_nervous_system(1)	1						GCCCAGCCCCTATTTGAGTTAC	0.436			NA											30	146	---	---	---	---	NA	NA	NA	NA	NA
FAM188A	80013	broad.mit.edu	37	10	15828568	15828569	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:15828568_15828569insA	uc001iod.1	-	13	1328_1329	c.1107_1108insT	c.(1105-1110)TTTCCTfs	p.F369fs	FAM188A_uc001ioe.1_Frame_Shift_Ins_p.F196fs	NM_024948	NP_079224	Q9H8M7	F188A_HUMAN	chromosome 10 open reading frame 97	369_370					apoptosis	nucleus	calcium ion binding			ovary(1)	1						ACCTGATCAGGAAAAAATTCTT	0.332	Pancreas(159;946 1953 2111 4475 22008)		NA											7	175	---	---	---	---	NA	NA	NA	NA	NA
CUBN	8029	broad.mit.edu	37	10	17110651	17110652	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:17110651_17110652insA	uc001ioo.2	-	20	2795_2796	c.2743_2744insT	c.(2743-2745)TCTfs	p.S915fs		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	915	CUB 4.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTTTTCAGTAGAAGAACTTTTC	0.361			NA											22	212	---	---	---	---	NA	NA	NA	NA	NA
C10orf140	387640	broad.mit.edu	37	10	21804201	21804202	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:21804201_21804202insA	uc009xkd.2	-	4	4803_4804	c.2550_2551insT	c.(2548-2553)TTTCCTfs	p.F850fs	uc001iqp.1_Intron	NM_207371	NP_997254	Q1XH10	DLN1_HUMAN	hypothetical protein LOC387640	769_770						nucleus	nucleotide binding			ovary(1)	1						GGTGGACAAGGAAAATTTGCCA	0.436			NA											9	66	---	---	---	---	NA	NA	NA	NA	NA
KIF20B	9585	broad.mit.edu	37	10	91476281	91476282	+	Frame_Shift_Ins	INS	-	-	T	rs146702249		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:91476281_91476282insT	uc001kgs.1	+	9	1101_1102	c.1029_1030insT	c.(1027-1032)AAATTGfs	p.K343fs	KIF20B_uc001kgr.1_Frame_Shift_Ins_p.K343fs	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	343_344	Kinesin-motor.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						CCTTCACAAAATTGAATAATGC	0.312			NA											9	23	---	---	---	---	NA	NA	NA	NA	NA
CUTC	51076	broad.mit.edu	37	10	101499503	101499504	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:101499503_101499504insG	uc001kqd.3	+	3	318_319	c.170_171insG	c.(169-171)GAGfs	p.E57fs	CUTC_uc010qpk.1_Frame_Shift_Ins_p.E57fs|CUTC_uc001kqe.3_RNA	NM_015960	NP_057044	Q9NTM9	CUTC_HUMAN	cutC copper transporter homolog	57					copper ion homeostasis|copper ion transport|protein tetramerization	cytoplasm|nucleus	copper ion binding			breast(1)	1		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		GGTTTATCAGAGGGGGGAACTA	0.401			NA											12	178	---	---	---	---	NA	NA	NA	NA	NA
MKI67	4288	broad.mit.edu	37	10	129913973	129913974	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr10:129913973_129913974insT	uc001lke.2	-	7	893_894	c.698_699insA	c.(697-699)AATfs	p.N233fs	MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	233					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				AGGGAGATTCATTTTTTTTGCT	0.347			NA											10	57	---	---	---	---	NA	NA	NA	NA	NA
C11orf35	256329	broad.mit.edu	37	11	556971	556972	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:556971_556972insC	uc001lpx.2	-	8	902_903	c.839_840insG	c.(838-840)GGCfs	p.G280fs	uc001lpy.2_5'Flank|uc001lpz.2_5'Flank	NM_173573	NP_775844	Q8IXW0	CK035_HUMAN	hypothetical protein LOC256329	280										pancreas(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGGAGTCAGCGCCCCCTGAGCT	0.678			NA											7	16	---	---	---	---	NA	NA	NA	NA	NA
LRDD	55367	broad.mit.edu	37	11	799980	799981	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:799980_799981insC	uc001lro.1	-	15	2450_2451	c.2308_2309insG	c.(2308-2310)GCTfs	p.A770fs	SLC25A22_uc009yci.2_5'Flank|SLC25A22_uc001lrj.2_5'Flank|LRDD_uc009yck.1_RNA|LRDD_uc001lrk.1_Frame_Shift_Ins_p.A753fs|LRDD_uc001lrl.1_Frame_Shift_Ins_p.A613fs|LRDD_uc001lrm.1_Frame_Shift_Ins_p.A457fs|LRDD_uc001lrn.1_Frame_Shift_Ins_p.A613fs|LRDD_uc001lrp.1_Frame_Shift_Ins_p.G453fs	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	770					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAGAGGCCAGCCCCCCGCCGT	0.624			NA											9	41	---	---	---	---	NA	NA	NA	NA	NA
AMPD3	272	broad.mit.edu	37	11	10506451	10506452	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:10506451_10506452insG	uc001mio.1	+	5	1009_1010	c.674_675insG	c.(673-675)CAGfs	p.Q225fs	AMPD3_uc010rbz.1_Frame_Shift_Ins_p.Q66fs|AMPD3_uc001min.1_Frame_Shift_Ins_p.Q234fs|AMPD3_uc009yfw.1_Splice_Site|AMPD3_uc009yfx.1_Frame_Shift_Ins_p.Q225fs|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Frame_Shift_Ins_p.Q232fs|AMPD3_uc009yfy.2_Frame_Shift_Ins_p.Q225fs	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	225					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GTCCACATGCAGGGGGGCATCC	0.569			NA											16	90	---	---	---	---	NA	NA	NA	NA	NA
MICALCL	84953	broad.mit.edu	37	11	12316384	12316389	+	In_Frame_Del	DEL	CTCCTA	CTCCTA	-	rs3812754	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CTCCTA	CTCCTA	-	-	CTCCTA	CTCCTA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:12316384_12316389delCTCCTA	uc001mkg.1	+	3	1697_1702	c.1406_1411delCTCCTA	c.(1405-1413)CCTCCTACA>CCA	p.PT470del		NM_032867	NP_116256	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	470_471					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding			skin(1)	1				Epithelial(150;0.00177)		cctcctcctcctcctACAGCGGGAGG	0.432			NA											5	8	---	---	---	---	NA	NA	NA	NA	NA
PIK3C2A	5286	broad.mit.edu	37	11	17156656	17156657	+	Splice_Site	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:17156656_17156657insC	uc001mmq.3	-	9	1963	c.1897_splice	c.e9+1	p.G633_splice	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Splice_Site_p.G253_splice|PIK3C2A_uc001mmr.3_Intron|PIK3C2A_uc010rcx.1_Splice_Site_p.G633_splice	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha						cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	TTAAACACATACCCCTAGTTGA	0.347			NA											12	183	---	---	---	---	NA	NA	NA	NA	NA
TTC17	55761	broad.mit.edu	37	11	43419030	43419031	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:43419030_43419031insAT	uc001mxi.2	+	7	921_922	c.907_908insAT	c.(907-909)AATfs	p.N303fs	TTC17_uc001mxh.2_Frame_Shift_Ins_p.N303fs|TTC17_uc010rfj.1_Frame_Shift_Ins_p.N246fs|TTC17_uc001mxj.2_Frame_Shift_Ins_p.N73fs	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	303	TPR 1.						binding			ovary(5)	5						CACTTTGGGGAATATATATGCA	0.406			NA											52	261	---	---	---	---	NA	NA	NA	NA	NA
PTPRJ	5795	broad.mit.edu	37	11	48134531	48134532	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:48134531_48134532delCA	uc001ngp.3	+	3	703_704	c.348_349delCA	c.(346-351)AGCACTfs	p.S116fs	PTPRJ_uc001ngo.3_Frame_Shift_Del_p.S116fs	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	116_117	Extracellular (Potential).				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						CTCCCAGTAGCACTGGTAAGCA	0.401			NA											7	86	---	---	---	---	NA	NA	NA	NA	NA
OR4A16	81327	broad.mit.edu	37	11	55110739	55110740	+	Frame_Shift_Ins	INS	-	-	A	rs78513473		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:55110739_55110740insA	uc010rie.1	+	1	63_64	c.63_64insA	c.(61-66)GTGAAAfs	p.V21fs		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	21_22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						ATCCTGATGTGAAAAAAACATT	0.416			NA											13	58	---	---	---	---	NA	NA	NA	NA	NA
OR5AS1	219447	broad.mit.edu	37	11	55798786	55798786	+	Frame_Shift_Del	DEL	A	A	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:55798786delA	uc010riw.1	+	1	892	c.892delA	c.(892-894)AAAfs	p.K298fs		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	298	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					CAAGGATGTGAAAAATGCTCT	0.313			NA											8	47	---	---	---	---	NA	NA	NA	NA	NA
MPEG1	219972	broad.mit.edu	37	11	58979595	58979599	+	Frame_Shift_Del	DEL	CACGG	CACGG	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CACGG	CACGG	-	-	CACGG	CACGG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:58979595_58979599delCACGG	uc001nnu.3	-	1	896_900	c.740_744delCCGTG	c.(739-744)ACCGTGfs	p.T247fs		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	247_248	MACPF.|Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				ATTTGAAGTTCACGGTGTTTTGAAA	0.532			NA											9	39	---	---	---	---	NA	NA	NA	NA	NA
C2CD3	26005	broad.mit.edu	37	11	73829363	73829364	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:73829363_73829364insT	uc001ouu.2	-	9	1656_1657	c.1429_1430insA	c.(1429-1431)ATAfs	p.I477fs	C2CD3_uc001ouv.2_Frame_Shift_Ins_p.I477fs	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	477						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					TGACTGGCTTATTTTTTTAGAA	0.431			NA											17	97	---	---	---	---	NA	NA	NA	NA	NA
CHRDL2	25884	broad.mit.edu	37	11	74414386	74414387	+	Frame_Shift_Ins	INS	-	-	G	rs144140395	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:74414386_74414387insG	uc001ovi.2	-	8	1162_1163	c.909_910insC	c.(907-912)CCCGAGfs	p.P303fs	CHRDL2_uc001ovg.2_Frame_Shift_Ins_p.P187fs|CHRDL2_uc001ovh.2_Frame_Shift_Ins_p.P303fs|CHRDL2_uc001ovj.1_RNA|CHRDL2_uc001ovk.1_Intron			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;	303_304	VWFC 3.				cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					GCCACTTTCTCGGGGTGACGGC	0.649			NA											15	62	---	---	---	---	NA	NA	NA	NA	NA
CASP5	838	broad.mit.edu	37	11	104874010	104874011	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr11:104874010_104874011insT	uc010rva.1	-	4	565_566	c.533_534insA	c.(532-534)AATfs	p.N178fs	CASP5_uc010ruz.1_Frame_Shift_Ins_p.N191fs|CASP5_uc010rvb.1_Frame_Shift_Ins_p.N120fs|CASP5_uc010rvc.1_Frame_Shift_Ins_p.N36fs|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	178					apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CCTCATCATGATTTTTTTTACA	0.361			NA											31	133	---	---	---	---	NA	NA	NA	NA	NA
PRB1	5542	broad.mit.edu	37	12	11506711	11506712	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:11506711_11506712insG	uc001qzw.1	-	3	362_363	c.325_326insC	c.(325-327)CAAfs	p.Q109fs	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	170	6.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in clone CP-4).|Missing (in clone CP-5).|Missing (in allele S).			extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGGGGACCTTGGGGCTGGTTA	0.614			NA											64	478	---	---	---	---	NA	NA	NA	NA	NA
SFRS2IP	9169	broad.mit.edu	37	12	46315840	46315841	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:46315840_46315841insT	uc001rox.2	-	15	4669_4670	c.4382_4383insA	c.(4381-4383)AACfs	p.N1461fs	SFRS2IP_uc001row.2_Frame_Shift_Ins_p.N1146fs	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	1461					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TTCAGCCTATGTTTTTTTCAGT	0.376			NA											47	262	---	---	---	---	NA	NA	NA	NA	NA
LRP1	4035	broad.mit.edu	37	12	57598893	57598894	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:57598893_57598894insC	uc001snd.2	+	73	11662_11663	c.11196_11197insC	c.(11194-11199)GAGCCCfs	p.E3732fs		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3732_3733	Extracellular (Potential).|LDL-receptor class A 30.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	p.P3733S(1)		ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCTCCTCAGAGCCCCCCACAGC	0.589			NA											14	59	---	---	---	---	NA	NA	NA	NA	NA
C12orf66	144577	broad.mit.edu	37	12	64588065	64588066	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:64588065_64588066insA	uc001srw.3	-	3	953_954	c.894_895insT	c.(892-897)TTTGGAfs	p.F298fs	C12orf66_uc009zql.2_Frame_Shift_Ins_p.F245fs	NM_152440	NP_689653	Q96MD2	CL066_HUMAN	hypothetical protein LOC144577	298_299										ovary(1)	1						GAAATCTTTCCAAAAAAGTCTG	0.401			NA											24	130	---	---	---	---	NA	NA	NA	NA	NA
UHRF1BP1L	23074	broad.mit.edu	37	12	100453146	100453147	+	Frame_Shift_Ins	INS	-	-	A	rs3748287		TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:100453146_100453147insA	uc001tgq.2	-	14	2137_2138	c.1908_1909insT	c.(1906-1911)TTTAGTfs	p.F636fs	UHRF1BP1L_uc001tgp.2_Frame_Shift_Ins_p.F286fs	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	636_637										ovary(2)	2						TATGTTTTACTAAAAAAATCAC	0.351			NA											19	73	---	---	---	---	NA	NA	NA	NA	NA
UTP20	27340	broad.mit.edu	37	12	101779775	101779776	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:101779775_101779776insA	uc001tia.1	+	62	8388_8389	c.8232_8233insA	c.(8230-8235)AAGAAAfs	p.K2744fs		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	2744_2745	Nuclear localization signal.|Potential.|Nucleolar localization signal.			KKK->AAA: Inhibits nucleolar but not nuclear localization.|K->A: Does not decrease nucleolar localization.	endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TTGCTGCCAAGAAAAAAATGAA	0.307			NA											7	79	---	---	---	---	NA	NA	NA	NA	NA
BRAP	8315	broad.mit.edu	37	12	112082051	112082052	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:112082051_112082052insC	uc001tsn.3	-	12	1924_1925	c.1730_1731insG	c.(1729-1731)GGCfs	p.G577fs	BRAP_uc010syh.1_Frame_Shift_Ins_p.G398fs|BRAP_uc009zvv.2_Frame_Shift_Ins_p.G547fs	NM_006768	NP_006759	Q7Z569	BRAP_HUMAN	BRCA1 associated protein	577					MAPKKK cascade|negative regulation of signal transduction|Ras protein signal transduction	cytoplasm|ubiquitin ligase complex	identical protein binding|nuclear localization sequence binding|nucleotide binding|ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1						ACTTCCCACTGCCCCCCGAAGA	0.604	Pancreas(146;846 1904 7830 25130 26065)		NA											15	74	---	---	---	---	NA	NA	NA	NA	NA
KNTC1	9735	broad.mit.edu	37	12	123087619	123087620	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr12:123087619_123087620insA	uc001ucv.2	+	48	5093_5094	c.4930_4931insA	c.(4930-4932)GAAfs	p.E1644fs	KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	1644					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ACACGTTTTCGAAAAAAAACTG	0.391			NA											7	42	---	---	---	---	NA	NA	NA	NA	NA
TRIM9	114088	broad.mit.edu	37	14	51446192	51446192	+	Frame_Shift_Del	DEL	A	A	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:51446192delA	uc001wyx.3	-	9	2748	c.1983delT	c.(1981-1983)TTTfs	p.F661fs	TRIM9_uc001wyy.2_Frame_Shift_Del_p.F742fs	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1	661	B30.2/SPRY.				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)					CATCGTTGATAAAAAATGTCA	0.473			NA											12	306	---	---	---	---	NA	NA	NA	NA	NA
BTBD7	55727	broad.mit.edu	37	14	93761192	93761193	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr14:93761192_93761193insT	uc001ybo.2	-	3	499_500	c.173_174insA	c.(172-174)AAGfs	p.K58fs	BTBD7_uc010aur.2_5'UTR|BTBD7_uc010two.1_5'UTR|BTBD7_uc001ybp.2_Intron|BTBD7_uc001ybq.3_5'UTR|BTBD7_uc001ybr.2_Frame_Shift_Ins_p.K58fs	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1	58										pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		CAGAGGTTCTCTTTTTTTTGTC	0.441			NA											28	132	---	---	---	---	NA	NA	NA	NA	NA
OR4N4	283694	broad.mit.edu	37	15	22332412	22332413	+	Translation_Start_Site	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr15:22332412_22332413insA	uc001yuc.1	+	3	219_220	c.-762_-761insA	c.(-764--759)ATGAAA>ATGAAAA		LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TTGGCTTGATGAAAAAAAACAA	0.287			NA											7	76	---	---	---	---	NA	NA	NA	NA	NA
ITGAD	3681	broad.mit.edu	37	16	31409145	31409146	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:31409145_31409146insG	uc002ebv.1	+	5	391_392	c.342_343insG	c.(340-345)TGTGGGfs	p.C114fs	ITGAD_uc010vfl.1_Frame_Shift_Ins_p.C114fs|ITGAD_uc010cap.1_Frame_Shift_Ins_p.C114fs|ITGAD_uc002ebw.1_5'UTR	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	114_115	FG-GAP 2.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						ACAGAGTCTGTGGGGAGAACTC	0.55			NA											7	35	---	---	---	---	NA	NA	NA	NA	NA
CDH1	999	broad.mit.edu	37	16	68846036	68846037	+	Splice_Site	DEL	AG	AG	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr16:68846036_68846037delAG	uc002ewg.1	+	8	1133	c.1009_splice	c.e8-1	p.S337_splice	CDH1_uc010vlj.1_Splice_Site|CDH1_uc010cfg.1_Splice_Site_p.S337_splice	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.?(8)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ATCTCTCTGCAGAGTTTCCCTA	0.51			NA	Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				8	82	---	---	---	---	NA	NA	NA	NA	NA
ERBB2	2064	broad.mit.edu	37	17	37884217	37884218	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:37884217_37884218insG	uc002hso.2	+	27	3926_3927	c.3688_3689insG	c.(3688-3690)CGGfs	p.R1230fs	ERBB2_uc002hsm.2_Frame_Shift_Ins_p.R1200fs|ERBB2_uc010cwa.2_Frame_Shift_Ins_p.R1215fs|ERBB2_uc002hsp.2_Frame_Shift_Ins_p.R1033fs|ERBB2_uc010cwb.2_3'UTR|ERBB2_uc010wek.1_Frame_Shift_Ins_p.R954fs	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	1230	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	CCCACCAGAGCGGGGGGCTCCA	0.634			1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			19	96	---	---	---	---	NA	NA	NA	NA	NA
VEZF1	7716	broad.mit.edu	37	17	56056586	56056587	+	In_Frame_Ins	INS	-	-	TGT			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:56056586_56056587insTGT	uc002ivf.1	-	5	1207_1208	c.1064_1065insACA	c.(1063-1065)CAT>CAACAT	p.354_355insQ	VEZF1_uc010dcn.1_In_Frame_Ins_p.204_205insQ	NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	354_355					cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						AGCTTGTCACAtgttgttgttg	0.317			NA											26	255	---	---	---	---	NA	NA	NA	NA	NA
BPTF	2186	broad.mit.edu	37	17	65871138	65871139	+	Splice_Site	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:65871138_65871139insA	uc002jgf.2	+	4	1925	c.1864_splice	c.e4+2	p.V622_splice	BPTF_uc002jge.2_Splice_Site_p.E622_splice|BPTF_uc010wqm.1_Splice_Site_p.E622_splice	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AATCTGAGGGTAAAAAAATTAC	0.337			NA											9	49	---	---	---	---	NA	NA	NA	NA	NA
SRP68	6730	broad.mit.edu	37	17	74068450	74068451	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:74068450_74068451insT	uc002jqk.1	-	1	157_158	c.122_123insA	c.(121-123)AACfs	p.N41fs	SRP68_uc010wsu.1_5'UTR|SRP68_uc002jql.1_Frame_Shift_Ins_p.N41fs|GALR2_uc002jqm.1_5'Flank	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	41					response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						AAGGGCGTTCGTTTTCTTTATT	0.337			NA											71	246	---	---	---	---	NA	NA	NA	NA	NA
RPTOR	57521	broad.mit.edu	37	17	78923270	78923271	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr17:78923270_78923271insT	uc002jyt.1	+	28	4098_4099	c.3293_3294insT	c.(3292-3294)AATfs	p.N1098fs	RPTOR_uc010wug.1_Frame_Shift_Ins_p.N940fs|RPTOR_uc002jyu.1_5'UTR	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	1098	WD 2.				cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						GTCTGGAAGAATTTTGCTGATT	0.614			NA											44	276	---	---	---	---	NA	NA	NA	NA	NA
ZNF93	81931	broad.mit.edu	37	19	20044269	20044270	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:20044269_20044270insA	uc002non.2	+	4	616_617	c.505_506insA	c.(505-507)GAAfs	p.E169fs		NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93	169						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1						AAGACATACTGAAAAAAAACCT	0.307			NA											8	45	---	---	---	---	NA	NA	NA	NA	NA
BCAM	4059	broad.mit.edu	37	19	45322439	45322440	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr19:45322439_45322440insG	uc002ozu.2	+	11	1507_1508	c.1463_1464insG	c.(1462-1464)TTGfs	p.L488fs	BCAM_uc002ozt.1_Frame_Shift_Ins_p.L488fs	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	488	Extracellular (Potential).|Ig-like C2-type 3.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				TGGAGCCAATTGGGGGGCAGCG	0.594			NA											9	112	---	---	---	---	NA	NA	NA	NA	NA
WBP1	23559	broad.mit.edu	37	2	74687542	74687543	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:74687542_74687543insC	uc002slj.1	+	4	697_698	c.544_545insC	c.(544-546)GCCfs	p.A182fs	WBP1_uc002slh.1_RNA|INO80B_uc002sli.1_RNA|WBP1_uc002slk.1_Frame_Shift_Ins_p.A179fs|WBP1_uc002sll.1_RNA	NM_012477	NP_036609	Q96G27	WBP1_HUMAN	WW domain binding protein 1	182							WW domain binding				0						CCACCAGAGTGCCCCCCCTCAT	0.604			NA											39	192	---	---	---	---	NA	NA	NA	NA	NA
RNF103	7844	broad.mit.edu	37	2	86831014	86831015	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:86831014_86831015insT	uc002srn.2	-	4	2978_2979	c.2009_2010insA	c.(2008-2010)AAGfs	p.K670fs	VPS24_uc010ytl.1_Intron|RNF103_uc002srm.2_Frame_Shift_Ins_p.K531fs|uc002sro.2_5'Flank	NM_005667	NP_005658	O00237	RN103_HUMAN	ring finger protein 103	670					central nervous system development|ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(1)	1						CATATGGCTGCTTTTTTTTATA	0.441			NA											20	128	---	---	---	---	NA	NA	NA	NA	NA
RBM43	375287	broad.mit.edu	37	2	152112047	152112048	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:152112047_152112048insT	uc002txh.2	-	2	361_362	c.213_214insA	c.(211-216)AAAGTTfs	p.K71fs		NM_198557	NP_940959	Q6ZSC3	RBM43_HUMAN	RNA binding motif protein 43	71_72	RRM.						nucleotide binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		TTGGAAATACCTTTTTTTTCTT	0.282			NA											17	95	---	---	---	---	NA	NA	NA	NA	NA
NEB	4703	broad.mit.edu	37	2	152534572	152534573	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:152534572_152534573insT	uc010fnx.2	-	33	3575_3576	c.3384_3385insA	c.(3382-3387)AAAGACfs	p.K1128fs		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1128_1129	Nebulin 27.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCTCATAGTCTTTTTTATACT	0.416			NA											8	48	---	---	---	---	NA	NA	NA	NA	NA
ABCB11	8647	broad.mit.edu	37	2	169801236	169801237	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:169801236_169801237insT	uc002ueo.1	-	21	2614_2615	c.2488_2489insA	c.(2488-2490)AGGfs	p.R830fs	ABCB11_uc010zda.1_Frame_Shift_Ins_p.R272fs|ABCB11_uc010zdb.1_Frame_Shift_Ins_p.R306fs	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	830	Cytoplasmic (Potential).|ABC transmembrane type-1 2.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	TTTACGTAGCCTTTTTGTTAGG	0.396			NA											21	112	---	---	---	---	NA	NA	NA	NA	NA
SSB	6741	broad.mit.edu	37	2	170665007	170665008	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:170665007_170665008insA	uc002ufk.2	+	7	677_678	c.570_571insA	c.(568-573)GCCAAAfs	p.A190fs	SSB_uc002ufl.2_Frame_Shift_Ins_p.A190fs|SSB_uc002ufm.2_Frame_Shift_Ins_p.A190fs	NM_003142	NP_003133	P05455	LA_HUMAN	autoantigen La	190_191					histone mRNA metabolic process|tRNA modification	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding|tRNA binding			skin(3)|pancreas(1)	4						ATTACTTTGCCAAAAAAAATGA	0.322			NA											12	67	---	---	---	---	NA	NA	NA	NA	NA
MYO3B	140469	broad.mit.edu	37	2	171073882	171073883	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:171073882_171073883insC	uc002ufy.2	+	6	723_724	c.580_581insC	c.(580-582)ACCfs	p.T194fs	MYO3B_uc002ufv.2_Frame_Shift_Ins_p.T181fs|MYO3B_uc010fqb.1_Frame_Shift_Ins_p.T181fs|MYO3B_uc002ufz.2_Frame_Shift_Ins_p.T194fs|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002uga.2_Frame_Shift_Ins_p.T181fs	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	194	Protein kinase.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						ATCTGTTGGCACCCCGTTCTGG	0.436			NA											8	271	---	---	---	---	NA	NA	NA	NA	NA
OLA1	29789	broad.mit.edu	37	2	175111470	175111471	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:175111470_175111471insT	uc002uih.2	-	2	259_260	c.73_74insA	c.(73-75)ATTfs	p.I25fs	OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Frame_Shift_Ins_p.I25fs|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_5'UTR|OLA1_uc010fqr.2_Frame_Shift_Ins_p.I25fs	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1	25					ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						AACAATACCAATTTTCAGTGAG	0.396			NA											10	103	---	---	---	---	NA	NA	NA	NA	NA
PSMD1	5707	broad.mit.edu	37	2	231931679	231931680	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr2:231931679_231931680insA	uc002vrn.1	+	5	495_496	c.364_365insA	c.(364-366)GAAfs	p.E122fs	PSMD1_uc002vrm.1_Frame_Shift_Ins_p.E122fs|PSMD1_uc010fxu.1_5'UTR	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1	122					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GCCTGAAGGAGAAAAAAAACCA	0.366			NA											9	32	---	---	---	---	NA	NA	NA	NA	NA
RBM39	9584	broad.mit.edu	37	20	34295125	34295126	+	Splice_Site	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:34295125_34295126insA	uc002xeb.2	-	14	1570	c.1226_splice	c.e14-1	p.A409_splice	RBM39_uc002xdz.2_Splice_Site_p.A385_splice|RBM39_uc002xea.2_Splice_Site_p.A252_splice|RBM39_uc010gfn.2_Splice_Site_p.A252_splice|RBM39_uc010zvm.1_Splice_Site_p.A381_splice|RBM39_uc002xeg.2_Splice_Site_p.A387_splice|RBM39_uc002xec.2_Splice_Site_p.A403_splice|RBM39_uc002xed.2_Splice_Site_p.A127_splice|RBM39_uc002xee.2_Splice_Site_p.A252_splice|RBM39_uc002xef.2_Splice_Site_p.A246_splice|RBM39_uc010zvn.1_Splice_Site_p.A252_splice	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					AAGCTGAAGCTAAAAAAAGAAA	0.366			NA											8	39	---	---	---	---	NA	NA	NA	NA	NA
PPP1R16B	26051	broad.mit.edu	37	20	37534665	37534665	+	Frame_Shift_Del	DEL	C	C	-	rs4812332	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:37534665delC	uc002xje.2	+	7	939	c.750delC	c.(748-750)GACfs	p.D250fs	PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	250	ANK 3.				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TCCTCCTGGACCATGGAGTGC	0.612			NA											24	83	---	---	---	---	NA	NA	NA	NA	NA
HNF4A	3172	broad.mit.edu	37	20	43058204	43058204	+	Frame_Shift_Del	DEL	G	G	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:43058204delG	uc002xma.2	+	10	1413	c.1324delG	c.(1324-1326)GGGfs	p.G442fs	HNF4A_uc002xlu.2_Frame_Shift_Del_p.G410fs|HNF4A_uc002xlv.2_Frame_Shift_Del_p.G420fs|HNF4A_uc002xlz.2_Frame_Shift_Del_p.G432fs|HNF4A_uc010ggq.2_Frame_Shift_Del_p.G435fs	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	442					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			AGGTGGCTCAGGGTCTGAGCC	0.592	Colon(79;2 1269 8820 14841 52347)		NA											30	255	---	---	---	---	NA	NA	NA	NA	NA
ARFGEF2	10564	broad.mit.edu	37	20	47587876	47587877	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr20:47587876_47587877insA	uc002xtx.3	+	10	1562_1563	c.1410_1411insA	c.(1408-1413)TTGAAAfs	p.L470fs		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	470_471					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AAATGCACTTGAAAATGCAGAT	0.337	Esophageal Squamous(176;1738 1974 26285 33069 35354)		NA											10	58	---	---	---	---	NA	NA	NA	NA	NA
MED15	51586	broad.mit.edu	37	22	20940865	20940866	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr22:20940865_20940866insT	uc002zsp.2	+	18	2321_2322	c.2241_2242insT	c.(2239-2244)CCCTTCfs	p.P747fs	MED15_uc002zsq.2_Frame_Shift_Ins_p.P707fs|MED15_uc010gso.2_Frame_Shift_Ins_p.P690fs|MED15_uc002zsr.2_Frame_Shift_Ins_p.P681fs|MED15_uc011ahs.1_Frame_Shift_Ins_p.P681fs|MED15_uc002zss.2_Frame_Shift_Ins_p.P626fs|MED15_uc011ahu.1_Frame_Shift_Ins_p.P457fs|MED15_uc002zst.2_Frame_Shift_Ins_p.P363fs|MED15_uc002zsu.2_Frame_Shift_Ins_p.P352fs	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	747_748					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding	p.P747S(1)		skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			ACGCCAACCCCTTCCTCCAGTC	0.678			NA											12	99	---	---	---	---	NA	NA	NA	NA	NA
PDGFRA	5156	broad.mit.edu	37	4	55151646	55151647	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:55151646_55151647insA	uc003han.3	+	17	2763_2764	c.2432_2433insA	c.(2431-2433)TCAfs	p.S811fs	PDGFRA_uc003haa.2_Frame_Shift_Ins_p.S571fs	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	811	Protein kinase.|Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TTTTTGGCTTCAAAAAATGTAA	0.416	Pancreas(151;208 1913 7310 23853 37092)		NA	Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			9	77	---	---	---	---	NA	NA	NA	NA	NA
ARHGAP24	83478	broad.mit.edu	37	4	86916559	86916560	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr4:86916559_86916560insG	uc003hpk.2	+	9	2201_2202	c.1752_1753insG	c.(1750-1755)TTTGGGfs	p.F584fs	ARHGAP24_uc003hpl.2_Frame_Shift_Ins_p.F489fs|ARHGAP24_uc010ikf.2_Frame_Shift_Ins_p.F499fs|ARHGAP24_uc003hpm.2_Frame_Shift_Ins_p.F491fs	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1	584_585					angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		AAGACTTTTTTGGGGGGAACTT	0.559			NA											27	73	---	---	---	---	NA	NA	NA	NA	NA
NSUN2	54888	broad.mit.edu	37	5	6607459	6607460	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:6607459_6607460delCT	uc003jdu.2	-	13	1426_1427	c.1361_1362delAG	c.(1360-1362)CAGfs	p.Q454fs	NSUN2_uc003jds.2_5'Flank|NSUN2_uc003jdt.2_Frame_Shift_Del_p.Q218fs|NSUN2_uc011cmk.1_Frame_Shift_Del_p.Q419fs|NSUN2_uc003jdv.2_Frame_Shift_Del_p.Q218fs	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	454						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						CAGGGCTCAGCTGTGTGCTTTC	0.46			NA											21	108	---	---	---	---	NA	NA	NA	NA	NA
C5orf42	65250	broad.mit.edu	37	5	37183684	37183685	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:37183684_37183685insT	uc011cpa.1	-	26	4829_4830	c.4598_4599insA	c.(4597-4599)AATfs	p.N1533fs	C5orf42_uc011coy.1_Frame_Shift_Ins_p.N34fs|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Frame_Shift_Ins_p.N608fs|C5orf42_uc011cpb.1_Frame_Shift_Ins_p.N414fs	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1533										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CAGGAAGTGTATTTTGTGATAA	0.302			NA											13	46	---	---	---	---	NA	NA	NA	NA	NA
RICTOR	253260	broad.mit.edu	37	5	38945792	38945793	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:38945792_38945793insT	uc003jlp.2	-	34	4457_4458	c.4433_4434insA	c.(4432-4434)AATfs	p.N1478fs	RICTOR_uc003jlo.2_Frame_Shift_Ins_p.N1502fs|RICTOR_uc010ivf.2_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	1478					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					AGTGAAAAGAATTTTTTACAAG	0.342			NA											7	50	---	---	---	---	NA	NA	NA	NA	NA
DEPDC1B	55789	broad.mit.edu	37	5	59982868	59982869	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:59982868_59982869insT	uc003jsh.2	-	2	307_308	c.234_235insA	c.(232-237)AAATTCfs	p.K78fs	DEPDC1B_uc011cqm.1_Frame_Shift_Ins_p.K78fs|DEPDC1B_uc011cqn.1_Frame_Shift_Ins_p.K51fs	NM_018369	NP_060839	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B isoform 1	78_79	DEP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)	1		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				TTCTTCAGGAATTTTTTTAGCA	0.465			NA											46	166	---	---	---	---	NA	NA	NA	NA	NA
LMNB1	4001	broad.mit.edu	37	5	126154676	126154677	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:126154676_126154677delCT	uc003kud.1	+	6	1370_1371	c.1002_1003delCT	c.(1000-1005)AACTCTfs	p.N334fs	LMNB1_uc003kuc.2_Frame_Shift_Del_p.N334fs|LMNB1_uc010jdb.1_RNA|LMNB1_uc011cxb.1_Frame_Shift_Del_p.N124fs	NM_005573	NP_005564	P20700	LMNB1_HUMAN	lamin B1	334_335	Rod.|Coil 2.				cellular component disassembly involved in apoptosis	lamin filament|nuclear inner membrane	protein binding|structural molecule activity			kidney(1)|central_nervous_system(1)	2		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		AAAAAGACAACTCTCGTCGCAT	0.391			NA											25	83	---	---	---	---	NA	NA	NA	NA	NA
PCDHB6	56130	broad.mit.edu	37	5	140531175	140531175	+	Frame_Shift_Del	DEL	T	T	-	rs246707	byFrequency	TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:140531175delT	uc003lir.2	+	1	1337	c.1337delT	c.(1336-1338)GTCfs	p.V446fs	PCDHB6_uc011dah.1_Frame_Shift_Del_p.V310fs	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	446	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATGACAACGTCCCCGCCTTC	0.582			NA											47	156	---	---	---	---	NA	NA	NA	NA	NA
C1QTNF2	114898	broad.mit.edu	37	5	159797634	159797635	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr5:159797634_159797635insG	uc003lyd.2	-	1	14_15	c.10_11insC	c.(10-12)CTAfs	p.L4fs		NM_031908	NP_114114	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	Error:Variant_position_missing_in_Q9BXJ5_after_alignment						collagen				skin(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCCAGGCATAGTTTTCCCATC	0.649			NA											11	44	---	---	---	---	NA	NA	NA	NA	NA
JARID2	3720	broad.mit.edu	37	6	15496722	15496722	+	Frame_Shift_Del	DEL	G	G	-			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:15496722delG	uc003nbj.2	+	7	1510	c.1266delG	c.(1264-1266)GTGfs	p.V422fs	JARID2_uc011diu.1_Frame_Shift_Del_p.V286fs|JARID2_uc011div.1_Frame_Shift_Del_p.V250fs|JARID2_uc011diw.1_Frame_Shift_Del_p.V384fs	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	422					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CTAAGGAGGTGGGGGGGCGGC	0.667			NA											9	142	---	---	---	---	NA	NA	NA	NA	NA
KIAA0319	9856	broad.mit.edu	37	6	24601319	24601320	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr6:24601319_24601320insG	uc011djo.1	-	2	249_250	c.12_13insC	c.(10-15)CCCACAfs	p.P4fs	KIAA0319_uc011djp.1_Intron|KIAA0319_uc003neh.1_Frame_Shift_Ins_p.P4fs|KIAA0319_uc011djq.1_5'UTR|KIAA0319_uc011djr.1_Frame_Shift_Ins_p.P4fs	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	4_5					negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						AGCACACCTGTGGGGGGCGCCA	0.525			NA											22	217	---	---	---	---	NA	NA	NA	NA	NA
NSMCE2	286053	broad.mit.edu	37	8	126194363	126194364	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr8:126194363_126194364insA	uc003yrw.2	+	5	511_512	c.283_284insA	c.(283-285)GAAfs	p.E95fs	NSMCE2_uc003yrv.2_Frame_Shift_Ins_p.E95fs	NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog	95					DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			AGAACGTCCAGAAAAAATACCA	0.287			NA											18	186	---	---	---	---	NA	NA	NA	NA	NA
FREM1	158326	broad.mit.edu	37	9	14857620	14857621	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:14857620_14857621insG	uc003zlm.2	-	5	1348_1349	c.758_759insC	c.(757-759)CCTfs	p.P253fs	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	253					cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		TGTTGGGTGAAGGGGGATCCAG	0.495			NA											9	112	---	---	---	---	NA	NA	NA	NA	NA
PLIN2	123	broad.mit.edu	37	9	19119812	19119813	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chr9:19119812_19119813insT	uc003zno.2	-	6	791_792	c.612_613insA	c.(610-615)AAAGTTfs	p.K204fs	PLIN2_uc011lna.1_Frame_Shift_Ins_p.K176fs|PLIN2_uc011lnb.1_Frame_Shift_Ins_p.K161fs	NM_001122	NP_001113	Q99541	PLIN2_HUMAN	adipose differentiation-related protein	204_205					cellular lipid metabolic process	endoplasmic reticulum|extracellular region|lipid particle				ovary(2)	2						AATCCTTCAACTTTTTTTGCTT	0.431			NA											8	102	---	---	---	---	NA	NA	NA	NA	NA
CCNB3	85417	broad.mit.edu	37	X	50051702	50051703	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:50051702_50051703insA	uc004dox.3	+	6	831_832	c.533_534insA	c.(532-534)TTAfs	p.L178fs	CCNB3_uc004doy.2_Frame_Shift_Ins_p.L178fs|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	178					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					TCATTATCTTTAAAAAAGTGCT	0.426			NA											20	34	---	---	---	---	NA	NA	NA	NA	NA
PLXNB3	5365	broad.mit.edu	37	X	153042690	153042691	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7567-01A-11D-2063-08	TCGA-95-7567-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	118e528b-c07f-4c32-a2dd-3f098916f81d	97f1e89e-69ae-476b-9dba-d46e08f126d1	g.chrX:153042690_153042691insG	uc004fii.2	+	30	5129_5130	c.4955_4956insG	c.(4954-4956)GAGfs	p.E1652fs	PLXNB3_uc010nuk.2_Frame_Shift_Ins_p.E1675fs|PLXNB3_uc011mzd.1_Frame_Shift_Ins_p.E1291fs|SRPK3_uc004fik.2_5'UTR	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	1652	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GATGGCGAGGAGGGGGGGGTGT	0.693			NA											4	3	---	---	---	---	NA	NA	NA	NA	NA
