Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
CALML6	163688	broad.mit.edu	37	1	1848605	1848605	+	Silent	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:1848605G>A	uc001aih.1	+	6	973	c.519G>A	c.(517-519)ACG>ACA	p.T173T		NM_138705	NP_619650	Q8TD86	CALL6_HUMAN	calmodulin-like 6	173	EF-hand 4.					cytoplasm|nucleus	calcium ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.94e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.83e-23)|GBM - Glioblastoma multiforme(42;3.23e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		CCATGATGACGGGGGAGTCCT	0.692			NA											7	54					0	0	0.038147	0	0
SPSB1	80176	broad.mit.edu	37	1	9416188	9416188	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:9416188G>T	uc010oae.1	+	2	577	c.238G>T	c.(238-240)GTG>TTG	p.V80L	SPSB1_uc001apv.2_Missense_Mutation_p.V80L	NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box	80	B30.2/SPRY.				intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		CCGGCATCCGGTGGCCCAGAG	0.582			NA											75	437					5.02462e-34	7.0829e-34	0.139131	1	0
PRAMEF2	65122	broad.mit.edu	37	1	12919660	12919660	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:12919660A>G	uc001aum.1	+	3	487	c.400A>G	c.(400-402)ACA>GCA	p.T134A		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	134											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAAGAGGCAGACAGCAGAGGA	0.542			NA											8	585					0	0	0.047766	0	0
INSL5	10022	broad.mit.edu	37	1	67263829	67263829	+	Missense_Mutation	SNP	C	C	T	rs137866143	by1000genomes	TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:67263829C>T	uc001dcw.2	-	2	310	c.275G>A	c.(274-276)CGT>CAT	p.R92H		NM_005478	NP_005469	Q9Y5Q6	INSL5_HUMAN	insulin-like 5 precursor	92						extracellular region	hormone activity				0						ACCCCAAAGACGGTCTTCCCC	0.483			NA											23	298					0	0	0.083992	0	0
WNT2B	7482	broad.mit.edu	37	1	113057555	113057555	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:113057555G>A	uc001ecb.2	+	2	757	c.242G>A	c.(241-243)CGG>CAG	p.R81Q	WNT2B_uc001eca.2_Missense_Mutation_p.R62Q|WNT2B_uc009wgg.2_5'UTR	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	81					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTGGTGAGCCGGCAGCGGCAG	0.592			NA											50	276					0	0	0.139131	0	0
SELE	6401	broad.mit.edu	37	1	169698730	169698730	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:169698730G>C	uc001ggm.3	-	6	957	c.800C>G	c.(799-801)ACC>AGC	p.T267S	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	267	Sushi 2.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					AAATGTACAGGTTGTGTTCCA	0.458			NA											54	332					0	0	0.139131	0	0
ASTN1	460	broad.mit.edu	37	1	176857225	176857225	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:176857225G>A	uc001glc.2	-	18	3268	c.3056C>T	c.(3055-3057)GCG>GTG	p.A1019V	ASTN1_uc001glb.1_Missense_Mutation_p.A1019V|ASTN1_uc001gld.1_Missense_Mutation_p.A1019V	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	1027					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						TGGGAGAGGCGCACAGGTGGG	0.418			NA											9	220					0	0	0.058154	0	0
KIF21B	23046	broad.mit.edu	37	1	200965516	200965516	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:200965516C>A	uc001gvs.1	-	15	2402	c.2085G>T	c.(2083-2085)ATG>ATT	p.M695I	KIF21B_uc001gvr.1_Missense_Mutation_p.M695I|KIF21B_uc009wzl.1_Missense_Mutation_p.M695I|KIF21B_uc010ppn.1_Missense_Mutation_p.M695I	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	695	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						TATAGCACTCCATGGTGCCTG	0.562			NA											71	345					4.83814e-26	6.65955e-26	0.139131	1	0
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	Missense_Mutation	SNP	A	A	G	rs2257765		TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr10:38654432A>G	uc010qex.1	+	5	599	c.524A>G	c.(523-525)AAT>AGT	p.N175S	HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						TCATCTCGCAATGCAAGGAAA	0.453			NA											5	176					0	0	0.014758	0	0
BMS1	9790	broad.mit.edu	37	10	43318597	43318597	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr10:43318597A>G	uc001jaj.2	+	20	3522	c.3164A>G	c.(3163-3165)AAA>AGA	p.K1055R		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	1055					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						GAAGTGGCCAAATTTGAAGGT	0.428			NA											5	275					0	0	0.021553	0	0
DCLRE1A	9937	broad.mit.edu	37	10	115609461	115609461	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr10:115609461G>T	uc001law.2	-	2	2321	c.1403C>A	c.(1402-1404)CCT>CAT	p.P468H		NM_014881	NP_055696	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	468	Nuclear focus formation.				cell division|mitosis	nucleus	hydrolase activity			skin(2)	2				Epithelial(162;0.0157)|all cancers(201;0.0171)		ACTTTCAAAAGGTTTCAACAT	0.318			NA						Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					33	179					1.22384e-17	1.62714e-17	0.054565	1	0
MPEG1	219972	broad.mit.edu	37	11	58979414	58979414	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr11:58979414G>C	uc001nnu.3	-	1	1081	c.925C>G	c.(925-927)CCG>GCG	p.P309A		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	309	MACPF.|Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				AAATGCAGCGGCAGGCCAGAG	0.567			NA											15	90					0	0	0.11911	0	0
MPEG1	219972	broad.mit.edu	37	11	58979536	58979536	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr11:58979536G>T	uc001nnu.3	-	1	959	c.803C>A	c.(802-804)TCA>TAA	p.S268*		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	268	MACPF.|Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				GGTTCGGTTTGAGAGGTAGCT	0.537			NA											8	57					0.000157383	0.000187896	0.038147	1	0
MS4A14	84689	broad.mit.edu	37	11	60183610	60183610	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr11:60183610C>A	uc001npj.2	+	5	1734	c.1169C>A	c.(1168-1170)ACA>AAA	p.T390K	MS4A14_uc001npi.2_Missense_Mutation_p.T278K|MS4A14_uc001npn.2_Missense_Mutation_p.T128K|MS4A14_uc001npk.2_Missense_Mutation_p.T373K|MS4A14_uc001npl.2_Missense_Mutation_p.T128K|MS4A14_uc001npm.2_Missense_Mutation_p.T128K	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	390						integral to membrane	receptor activity			breast(1)	1						tctcaagacacaccatcccac	0.08			NA											8	51					0.00307968	0.00363962	0.038147	1	0
SLC29A2	3177	broad.mit.edu	37	11	66130941	66130941	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr11:66130941G>A	uc001oht.2	-	12	1566	c.1337C>T	c.(1336-1338)GCC>GTC	p.A446V	SLC29A2_uc001ohs.2_Missense_Mutation_p.A326V|SLC29A2_uc010rpb.1_RNA|SLC29A2_uc009yrf.2_Missense_Mutation_p.A326V|SLC29A2_uc001ohu.2_Missense_Mutation_p.A446V|SLC29A2_uc001ohv.2_3'UTR	NM_001532	NP_001523	Q14542	S29A2_HUMAN	solute carrier family 29 (nucleoside	446	Helical; (Potential).				cell proliferation|nucleobase, nucleoside and nucleotide metabolic process	basolateral plasma membrane|integral to plasma membrane|nuclear membrane|nucleolus	nucleoside transmembrane transporter activity			ovary(1)	1						GGAGAGGGAGGCTCCACAGGA	0.637			NA											15	81					0	0	0.038395	0	0
IQSEC3	440073	broad.mit.edu	37	12	247991	247991	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr12:247991G>A	uc001qhw.1	+	1	559	c.553G>A	c.(553-555)GTC>ATC	p.V185I	IQSEC3_uc001qhu.1_Missense_Mutation_p.V185I|IQSEC3_uc001qht.1_Missense_Mutation_p.V270I|uc001qhv.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	488					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		TTTCCGGGACGTCACGGTGCA	0.577			NA											21	52					0	0	0.076483	0	0
MLL2	8085	broad.mit.edu	37	12	49446807	49446807	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr12:49446807G>A	uc001rta.3	-	8	1003	c.1003C>T	c.(1003-1005)CCC>TCC	p.P335S		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	335					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TCCGAGTTGGGATTCAGTTCT	0.582			NA	N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			7	347					0	0	0.02938	0	0
NCKAP1L	3071	broad.mit.edu	37	12	54910732	54910732	+	Silent	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr12:54910732C>T	uc001sgc.3	+	11	1130	c.1051C>T	c.(1051-1053)CTG>TTG	p.L351L	NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Silent_p.L301L	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	351					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						AGTGAAGGAGCTGGAGACTGT	0.502			NA											27	299					0	0	0.144211	0	0
NBEA	26960	broad.mit.edu	37	13	35517094	35517094	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr13:35517094G>T	uc001uvb.2	+	2	343	c.137G>T	c.(136-138)AGG>ATG	p.R46M		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	46						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGGGAGCTAAGGGGGGCGTCC	0.498			NA											17	63					1.15088e-07	1.4174e-07	0.146539	1	0
RB1	5925	broad.mit.edu	37	13	48937094	48937094	+	Splice_Site	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr13:48937094G>A	uc001vcb.2	+	8	1027	c.861_splice	c.e8+1	p.E287_splice	RB1_uc010act.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(5)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TATAGATGAGGTAATTTAACT	0.303			6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			10	98					0	0	0.069234	0	0
PCNX	22990	broad.mit.edu	37	14	71500221	71500221	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr14:71500221C>T	uc001xmo.2	+	17	4080	c.3634C>T	c.(3634-3636)CTC>TTC	p.L1212F	PCNX_uc010are.1_Missense_Mutation_p.L1101F|PCNX_uc010arf.1_Missense_Mutation_p.L72F	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1212	Helical; (Potential).					integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GTCTTACCATCTCAGCCGACA	0.348			NA											5	146					0	0	0.014758	0	0
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	Splice_Site	SNP	G	G	A	rs112615235	by1000genomes	TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr15:30938316G>A	uc010azv.1	+	11		c.1127_splice	c.e11-1		ARHGAP11B_uc001zeu.2_Splice_Site			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TTCCTTGGCAGTGGATAAGTT	0.393			NA											5	82					0	0	0.021553	0	0
ARID3B	10620	broad.mit.edu	37	15	74836319	74836319	+	Silent	SNP	A	A	G			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr15:74836319A>G	uc002aye.2	+	2	243	c.42A>G	c.(40-42)CAA>CAG	p.Q14Q	ARID3B_uc002ayc.2_Silent_p.Q14Q|ARID3B_uc002ayd.2_Silent_p.Q14Q	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B	14	Gln-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						agcagcaacaacagaagcagc	0.443			NA											3	78					0	0	0.02938	0	0
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652			NA											6	97					0	0	0.038147	0	0
MEFV	4210	broad.mit.edu	37	16	3304702	3304702	+	Silent	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr16:3304702G>A	uc002cun.1	-	2	406	c.366C>T	c.(364-366)GAC>GAT	p.D122D		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	122					inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	CCTCGGGGTGGTCTGGAGTCT	0.657			NA											31	121					0	0	0.045705	0	0
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr17:7577094G>A	uc002gim.2	-	8	1038	c.844C>T	c.(844-846)CGG>TGG	p.R282W	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R282W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R150W|TP53_uc010cng.1_Missense_Mutation_p.R150W|TP53_uc002gii.1_Missense_Mutation_p.R150W|TP53_uc010cnh.1_Missense_Mutation_p.R282W|TP53_uc010cni.1_Missense_Mutation_p.R282W|TP53_uc002gij.2_Missense_Mutation_p.R282W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGTGCGCCGGTCTCTCCCA	0.557	Pancreas(47;798 1329 9957 10801)		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			18	105					0	0	0.038395	0	0
KCNG2	26251	broad.mit.edu	37	18	77659126	77659126	+	Silent	SNP	C	C	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr18:77659126C>A	uc010xfl.1	+	2	711	c.711C>A	c.(709-711)TCC>TCA	p.S237S		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	237	Helical; Name=Segment S2; (Potential).				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		TGCTGCGCTCCCTGCAGGCCG	0.667			NA											18	87					6.94344e-10	8.92728e-10	0.038395	1	0
ATP8B3	148229	broad.mit.edu	37	19	1800400	1800400	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr19:1800400C>T	uc002ltw.2	-	13	1435	c.1201G>A	c.(1201-1203)GGT>AGT	p.G401S	ATP8B3_uc002ltv.2_Missense_Mutation_p.G354S|ATP8B3_uc002ltx.2_RNA|ATP8B3_uc002lty.1_Missense_Mutation_p.G149S|ATP8B3_uc002ltz.1_Missense_Mutation_p.G348S	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	401	Helical; (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTGAGAAACCGAAGCCGAAG	0.597			NA											40	225					0	0	0.124865	0	0
ADAMTS10	81794	broad.mit.edu	37	19	8660968	8660968	+	Silent	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr19:8660968G>A	uc002mkj.1	-	11	1600	c.1326C>T	c.(1324-1326)ACC>ACT	p.T442T	ADAMTS10_uc002mkk.1_Silent_p.T74T	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	442	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						CTAGAAAGCTGGTGATGTAGT	0.587			NA											48	243					0	0	0.139131	0	0
ZNF175	7728	broad.mit.edu	37	19	52090627	52090627	+	Nonsense_Mutation	SNP	C	C	A	rs150573174		TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr19:52090627C>A	uc002pxb.2	+	5	1421	c.1043C>A	c.(1042-1044)TCA>TAA	p.S348*		NM_007147	NP_009078	Q9Y473	ZN175_HUMAN	zinc finger protein 175	348	C2H2-type 3.				response to virus	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		ATTCAGAGATCAGAATTGCTT	0.403			NA											44	222					5.20837e-25	7.00436e-25	0.104719	1	0
TMEM150B	284417	broad.mit.edu	37	19	55831513	55831513	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr19:55831513C>A	uc010esw.1	-	6	391	c.218G>T	c.(217-219)CGT>CTT	p.R73L	TMEM150B_uc010yfu.1_Missense_Mutation_p.R73L|TMEM150B_uc010yfv.1_RNA|TMEM150B_uc010yfw.1_RNA|TMEM150B_uc002qki.2_Missense_Mutation_p.R73L	NM_001085488	NP_001078957	A6NC51	T150B_HUMAN	transmembrane protein 150B precursor	73	Cytoplasmic (Potential).					integral to membrane					0						CTGGTGGTAACGGACAATGCA	0.622			NA											55	338					1.85257e-25	2.52036e-25	0.139131	1	0
GALP	85569	broad.mit.edu	37	19	56693610	56693610	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr19:56693610G>A	uc002qmo.1	+	4	288	c.206G>A	c.(205-207)TGG>TAG	p.W69*	GALP_uc010eti.2_3'UTR	NM_033106	NP_149097	Q9UBC7	GALP_HUMAN	galanin-like peptide isoform 1 precursor	69					neuropeptide signaling pathway	extracellular region	hormone activity				0		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		CTAGACCTGTGGAAGGCCATC	0.502			NA											14	108					0	0	0.043863	0	0
FAM179A	165186	broad.mit.edu	37	2	29225560	29225560	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr2:29225560G>T	uc010ezl.2	+	5	937	c.586G>T	c.(586-588)GAC>TAC	p.D196Y	FAM179A_uc010ymm.1_Missense_Mutation_p.D196Y	NM_199280	NP_954974	Q6ZUX3	F179A_HUMAN	hypothetical protein LOC165186	196							binding			ovary(3)|skin(1)	4						GAAGGGCCTGGACCTACCGGG	0.622			NA											19	93					1.56452e-12	2.05673e-12	0.043863	1	0
MYEOV2	150678	broad.mit.edu	37	2	241066016	241066016	+	Silent	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr2:241066016C>T	uc002vyu.1	-	5	723	c.723G>A	c.(721-723)GGG>GGA	p.G241G		NM_138336	NP_612209	Q8WXC6	MYOV2_HUMAN	hypothetical protein LOC150678 isoform 1	Error:Variant_position_missing_in_Q8WXC6_after_alignment											0		all_epithelial(40;1.56e-11)|Breast(86;0.0002)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.81e-30)|all cancers(36;1.1e-27)|OV - Ovarian serous cystadenocarcinoma(60;2.74e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.54e-06)|Lung(119;0.00361)|LUSC - Lung squamous cell carcinoma(224;0.0153)|Colorectal(34;0.0202)|COAD - Colon adenocarcinoma(134;0.143)		TGGTCTTCTTCCCTTCTTCTC	0.438			NA											42	232					0	0	0.11126	0	0
INSM1	3642	broad.mit.edu	37	20	20349683	20349683	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr20:20349683G>A	uc002wrx.2	+	1	919	c.772G>A	c.(772-774)GGG>AGG	p.G258R		NM_002196	NP_002187	Q01101	INSM1_HUMAN	insulinoma-associated 1	258					endocrine pancreas development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0649)		gggccgcgcggggggcgcggc	0.527			NA											8	37					0	0	0.038147	0	0
FRG1B	284802	broad.mit.edu	37	20	29625875	29625875	+	Missense_Mutation	SNP	T	T	C	rs143761036	by1000genomes	TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr20:29625875T>C	uc010ztl.1	+	2	61	c.29T>C	c.(28-30)ATC>ACC	p.I10T	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATGTACAGAATCGCCCTGAAA	0.353			NA											9	164					0	0	0.11911	0	0
TRPM2	7226	broad.mit.edu	37	21	45861686	45861686	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr21:45861686G>A	uc002zet.1	+	33	4711	c.4498G>A	c.(4498-4500)GGG>AGG	p.G1500R	TRPM2_uc002zeu.1_Missense_Mutation_p.G1500R|TRPM2_uc002zew.1_Missense_Mutation_p.G1500R|TRPM2_uc010gpt.1_Missense_Mutation_p.G1550R|TRPM2_uc002zex.1_Missense_Mutation_p.G1286R|TRPM2_uc002zey.1_Missense_Mutation_p.G979R|TRPM2_uc011aff.1_Missense_Mutation_p.G181R	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	1500	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CGCTGAGTTCGGGGCTCACTA	0.637			NA											56	106					0	0	0.139131	0	0
IL17RD	54756	broad.mit.edu	37	3	57132270	57132270	+	Silent	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr3:57132270G>A	uc003dil.2	-	12	1550	c.1461C>T	c.(1459-1461)GAC>GAT	p.D487D	IL17RD_uc003dik.2_Silent_p.D463D|IL17RD_uc010hna.2_Silent_p.D343D|IL17RD_uc011bex.1_Silent_p.D343D	NM_017563	NP_060033	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D precursor	487	SEFIR.|Cytoplasmic (Potential).					Golgi membrane|integral to membrane|plasma membrane	receptor activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		TACCGGGGACGTCTCCCTCGC	0.567			NA											7	82					0	0	0.02938	0	0
EIF4G1	1981	broad.mit.edu	37	3	184049748	184049748	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr3:184049748C>T	uc003fnp.2	+	32	4690	c.4492C>T	c.(4492-4494)CGA>TGA	p.R1498*	EIF4G1_uc003fnt.2_Nonsense_Mutation_p.R1209*|EIF4G1_uc003fnq.2_Nonsense_Mutation_p.R1411*|EIF4G1_uc003fnr.2_Nonsense_Mutation_p.R1334*|EIF4G1_uc010hxx.2_Nonsense_Mutation_p.R1505*|EIF4G1_uc003fns.2_Nonsense_Mutation_p.R1458*|EIF4G1_uc010hxy.2_Nonsense_Mutation_p.R1505*|EIF4G1_uc003fnv.3_Nonsense_Mutation_p.R1499*|EIF4G1_uc003fnu.3_Nonsense_Mutation_p.R1498*|EIF4G1_uc003fnw.2_Nonsense_Mutation_p.R1505*|EIF4G1_uc003fnx.2_Nonsense_Mutation_p.R1303*|EIF4G1_uc003fny.3_Nonsense_Mutation_p.R1302*|EIF4G1_uc003foa.2_Nonsense_Mutation_p.R170*	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1498	W2.|EIF4A-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GACTCCCCTCCGAGTGGACGT	0.582			NA											10	235					0	0	0.058154	0	0
MFSD8	256471	broad.mit.edu	37	4	128861025	128861025	+	Silent	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr4:128861025C>T	uc003ifp.2	-	7	844	c.681G>A	c.(679-681)CTG>CTA	p.L227L	MFSD8_uc011cgu.1_Silent_p.L182L|MFSD8_uc011cgv.1_Silent_p.L189L|MFSD8_uc011cgw.1_RNA|MFSD8_uc011cgx.1_Intron	NM_152778	NP_689991	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing	227	Helical; (Potential).				cell death|transmembrane transport	integral to membrane|lysosomal membrane				ovary(1)|liver(1)	2						TGGCAAGGATCAGAATAATAT	0.308			NA											19	171					0	0	0.069288	0	0
TRIO	7204	broad.mit.edu	37	5	14482836	14482836	+	Missense_Mutation	SNP	A	A	G	rs141648983		TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr5:14482836A>G	uc003jff.2	+	46	6617	c.6611A>G	c.(6610-6612)AAG>AGG	p.K2204R	TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Missense_Mutation_p.K1853R	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	2204	PH 2.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					CTTGATAAAAAGAAGGGCTTC	0.498			NA											6	328					0	0	0.021553	0	0
FAT2	2196	broad.mit.edu	37	5	150922824	150922824	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr5:150922824A>G	uc003lue.3	-	9	7877	c.7864T>C	c.(7864-7866)TAC>CAC	p.Y2622H	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2622	Cadherin 23.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCACTGAGTAGGTGACATCT	0.453			NA											87	457					0	0	0.139131	0	0
DSP	1832	broad.mit.edu	37	6	7581318	7581318	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr6:7581318A>T	uc003mxp.1	+	23	5174	c.4895A>T	c.(4894-4896)GAC>GTC	p.D1632V	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1632	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGTGAGGATGACCTCCGGCAG	0.582			NA											20	229					0	0	0.049695	0	0
BTBD9	114781	broad.mit.edu	37	6	38224278	38224278	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr6:38224278T>C	uc003ooa.3	-	10	2045	c.1469A>G	c.(1468-1470)GAT>GGT	p.D490G	BTBD9_uc003ony.3_Missense_Mutation_p.D422G|BTBD9_uc010jwv.2_Missense_Mutation_p.D451G|BTBD9_uc010jww.2_RNA|BTBD9_uc010jwx.2_Missense_Mutation_p.D490G	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a	490					cell adhesion						0						ATCATCACAATCCCAAAGTAG	0.423			NA											31	138					0	0	0.059317	0	0
LRFN2	57497	broad.mit.edu	37	6	40359735	40359735	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr6:40359735C>A	uc003oph.1	-	3	2782	c.2317G>T	c.(2317-2319)GGG>TGG	p.G773W		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	773	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCCCGGGCCCCCACCAGGTCA	0.632			NA											33	175					9.93527e-08	1.23662e-07	0.054565	1	0
DST	667	broad.mit.edu	37	6	56362211	56362211	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr6:56362211G>A	uc003pdf.2	-	76	13860	c.13832C>T	c.(13831-13833)CCG>CTG	p.P4611L	DST_uc003pcz.3_Missense_Mutation_p.P4433L|DST_uc011dxj.1_Missense_Mutation_p.P4462L|DST_uc011dxk.1_Missense_Mutation_p.P4473L|DST_uc003pcy.3_Missense_Mutation_p.P4107L	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6519	Spectrin 16.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGCTGTTTCCGGTAAACCTCC	0.483			NA											8	322					0	0	0.047766	0	0
DST	667	broad.mit.edu	37	6	56438682	56438682	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr6:56438682T>C	uc003pdf.2	-	45	6702	c.6674A>G	c.(6673-6675)GAC>GGC	p.D2225G	DST_uc003pcz.3_Missense_Mutation_p.D2047G|DST_uc011dxj.1_Missense_Mutation_p.D2076G|DST_uc011dxk.1_Missense_Mutation_p.D2087G|DST_uc003pcy.3_Missense_Mutation_p.D1721G|DST_uc010kaa.1_RNA	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	4133	Spectrin 3.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCCAACAATGTCATCTACTCC	0.398			NA											3	103					0	0	0.115264	0	0
HUS1	3364	broad.mit.edu	37	7	48007448	48007448	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr7:48007448G>A	uc003tod.1	-	7	845	c.715C>T	c.(715-717)CAG>TAG	p.Q239*	HUS1_uc003toe.1_Nonsense_Mutation_p.Q239*|HUS1_uc011kce.1_RNA	NM_004507	NP_004498	O60921	HUS1_HUMAN	HUS1 checkpoint protein	239					DNA damage checkpoint|DNA replication	Golgi apparatus|nucleolus|nucleoplasm	protein binding			ovary(2)|lung(2)|kidney(1)	5		Breast(660;0.00139)				GCAAGAAACTGTAGGAGCTTC	0.388	Ovarian(103;466 1517 21788 34610 43890)		NA						Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					25	168					0	0	0.108266	0	0
ZAN	7455	broad.mit.edu	37	7	100391521	100391521	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr7:100391521C>T	uc003uwj.2	+	44	8032	c.7867C>T	c.(7867-7869)CGG>TGG	p.R2623W	ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kke.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2623	Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGGCAGACCCCGGGGACTGCG	0.637			NA											29	234					0	0	0.144211	0	0
GBX1	2636	broad.mit.edu	37	7	150845685	150845685	+	Silent	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr7:150845685G>A	uc011kvg.1	-	2	1315	c.1083C>T	c.(1081-1083)GCC>GCT	p.A361A		NM_001098834	NP_001092304	Q14549	GBX1_HUMAN	gastrulation brain homeo box 1	361						nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTCAGGGCCGGGCCCCCTGCT	0.582			NA											8	166					0	0	0.038147	0	0
PDLIM2	64236	broad.mit.edu	37	8	22442336	22442336	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr8:22442336C>G	uc003xby.2	+	4	648	c.248C>G	c.(247-249)TCT>TGT	p.S83C	PDLIM2_uc003xbx.1_Missense_Mutation_p.S83C|PDLIM2_uc003xbz.2_Missense_Mutation_p.S83C|PDLIM2_uc003xca.2_Missense_Mutation_p.S83C|PDLIM2_uc003xcb.2_Missense_Mutation_p.S83C|PDLIM2_uc003xcc.1_Missense_Mutation_p.S83C	NM_021630	NP_067643	Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 isoform 2	83	PDZ.					actin cytoskeleton|cell surface|cytoplasm|focal adhesion|nucleus	zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CTTCTCAGGTCTCAGGCTACG	0.527			NA											46	252					0	0	0.139131	0	0
PDLIM2	64236	broad.mit.edu	37	8	22442594	22442594	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr8:22442594C>T	uc003xby.2	+	5	780	c.380C>T	c.(379-381)TCC>TTC	p.S127F	PDLIM2_uc003xbx.1_Missense_Mutation_p.S127F|PDLIM2_uc003xbz.2_Missense_Mutation_p.S127F|PDLIM2_uc003xca.2_Missense_Mutation_p.S127F|PDLIM2_uc003xcb.2_Missense_Mutation_p.S127F|PDLIM2_uc003xcc.1_Missense_Mutation_p.S127F	NM_021630	NP_067643	Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 isoform 2	127	Ser-rich.					actin cytoskeleton|cell surface|cytoplasm|focal adhesion|nucleus	zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		AGCCCAACCTCCCTCAGCCCG	0.622			NA											67	376					0	0	0.139131	0	0
LACTB2	51110	broad.mit.edu	37	8	71570008	71570008	+	Silent	SNP	A	A	C			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr8:71570008A>C	uc011lfd.1	-	3	488	c.396T>G	c.(394-396)ACT>ACG	p.T132T	LACTB2_uc003xyp.2_Silent_p.T132T	NM_016027	NP_057111	Q53H82	LACB2_HUMAN	lactamase, beta 2	132							hydrolase activity|metal ion binding			ovary(1)	1	Breast(64;0.0716)		Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)			TGGCTCCCTCAGTCTTAATCA	0.373			NA											20	314					0	0	0.069288	0	0
ZFHX4	79776	broad.mit.edu	37	8	77616928	77616928	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr8:77616928G>T	uc003yav.2	+	2	992	c.605G>T	c.(604-606)GGG>GTG	p.G202V	ZFHX4_uc003yat.1_Missense_Mutation_p.G202V|ZFHX4_uc003yau.1_Missense_Mutation_p.G202V|ZFHX4_uc003yaw.1_Missense_Mutation_p.G202V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	202						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCATCCCTCGGGAAACCATTT	0.488			NA								HNSCC(33;0.089)			18	113					9.16793e-09	1.15338e-08	0.0333	1	0
TMEM55A	55529	broad.mit.edu	37	8	92033563	92033563	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr8:92033563C>T	uc003yes.2	-	2	402	c.176G>A	c.(175-177)CGT>CAT	p.R59H		NM_018710	NP_061180	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A	59						integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity				0			BRCA - Breast invasive adenocarcinoma(11;0.033)			TTGGCACACACGGCAGTTTAT	0.458			NA											18	264					0	0	0.043863	0	0
KCNK9	51305	broad.mit.edu	37	8	140631199	140631199	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr8:140631199T>C	uc003yvf.1	-	2	491	c.427A>G	c.(427-429)ATT>GTT	p.I143V	KCNK9_uc003yvg.1_Missense_Mutation_p.I143V|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	143	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			CACTTCTTAATGCGCTTCAGC	0.592			NA											11	86					0	0	0.09319	0	0
FAM75A6	389730	broad.mit.edu	37	9	43625382	43625382	+	Missense_Mutation	SNP	G	G	A	rs143826416	by1000genomes	TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr9:43625382G>A	uc011lrb.1	-	4	3334	c.3305C>T	c.(3304-3306)CCT>CTT	p.P1102L		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	1102						integral to membrane					0						CTTGTGAATAGGGGGAAACAT	0.483			NA											9	414					0	0	0.11911	0	0
PTPDC1	138639	broad.mit.edu	37	9	96859692	96859692	+	Missense_Mutation	SNP	A	A	T	rs143093313	byFrequency	TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr9:96859692A>T	uc004auf.1	+	7	1022	c.682A>T	c.(682-684)ATA>TTA	p.I228L	PTPDC1_uc004aug.1_Missense_Mutation_p.I228L|PTPDC1_uc004auh.1_Missense_Mutation_p.I280L|PTPDC1_uc010mrj.1_Missense_Mutation_p.I282L|PTPDC1_uc010mri.1_Missense_Mutation_p.I280L	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	228	Tyrosine-protein phosphatase.						protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						ACCCAATTCCATACAAACCAG	0.423			NA											5	230					0	0	0.021553	0	0
DCAF8L2	347442	broad.mit.edu	37	X	27766045	27766045	+	Missense_Mutation	SNP	A	A	G	rs5926895	by1000genomes	TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chrX:27766045A>G	uc011mjy.1	+	1	1120	c.1033A>G	c.(1033-1035)ACC>GCC	p.T345A		NM_001136533	NP_001130005			DDB1 and CUL4 associated factor 8-like 2											central_nervous_system(1)|pancreas(1)	2						TGTTGTCTTCACCATTGACCT	0.478			NA											3	87					0	0	0.014758	0	0
GPC4	2239	broad.mit.edu	37	X	132458560	132458560	+	Silent	SNP	G	G	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chrX:132458560G>A	uc004exc.1	-	3	536	c.324C>T	c.(322-324)TTC>TTT	p.F108F	GPC4_uc011mvg.1_Silent_p.F38F	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor	108					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)					GTTCTTTGAAGAATTCTGAAA	0.284			NA											27	378					0	0	0.116897	0	0
DNAJC11	55735	broad.mit.edu	37	1	6727803	6727804	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:6727803_6727804delTC	uc001aof.2	-	4	449_450	c.343_344delGA	c.(343-345)GAAfs	p.E115fs	DNAJC11_uc010nzt.1_Frame_Shift_Del_p.E77fs|DNAJC11_uc001aog.2_Frame_Shift_Del_p.E115fs|DNAJC11_uc010nzu.1_Frame_Shift_Del_p.E25fs	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	115					protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCCTCTCTTCTCTCTCTCTC	0.505			NA											9	228	---	---	---	---	NA	NA	NA	NA	NA
SPEN	23013	broad.mit.edu	37	1	16255142	16255143	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:16255142_16255143delGA	uc001axk.1	+	11	2611_2612	c.2407_2408delGA	c.(2407-2409)GAGfs	p.E803fs	SPEN_uc010obp.1_Frame_Shift_Del_p.E762fs	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	803	Arg-rich.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGAGAGAGTGGAGAGAGAGAGA	0.431			NA											7	282	---	---	---	---	NA	NA	NA	NA	NA
MST1P9	11223	broad.mit.edu	37	1	17085590	17085595	+	In_Frame_Del	DEL	GCGCTG	GCGCTG	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	GCGCTG	GCGCTG	-	-	GCGCTG	GCGCTG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:17085590_17085595delGCGCTG	uc010ock.1	-	9	1126_1131	c.1126_1131delCAGCGC	c.(1126-1131)CAGCGCdel	p.QR376del	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						CAGCGGACCAGCGCTGGCACTGGACA	0.704			NA											17	343	---	---	---	---	NA	NA	NA	NA	NA
TMEM48	55706	broad.mit.edu	37	1	54298190	54298192	+	In_Frame_Del	DEL	TTA	TTA	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	TTA	TTA	-	-	TTA	TTA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:54298190_54298192delTTA	uc001cvs.2	-	3	492_494	c.251_253delTAA	c.(250-255)ATAAGT>AGT	p.I84del	TMEM48_uc010onu.1_In_Frame_Del_p.I84del|TMEM48_uc001cvt.2_5'UTR|TMEM48_uc009vzk.2_RNA|TMEM48_uc010onv.1_5'UTR	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48	84	Helical; Name=2; (Potential).				mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						TTGAAAATACTTATTATTATTAT	0.305	Ovarian(178;223 2720 6667 9715)		NA											7	151	---	---	---	---	NA	NA	NA	NA	NA
HAX1	10456	broad.mit.edu	37	1	154245864	154245866	+	In_Frame_Del	DEL	GAA	GAA	-	rs11556342		TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	GAA	GAA	-	-	GAA	GAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr1:154245864_154245866delGAA	uc001fes.2	+	2	267_269	c.106_108delGAA	c.(106-108)GAAdel	p.E40del	HAX1_uc001fet.2_Intron|HAX1_uc010peo.1_In_Frame_Del_p.E40del|HAX1_uc009wou.2_5'UTR|HAX1_uc009wov.2_In_Frame_Del_p.E14del	NM_006118	NP_006109	O00165	HAX1_HUMAN	HCLS1 associated protein X-1 isoform a	40	Asp/Glu-rich (highly acidic).|Required for localization in mitochondria (By similarity).					actin cytoskeleton|cytoplasmic membrane-bounded vesicle|lamellipodium|mitochondrion|nuclear membrane|sarcoplasmic reticulum|soluble fraction	interleukin-1 binding|protein N-terminus binding				0	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGATGATGAGGAAGAAGAAGAAG	0.522			NA							Kostmann_syndrome				10	212	---	---	---	---	NA	NA	NA	NA	NA
KIAA1462	57608	broad.mit.edu	37	10	30316501	30316503	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	CTG	CTG	-	-	CTG	CTG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr10:30316501_30316503delCTG	uc001iux.2	-	2	2633_2635	c.2574_2576delCAG	c.(2572-2577)AGCAGT>AGT	p.858_859SS>S	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_In_Frame_Del_p.720_721SS>S|KIAA1462_uc009xle.1_In_Frame_Del_p.858_859SS>S	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	858_859	Ser-rich.									ovary(4)	4						ACTCTCCTCActgctgctgctgc	0.463			NA											12	272	---	---	---	---	NA	NA	NA	NA	NA
OR5W2	390148	broad.mit.edu	37	11	55681686	55681713	+	Frame_Shift_Del	DEL	CCTTGTACCGATCAAAGGCCATCACTGA	CCTTGTACCGATCAAAGGCCATCACTGA	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	CCTTGTACCGATCAAAGGCCATCACTGA	CCTTGTACCGATCAAAGGCCATCACTGA	-	-	CCTTGTACCGATCAAAGGCCATCACTGA	CCTTGTACCGATCAAAGGCCATCACTGA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr11:55681686_55681713delCCTTGTACCGATCAAAGGCCATCACTGA	uc010rir.1	-	1	346_373	c.346_373delTCAGTGATGGCCTTTGATCGGTACAAGG	c.(346-375)TCAGTGATGGCCTTTGATCGGTACAAGGCCfs	p.S116fs		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	116_125	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TTGATGATGGCCTTGTACCGATCAAAGGCCATCACTGACAGCAGTAGA	0.456	Melanoma(48;171 1190 15239 43886 49348)		NA											17	205	---	---	---	---	NA	NA	NA	NA	NA
PPME1	51400	broad.mit.edu	37	11	73950234	73950240	+	Frame_Shift_Del	DEL	AGGAAGA	AGGAAGA	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	AGGAAGA	AGGAAGA	-	-	AGGAAGA	AGGAAGA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr11:73950234_73950240delAGGAAGA	uc001ouw.2	+	9	866_872	c.767_773delAGGAAGA	c.(766-774)GAGGAAGAAfs	p.E256fs	PPME1_uc009yty.2_Frame_Shift_Del_p.E126fs|PPME1_uc001oux.2_Frame_Shift_Del_p.E69fs	NM_016147	NP_057231	Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	256_258	Poly-Glu.				protein demethylation		carboxylesterase activity|protein C-terminal methylesterase activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0	Breast(11;3.29e-05)					GGAATCATAGAGGAAGAAGAAGAAGAT	0.377			NA											10	113	---	---	---	---	NA	NA	NA	NA	NA
PAK1	5058	broad.mit.edu	37	11	77069990	77069992	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	CAT	CAT	-	-	CAT	CAT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr11:77069990_77069992delCAT	uc001oyh.3	-	6	1081_1083	c.548_550delATG	c.(547-552)GATGCT>GCT	p.D183del	PAK1_uc010rso.1_In_Frame_Del_p.D85del|PAK1_uc001oyg.3_In_Frame_Del_p.D183del|PAK1_uc001oyi.1_In_Frame_Del_p.D183del|PAK1_uc010rsn.1_5'UTR	NM_002576	NP_002567	Q13153	PAK1_HUMAN	p21-activated kinase 1 isoform 2	183	Interaction with CRIPAK.				apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)					GGTGGGGTAGcatcatcatcatc	0.429			NA											8	393	---	---	---	---	NA	NA	NA	NA	NA
LRP6	4040	broad.mit.edu	37	12	12336938	12336951	+	Frame_Shift_Del	DEL	CCAGGAGTTTGACC	CCAGGAGTTTGACC	-	rs142395866		TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	CCAGGAGTTTGACC	CCAGGAGTTTGACC	-	-	CCAGGAGTTTGACC	CCAGGAGTTTGACC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr12:12336938_12336951delCCAGGAGTTTGACC	uc001rah.3	-	5	1081_1094	c.939_952delGGTCAAACTCCTGG	c.(937-954)GGGGTCAAACTCCTGGAGfs	p.G313fs	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Frame_Shift_Del_p.G313fs	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	313_318	Extracellular (Potential).|EGF-like 1.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				TTTCCATTCTCCAGGAGTTTGACCCCAGTGGGGC	0.383			NA											9	188	---	---	---	---	NA	NA	NA	NA	NA
CHD8	57680	broad.mit.edu	37	14	21884031	21884031	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr14:21884031delT	uc001was.1	-	6	1009	c.915delA	c.(913-915)AAAfs	p.K305fs	CHD8_uc001war.1_Frame_Shift_Del_p.K201fs	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	584					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CCTCTGTATATTTTTTTCGCT	0.398			NA											8	582	---	---	---	---	NA	NA	NA	NA	NA
ZKSCAN2	342357	broad.mit.edu	37	16	25258540	25258557	+	In_Frame_Del	DEL	CTCCATGTTTTTCCTGCA	CTCCATGTTTTTCCTGCA	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	CTCCATGTTTTTCCTGCA	CTCCATGTTTTTCCTGCA	-	-	CTCCATGTTTTTCCTGCA	CTCCATGTTTTTCCTGCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr16:25258540_25258557delCTCCATGTTTTTCCTGCA	uc002dod.3	-	5	1367_1384	c.960_977delTGCAGGAAAAACATGGAG	c.(958-978)AGTGCAGGAAAAACATGGAGA>AGA	p.SAGKTW320del	ZKSCAN2_uc010vcl.1_In_Frame_Del_p.SAGKTW116del|ZKSCAN2_uc002doe.2_In_Frame_Del_p.SAGKTW320del	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	320_325					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		CTGCTGCTCTCTCCATGTTTTTCCTGCACTCCTTGCAG	0.459			NA											28	264	---	---	---	---	NA	NA	NA	NA	NA
NOB1	28987	broad.mit.edu	37	16	69782978	69782980	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	TCC	TCC	-	-	TCC	TCC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr16:69782978_69782980delTCC	uc002exs.2	-	6	583_585	c.567_569delGGA	c.(565-570)GAGGAA>GAA	p.189_190EE>E		NM_014062	NP_054781	Q9ULX3	NOB1_HUMAN	nin one binding protein	189_190	Poly-Glu.					nucleus	metal ion binding|protein binding				0						CCCGTTTTCTTCCTCCTCCTCCT	0.522			NA											9	376	---	---	---	---	NA	NA	NA	NA	NA
NF1	4763	broad.mit.edu	37	17	29665755	29665756	+	Frame_Shift_Ins	INS	-	-	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr17:29665755_29665756insA	uc002hgg.2	+	46	7186_7187	c.6853_6854insA	c.(6853-6855)TACfs	p.Y2285fs	NF1_uc002hgh.2_Frame_Shift_Ins_p.Y2264fs|NF1_uc010cso.2_Frame_Shift_Ins_p.Y473fs|NF1_uc010wbt.1_Intron|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2285					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.Y2285fs*5(4)|p.Y2285*(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACCTGACACTTACAACAGTCAA	0.312			NA	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			41	235	---	---	---	---	NA	NA	NA	NA	NA
GAS2L2	246176	broad.mit.edu	37	17	34071994	34071996	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	TCC	TCC	-	-	TCC	TCC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr17:34071994_34071996delTCC	uc002hjv.1	-	6	2548_2550	c.2520_2522delGGA	c.(2518-2523)GAGGAA>GAA	p.840_841EE>E		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	840_841					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ctcctttccttcctcctcctcct	0.527			NA											7	241	---	---	---	---	NA	NA	NA	NA	NA
TRIM25	7706	broad.mit.edu	37	17	54978862	54978862	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr17:54978862delT	uc002iut.2	-	4	1065	c.1005delA	c.(1003-1005)AAAfs	p.K335fs	TRIM25_uc010dcj.2_Frame_Shift_Del_p.K127fs	NM_005082	NP_005073	Q14258	TRI25_HUMAN	tripartite motif-containing 25	335	Interaction with influenza A virus NS1.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|response to virus	cell junction|cytosol|nucleus	sequence-specific DNA binding transcription factor activity|ubiquitin-protein ligase activity|zinc ion binding			lung(1)|breast(1)|skin(1)	3	Breast(9;6.15e-08)					GGTGGATGCCTTTTATCAGCT	0.547			NA											8	1353	---	---	---	---	NA	NA	NA	NA	NA
LILRB2	10288	broad.mit.edu	37	19	54780707	54780709	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	GAG	GAG	-	-	GAG	GAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr19:54780707_54780709delGAG	uc002qfb.2	-	10	1701_1703	c.1435_1437delCTC	c.(1435-1437)CTCdel	p.L479del	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_In_Frame_Del_p.L479del|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_In_Frame_Del_p.L478del|LILRB2_uc010yet.1_In_Frame_Del_p.L363del	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	479	Helical; (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ggatgaggaagaggaggaggagg	0.488			NA											9	343	---	---	---	---	NA	NA	NA	NA	NA
LOXL3	84695	broad.mit.edu	37	2	74763924	74763924	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr2:74763924delC	uc002smp.1	-	5	896	c.824delG	c.(823-825)GGCfs	p.G275fs	LOXL3_uc002smo.1_Intron|LOXL3_uc010ffm.1_Frame_Shift_Del_p.G275fs|LOXL3_uc002smq.1_Intron|LOXL3_uc010ffn.1_Intron	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	275	SRCR 2.					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						CACTGCAGGGCCCCCCCCAGG	0.647			NA											9	378	---	---	---	---	NA	NA	NA	NA	NA
TEKT4	150483	broad.mit.edu	37	2	95539829	95539830	+	Frame_Shift_Ins	INS	-	-	G	rs35031477		TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr2:95539829_95539830insG	uc002stw.1	+	3	782_783	c.689_690insG	c.(688-690)CCGfs	p.P230fs	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	230					cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						CAGGCTCATCCGTACTCCACCA	0.663			NA											7	295	---	---	---	---	NA	NA	NA	NA	NA
RGPD3	653489	broad.mit.edu	37	2	107041534	107041534	+	Frame_Shift_Del	DEL	A	A	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr2:107041534delA	uc010ywi.1	-	20	2946	c.2889delT	c.(2887-2889)TTTfs	p.F963fs		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	963					intracellular transport		binding			ovary(1)	1						TTGTTTGGCCAAAAATCACAC	0.398			NA											8	865	---	---	---	---	NA	NA	NA	NA	NA
FRG1B	284802	broad.mit.edu	37	20	29625899	29625900	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr20:29625899_29625900insAT	uc010ztl.1	+	2	85_86	c.53_54insAT	c.(52-54)AAAfs	p.K18fs	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGCTATGGAAAATATCTTGGTA	0.342			NA											10	214	---	---	---	---	NA	NA	NA	NA	NA
CTCFL	140690	broad.mit.edu	37	20	56099187	56099187	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr20:56099187delT	uc010gix.1	-	1	737	c.75delA	c.(73-75)AAAfs	p.K25fs	CTCFL_uc010giw.1_Frame_Shift_Del_p.K25fs|CTCFL_uc002xym.2_Frame_Shift_Del_p.K25fs|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjb.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjc.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjd.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gje.2_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjk.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjl.1_Frame_Shift_Del_p.K25fs	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein	25					cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CCTTCAGGCCTTTTTCCGGCA	0.502			NA											9	1367	---	---	---	---	NA	NA	NA	NA	NA
PLAC4	191585	broad.mit.edu	37	21	42551433	42551433	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr21:42551433delG	uc002yyz.2	-	1	5734	c.123delC	c.(121-123)CCCfs	p.P41fs	BACE2_uc002yyw.2_Intron|BACE2_uc002yyx.2_Intron|BACE2_uc002yyy.2_Intron	NM_182832	NP_878252	Q8WY50	PLAC4_HUMAN	placenta-specific 4	41				P -> H (in Ref. 1; AAG23170).							0		Prostate(19;2.29e-06)				GACGGTGTCTGGGGTGAGTGA	0.517			NA											17	64	---	---	---	---	NA	NA	NA	NA	NA
MBNL1	4154	broad.mit.edu	37	3	152132832	152132832	+	Frame_Shift_Del	DEL	A	A	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr3:152132832delA	uc003ezm.2	+	2	1066	c.277delA	c.(277-279)ATGfs	p.M93fs	MBNL1_uc003ezh.2_Frame_Shift_Del_p.M93fs|MBNL1_uc003ezi.2_Frame_Shift_Del_p.M93fs|MBNL1_uc003ezj.2_Frame_Shift_Del_p.M36fs|MBNL1_uc003ezl.2_Frame_Shift_Del_p.M93fs|MBNL1_uc003ezp.2_Frame_Shift_Del_p.M93fs|MBNL1_uc003ezn.2_Frame_Shift_Del_p.M93fs|MBNL1_uc003ezo.2_Frame_Shift_Del_p.M93fs|MBNL1_uc010hvp.2_Frame_Shift_Del_p.M1fs	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	93					embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GCAGAAGAACATGGCCATGTT	0.463			NA											46	221	---	---	---	---	NA	NA	NA	NA	NA
OTOP1	133060	broad.mit.edu	37	4	4204225	4204229	+	Frame_Shift_Del	DEL	TTGAG	TTGAG	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	TTGAG	TTGAG	-	-	TTGAG	TTGAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr4:4204225_4204229delTTGAG	uc003ghp.1	-	4	706_710	c.676_680delCTCAA	c.(676-681)CTCAATfs	p.L226fs		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	226_227					biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTTGTGCTCATTGAGTTGGTGCTTT	0.502			NA											7	365	---	---	---	---	NA	NA	NA	NA	NA
MAML3	55534	broad.mit.edu	37	4	140811064	140811072	+	Splice_Site	DEL	TGCTGCTGC	TGCTGCTGC	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	TGCTGCTGC	TGCTGCTGC	-	-	TGCTGCTGC	TGCTGCTGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr4:140811064_140811072delTGCTGCTGC	uc003ihz.1	-	3	2265	c.1513_splice	c.e3-1	p.Q505_splice	MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					TGAGtgctgttgctgctgctgctgctgct	0.263			NA											7	238	---	---	---	---	NA	NA	NA	NA	NA
PAPD7	11044	broad.mit.edu	37	5	6755013	6755014	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	AC	AC	-	-	AC	AC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr5:6755013_6755014delAC	uc003jdx.1	+	13	1713_1714	c.1584_1585delAC	c.(1582-1587)AAACACfs	p.K528fs	PAPD7_uc011cmn.1_Frame_Shift_Del_p.K518fs|PAPD7_uc010itl.1_Frame_Shift_Del_p.K348fs	NM_006999	NP_008930	Q5XG87	PAPD7_HUMAN	DNA polymerase sigma	528_529					cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1						GGAGGAAAAAACACACACACAC	0.653	NSCLC(7;212 333 5667 23379 46547)		NA											7	192	---	---	---	---	NA	NA	NA	NA	NA
SLC22A4	6583	broad.mit.edu	37	5	131676327	131676327	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr5:131676327delT	uc003kwq.2	+	9	1679	c.1514delT	c.(1513-1515)CTTfs	p.L505fs	uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	505	Helical; Name=12; (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	ATCCTCACCCTTTTTTTCCCT	0.418			NA											10	647	---	---	---	---	NA	NA	NA	NA	NA
VDAC1	7416	broad.mit.edu	37	5	133316639	133316639	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr5:133316639delT	uc003kyp.1	-	6	431	c.332delA	c.(331-333)AATfs	p.N111fs	VDAC1_uc003kyq.1_Frame_Shift_Del_p.N111fs|VDAC1_uc003kyr.1_Frame_Shift_Del_p.N111fs	NM_003374	NP_003365	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	111	Beta stranded.				apoptosis|interspecies interaction between organisms	mitochondrial nucleoid|mitochondrial outer membrane|plasma membrane|pore complex	porin activity|protein binding|voltage-gated anion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GATTTTAGCATTTTTTTTCCT	0.403	NSCLC(127;1776 1806 35523 41489 48154)		NA											7	294	---	---	---	---	NA	NA	NA	NA	NA
HSP90AB1	3326	broad.mit.edu	37	6	44221052	44221052	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr6:44221052delT	uc003oxa.1	+	11	2086	c.2002delT	c.(2002-2004)TTTfs	p.F668fs	HSP90AB1_uc011dvr.1_Frame_Shift_Del_p.F658fs|HSP90AB1_uc003oxb.1_Frame_Shift_Del_p.F668fs|HSP90AB1_uc011dvs.1_Frame_Shift_Del_p.F488fs|HSP90AB1_uc003oxc.1_Frame_Shift_Del_p.F306fs	NM_007355	NP_031381	P08238	HS90B_HUMAN	heat shock 90kDa protein 1, beta	668					axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding			lung(3)|breast(1)	4	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATCTTCTGGCTTTTCCCTTGA	0.527			NA											9	1724	---	---	---	---	NA	NA	NA	NA	NA
TDRD6	221400	broad.mit.edu	37	6	46660414	46660415	+	Frame_Shift_Ins	INS	-	-	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr6:46660414_46660415insA	uc003oyj.2	+	1	4549_4550	c.4549_4550insA	c.(4549-4551)GAAfs	p.E1517fs	TDRD6_uc010jze.2_Frame_Shift_Ins_p.E1511fs	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1517					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			GTATAATCCAGAAAAAAAAATG	0.351			NA											8	237	---	---	---	---	NA	NA	NA	NA	NA
SCIN	85477	broad.mit.edu	37	7	12692267	12692269	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	TCA	TCA	-	-	TCA	TCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr7:12692267_12692269delTCA	uc003ssn.3	+	16	2285_2287	c.2075_2077delTCA	c.(2074-2079)GTCATC>GTC	p.I694del	SCIN_uc010ktt.2_RNA|SCIN_uc003sso.3_In_Frame_Del_p.I447del	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1	694	Ca(2+)-dependent actin binding.				actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		ACACCAATTGTCATCATAAAACA	0.404			NA											39	261	---	---	---	---	NA	NA	NA	NA	NA
NPM2	10361	broad.mit.edu	37	8	21892020	21892021	+	Splice_Site	INS	-	-	A			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr8:21892020_21892021insA	uc003xab.2	+	7	1190	c.532_splice	c.e7-1	p.K178_splice	NPM2_uc003xac.2_Splice_Site_p.K178_splice|NPM2_uc003xad.2_Splice_Site_p.K178_splice|NPM2_uc003xae.2_Splice_Site_p.K178_splice|NPM2_uc003xaf.2_Splice_Site_p.E122_splice	NM_182795	NP_877724	Q86SE8	NPM2_HUMAN	nucleoplasmin 2						chromatin remodeling|embryo development|oocyte differentiation|positive regulation of meiosis|regulation of exit from mitosis|single fertilization	cytoplasmic chromatin|nuclear chromatin	histone binding|nucleic acid binding				0				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		TTGGTTCCCAGAAAAAAAAGCT	0.292			NA											7	727	---	---	---	---	NA	NA	NA	NA	NA
ASTN2	23245	broad.mit.edu	37	9	119976989	119976991	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chr9:119976989_119976991delCAG	uc004bjs.1	-	3	762_764	c.661_663delCTG	c.(661-663)CTGdel	p.L221del	ASTN2_uc004bjr.1_In_Frame_Del_p.L221del|ASTN2_uc004bjt.1_In_Frame_Del_p.L221del	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	221	Helical; (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CGGTGAACACCAGCAGCAGCAGC	0.601			NA											10	199	---	---	---	---	NA	NA	NA	NA	NA
ATXN3L	92552	broad.mit.edu	37	X	13337469	13337469	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7553-01A-21D-2036-08	TCGA-97-7553-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	354e2e65-84fe-4304-960d-a17e78eadc66	caaf6b26-7264-4cab-b984-e406075c7f33	g.chrX:13337469delT	uc010ned.2	-	1	1050	c.585delA	c.(583-585)AAAfs	p.K195fs		NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	195					protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity			lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						GTTTTACTAATTTTTTTCCAT	0.383			NA											9	468	---	---	---	---	NA	NA	NA	NA	NA
