#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GLCCI1	113263	hgsc.bcm.edu	37	7	8124622	8124622	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr7:8124622C>T	ENST00000223145.5	+	7	1830	c.1273C>T	c.(1273-1275)Cga>Tga	p.R425*		NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	425						cytoplasm (GO:0005737)		p.R425*(1)		endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		GGGATGTGAGCGAGTGAAGGT	0.453																																					p.R425X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1273T	7						.						136.0	137.0	137.0					7																	8124622		2203	4300	6503	8091147	SO:0001587	stop_gained	113263	exon7			BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.1273C>T	7.37:g.8124622C>T	ENSP00000223145:p.Arg425*	Somatic		Capture	SOLID	Phase_I	8091147	NM_138426	A4D103|Q96FD0	Nonsense_Mutation	SNP	ENST00000223145.5	37	CCDS34601.1	.	.	.	.	.	.	.	.	.	.	C	43	10.414238	0.99401	.	.	ENSG00000106415	ENST00000223145	.	.	.	5.22	4.33	0.51752	.	0.062472	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.0336	15.5783	0.76410	0.1389:0.8611:0.0:0.0	.	.	.	.	X	425	.	ENSP00000223145:R425X	R	+	1	2	GLCCI1	8091147	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.011000	0.64011	1.553000	0.49476	0.655000	0.94253	CGA		0.453	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324672.1	NM_138426	
TRRAP	8295	hgsc.bcm.edu	37	7	98550994	98550994	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr7:98550994G>A	ENST00000359863.4	+	39	5856	c.5647G>A	c.(5647-5649)Gga>Aga	p.G1883R	TRRAP_ENST00000355540.3_Missense_Mutation_p.G1865R|TRRAP_ENST00000446306.3_Missense_Mutation_p.G1864R	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1883					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.G1883R(1)|p.G1865R(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CAAGTACAGCGGACACTTGCT	0.587																																					p.G1865R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5593A	7						.						121.0	95.0	104.0					7																	98550994		2203	4300	6503	98388930	SO:0001583	missense	8295	exon38			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.5647G>A	7.37:g.98550994G>A	ENSP00000352925:p.Gly1883Arg	Somatic		Capture	SOLID	Phase_I	98388930	NM_003496	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	32	5.142909	0.94560	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.63417	-0.04;-0.04	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.82235	0.4993	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.83697	0.0180	10	0.87932	D	0	.	20.1184	0.97949	0.0:0.0:1.0:0.0	.	1865;1604;1883	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	R	1883;1865;1863	ENSP00000352925:G1883R;ENSP00000347733:G1865R	ENSP00000347733:G1865R	G	+	1	0	TRRAP	98388930	1.000000	0.71417	0.660000	0.29694	0.771000	0.43674	9.869000	0.99810	2.769000	0.95229	0.655000	0.94253	GGA		0.587	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
ZNF394	84124	hgsc.bcm.edu	37	7	99096405	99096405	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr7:99096405C>T	ENST00000337673.6	-	2	720	c.517G>A	c.(517-519)Gac>Aac	p.D173N	ZNF394_ENST00000394177.3_5'UTR|ZNF394_ENST00000426306.2_Intron|ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	173	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D173N(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CGTGCTGGGTCCAGGCGCTCC	0.592																																					p.D173N	Ovarian(24;589 697 9939 12704 40742)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G517A	7						.						118.0	91.0	100.0					7																	99096405		2203	4300	6503	98934341	SO:0001583	missense	84124	exon2			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.517G>A	7.37:g.99096405C>T	ENSP00000337363:p.Asp173Asn	Somatic		Capture	SOLID	Phase_I	98934341	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	ENST00000337673.6	37	CCDS5666.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.994156	0.54041	.	.	ENSG00000160908	ENST00000337673	T	0.02525	4.26	4.31	4.31	0.51392	Krueppel-associated box (4);	0.322570	0.22592	N	0.058069	T	0.05410	0.0143	L	0.28192	0.835	0.31071	N	0.713025	D	0.63046	0.992	P	0.61070	0.883	T	0.11203	-1.0597	10	0.39692	T	0.17	.	8.3485	0.32288	0.0:0.8969:0.0:0.1031	.	173	Q53GI3	ZN394_HUMAN	N	173	ENSP00000337363:D173N	ENSP00000337363:D173N	D	-	1	0	ZNF394	98934341	0.003000	0.15002	0.089000	0.20774	0.194000	0.23727	1.209000	0.32357	2.700000	0.92200	0.563000	0.77884	GAC		0.592	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
CST9	128822	hgsc.bcm.edu	37	20	23584292	23584292	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr20:23584292T>C	ENST00000376971.3	-	2	346	c.335A>G	c.(334-336)aAc>aGc	p.N112S		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	112						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.N112S(1)		central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					AAAAGGGCAGTTGTCAATGTC	0.488																																					p.N112S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A335G	20						.						217.0	197.0	204.0					20																	23584292		2203	4300	6503	23532292	SO:0001583	missense	128822	exon2			AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.335A>G	20.37:g.23584292T>C	ENSP00000366170:p.Asn112Ser	Somatic		Capture	SOLID	Phase_I	23532292	NM_001008693	B2RP76|Q8TD53	Missense_Mutation	SNP	ENST00000376971.3	37	CCDS33450.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.811133	0.32053	.	.	ENSG00000173335	ENST00000376971	T	0.13901	2.55	2.43	-1.45	0.08828	Proteinase inhibitor I25, cystatin (1);	0.456574	0.16313	N	0.219936	T	0.23014	0.0556	M	0.66439	2.03	0.09310	N	1	D	0.69078	0.997	D	0.69824	0.966	T	0.14559	-1.0468	10	0.49607	T	0.09	.	0.2726	0.00234	0.218:0.1573:0.2455:0.3792	.	112	Q5W186	CST9_HUMAN	S	112	ENSP00000366170:N112S	ENSP00000366170:N112S	N	-	2	0	CST9	23532292	0.387000	0.25188	0.019000	0.16419	0.047000	0.14425	-0.002000	0.12924	-0.371000	0.08004	-0.379000	0.06801	AAC		0.488	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1	
GNAS	2778	hgsc.bcm.edu	37	20	57484615	57484615	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr20:57484615G>T	ENST00000371085.3	+	9	1123	c.699G>T	c.(697-699)aaG>aaT	p.K233N	GNAS_ENST00000265620.7_Missense_Mutation_p.K218N|GNAS_ENST00000306090.10_Missense_Mutation_p.K219N|GNAS_ENST00000354359.7_Missense_Mutation_p.K234N|GNAS_ENST00000371102.4_Missense_Mutation_p.K862N|GNAS_ENST00000371100.4_Missense_Mutation_p.K876N|GNAS_ENST00000371095.3_Missense_Mutation_p.K219N|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	233					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.K233N(1)|p.K876N(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			AACGCCGCAAGTGGATCCAGT	0.552			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.K219N	Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G657T	20						.						128.0	105.0	112.0					20																	57484615		2203	4300	6503	56918010	SO:0001583	missense	2778	exon8			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.699G>T	20.37:g.57484615G>T	ENSP00000360126:p.Lys233Asn	Somatic		Capture	SOLID	Phase_I	56918010	NM_080426	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841046	0.71488	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.63	-0.501	0.12008	.	0.000000	0.85682	D	0.000000	D	0.95111	0.8416	H	0.96142	3.775	0.80722	D	1	P;P;P;P	0.49090	0.537;0.537;0.481;0.919	P;B;B;P	0.57425	0.487;0.313;0.209;0.82	D	0.94022	0.7293	10	0.87932	D	0	.	9.5805	0.39484	0.5003:0.0:0.4997:0.0	.	233;234;218;876	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	N	876;862;219;233;234;218;219	ENSP00000360141:K876N;ENSP00000360143:K862N;ENSP00000360136:K219N;ENSP00000360126:K233N;ENSP00000346328:K234N;ENSP00000265620:K218N;ENSP00000304472:K219N	ENSP00000265620:K218N	K	+	3	2	GNAS	56918010	0.992000	0.36948	0.998000	0.56505	0.907000	0.53573	0.490000	0.22403	0.071000	0.16664	0.655000	0.94253	AAG		0.552	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
NRXN3	9369	hgsc.bcm.edu	37	14	80328212	80328212	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr14:80328212G>A	ENST00000557594.1	+	6	2772	c.1819G>A	c.(1819-1821)Gcc>Acc	p.A607T	NRXN3_ENST00000556003.1_3'UTR|NRXN3_ENST00000428277.2_Missense_Mutation_p.A429T|NRXN3_ENST00000281127.7_Missense_Mutation_p.A402T|NRXN3_ENST00000554719.1_Missense_Mutation_p.A1031T|NRXN3_ENST00000335750.5_Missense_Mutation_p.A1031T	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	607					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.A429T(1)|p.A1031T(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAGCAACTCCGCCCAGAGCAA	0.527																																					p.A402T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1204A	14						.						91.0	85.0	87.0					14																	80328212		2203	4300	6503	79397965	SO:0001583	missense	9369	exon6			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1819G>A	14.37:g.80328212G>A	ENSP00000451672:p.Ala607Thr	Somatic		Capture	SOLID	Phase_I	79397965	NM_138970	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	37		.	.	.	.	.	.	.	.	.	.	G	18.15	3.560649	0.65538	.	.	ENSG00000021645	ENST00000330071;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	T;T;T;T;T	0.70986	-0.53;-0.53;1.03;1.23;0.99	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.83289	0.5222	M	0.64170	1.965	0.46241	D	0.998945	D;P;D;D	0.89917	1.0;0.842;0.965;0.999	D;B;P;D	0.83275	0.996;0.214;0.766;0.988	T	0.80913	-0.1170	9	.	.	.	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	429;402;607;1031	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	T	1613;1031;1031;607;402;429	ENSP00000451648:A1031T;ENSP00000338349:A1031T;ENSP00000451672:A607T;ENSP00000281127:A402T;ENSP00000394426:A429T	.	A	+	1	0	NRXN3	79397965	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.788000	0.95919	0.650000	0.86243	GCC		0.527	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
PLIN3	10226	hgsc.bcm.edu	37	19	4844732	4844732	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr19:4844732C>T	ENST00000221957.4	-	7	1084	c.908G>A	c.(907-909)aGc>aAc	p.S303N	PLIN3_ENST00000592528.1_Missense_Mutation_p.S291N|PLIN3_ENST00000585479.1_Missense_Mutation_p.S303N	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	303					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)		p.S303N(1)		cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	CTGGTTCCAGCTGAGCCACAT	0.617																																					p.S291N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G872A	19						.						42.0	35.0	37.0					19																	4844732		2203	4300	6503	4795732	SO:0001583	missense	10226	exon7			AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.908G>A	19.37:g.4844732C>T	ENSP00000221957:p.Ser303Asn	Somatic		Capture	SOLID	Phase_I	4795732	NM_001164194	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389028	0.25118	.	.	ENSG00000105355	ENST00000221957	T	0.18960	2.18	4.37	-7.03	0.01584	.	0.701948	0.13437	N	0.387992	T	0.09598	0.0236	N	0.24115	0.695	0.09310	N	0.999999	B;B;B	0.10296	0.001;0.003;0.001	B;B;B	0.12156	0.004;0.004;0.007	T	0.26087	-1.0113	10	0.24483	T	0.36	-15.3958	7.5813	0.27965	0.0:0.258:0.2:0.542	.	303;120;303	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	N	303	ENSP00000221957:S303N	ENSP00000221957:S303N	S	-	2	0	PLIN3	4795732	0.001000	0.12720	0.230000	0.23976	0.983000	0.72400	-0.092000	0.11129	-1.112000	0.02984	0.561000	0.74099	AGC		0.617	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817	
RAD23A	5886	hgsc.bcm.edu	37	19	13058819	13058819	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr19:13058819C>T	ENST00000586534.1	+	2	291	c.230C>T	c.(229-231)aCc>aTc	p.T77I	RAD23A_ENST00000592268.1_Missense_Mutation_p.T77I|RAD23A_ENST00000541222.1_5'UTR|RAD23A_ENST00000588826.2_3'UTR|RAD23A_ENST00000316856.3_Missense_Mutation_p.T77I			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	77	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)	p.T77I(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						GTCATGGTGACCAAGGTGGGT	0.567								Nucleotide excision repair (NER)																													p.T77I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C230T	19						.						143.0	136.0	138.0					19																	13058819		2203	4300	6503	12919819	SO:0001583	missense	5886	exon2				CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.230C>T	19.37:g.13058819C>T	ENSP00000467024:p.Thr77Ile	Somatic		Capture	SOLID	Phase_I	12919819	NM_005053	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	37	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395192	0.83011	.	.	ENSG00000179262	ENST00000316856	T	0.72167	-0.63	4.84	4.84	0.62591	Ubiquitin supergroup (1);Ubiquitin (2);	0.064366	0.64402	D	0.000005	D	0.83073	0.5175	M	0.74546	2.27	0.80722	D	1	D;D;D	0.63046	0.974;0.989;0.992	D;D;D	0.67231	0.911;0.95;0.949	D	0.85442	0.1155	10	0.66056	D	0.02	-28.6643	16.7139	0.85393	0.0:1.0:0.0:0.0	.	77;94;77	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	I	77	ENSP00000321365:T77I	ENSP00000321365:T77I	T	+	2	0	RAD23A	12919819	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.100000	0.76989	2.222000	0.72286	0.650000	0.86243	ACC		0.567	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	
ZNF577	84765	hgsc.bcm.edu	37	19	52376404	52376404	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr19:52376404G>T	ENST00000301399.5	-	7	1204	c.839C>A	c.(838-840)tCt>tAt	p.S280Y	ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000420592.1_Missense_Mutation_p.S221Y|ZNF577_ENST00000451628.2_Missense_Mutation_p.S221Y	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S273Y(1)		breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TGCCTTCTGAGAAAAGGCTTT	0.473																																					p.S280Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C839A	19						.						73.0	68.0	70.0					19																	52376404		2203	4300	6503	57068216	SO:0001583	missense	84765	exon7			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.839C>A	19.37:g.52376404G>T	ENSP00000301399:p.Ser280Tyr	Somatic		Capture	SOLID	Phase_I	57068216	NM_032679	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	37	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	7.536	0.659659	0.14645	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	2.86	-1.46	0.08800	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07234	0.0183	L	0.56769	1.78	0.09310	N	1	P;P	0.48911	0.917;0.886	B;B	0.41236	0.351;0.241	T	0.29822	-0.9999	9	0.27082	T	0.32	.	2.7125	0.05179	0.1121:0.3313:0.3885:0.1681	.	280;221	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	Y	280;221;221;280	ENSP00000301399:S280Y;ENSP00000413476:S221Y;ENSP00000389652:S221Y;ENSP00000404509:S280Y	ENSP00000301399:S280Y	S	-	2	0	ZNF577	57068216	0.000000	0.05858	0.001000	0.08648	0.254000	0.26022	-1.045000	0.03528	0.029000	0.15352	0.591000	0.81541	TCT		0.473	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679	
VN1R2	317701	hgsc.bcm.edu	37	19	53762133	53762133	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr19:53762133C>A	ENST00000341702.3	+	1	589	c.505C>A	c.(505-507)Cac>Aac	p.H169N		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	169					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)	p.H169N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		TTTGTATGCACACAGGGTAGG	0.453																																					p.H169N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C505A	19						.						44.0	46.0	45.0					19																	53762133		2203	4300	6503	58453945	SO:0001583	missense	317701	exon1			AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.505C>A	19.37:g.53762133C>A	ENSP00000351244:p.His169Asn	Somatic		Capture	SOLID	Phase_I	58453945	NM_173856	A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	37	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	C	6.762	0.509446	0.12883	.	.	ENSG00000196131	ENST00000341702	T	0.10477	2.87	2.94	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.17109	0.0411	L	0.53617	1.68	0.09310	N	1	P	0.51240	0.943	P	0.53722	0.733	T	0.10268	-1.0637	9	0.87932	D	0	.	4.9268	0.13898	0.0:0.7206:0.0:0.2794	.	169	Q8NFZ6	VN1R2_HUMAN	N	169	ENSP00000351244:H169N	ENSP00000351244:H169N	H	+	1	0	VN1R2	58453945	0.011000	0.17503	0.018000	0.16275	0.011000	0.07611	0.510000	0.22723	0.834000	0.34852	0.596000	0.82720	CAC		0.453	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
NEFM	4741	hgsc.bcm.edu	37	8	24775851	24775851	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr8:24775851G>T	ENST00000221166.5	+	3	3265	c.2483G>T	c.(2482-2484)gGc>gTc	p.G828V	NEFM_ENST00000437366.2_Missense_Mutation_p.G789V|NEFM_ENST00000518131.1_Missense_Mutation_p.G610V|NEFM_ENST00000433454.2_Missense_Mutation_p.G452V|NEFM_ENST00000521540.1_3'UTR			P07197	NFM_HUMAN	neurofilament, medium polypeptide	828	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)	p.G828V(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		gaggagaaagGCGTTGTCACC	0.493																																					p.G452V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1355T	8						.						64.0	63.0	63.0					8																	24775851		2203	4300	6503	24831756	SO:0001583	missense	4741	exon3			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.2483G>T	8.37:g.24775851G>T	ENSP00000221166:p.Gly828Val	Somatic		Capture	SOLID	Phase_I	24831756	NM_001105541	B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	ENST00000221166.5	37	CCDS6046.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214647	0.39102	.	.	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366;ENST00000433454	D;D;D;D	0.94931	-2.01;-1.97;-1.88;-3.56	4.63	4.63	0.57726	.	0.000000	0.44285	D	0.000477	D	0.92779	0.7704	L	0.40543	1.245	0.80722	D	1	P;D	0.59767	0.731;0.986	B;P	0.48873	0.231;0.593	D	0.93481	0.6827	10	0.87932	D	0	.	13.265	0.60128	0.0:0.1594:0.8406:0.0	.	610;828	E7EMV2;P07197	.;NFM_HUMAN	V	828;610;789;452	ENSP00000221166:G828V;ENSP00000427872:G610V;ENSP00000410137:G789V;ENSP00000412295:G452V	ENSP00000221166:G828V	G	+	2	0	NEFM	24831756	0.996000	0.38824	0.997000	0.53966	0.991000	0.79684	2.731000	0.47343	2.114000	0.64651	0.467000	0.42956	GGC		0.493	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382	
PHTF1	10745	hgsc.bcm.edu	37	1	114247312	114247312	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:114247312C>T	ENST00000369604.1	-	14	2262	c.1779G>A	c.(1777-1779)tgG>tgA	p.W593*	PHTF1_ENST00000393357.2_Nonsense_Mutation_p.W593*|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369598.1_Nonsense_Mutation_p.W548*|PHTF1_ENST00000369600.1_Nonsense_Mutation_p.W540*|PHTF1_ENST00000369596.2_Nonsense_Mutation_p.W540*|PHTF1_ENST00000357783.2_Nonsense_Mutation_p.W593*			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	593					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W593*(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGTGATAACCATATTTTAA	0.358																																					p.W593X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1779A	1						.						81.0	86.0	84.0					1																	114247312		2203	4300	6503	114048835	SO:0001587	stop_gained	10745	exon13			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1779G>A	1.37:g.114247312C>T	ENSP00000358617:p.Trp593*	Somatic		Capture	SOLID	Phase_I	114048835	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Nonsense_Mutation	SNP	ENST00000369604.1	37	CCDS861.1	.	.	.	.	.	.	.	.	.	.	C	44	10.632256	0.99441	.	.	ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0138	19.6271	0.95682	0.0:1.0:0.0:0.0	.	.	.	.	X	548;593;540;548;540;593;593	.	ENSP00000350428:W593X	W	-	3	0	PHTF1	114048835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.645000	0.89757	0.591000	0.81541	TGG		0.358	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
PRDM2	7799	hgsc.bcm.edu	37	1	14108337	14108337	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:14108337C>G	ENST00000235372.7	+	8	4903	c.4047C>G	c.(4045-4047)caC>caG	p.H1349Q	PRDM2_ENST00000311066.5_Missense_Mutation_p.H1349Q|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.H1148Q|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.H1148Q	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.H1349Q(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CGGAGTTGCACAAACATATCC	0.448																																					p.H1148Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3444G	1						.						117.0	114.0	115.0					1																	14108337		2203	4300	6503	13980924	SO:0001583	missense	7799	exon3			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4047C>G	1.37:g.14108337C>G	ENSP00000235372:p.His1349Gln	Somatic		Capture	SOLID	Phase_I	13980924	NM_001007257	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.916933	0.52546	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.12147	2.8;2.71;2.72;2.72	6.17	4.31	0.51392	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.21631	0.0521	N	0.19112	0.55	0.47511	D	0.999449	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.02042	-1.1224	10	0.59425	D	0.04	.	11.4233	0.49996	0.0:0.8524:0.0:0.1476	.	1207;1349;1349	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	Q	1349;1349;1349;1148;1148	ENSP00000235372:H1349Q;ENSP00000312352:H1349Q;ENSP00000411103:H1148Q;ENSP00000341621:H1148Q	ENSP00000235372:H1349Q	H	+	3	2	PRDM2	13980924	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.337000	0.52120	0.925000	0.37094	-0.137000	0.14449	CAC		0.448	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
NRAS	4893	hgsc.bcm.edu	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	A	rs11554290	byFrequency	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:115256529T>A	ENST00000369535.4	-	3	435	c.182A>T	c.(181-183)cAa>cTa	p.Q61L		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61L			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-1	.	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	c.A182T	1						.						180.0	156.0	164.0					1																	115256529		2203	4300	6503	115058052	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>T	1.37:g.115256529T>A	ENSP00000358548:p.Gln61Leu	Somatic		Capture	SOLID	Phase_I	115058052	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.844732	0.91197	.	.	ENSG00000213281	ENST00000369535	D	0.83992	-1.79	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.92446	0.7602	H	0.96748	3.875	0.80722	D	1	D	0.55800	0.973	P	0.61533	0.89	D	0.94664	0.7851	10	0.72032	D	0.01	.	15.0132	0.71565	0.0:0.0:0.0:1.0	.	61	P01111	RASN_HUMAN	L	61	ENSP00000358548:Q61L	ENSP00000358548:Q61L	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
LY9	4063	hgsc.bcm.edu	37	1	160784533	160784533	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:160784533G>A	ENST00000263285.6	+	4	1084	c.1054G>A	c.(1054-1056)Gtc>Atc	p.V352I	LY9_ENST00000392203.4_Missense_Mutation_p.V352I|LY9_ENST00000368037.5_Missense_Mutation_p.V352I|LY9_ENST00000368040.1_Missense_Mutation_p.V4I|LY9_ENST00000368041.2_Missense_Mutation_p.V312I|LY9_ENST00000341032.4_Missense_Mutation_p.V352I			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	352	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.V352I(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CATGACACATGTCACCCTGCT	0.582																																					p.V352I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1054A	1						.						42.0	40.0	40.0					1																	160784533		2203	4300	6503	159051157	SO:0001583	missense	4063	exon4			L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.1054G>A	1.37:g.160784533G>A	ENSP00000263285:p.Val352Ile	Somatic		Capture	SOLID	Phase_I	159051157	NM_002348	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	37	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	G	8.820	0.937291	0.18206	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000368040;ENST00000263285;ENST00000542780;ENST00000392203;ENST00000368037;ENST00000368036;ENST00000368035	T;T;T;T	0.14391	4.68;2.51;4.68;2.51	2.83	-5.66	0.02451	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.01320	0.0043	N	0.11560	0.145	0.09310	N	1	B;B;B;B;B;B;B	0.25850	0.029;0.031;0.029;0.012;0.057;0.136;0.037	B;B;B;B;B;B;B	0.22152	0.004;0.008;0.008;0.004;0.027;0.038;0.011	T	0.41233	-0.9520	9	0.32370	T	0.25	-0.034	3.8363	0.08896	0.2798:0.0:0.2919:0.4282	.	352;4;312;312;352;352;352	B4E0J5;Q5VYI1;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;.;LY9_HUMAN	I	352;352;4;352;352;312;312;254;4	ENSP00000342921:V352I;ENSP00000357019:V4I;ENSP00000263285:V352I;ENSP00000357014:V4I	ENSP00000263285:V352I	V	+	1	0	LY9	159051157	0.000000	0.05858	0.001000	0.08648	0.970000	0.65996	-1.694000	0.01915	-2.176000	0.00770	-0.253000	0.11424	GTC		0.582	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
NAV1	89796	hgsc.bcm.edu	37	1	201752711	201752711	+	Silent	SNP	G	G	A	rs144457633		TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:201752711G>A	ENST00000367296.4	+	7	2955	c.2535G>A	c.(2533-2535)ccG>ccA	p.P845P	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Silent_p.P858P|NAV1_ENST00000295624.6_Silent_p.P845P|NAV1_ENST00000367295.1_Silent_p.P454P|NAV1_ENST00000367297.4_Silent_p.P845P|NAV1_ENST00000469130.1_3'UTR|NAV1_ENST00000367300.3_Silent_p.P845P	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	845					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.P845P(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CCCCCAGTCCGGCACCCATCC	0.547													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17461	0.0		0.0	False		,,,				2504	0.0				p.P454P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1362A	1						.	G	,	2,4404	4.2+/-10.8	0,2,2201	138.0	146.0	143.0		1362,2535	-9.9	0.7	1	dbSNP_134	143	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	NAV1	NM_001167738.1,NM_020443.4	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	454/1484,845/1878	201752711	2,13004	2203	4300	6503	200019334	SO:0001819	synonymous_variant	89796	exon5			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.2535G>A	1.37:g.201752711G>A		Somatic		Capture	SOLID	Phase_I	200019334	NM_001167738	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	8.861	0.946921	0.18356	4.54E-4	0.0	ENSG00000134369	ENST00000430015	.	.	.	5.33	-9.9	0.00461	.	.	.	.	.	T	0.42471	0.1204	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49224	-0.8962	4	.	.	.	-16.1826	5.5588	0.17131	0.2989:0.0859:0.4788:0.1364	.	.	.	.	S	403	.	.	G	+	1	0	NAV1	200019334	0.000000	0.05858	0.663000	0.29738	0.960000	0.62799	-2.804000	0.00759	-1.755000	0.01320	-1.340000	0.01251	GGC		0.547	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
ELF3	1999	hgsc.bcm.edu	37	1	201984395	201984395	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:201984395T>C	ENST00000359651.3	+	8	4252	c.1060T>C	c.(1060-1062)Ttt>Ctt	p.F354L	ELF3_ENST00000367284.5_Missense_Mutation_p.F354L|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367283.3_Missense_Mutation_p.F354L					E74-like factor 3 (ets domain transcription factor, epithelial-specific )									p.F354L(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						CGTCTACAAGTTTGGCAAAAA	0.547																																					p.F354L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1060C	1						.						83.0	84.0	84.0					1																	201984395		2203	4300	6503	200251018	SO:0001583	missense	1999	exon9			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.1060T>C	1.37:g.201984395T>C	ENSP00000352673:p.Phe354Leu	Somatic		Capture	SOLID	Phase_I	200251018	NM_001114309		Missense_Mutation	SNP	ENST00000359651.3	37	CCDS1419.1	.	.	.	.	.	.	.	.	.	.	T	34	5.329061	0.95733	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044	T;T;T	0.35421	1.31;1.31;1.31	4.61	4.61	0.57282	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.66597	0.2805	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75221	-0.3394	10	0.87932	D	0	.	13.1767	0.59630	0.0:0.0:0.0:1.0	.	354	P78545	ELF3_HUMAN	L	354;354;354;331	ENSP00000352673:F354L;ENSP00000356253:F354L;ENSP00000356252:F354L	ENSP00000311348:F331L	F	+	1	0	ELF3	200251018	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.836000	0.86788	1.961000	0.56991	0.454000	0.30748	TTT		0.547	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
CNTN2	6900	hgsc.bcm.edu	37	1	205027763	205027763	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:205027763G>T	ENST00000331830.4	+	5	743	c.459G>T	c.(457-459)ttG>ttT	p.L153F		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	153	Ig-like C2-type 2.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.L153F(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGGTGATGTTGCCCTGTAACC	0.597																																					p.L153F	Melanoma(183;2548 2817 37099 41192)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G459T	1						.						46.0	45.0	45.0					1																	205027763		2203	4300	6503	203294386	SO:0001583	missense	6900	exon5			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.459G>T	1.37:g.205027763G>T	ENSP00000330633:p.Leu153Phe	Somatic		Capture	SOLID	Phase_I	203294386	NM_005076	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	37	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371333	0.42003	.	.	ENSG00000184144	ENST00000331830	T	0.09445	2.98	4.8	1.75	0.24633	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.158492	0.29286	N	0.012581	T	0.16385	0.0394	M	0.66297	2.02	0.45899	D	0.998741	B;B;P	0.41450	0.17;0.17;0.75	B;B;P	0.50754	0.312;0.312;0.649	T	0.04140	-1.0974	10	0.66056	D	0.02	.	1.5574	0.02587	0.2347:0.2558:0.3787:0.1308	.	153;153;44	A1L3A3;Q02246;Q68DA2	.;CNTN2_HUMAN;.	F	153	ENSP00000330633:L153F	ENSP00000330633:L153F	L	+	3	2	CNTN2	203294386	0.031000	0.19500	0.993000	0.49108	0.952000	0.60782	-0.083000	0.11286	0.420000	0.25954	-0.263000	0.10527	TTG		0.597	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
MACF1	23499	hgsc.bcm.edu	37	1	39801196	39801196	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:39801196A>G	ENST00000372915.3	+	36	9038	c.8951A>G	c.(8950-8952)gAg>gGg	p.E2984G	MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.E2979G|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.E1419G|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.E3016G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2984					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.E1419G(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGAAGAGGGAGGTGATTGTA	0.418																																					p.E1419G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4256G	1						.						64.0	65.0	65.0					1																	39801196		2203	4300	6503	39573783	SO:0001583	missense	23499	exon1			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.8951A>G	1.37:g.39801196A>G	ENSP00000362006:p.Glu2984Gly	Somatic		Capture	SOLID	Phase_I	39573783	NM_033044	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	4.215	0.038730	0.08148	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.69040	-0.37;0.68	5.41	2.83	0.33086	.	1.548280	0.04014	N	0.298629	T	0.53110	0.1776	N	0.24115	0.695	0.09310	N	0.999995	B	0.19583	0.037	B	0.16722	0.016	T	0.41288	-0.9517	10	0.52906	T	0.07	.	4.3736	0.11260	0.6795:0.1894:0.1311:0.0	.	2984	Q9UPN3	MACF1_HUMAN	G	2984;1419	ENSP00000362006:E2984G;ENSP00000289893:E1419G	ENSP00000289893:E1419G	E	+	2	0	MACF1	39573783	0.032000	0.19561	0.001000	0.08648	0.297000	0.27493	1.398000	0.34554	0.253000	0.21552	0.383000	0.25322	GAG		0.418	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
NFYC	4802	hgsc.bcm.edu	37	1	41223825	41223825	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:41223825G>T	ENST00000308733.5	+	5	426	c.420G>T	c.(418-420)gaG>gaT	p.E140D	MIR30C1_ENST00000385227.1_RNA|NFYC_ENST00000440226.3_Missense_Mutation_p.E140D|NFYC_ENST00000456393.2_Missense_Mutation_p.E140D|NFYC_ENST00000425457.2_Missense_Mutation_p.E140D|NFYC_ENST00000427410.2_Missense_Mutation_p.E102D|NFYC_ENST00000372652.1_Missense_Mutation_p.E140D|NFYC_ENST00000372654.1_Missense_Mutation_p.E140D|NFYC_ENST00000372653.1_Missense_Mutation_p.E140D|NFYC_ENST00000372651.1_Missense_Mutation_p.E140D|NFYC_ENST00000447388.3_Missense_Mutation_p.E140D			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	140					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.E140D(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			CTCCTGCCGAGCCAGTCCAGT	0.587																																					p.E140D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G420T	1						.						50.0	42.0	45.0					1																	41223825		2203	4300	6503	40996412	SO:0001583	missense	4802	exon6			U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.420G>T	1.37:g.41223825G>T	ENSP00000312617:p.Glu140Asp	Somatic		Capture	SOLID	Phase_I	40996412	NM_014223	B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Missense_Mutation	SNP	ENST00000308733.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.77|15.77	2.932803|2.932803	0.52866|0.52866	.|.	.|.	ENSG00000066136|ENSG00000066136	ENST00000414185|ENST00000427410;ENST00000447388;ENST00000425457;ENST00000456393;ENST00000372658;ENST00000372655;ENST00000372654;ENST00000372653;ENST00000372669;ENST00000372652;ENST00000372651;ENST00000440226;ENST00000525290;ENST00000416859;ENST00000308733	.|T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.44482	.|2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;0.92;1.47;2.2	5.6|5.6	4.68|4.68	0.58851|0.58851	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.45796|0.45796	0.1360|0.1360	N|N	0.16567|0.16567	0.415|0.415	0.58432|0.58432	D|D	0.999995|0.999995	.|D;D;D;P;D;D;D;B	.|0.64830	.|0.974;0.99;0.994;0.956;0.99;0.974;0.974;0.07	.|D;D;D;P;D;D;D;B	.|0.73380	.|0.953;0.98;0.97;0.899;0.98;0.953;0.953;0.042	T|T	0.39522|0.39522	-0.9610|-0.9610	5|10	.|0.33141	.|T	.|0.24	.|.	12.6502|12.6502	0.56757|0.56757	0.0809:0.0:0.9191:0.0|0.0809:0.0:0.9191:0.0	.|.	.|102;46;140;140;140;140;140;140	.|B4DW63;B4DVS8;Q13952;Q5T6K9;Q13952-3;F8VWM3;Q13952-2;B4DUS6	.|.;.;NFYC_HUMAN;.;.;.;.;.	S|D	23|102;140;140;140;38;38;140;140;140;140;140;140;139;108;140	.|ENSP00000408315:E102D;ENSP00000404427:E140D;ENSP00000396620:E140D;ENSP00000408867:E140D;ENSP00000361738:E140D;ENSP00000361737:E140D;ENSP00000361754:E140D;ENSP00000361736:E140D;ENSP00000361734:E140D;ENSP00000414299:E140D;ENSP00000436710:E139D;ENSP00000409219:E108D;ENSP00000312617:E140D	.|ENSP00000312617:E140D	A|E	+|+	1|3	0|2	NFYC|NFYC	40996412|40996412	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.908000|0.908000	0.53690|0.53690	3.201000|3.201000	0.51059|0.51059	1.372000|1.372000	0.46190|0.46190	0.561000|0.561000	0.74099|0.74099	GCC|GAG		0.587	NFYC-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000020802.1	NM_014223	
ORC1	4998	hgsc.bcm.edu	37	1	52861741	52861741	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:52861741G>T	ENST00000371568.3	-	5	916	c.698C>A	c.(697-699)gCc>gAc	p.A233D	ORC1_ENST00000371566.1_Missense_Mutation_p.A233D	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	233					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.A233D(1)		breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCTCTTTCTGGCTCTTGGGGT	0.483																																					p.A233D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C698A	1						.						91.0	92.0	92.0					1																	52861741		2203	4300	6503	52634329	SO:0001583	missense	4998	exon5				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.698C>A	1.37:g.52861741G>T	ENSP00000360623:p.Ala233Asp	Somatic		Capture	SOLID	Phase_I	52634329	NM_001190818	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292266	0.59976	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.59772	0.24;0.24	4.37	4.37	0.52481	.	0.159801	0.56097	D	0.000033	T	0.72510	0.3469	M	0.72894	2.215	0.42466	D	0.992809	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.983	T	0.75513	-0.3291	10	0.66056	D	0.02	-14.5656	12.0137	0.53301	0.0843:0.0:0.9157:0.0	.	233;233	B7Z8H0;Q13415	.;ORC1_HUMAN	D	233	ENSP00000360623:A233D;ENSP00000360621:A233D	ENSP00000360621:A233D	A	-	2	0	ORC1	52634329	1.000000	0.71417	0.413000	0.26509	0.723000	0.41478	4.153000	0.58118	2.418000	0.82041	0.591000	0.81541	GCC		0.483	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153	
MSH4	4438	hgsc.bcm.edu	37	1	76276420	76276420	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:76276420A>G	ENST00000263187.3	+	4	731	c.627A>G	c.(625-627)atA>atG	p.I209M		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	209					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.I209M(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						CTTTGGAAATAATAATGTCAA	0.289								Mismatch excision repair (MMR)																													p.I209M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A627G	1						.						66.0	69.0	68.0					1																	76276420		2203	4297	6500	76049008	SO:0001583	missense	4438	exon4			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.627A>G	1.37:g.76276420A>G	ENSP00000263187:p.Ile209Met	Somatic		Capture	SOLID	Phase_I	76049008	NM_002440	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	37	CCDS670.1	.	.	.	.	.	.	.	.	.	.	A	17.53	3.412134	0.62511	.	.	ENSG00000057468	ENST00000263187	D	0.89939	-2.59	4.64	4.64	0.57946	DNA mismatch repair protein MutS, connector (2);	0.043376	0.85682	D	0.000000	D	0.92896	0.7740	M	0.82823	2.61	0.42866	D	0.994121	D	0.61697	0.99	D	0.64321	0.924	D	0.93801	0.7101	10	0.62326	D	0.03	-2.6674	14.7795	0.69754	1.0:0.0:0.0:0.0	.	209	O15457	MSH4_HUMAN	M	209	ENSP00000263187:I209M	ENSP00000263187:I209M	I	+	3	3	MSH4	76049008	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.551000	0.45820	2.024000	0.59613	0.383000	0.25322	ATA		0.289	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
KCNK2	3776	hgsc.bcm.edu	37	1	215408405	215408405	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr1:215408405C>A	ENST00000444842.2	+	7	1348	c.1198C>A	c.(1198-1200)Ctg>Atg	p.L400M	KCNK2_ENST00000391894.2_Missense_Mutation_p.L385M|KCNK2_ENST00000391895.2_Missense_Mutation_p.L396M	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	400	Essential for chloroform and halothane sensitivity. {ECO:0000250}.|Required for basal channel activity. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.L385M(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	GCCTCCCTTACTGAAGACTGA	0.488																																					p.L396M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1186A	1						.						131.0	128.0	129.0					1																	215408405		2203	4300	6503	213475028	SO:0001583	missense	3776	exon7			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1198C>A	1.37:g.215408405C>A	ENSP00000394033:p.Leu400Met	Somatic		Capture	SOLID	Phase_I	213475028	NM_001017424	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.516484	0.27123	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.20332	2.08;2.09;2.08	5.72	2.61	0.31194	.	0.333575	0.29348	N	0.012404	T	0.08179	0.0204	N	0.08118	0	0.24599	N	0.99379	B;B;B	0.28584	0.071;0.138;0.216	B;B;B	0.27608	0.081;0.06;0.081	T	0.31081	-0.9956	10	0.16896	T	0.51	.	5.1082	0.14794	0.3468:0.4732:0.0:0.18	.	385;400;396	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	M	396;385;400	ENSP00000375765:L396M;ENSP00000375764:L385M;ENSP00000394033:L400M	ENSP00000375764:L385M	L	+	1	2	KCNK2	213475028	0.966000	0.33281	0.999000	0.59377	0.997000	0.91878	1.714000	0.37961	0.785000	0.33685	0.561000	0.74099	CTG		0.488	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
SERGEF	26297	hgsc.bcm.edu	37	11	17809888	17809888	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr11:17809888G>T	ENST00000265965.5	-	11	1272	c.1121C>A	c.(1120-1122)gCc>gAc	p.A374D	SERGEF_ENST00000528200.1_3'UTR	NM_012139.2	NP_036271.1	Q9UGK8	SRGEF_HUMAN	secretion regulating guanine nucleotide exchange factor	374					negative regulation of protein secretion (GO:0050709)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.A374D(1)		autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(5)|lung(5)	12						CGGCTTTGGGGCCCAGACGTT	0.612																																					p.A374D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1121A	11						.						64.0	53.0	57.0					11																	17809888		2200	4293	6493	17766464	SO:0001583	missense	26297	exon11			AJ243950	CCDS7828.1	11p14.3	2006-03-09			ENSG00000129158	ENSG00000129158			17499	protein-coding gene	gene with protein product		606051				10571079, 12459492	Standard	NM_012139		Approved	DelGEF, Gnefr	uc001mnm.3	Q9UGK8	OTTHUMG00000166420	ENST00000265965.5:c.1121C>A	11.37:g.17809888G>T	ENSP00000265965:p.Ala374Asp	Somatic		Capture	SOLID	Phase_I	17766464	NM_012139	Q9UGK9	Missense_Mutation	SNP	ENST00000265965.5	37	CCDS7828.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.660|6.660	0.490314|0.490314	0.12702|0.12702	.|.	.|.	ENSG00000129158|ENSG00000129158	ENST00000265965|ENST00000529151	D|.	0.84944|.	-1.92|.	5.41|5.41	4.5|4.5	0.54988|0.54988	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);|.	0.545902|.	0.20937|.	N|.	0.082987|.	T|T	0.55529|0.55529	0.1926|0.1926	L|L	0.41906|0.41906	1.305|1.305	0.80722|0.80722	D|D	1|1	D|.	0.54772|.	0.968|.	P|.	0.55303|.	0.773|.	T|T	0.51810|0.51810	-0.8658|-0.8658	10|5	0.17832|.	T|.	0.49|.	0.0|0.0	11.0499|11.0499	0.47880|0.47880	0.1619:0.0:0.8381:0.0|0.1619:0.0:0.8381:0.0	.|.	374|.	Q9UGK8|.	SRGEF_HUMAN|.	D|T	374|238	ENSP00000265965:A374D|.	ENSP00000265965:A374D|.	A|P	-|-	2|1	0|0	SERGEF|SERGEF	17766464|17766464	0.998000|0.998000	0.40836|0.40836	0.997000|0.997000	0.53966|0.53966	0.341000|0.341000	0.28922|0.28922	1.689000|1.689000	0.37700|0.37700	1.277000|1.277000	0.44412|0.44412	0.561000|0.561000	0.74099|0.74099	GCC|CCC		0.612	SERGEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389538.1	NM_012139	
C11orf24	53838	hgsc.bcm.edu	37	11	68030224	68030224	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr11:68030224G>T	ENST00000304271.6	-	4	641	c.239C>A	c.(238-240)aCa>aAa	p.T80K	C11orf24_ENST00000533310.1_Missense_Mutation_p.T80K|C11orf24_ENST00000530166.1_5'UTR	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	80						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T80K(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						GTCCTCTGTTGTGACTTCCAT	0.522																																					p.T80K	NSCLC(21;855 905 4198 36694)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C239A	11						.						130.0	102.0	112.0					11																	68030224		2200	4294	6494	67786800	SO:0001583	missense	53838	exon4			AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.239C>A	11.37:g.68030224G>T	ENSP00000307264:p.Thr80Lys	Somatic		Capture	SOLID	Phase_I	67786800	NM_022338	Q9H2K4	Missense_Mutation	SNP	ENST00000304271.6	37	CCDS8180.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497105	0.44352	.	.	ENSG00000171067	ENST00000304271;ENST00000533310	T	0.42900	0.96	3.96	1.91	0.25777	.	0.452839	0.16453	N	0.213752	T	0.46756	0.1409	L	0.48642	1.525	0.09310	N	1	D;D	0.65815	0.995;0.99	P;P	0.61592	0.891;0.891	T	0.17715	-1.0360	10	0.46703	T	0.11	-0.6797	4.9084	0.13809	0.1199:0.2194:0.6607:0.0	.	80;80	E9PRU5;Q96F05	.;CK024_HUMAN	K	80	ENSP00000307264:T80K	ENSP00000307264:T80K	T	-	2	0	C11orf24	67786800	0.014000	0.17966	0.003000	0.11579	0.007000	0.05969	0.769000	0.26604	1.014000	0.39417	0.460000	0.39030	ACA		0.522	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394750.1	NM_022338	
WNT11	7481	hgsc.bcm.edu	37	11	75902769	75902769	+	Silent	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr11:75902769C>T	ENST00000322563.3	-	4	853	c.729G>A	c.(727-729)tcG>tcA	p.S243S	RP11-619A14.2_ENST00000527314.1_RNA	NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	243					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)	p.S243S(1)		breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						CCTTGGTGGCCGACAGGTATC	0.627																																					p.S243S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G729A	11						.						96.0	88.0	91.0					11																	75902769		2200	4292	6492	75580417	SO:0001819	synonymous_variant	7481	exon4			Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.729G>A	11.37:g.75902769C>T		Somatic		Capture	SOLID	Phase_I	75580417	NM_004626	B2R8Z6|Q14DE8|Q8WZ98	Silent	SNP	ENST00000322563.3	37	CCDS8242.1																																																																																				0.627	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626	
DSCAML1	57453	hgsc.bcm.edu	37	11	117376205	117376205	+	Missense_Mutation	SNP	C	C	T	rs369846579		TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr11:117376205C>T	ENST00000321322.6	-	9	2207	c.2206G>A	c.(2206-2208)Gcc>Acc	p.A736T	DSCAML1_ENST00000527706.1_Missense_Mutation_p.A466T	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	676	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.A736T(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTCACGGTGGCGGCTGCGTTG	0.617																																					p.A736T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2206A	11						.	C	THR/ALA	1,4401	2.1+/-5.4	0,1,2200	90.0	86.0	87.0		2206	4.9	1.0	11		87	0,8592		0,0,4296	no	missense	DSCAML1	NM_020693.2	58	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	736/2114	117376205	1,12993	2201	4296	6497	116881415	SO:0001583	missense	57453	exon9				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2206G>A	11.37:g.117376205C>T	ENSP00000315465:p.Ala736Thr	Somatic		Capture	SOLID	Phase_I	116881415	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	33	5.273059	0.95429	2.27E-4	0.0	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.72051	-0.62;-0.62	4.91	4.91	0.64330	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82783	0.5112	M	0.68952	2.095	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	D	0.84472	0.0600	9	0.66056	D	0.02	.	18.2851	0.90112	0.0:1.0:0.0:0.0	.	676	Q8TD84	DSCL1_HUMAN	T	466;736;443	ENSP00000434335:A466T;ENSP00000315465:A736T	ENSP00000315465:A736T	A	-	1	0	DSCAML1	116881415	1.000000	0.71417	0.966000	0.40874	0.928000	0.56348	7.651000	0.83577	2.541000	0.85698	0.491000	0.48974	GCC		0.617	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
MSH5	4439	hgsc.bcm.edu	37	6	31726618	31726618	+	Missense_Mutation	SNP	G	G	A	rs146419845		TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr6:31726618G>A	ENST00000375755.3	+	15	1578	c.1292G>A	c.(1291-1293)cGt>cAt	p.R431H	MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.R448H|MSH5_ENST00000395853.1_Missense_Mutation_p.R105H|MSH5_ENST00000375750.3_Missense_Mutation_p.R431H|MSH5_ENST00000375742.3_Missense_Mutation_p.R448H|MSH5_ENST00000375740.3_Missense_Mutation_p.R448H|MSH5_ENST00000375703.3_Missense_Mutation_p.R431H|RNU6-850P_ENST00000516934.1_RNA|MSH5_ENST00000431848.2_Missense_Mutation_p.R130H|MSH5_ENST00000534153.4_Missense_Mutation_p.R448H	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	431					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.R431H(1)		breast(1)|ovary(2)|skin(2)	5						CTGGACTCCCGTATTCCTTCA	0.507								Direct reversal of damage;Mismatch excision repair (MMR)																													p.R448H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1343A	6						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	108.0	104.0	105.0		1292,1343,1292,1292	5.4	0.5	6	dbSNP_134	105	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	MSH5	NM_002441.4,NM_025259.5,NM_172165.3,NM_172166.3	29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign	431/835,448/823,431/836,431/835	31726618	1,13005	2203	4300	6503	31834597	SO:0001583	missense	4439	exon15			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1292G>A	6.37:g.31726618G>A	ENSP00000364908:p.Arg431His	Somatic		Capture	SOLID	Phase_I	31834597	NM_025259	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	ENST00000375755.3	37	CCDS4720.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703126	0.48412	0.0	1.16E-4	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000450148;ENST00000431848;ENST00000395853	T;T;T;T;T;T;T;D;T	0.89810	1.55;1.55;1.55;1.55;1.55;1.55;1.55;-2.57;1.55	5.42	5.42	0.78866	DNA mismatch repair protein MutS, clamp (1);DNA mismatch repair protein MutS, core (3);	0.125598	0.56097	D	0.000035	T	0.62804	0.2458	N	0.11427	0.14	0.36084	D	0.842969	B;B;B;B;B	0.17268	0.003;0.007;0.009;0.002;0.021	B;B;B;B;B	0.12156	0.003;0.004;0.007;0.001;0.006	T	0.55302	-0.8162	9	0.14252	T	0.57	-9.6859	10.1909	0.43026	0.0904:0.0:0.9096:0.0	.	116;448;431;431;448	Q59EC5;O43196-4;O43196;O43196-2;O43196-3	.;.;MSH5_HUMAN;.;.	H	431;448;431;448;431;448;273;130;105	ENSP00000364908:R431H;ENSP00000364894:R448H;ENSP00000364903:R431H;ENSP00000431693:R448H;ENSP00000364855:R431H;ENSP00000364892:R448H;ENSP00000394971:R273H;ENSP00000416784:R130H;ENSP00000379194:R105H	ENSP00000364855:R431H	R	+	2	0	MSH5	31834597	0.995000	0.38212	0.535000	0.28026	0.952000	0.60782	4.725000	0.61979	2.557000	0.86248	0.591000	0.81541	CGT		0.507	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4		
TFAP2B	7021	hgsc.bcm.edu	37	6	50805803	50805803	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr6:50805803G>A	ENST00000393655.3	+	5	1106	c.937G>A	c.(937-939)Gaa>Aaa	p.E313K	TFAP2B_ENST00000263046.4_Missense_Mutation_p.E322K	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	313					aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E313K(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					CTCCCTGGTGGAAGGTAAGCA	0.488																																					p.E313K	Pancreas(116;1373 2332 5475 10752)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G937A	6						.						93.0	88.0	90.0					6																	50805803		2203	4300	6503	50913762	SO:0001583	missense	7021	exon5			X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.937G>A	6.37:g.50805803G>A	ENSP00000377265:p.Glu313Lys	Somatic		Capture	SOLID	Phase_I	50913762	NM_003221	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	ENST00000393655.3	37	CCDS4934.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073984	0.76415	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.98876	-5.2;-5.2	5.63	4.77	0.60923	Transcription factor AP-2, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98308	0.9439	M	0.93420	3.415	0.80722	D	1	B	0.31256	0.316	B	0.36666	0.23	D	0.99894	1.1142	10	0.87932	D	0	-15.2017	14.7238	0.69329	0.0695:0.0:0.9305:0.0	.	313	Q92481	AP2B_HUMAN	K	313;322	ENSP00000377265:E313K;ENSP00000263046:E322K	ENSP00000263046:E322K	E	+	1	0	TFAP2B	50913762	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.793000	0.99091	1.525000	0.49052	0.561000	0.74099	GAA		0.488	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3	NM_003221	
TP53	7157	hgsc.bcm.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R196X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-2	.	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	c.C586T	17	GRCh37	CM941329	TP53	M		.						102.0	91.0	94.0					17																	7578263		2203	4300	6503	7518988	SO:0001587	stop_gained	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Somatic		Capture	SOLID	Phase_I	7518988	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
WDR16	146845	hgsc.bcm.edu	37	17	9511527	9511527	+	Missense_Mutation	SNP	A	A	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr17:9511527A>T	ENST00000352665.5	+	7	914	c.845A>T	c.(844-846)aAa>aTa	p.K282I	WDR16_ENST00000396219.3_Missense_Mutation_p.K214I|WDR16_ENST00000299764.5_Missense_Mutation_p.K292I	NM_145054.4	NP_659491.4			WD repeat domain 16									p.K282I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CCTGGCTACAAACCCATCAAG	0.537																																					p.K282I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A845T	17						.						62.0	61.0	61.0					17																	9511527		2203	4300	6503	9452252	SO:0001583	missense	146845	exon7			AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.845A>T	17.37:g.9511527A>T	ENSP00000339449:p.Lys282Ile	Somatic		Capture	SOLID	Phase_I	9452252	NM_145054		Missense_Mutation	SNP	ENST00000352665.5	37	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	a	23.0	4.363046	0.82353	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;D;T	0.91124	2.35;-2.79;4.81	5.42	4.34	0.51931	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.086995	0.85682	D	0.000000	D	0.92473	0.7610	L	0.58810	1.83	0.40892	D	0.98408	D;D;D	0.63880	0.987;0.993;0.978	P;P;P	0.61477	0.889;0.889;0.736	D	0.91959	0.5577	10	0.52906	T	0.07	-17.5608	10.5026	0.44815	0.9221:0.0:0.0779:0.0	.	292;214;282	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	I	282;214;292	ENSP00000339449:K282I;ENSP00000379521:K214I;ENSP00000299764:K292I	ENSP00000299764:K292I	K	+	2	0	WDR16	9452252	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.720000	0.54933	1.007000	0.39238	0.456000	0.33151	AAA		0.537	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
EZH1	2145	hgsc.bcm.edu	37	17	40860050	40860050	+	Missense_Mutation	SNP	C	C	T	rs201655400		TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr17:40860050C>T	ENST00000428826.2	-	15	1707	c.1586G>A	c.(1585-1587)cGc>cAc	p.R529H	EZH1_ENST00000590783.1_5'UTR|EZH1_ENST00000435174.1_Missense_Mutation_p.R390H|EZH1_ENST00000585893.1_Missense_Mutation_p.R489H|EZH1_ENST00000592743.1_Missense_Mutation_p.R529H|EZH1_ENST00000590078.1_Missense_Mutation_p.R459H|EZH1_ENST00000415827.2_Missense_Mutation_p.R520H			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	529	CXC. {ECO:0000255|PROSITE- ProRule:PRU00970}.|Cys-rich.				anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)	p.R529H(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		GTCACAGGGGCGGTCTGGGTG	0.502																																					p.R529H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1586A	17						.						149.0	136.0	140.0					17																	40860050		2203	4300	6503	38113576	SO:0001583	missense	2145	exon15				CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.1586G>A	17.37:g.40860050C>T	ENSP00000404658:p.Arg529His	Somatic		Capture	SOLID	Phase_I	38113576	NM_001991	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	ENST00000428826.2	37	CCDS32659.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043753	0.55003	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	T;D;T	0.81659	-1.35;-1.52;-1.35	5.49	5.49	0.81192	.	0.046432	0.85682	D	0.000000	T	0.59729	0.2215	N	0.05510	-0.035	0.47737	D	0.999502	B;B;B;B;B	0.06786	0.0;0.001;0.001;0.001;0.001	B;B;B;B;B	0.08055	0.001;0.002;0.003;0.002;0.001	T	0.55964	-0.8057	10	0.31617	T	0.26	.	6.6237	0.22818	0.0:0.7995:0.0:0.2005	.	390;489;535;459;529	Q92800-5;Q92800-3;Q92800-2;Q92800-4;Q92800	.;.;.;.;EZH1_HUMAN	H	532;529;489;390	ENSP00000404658:R529H;ENSP00000407869:R489H;ENSP00000404071:R390H	ENSP00000264646:R532H	R	-	2	0	EZH1	38113576	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.991000	0.70602	2.865000	0.98341	0.655000	0.94253	CGC		0.502	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991	
MX1	4599	hgsc.bcm.edu	37	21	42812931	42812931	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr21:42812931C>T	ENST00000398600.2	+	11	1734	c.709C>T	c.(709-711)Ccc>Tcc	p.P237S	MX1_ENST00000455164.2_Missense_Mutation_p.P237S|MX1_ENST00000398598.3_Missense_Mutation_p.P237S|AP001610.5_ENST00000411427.1_RNA|MX1_ENST00000288383.6_Missense_Mutation_p.P214S	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	237	Dynamin-type G.|GTPase domain (Globular).				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P237S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GGAGGTGGACCCCGAGGGAGA	0.632																																					p.P237S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C709T	21						.						69.0	68.0	69.0					21																	42812931		2203	4300	6503	41734801	SO:0001583	missense	4599	exon11				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.709C>T	21.37:g.42812931C>T	ENSP00000381601:p.Pro237Ser	Somatic		Capture	SOLID	Phase_I	41734801	NM_001144925	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	ENST00000398600.2	37	CCDS13673.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923161	0.92319	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28	4.65	4.65	0.58169	Dynamin, GTPase domain (2);	0.000000	0.85682	D	0.000000	D	0.98817	0.9601	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99357	1.0916	10	0.62326	D	0.03	-23.6857	17.025	0.86443	0.0:1.0:0.0:0.0	.	237	P20591	MX1_HUMAN	S	237;237;237;214	ENSP00000381601:P237S;ENSP00000381599:P237S;ENSP00000410523:P237S;ENSP00000288383:P214S	ENSP00000288383:P214S	P	+	1	0	MX1	41734801	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	6.642000	0.74329	2.532000	0.85374	0.650000	0.86243	CCC		0.632	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195161.2		
FTO	79068	hgsc.bcm.edu	37	16	53878111	53878111	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr16:53878111G>A	ENST00000471389.1	+	4	1018	c.796G>A	c.(796-798)Gat>Aat	p.D266N	FTO_ENST00000394647.3_5'UTR	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	266	Fe2OG dioxygenase domain.				adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)	p.D266N(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						CGAAGGCAGGGATCCTGATAT	0.438																																					p.D266N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G796A	16						.						167.0	154.0	158.0					16																	53878111		2198	4300	6498	52435612	SO:0001583	missense	79068	exon4			BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.796G>A	16.37:g.53878111G>A	ENSP00000418823:p.Asp266Asn	Somatic		Capture	SOLID	Phase_I	52435612	NM_001080432	A2RUH1|B2RNS0|Q0P676|Q7Z785	Missense_Mutation	SNP	ENST00000471389.1	37	CCDS32448.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067619	0.55539	.	.	ENSG00000140718	ENST00000471389	T	0.67698	-0.28	5.81	4.67	0.58626	Alpha-ketoglutarate-dependent dioxygenase FTO, catalytic domain (1);	0.394189	0.30311	N	0.009907	T	0.58235	0.2108	L	0.41236	1.265	0.80722	D	1	B	0.16166	0.016	B	0.19946	0.027	T	0.55211	-0.8176	10	0.41790	T	0.15	-10.7864	14.0406	0.64672	0.0815:0.0:0.9185:0.0	.	266	Q9C0B1	FTO_HUMAN	N	266	ENSP00000418823:D266N	ENSP00000418823:D266N	D	+	1	0	FTO	52435612	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.581000	0.53914	2.756000	0.94617	0.655000	0.94253	GAT		0.438	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352196.1	NM_001080432	
SPG7	6687	hgsc.bcm.edu	37	16	89597098	89597098	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr16:89597098T>G	ENST00000268704.2	+	7	884	c.869T>G	c.(868-870)cTt>cGt	p.L290R	RNU7-117P_ENST00000516770.1_RNA|SPG7_ENST00000341316.2_Missense_Mutation_p.L290R	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	290					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.L290R(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		CAGAATCAGCTTAAAATGGCT	0.547																																					p.L290R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T869G	16						.						117.0	107.0	111.0					16																	89597098		2198	4300	6498	88124599	SO:0001583	missense	6687	exon7			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.869T>G	16.37:g.89597098T>G	ENSP00000268704:p.Leu290Arg	Somatic		Capture	SOLID	Phase_I	88124599	NM_003119	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	37	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.582603	0.86748	.	.	ENSG00000197912	ENST00000268704;ENST00000341316	T;T	0.41400	1.0;1.0	5.89	5.89	0.94794	Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	T	0.57213	0.2038	L	0.43152	1.355	0.80722	D	1	D;D	0.71674	0.985;0.998	P;D	0.69479	0.887;0.964	T	0.59134	-0.7511	10	0.72032	D	0.01	.	16.3109	0.82869	0.0:0.0:0.0:1.0	.	290;290	Q9UQ90;Q9UQ90-2	SPG7_HUMAN;.	R	290	ENSP00000268704:L290R;ENSP00000341157:L290R	ENSP00000268704:L290R	L	+	2	0	SPG7	88124599	1.000000	0.71417	0.932000	0.37286	0.949000	0.60115	6.050000	0.71063	2.257000	0.74773	0.460000	0.39030	CTT		0.547	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119	
SMAD4	4089	hgsc.bcm.edu	37	18	48591901	48591901	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr18:48591901A>G	ENST00000342988.3	+	9	1602	c.1064A>G	c.(1063-1065)gAc>gGc	p.D355G	SMAD4_ENST00000398417.2_Missense_Mutation_p.D355G|SMAD4_ENST00000588745.1_Missense_Mutation_p.D259G	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	355	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.D355G(2)|p.D355A(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGATACGTGGACCCTTCTGGA	0.428																																					p.D355G												SMAD4,large_intestine,colon,Substitution - Missense,0	.	41	Whole gene deletion(36)|Substitution - Missense(3)|Unknown(2)	pancreas(27)|large_intestine(5)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.A1064G	18						.						216.0	180.0	192.0					18																	48591901		2203	4300	6503	46845899	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1064A>G	18.37:g.48591901A>G	ENSP00000341551:p.Asp355Gly	Somatic		Capture	SOLID	Phase_I	46845899	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.016245	0.93404	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98060	-4.69;-4.69	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98845	0.9610	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99777	1.1026	10	0.87932	D	0	.	15.2431	0.73485	1.0:0.0:0.0:0.0	.	355	Q13485	SMAD4_HUMAN	G	355	ENSP00000341551:D355G;ENSP00000381452:D355G	ENSP00000341551:D355G	D	+	2	0	SMAD4	46845899	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.159000	0.94728	2.237000	0.73441	0.460000	0.39030	GAC		0.428	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
PCOLCE2	26577	hgsc.bcm.edu	37	3	142539838	142539838	+	Silent	SNP	G	G	A	rs377468452		TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr3:142539838G>A	ENST00000295992.3	-	8	1305	c.999C>T	c.(997-999)caC>caT	p.H333H	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.R254C	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	333	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.H333H(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						AGACTGTGGCGTGCAAACTCC	0.488																																					p.H333H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C999T	3						.	G		1,4405	2.1+/-5.4	0,1,2202	134.0	115.0	122.0		999	-10.8	0.1	3		122	0,8600		0,0,4300	no	coding-synonymous	PCOLCE2	NM_013363.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		333/416	142539838	1,13005	2203	4300	6503	144022528	SO:0001819	synonymous_variant	26577	exon8			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.999C>T	3.37:g.142539838G>A		Somatic		Capture	SOLID	Phase_I	144022528	NM_013363	B2RCH9|D3DNG4|Q9BRH3	Silent	SNP	ENST00000295992.3	37	CCDS3127.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456395	0.43634	2.27E-4	0.0	ENSG00000163710	ENST00000485766	T	0.21734	1.99	5.42	-10.8	0.00216	.	.	.	.	.	T	0.18087	0.0434	.	.	.	0.23872	N	0.996605	.	.	.	.	.	.	T	0.44667	-0.9313	6	0.59425	D	0.04	-16.3672	8.8854	0.35400	0.3594:0.2636:0.377:0.0	.	.	.	.	C	254	ENSP00000419842:R254C	ENSP00000419842:R254C	R	-	1	0	PCOLCE2	144022528	0.057000	0.20700	0.090000	0.20809	0.220000	0.24768	-0.484000	0.06528	-2.729000	0.00385	-1.105000	0.02106	CGC		0.488	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	G	rs121913416|rs121913400		TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr3:41266101C>G	ENST00000349496.5	+	3	378	c.98C>G	c.(97-99)tCt>tGt	p.S33C	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33C|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26C	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33C	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,biliary_tract,gallbladder,Substitution - Missense,+1	.	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98G	3						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	41241105	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>G	3.37:g.41266101C>G	ENSP00000344456:p.Ser33Cys	Somatic		Capture	SOLID	Phase_I	41241105	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381716	0.82792	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	C	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26C;ENSP00000385604:S33C;ENSP00000412219:S33C;ENSP00000379486:S33C;ENSP00000344456:S33C;ENSP00000411226:S26C;ENSP00000379488:S33C;ENSP00000409302:S33C;ENSP00000401599:S33C	ENSP00000344456:S33C	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
ATRIP	84126	hgsc.bcm.edu	37	3	48500766	48500766	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr3:48500766C>G	ENST00000320211.3	+	6	951	c.838C>G	c.(838-840)Ccc>Gcc	p.P280A	ATRIP_ENST00000346691.4_Missense_Mutation_p.P280A|ATRIP_ENST00000357105.6_Missense_Mutation_p.P153A|ATRIP_ENST00000412052.1_Missense_Mutation_p.P187A	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	280				P -> L (in Ref. 5; AAH14153). {ECO:0000305}.	DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P280A(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGATAGTAAGCCCCACAGTCT	0.413								Other conserved DNA damage response genes																													p.P280A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C838G	3						.						73.0	70.0	71.0					3																	48500766		2203	4300	6503	48475770	SO:0001583	missense	84126	exon6			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.838C>G	3.37:g.48500766C>G	ENSP00000323099:p.Pro280Ala	Somatic		Capture	SOLID	Phase_I	48475770	NM_130384	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	ENST00000320211.3	37	CCDS2768.1	.	.	.	.	.	.	.	.	.	.	C	8.567	0.879247	0.17395	.	.	ENSG00000164053	ENST00000421175;ENST00000320211;ENST00000346691;ENST00000357105;ENST00000412052	T;T;T;T;T	0.40756	1.72;1.6;1.59;1.02;1.61	5.39	-2.69	0.06022	.	1.431590	0.03853	N	0.272683	T	0.12305	0.0299	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29852	-0.9998	10	0.06625	T	0.88	0.9602	6.1891	0.20513	0.4623:0.1433:0.3944:0.0	.	280;280	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	A	187;280;280;153;187	ENSP00000406664:P187A;ENSP00000323099:P280A;ENSP00000302338:P280A;ENSP00000349620:P153A;ENSP00000400930:P187A	ENSP00000323099:P280A	P	+	1	0	ATRIP	48475770	0.025000	0.19082	0.273000	0.24645	0.930000	0.56654	0.133000	0.15912	-0.219000	0.10003	-0.375000	0.07067	CCC		0.413	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
PHF7	51533	hgsc.bcm.edu	37	3	52453875	52453875	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr3:52453875G>T	ENST00000327906.3	+	5	873	c.213G>T	c.(211-213)agG>agT	p.R71S	PHF7_ENST00000347025.2_Missense_Mutation_p.R71S	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7	71						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.R71S(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		TGCCTCAGAGGGGCCAGTCCA	0.502																																					p.R71S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G213T	3						.						36.0	38.0	37.0					3																	52453875		2203	4300	6503	52428915	SO:0001583	missense	51533	exon5			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495	ENST00000327906.3:c.213G>T	3.37:g.52453875G>T	ENSP00000333024:p.Arg71Ser	Somatic		Capture	SOLID	Phase_I	52428915	NM_016483	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	37	CCDS2854.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.25|15.25	2.778367|2.778367	0.49786|0.49786	.|.	.|.	ENSG00000010318|ENSG00000010318	ENST00000461861|ENST00000478707;ENST00000327906;ENST00000347025;ENST00000454052	.|T;T;T	.|0.70516	.|-0.49;-0.49;-0.49	5.87|5.87	3.03|3.03	0.35002|0.35002	.|.	.|0.105878	.|0.64402	.|D	.|0.000012	T|T	0.59390|0.59390	0.2190|0.2190	L|L	0.48260|0.48260	1.515|1.515	0.34350|0.34350	D|D	0.68976|0.68976	.|P;P	.|0.43938	.|0.822;0.822	.|B;B	.|0.40825	.|0.341;0.341	T|T	0.66432|0.66432	-0.5925|-0.5925	5|10	.|0.45353	.|T	.|0.12	-9.7721|-9.7721	5.8124|5.8124	0.18473|0.18473	0.1622:0.0:0.6848:0.153|0.1622:0.0:0.6848:0.153	.|.	.|71;71	.|A8K856;Q9BWX1	.|.;PHF7_HUMAN	V|S	31|71;71;71;36	.|ENSP00000419316:R71S;ENSP00000333024:R71S;ENSP00000246282:R71S	.|ENSP00000333024:R71S	G|R	+|+	2|3	0|2	PHF7|PHF7	52428915|52428915	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	1.243000|1.243000	0.32767|0.32767	0.832000|0.832000	0.34804|0.34804	0.655000|0.655000	0.94253|0.94253	GGG|AGG		0.502	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64527268	64527268	+	Silent	SNP	T	T	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr3:64527268T>A	ENST00000498707.1	-	34	5568	c.5226A>T	c.(5224-5226)gtA>gtT	p.V1742V	ADAMTS9_ENST00000295903.4_Silent_p.V1714V	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1742	GON. {ECO:0000255|PROSITE- ProRule:PRU00383}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1742V(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TAAGTCTTTTTACCTCCTTGC	0.383																																					p.V1742V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5226T	3						.						159.0	160.0	160.0					3																	64527268		2203	4300	6503	64502308	SO:0001819	synonymous_variant	56999	exon34			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5226A>T	3.37:g.64527268T>A		Somatic		Capture	SOLID	Phase_I	64502308	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	T	0.150	-1.092530	0.01858	.	.	ENSG00000163638	ENST00000481060	.	.	.	5.75	-11.5	0.00074	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.6833	0.00878	0.2445:0.1573:0.194:0.4042	.	.	.	.	L	798	.	.	X	-	2	2	ADAMTS9	64502308	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.645000	0.02000	-3.439000	0.00163	-1.235000	0.01560	TAA		0.383	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
TCTEX1D2	255758	hgsc.bcm.edu	37	3	196043017	196043017	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr3:196043017G>A	ENST00000325318.5	-	2	334	c.199C>T	c.(199-201)Cct>Tct	p.P67S	TM4SF19_ENST00000442633.1_3'UTR|TM4SF19-AS1_ENST00000452051.1_RNA|TM4SF19-AS1_ENST00000420226.1_RNA|RP11-447L10.1_ENST00000431391.1_Missense_Mutation_p.P67S|TM4SF19-AS1_ENST00000444939.1_RNA	NM_152773.4	NP_689986.2	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2	67								p.P67S(1)		breast(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	7	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		GTAAGCTGAGGCATTTCTTCT	0.373																																					p.P67S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C199T	3						.						136.0	124.0	128.0					3																	196043017		2203	4300	6503	197527414	SO:0001583	missense	255758	exon2			BC021177	CCDS33929.1	3q29	2010-07-19			ENSG00000213123	ENSG00000213123			28482	protein-coding gene	gene with protein product						12477932	Standard	NM_152773		Approved	MGC33212	uc003fwi.3	Q8WW35	OTTHUMG00000155672	ENST00000325318.5:c.199C>T	3.37:g.196043017G>A	ENSP00000324323:p.Pro67Ser	Somatic		Capture	SOLID	Phase_I	197527414	NM_152773	A6NCN5	Missense_Mutation	SNP	ENST00000325318.5	37	CCDS33929.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342924	0.24339	.	.	ENSG00000213123	ENST00000325318;ENST00000545438	T	0.27557	1.66	5.42	4.55	0.56014	.	0.098130	0.40554	U	0.001079	T	0.17577	0.0422	N	0.16903	0.455	0.80722	D	1	B	0.22276	0.067	B	0.25987	0.065	T	0.04090	-1.0978	10	0.06891	T	0.86	-29.2136	11.9106	0.52737	0.0847:0.0:0.9153:0.0	.	67	Q8WW35	TC1D2_HUMAN	S	67	ENSP00000324323:P67S	ENSP00000324323:P67S	P	-	1	0	TCTEX1D2	197527414	1.000000	0.71417	0.930000	0.37139	0.820000	0.46376	4.724000	0.61972	1.268000	0.44264	0.561000	0.74099	CCT		0.373	TCTEX1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341166.1	NM_152773	
ERC1	23085	hgsc.bcm.edu	37	12	1137345	1137345	+	Silent	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr12:1137345C>T	ENST00000397203.2	+	2	682	c.276C>T	c.(274-276)ggC>ggT	p.G92G	ERC1_ENST00000355446.5_Silent_p.G92G|ERC1_ENST00000546231.2_Silent_p.G92G|ERC1_ENST00000360905.4_Silent_p.G92G|ERC1_ENST00000589028.1_Silent_p.G92G|ERC1_ENST00000543086.3_Silent_p.G92G			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	92					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)	p.G92G(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TGACACTTGGCCGTTCTGGGG	0.483																																					p.G92G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C276T	12						.						126.0	121.0	123.0					12																	1137345		2203	4300	6503	1007606	SO:0001819	synonymous_variant	23085	exon2			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.276C>T	12.37:g.1137345C>T		Somatic		Capture	SOLID	Phase_I	1007606	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Silent	SNP	ENST00000397203.2	37	CCDS8508.1																																																																																				0.483	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
NEDD1	121441	hgsc.bcm.edu	37	12	97338448	97338448	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr12:97338448G>C	ENST00000266742.4	+	13	1868	c.1529G>C	c.(1528-1530)aGt>aCt	p.S510T	NEDD1_ENST00000457368.2_Missense_Mutation_p.S421T|NEDD1_ENST00000411739.2_Missense_Mutation_p.S421T|NEDD1_ENST00000429527.2_Missense_Mutation_p.S510T|NEDD1_ENST00000557644.1_Missense_Mutation_p.S517T	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	510					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)		p.S510T(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						GGTGCTGAAAGTGGAAATCTA	0.299																																					p.S510T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1529C	12						.						51.0	52.0	52.0					12																	97338448		2203	4299	6502	95862579	SO:0001583	missense	121441	exon13				CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.1529G>C	12.37:g.97338448G>C	ENSP00000266742:p.Ser510Thr	Somatic		Capture	SOLID	Phase_I	95862579	NM_152905	B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	37	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	G	0.425	-0.906105	0.02453	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000557644;ENST00000457368	T;T;T;T;T	0.49432	0.78;0.78;1.56;0.78;1.56	5.86	4.98	0.66077	.	0.472050	0.26026	N	0.026787	T	0.40670	0.1126	L	0.50333	1.59	0.27348	N	0.956323	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.28586	-1.0039	10	0.09843	T	0.71	.	14.8834	0.70550	0.0:0.8505:0.1495:0.0	.	517;510	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	T	510;510;421;517;421	ENSP00000266742:S510T;ENSP00000404978:S510T;ENSP00000411307:S421T;ENSP00000451211:S517T;ENSP00000407964:S421T	ENSP00000266742:S510T	S	+	2	0	NEDD1	95862579	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	3.064000	0.49986	1.482000	0.48325	-0.171000	0.13296	AGT		0.299	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1		
TGM7	116179	hgsc.bcm.edu	37	15	43574082	43574082	+	Silent	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr15:43574082G>A	ENST00000452443.2	-	9	1315	c.1311C>T	c.(1309-1311)gaC>gaT	p.D437D		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	437					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.D437D(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	TCTGGCGCTGGTCTGACCCCA	0.552																																					p.D437D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1311T	15						.						110.0	77.0	88.0					15																	43574082		2202	4299	6501	41361374	SO:0001819	synonymous_variant	116179	exon9			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.1311C>T	15.37:g.43574082G>A		Somatic		Capture	SOLID	Phase_I	41361374	NM_052955		Silent	SNP	ENST00000452443.2	37	CCDS32213.1																																																																																				0.552	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
SPG11	80208	hgsc.bcm.edu	37	15	44858069	44858069	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr15:44858069G>T	ENST00000261866.7	-	38	6998	c.6982C>A	c.(6982-6984)Cta>Ata	p.L2328I	SPG11_ENST00000427534.2_Intron|SPG11_ENST00000535302.2_Missense_Mutation_p.L2215I	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	2328					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.L2328I(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AACCGAGGTAGGGCCAGAATA	0.507																																					p.L2328I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6982A	15						.						61.0	44.0	50.0					15																	44858069		2198	4298	6496	42645361	SO:0001583	missense	80208	exon38				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.6982C>A	15.37:g.44858069G>T	ENSP00000261866:p.Leu2328Ile	Somatic		Capture	SOLID	Phase_I	42645361	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570566	0.65765	.	.	ENSG00000104133	ENST00000261866;ENST00000535302	T;T	0.77620	-1.11;-0.8	5.87	5.87	0.94306	.	0.230432	0.37623	N	0.002001	D	0.86908	0.6046	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.968;0.968	D	0.85642	0.1277	10	0.42905	T	0.14	.	13.9622	0.64188	0.0718:0.0:0.9282:0.0	.	2215;2328;2328	F5H3N6;C4B7M4;Q96JI7	.;.;SPTCS_HUMAN	I	2328;2215	ENSP00000261866:L2328I;ENSP00000445278:L2215I	ENSP00000261866:L2328I	L	-	1	2	SPG11	42645361	1.000000	0.71417	0.975000	0.42487	0.631000	0.37964	3.381000	0.52455	2.941000	0.99782	0.655000	0.94253	CTA		0.507	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
SECISBP2L	9728	hgsc.bcm.edu	37	15	49304971	49304971	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr15:49304971T>G	ENST00000559471.1	-	12	1868	c.1605A>C	c.(1603-1605)agA>agC	p.R535S	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.R490S	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	535							poly(A) RNA binding (GO:0044822)	p.R490S(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TTAAAGGTTTTCTATTAGTAG	0.358																																					p.R490S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1470C	15						.						96.0	102.0	100.0					15																	49304971		2197	4295	6492	47092263	SO:0001583	missense	9728	exon11			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1605A>C	15.37:g.49304971T>G	ENSP00000453854:p.Arg535Ser	Somatic		Capture	SOLID	Phase_I	47092263	NM_014701	Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	T	13.69	2.312650	0.40895	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.72051	-0.62	5.76	5.76	0.90799	.	0.105878	0.64402	D	0.000002	T	0.54415	0.1857	L	0.35414	1.06	0.41131	D	0.985885	P;P	0.38370	0.495;0.628	B;B	0.34489	0.057;0.184	T	0.54166	-0.8334	10	0.11485	T	0.65	.	11.1653	0.48539	0.0:0.0714:0.0:0.9286	.	535;490	Q93073;Q93073-2	SBP2L_HUMAN;.	S	490;535	ENSP00000261847:R490S	ENSP00000261847:R490S	R	-	3	2	SECISBP2L	47092263	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.949000	0.49074	2.202000	0.70862	0.528000	0.53228	AGA		0.358	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
TTC23	64927	hgsc.bcm.edu	37	15	99740216	99740216	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr15:99740216T>C	ENST00000394132.2	-	9	1484	c.667A>G	c.(667-669)Aca>Gca	p.T223A	TTC23_ENST00000394129.2_Missense_Mutation_p.T223A|TTC23_ENST00000394136.1_Missense_Mutation_p.T223A|TTC23_ENST00000558663.1_Missense_Mutation_p.T223A|TTC23_ENST00000394135.3_Missense_Mutation_p.T223A|TTC23_ENST00000558613.1_Missense_Mutation_p.T223A|TTC23_ENST00000394130.1_Missense_Mutation_p.T223A|TTC23_ENST00000262074.4_Missense_Mutation_p.T223A			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	223								p.T223A(1)		endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TCACGACTTGTTTCACCTTTA	0.428																																					p.T223A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A667G	15						.						227.0	201.0	209.0					15																	99740216		2197	4297	6494	97557739	SO:0001583	missense	64927	exon6				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.667A>G	15.37:g.99740216T>C	ENSP00000377690:p.Thr223Ala	Somatic		Capture	SOLID	Phase_I	97557739	NM_001040659	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	ENST00000394132.2	37	CCDS10379.2	.	.	.	.	.	.	.	.	.	.	T	10.02	1.237017	0.22711	.	.	ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129	T;T;T;T;T;T	0.76060	2.54;2.54;2.54;2.54;0.01;-0.99	5.87	2.28	0.28536	Tetratricopeptide-like helical (1);	0.275875	0.41294	D	0.000913	T	0.48003	0.1476	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26155	-1.0111	10	0.27785	T	0.31	-9.1396	5.0064	0.14289	0.0:0.1607:0.1553:0.684	.	223;223	Q5W5X9-2;Q5W5X9	.;TTC23_HUMAN	A	223	ENSP00000377690:T223A;ENSP00000377693:T223A;ENSP00000262074:T223A;ENSP00000377692:T223A;ENSP00000377688:T223A;ENSP00000457901:T223A	ENSP00000262074:T223A	T	-	1	0	TTC23	97557739	0.188000	0.23250	0.146000	0.22360	0.553000	0.35397	0.376000	0.20535	0.194000	0.20326	0.533000	0.62120	ACA		0.428	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303953.2	NM_022905	
TNIP2	79155	hgsc.bcm.edu	37	4	2746603	2746603	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr4:2746603C>T	ENST00000315423.7	-	4	813	c.727G>A	c.(727-729)Gcg>Acg	p.A243T	TNIP2_ENST00000503235.1_Intron|TNIP2_ENST00000505186.1_5'UTR|TNIP2_ENST00000510267.1_Missense_Mutation_p.A136T	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2									p.A243T(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTGAGCTGCGCATGGAGCCCC	0.582																																					p.A243T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G727A	4						.						54.0	53.0	53.0					4																	2746603		2203	4300	6503	2716401	SO:0001583	missense	79155	exon4			BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.727G>A	4.37:g.2746603C>T	ENSP00000321203:p.Ala243Thr	Somatic		Capture	SOLID	Phase_I	2716401	NM_024309		Missense_Mutation	SNP	ENST00000315423.7	37	CCDS3362.1	.	.	.	.	.	.	.	.	.	.	C	9.762	1.170438	0.21621	.	.	ENSG00000168884	ENST00000510267;ENST00000315423	T;T	0.44083	0.93;0.93	5.36	2.54	0.30619	TSG101 and ALIX binding domain of CEP55 (1);	0.659654	0.15545	N	0.256740	T	0.27559	0.0677	L	0.44542	1.39	0.19300	N	0.99997	B	0.17667	0.023	B	0.20577	0.03	T	0.13953	-1.0490	10	0.14656	T	0.56	-8.0672	2.9341	0.05809	0.2374:0.4292:0.2446:0.0888	.	243	Q8NFZ5	TNIP2_HUMAN	T	136;243	ENSP00000427613:A136T;ENSP00000321203:A243T	ENSP00000321203:A243T	A	-	1	0	TNIP2	2716401	0.040000	0.19996	0.002000	0.10522	0.343000	0.28985	1.756000	0.38390	1.403000	0.46800	0.555000	0.69702	GCG		0.582	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
STAG2	10735	hgsc.bcm.edu	37	X	123176443	123176443	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:123176443G>T	ENST00000371160.1	+	7	700	c.410G>T	c.(409-411)aGa>aTa	p.R137I	STAG2_ENST00000218089.9_Missense_Mutation_p.R137I|STAG2_ENST00000371157.3_Missense_Mutation_p.R137I|STAG2_ENST00000371145.3_Missense_Mutation_p.R137I|STAG2_ENST00000371144.3_Missense_Mutation_p.R137I|STAG2_ENST00000354548.5_Missense_Mutation_p.R68I|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	137					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.R137I(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GAAATGTTTAGACATATGCAG	0.313																																					p.R137I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G410T	X						.						73.0	70.0	71.0					X																	123176443		2203	4300	6503	123004124	SO:0001583	missense	10735	exon7			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.410G>T	X.37:g.123176443G>T	ENSP00000360202:p.Arg137Ile	Somatic		Capture	SOLID	Phase_I	123004124	NM_001042750	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383483	0.82792	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000435103;ENST00000371157;ENST00000371145;ENST00000371144;ENST00000428941;ENST00000435215	T;T;T;T;T;T;T	0.47177	1.84;0.85;1.44;1.44;1.44;1.84;1.44	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.68979	0.3060	M	0.74647	2.275	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.66847	0.947;0.921	T	0.68800	-0.5313	10	0.44086	T	0.13	-10.9567	18.9534	0.92649	0.0:0.0:1.0:0.0	.	137;137	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	I	137;137;68;137;137;137;137;137;137;137	ENSP00000218089:R137I;ENSP00000397265:R137I;ENSP00000346555:R68I;ENSP00000360202:R137I;ENSP00000360199:R137I;ENSP00000360187:R137I;ENSP00000360186:R137I	ENSP00000218089:R137I	R	+	2	0	STAG2	123004124	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.902000	0.87389	2.425000	0.82216	0.522000	0.50473	AGA		0.313	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
ZNF75D	7626	hgsc.bcm.edu	37	X	134421635	134421635	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:134421635T>C	ENST00000370766.3	-	7	3676	c.967A>G	c.(967-969)Aca>Gca	p.T323A	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Missense_Mutation_p.T228A	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	323					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T323A(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						ACACTGTGTGTATCACCAGGA	0.388																																					p.T323A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A967G	X						.						128.0	117.0	121.0					X																	134421635		2203	4299	6502	134249301	SO:0001583	missense	7626	exon6			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.967A>G	X.37:g.134421635T>C	ENSP00000359802:p.Thr323Ala	Somatic		Capture	SOLID	Phase_I	134249301	NM_007131	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	ENST00000370766.3	37	CCDS14648.1	.	.	.	.	.	.	.	.	.	.	T	0.155	-1.087503	0.01873	.	.	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.06449	3.3;3.32	2.84	0.219	0.15274	.	0.642469	0.12949	N	0.425960	T	0.03651	0.0104	L	0.27053	0.805	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.47156	-0.9139	10	0.15499	T	0.54	.	3.8436	0.08925	0.0:0.1444:0.4557:0.3999	.	323;228	P51815;A6NK62	ZN75D_HUMAN;.	A	323;228	ENSP00000359802:T323A;ENSP00000359800:T228A	ENSP00000359800:T228A	T	-	1	0	ZNF75D	134249301	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.001000	0.03690	-0.034000	0.13713	-0.537000	0.04273	ACA		0.388	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058415.1	NM_007131	
GEMIN8	54960	hgsc.bcm.edu	37	X	14027262	14027262	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:14027262G>A	ENST00000380523.4	-	5	817	c.499C>T	c.(499-501)Cgc>Tgc	p.R167C	GEMIN8_ENST00000398355.3_Missense_Mutation_p.R167C	NM_017856.2	NP_060326.1	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8	167					spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)		p.R167C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	9						CTGTCCAGGCGCTCTGCATCC	0.597																																					p.R167C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C499T	X						.						59.0	51.0	53.0					X																	14027262		2203	4300	6503	13937183	SO:0001583	missense	54960	exon4			BC020785	CCDS14159.1	Xp22	2010-03-16	2006-11-24	2006-11-24	ENSG00000046647	ENSG00000046647			26044	protein-coding gene	gene with protein product			"""family with sequence similarity 51, member A1"""	FAM51A1		16434402	Standard	NM_017856		Approved	FLJ20514	uc004cwd.3	Q9NWZ8	OTTHUMG00000021160	ENST00000380523.4:c.499C>T	X.37:g.14027262G>A	ENSP00000369895:p.Arg167Cys	Somatic		Capture	SOLID	Phase_I	13937183	NM_001042480	C4AMC4|Q2LJ66|Q6ZV27	Missense_Mutation	SNP	ENST00000380523.4	37	CCDS14159.1	.	.	.	.	.	.	.	.	.	.	.	11.06	1.528560	0.27299	.	.	ENSG00000046647	ENST00000380523;ENST00000398355;ENST00000332885	T;T;T	0.46063	0.88;0.88;0.88	5.65	4.74	0.60224	.	0.444555	0.27941	N	0.017234	T	0.52629	0.1746	L	0.50333	1.59	0.39933	D	0.974311	D	0.89917	1.0	D	0.63703	0.917	T	0.56908	-0.7901	10	0.87932	D	0	.	9.0957	0.36638	0.0:0.1326:0.6057:0.2617	.	167	Q9NWZ8	GEMI8_HUMAN	C	167	ENSP00000369895:R167C;ENSP00000381398:R167C;ENSP00000369894:R167C	ENSP00000369894:R167C	R	-	1	0	GEMIN8	13937183	1.000000	0.71417	0.898000	0.35279	0.043000	0.13939	2.634000	0.46528	2.397000	0.81536	0.600000	0.82982	CGC		0.597	GEMIN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055815.1	NM_017856	
GPR112	139378	hgsc.bcm.edu	37	X	135429260	135429260	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:135429260C>A	ENST00000394143.1	+	6	3686	c.3395C>A	c.(3394-3396)tCa>tAa	p.S1132*	GPR112_ENST00000394141.1_Nonsense_Mutation_p.S927*|GPR112_ENST00000287534.4_Nonsense_Mutation_p.S1069*|GPR112_ENST00000370652.1_Nonsense_Mutation_p.S1132*|GPR112_ENST00000412101.1_Nonsense_Mutation_p.S927*	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1132					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S1132*(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTCTCTACCTCAGTTGATACA	0.488																																					p.S1132X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3395A	X						.						151.0	119.0	130.0					X																	135429260		2203	4300	6503	135256926	SO:0001587	stop_gained	139378	exon6			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3395C>A	X.37:g.135429260C>A	ENSP00000377699:p.Ser1132*	Somatic		Capture	SOLID	Phase_I	135256926	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Nonsense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	C	41	8.853430	0.98978	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	.	.	.	2.55	1.65	0.23941	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.9473	0.09353	0.0:0.7799:0.0:0.2201	.	.	.	.	X	1132;1132;927;1069;927	.	ENSP00000287534:S1069X	S	+	2	0	GPR112	135256926	0.356000	0.24930	0.006000	0.13384	0.049000	0.14656	1.888000	0.39708	1.232000	0.43678	0.436000	0.28706	TCA		0.488	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
MAGEB1	4112	hgsc.bcm.edu	37	X	30269335	30269335	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:30269335G>A	ENST00000378981.3	+	4	1046	c.725G>A	c.(724-726)cGt>cAt	p.R242H	MAGEB1_ENST00000397548.2_Missense_Mutation_p.R242H|MAGEB1_ENST00000397550.1_Missense_Mutation_p.R242H	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	242	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.R242H(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						GGGGAACCCCGTAAGTTCATC	0.488																																					p.R242H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G725A	X						.						76.0	66.0	69.0					X																	30269335		2202	4300	6502	30179256	SO:0001583	missense	4112	exon4				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.725G>A	X.37:g.30269335G>A	ENSP00000368264:p.Arg242His	Somatic		Capture	SOLID	Phase_I	30179256	NM_002363	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	ENST00000378981.3	37	CCDS14222.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698196	0.30142	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.05649	3.41;3.41;3.41	3.99	2.21	0.28008	.	0.112149	0.64402	D	0.000020	T	0.30885	0.0779	H	0.96889	3.9	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.19844	-1.0293	10	0.87932	D	0	.	5.3606	0.16085	0.2623:0.0:0.7377:0.0	.	242	P43366	MAGB1_HUMAN	H	242	ENSP00000368264:R242H;ENSP00000380683:R242H;ENSP00000380681:R242H	ENSP00000368264:R242H	R	+	2	0	MAGEB1	30179256	0.027000	0.19231	0.009000	0.14445	0.170000	0.22686	0.756000	0.26419	0.467000	0.27218	0.600000	0.82982	CGT		0.488	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363	
SLC38A5	92745	hgsc.bcm.edu	37	X	48326262	48326262	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:48326262A>G	ENST00000376876.3	-	2	893	c.50T>C	c.(49-51)gTg>gCg	p.V17A	SLC38A5_ENST00000376875.1_5'Flank|SLC38A5_ENST00000317669.5_Missense_Mutation_p.V17A			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	17					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)	p.V17A(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						GACTCACCCCACAGCATCCGA	0.567																																					p.V17A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T50C	X						.						59.0	48.0	51.0					X																	48326262		2203	4298	6501	48211206	SO:0001583	missense	92745	exon3			AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.50T>C	X.37:g.48326262A>G	ENSP00000366073:p.Val17Ala	Somatic		Capture	SOLID	Phase_I	48211206	NM_033518	B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Missense_Mutation	SNP	ENST00000376876.3	37	CCDS14293.1	.	.	.	.	.	.	.	.	.	.	a	3.487	-0.104581	0.06967	.	.	ENSG00000017483	ENST00000376876;ENST00000317669;ENST00000440085;ENST00000441948;ENST00000413668;ENST00000416711;ENST00000429543	T;T;T;T;T;T;T	0.40756	3.2;3.2;1.6;1.6;1.61;1.61;1.02	4.41	-1.49	0.08718	.	1.048400	0.07524	N	0.911045	T	0.17365	0.0417	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25398	-1.0133	10	0.02654	T	1	.	0.6906	0.00890	0.4108:0.1588:0.1145:0.3159	.	17	Q8WUX1	S38A5_HUMAN	A	17	ENSP00000366073:V17A;ENSP00000313740:V17A;ENSP00000402988:V17A;ENSP00000407258:V17A;ENSP00000403976:V17A;ENSP00000389644:V17A;ENSP00000416948:V17A	ENSP00000313740:V17A	V	-	2	0	SLC38A5	48211206	0.480000	0.25933	0.937000	0.37676	0.372000	0.29890	-0.172000	0.09868	0.018000	0.15052	0.242000	0.17961	GTG		0.567	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060724.1	NM_033518	
OPHN1	4983	hgsc.bcm.edu	37	X	67293120	67293120	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:67293120C>A	ENST00000355520.5	-	20	2349	c.1708G>T	c.(1708-1710)Gaa>Taa	p.E570*	OPHN1_ENST00000540071.1_Nonsense_Mutation_p.E570*|OPHN1_ENST00000484842.1_5'UTR	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	570					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.E570*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						GCAGCGCTTTCCTCAGGTGGA	0.473																																					p.E570X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1708T	X						.						80.0	64.0	69.0					X																	67293120		2203	4300	6503	67209845	SO:0001587	stop_gained	4983	exon20			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1708G>T	X.37:g.67293120C>A	ENSP00000347710:p.Glu570*	Somatic		Capture	SOLID	Phase_I	67209845	NM_002547	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Nonsense_Mutation	SNP	ENST00000355520.5	37	CCDS14388.1	.	.	.	.	.	.	.	.	.	.	C	44	10.810487	0.99471	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	.	.	.	4.61	4.61	0.57282	.	0.189442	0.44097	D	0.000495	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	11.6892	0.51505	0.0:1.0:0.0:0.0	.	.	.	.	X	570	.	ENSP00000347710:E570X	E	-	1	0	OPHN1	67209845	0.994000	0.37717	0.885000	0.34714	0.895000	0.52256	4.100000	0.57762	2.140000	0.66376	0.538000	0.68166	GAA		0.473	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547	
TEX11	56159	hgsc.bcm.edu	37	X	69890310	69890310	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:69890310A>G	ENST00000395889.2	-	17	1497	c.1342T>C	c.(1342-1344)Tca>Cca	p.S448P	TEX11_ENST00000374333.2_Missense_Mutation_p.S433P|TEX11_ENST00000374320.2_Missense_Mutation_p.S123P|TEX11_ENST00000344304.3_Missense_Mutation_p.S448P	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	448					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.S433P(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TCATCAGTTGAATAAAACCTC	0.378																																					p.S448P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1342C	X						.						111.0	93.0	99.0					X																	69890310		2203	4300	6503	69807035	SO:0001583	missense	56159	exon17			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1342T>C	X.37:g.69890310A>G	ENSP00000379226:p.Ser448Pro	Somatic		Capture	SOLID	Phase_I	69807035	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	37	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	A	0.231	-1.020897	0.02061	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5	3.77	-0.573	0.11742	Tetratricopeptide-like helical (1);	0.902595	0.09436	N	0.802426	T	0.34745	0.0908	N	0.02011	-0.69	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.20840	-1.0263	9	.	.	.	0.068	1.3204	0.02115	0.4048:0.2998:0.1679:0.1275	.	433;448	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	P	433;448;123;448	ENSP00000363453:S433P;ENSP00000379226:S448P;ENSP00000363440:S123P;ENSP00000340995:S448P	.	S	-	1	0	TEX11	69807035	0.003000	0.15002	0.056000	0.19401	0.046000	0.14306	-0.312000	0.08113	0.129000	0.18514	0.345000	0.21793	TCA		0.378	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
P2RY10	27334	hgsc.bcm.edu	37	X	78216602	78216602	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:78216602G>T	ENST00000171757.2	+	4	865	c.585G>T	c.(583-585)ttG>ttT	p.L195F	P2RY10_ENST00000544091.1_Missense_Mutation_p.L195F	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.L195F(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						CAGTTGCGTTGGTCGGGATGA	0.458																																					p.L195F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G585T	X						.						162.0	120.0	134.0					X																	78216602		2203	4300	6503	78103258	SO:0001583	missense	27334	exon2			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.585G>T	X.37:g.78216602G>T	ENSP00000171757:p.Leu195Phe	Somatic		Capture	SOLID	Phase_I	78103258	NM_198333	D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	37	CCDS14442.1	.	.	.	.	.	.	.	.	.	.	G	2.833	-0.242124	0.05906	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.37584	1.19;1.19	4.78	1.82	0.25136	GPCR, rhodopsin-like superfamily (1);	1.324970	0.05724	N	0.598223	T	0.31796	0.0808	L	0.31294	0.92	0.09310	N	1	B	0.27765	0.188	B	0.38921	0.285	T	0.40924	-0.9537	10	0.11485	T	0.65	.	8.8858	0.35402	0.3089:0.0:0.6911:0.0	.	195	O00398	P2Y10_HUMAN	F	195	ENSP00000443138:L195F;ENSP00000171757:L195F	ENSP00000171757:L195F	L	+	3	2	P2RY10	78103258	0.000000	0.05858	0.633000	0.29310	0.841000	0.47740	-0.575000	0.05861	0.460000	0.27045	0.417000	0.27973	TTG		0.458	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1		
SLITRK2	84631	hgsc.bcm.edu	37	X	144906030	144906030	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chrX:144906030G>T	ENST00000370490.1	+	1	6342	c.2087G>T	c.(2086-2088)tGc>tTc	p.C696F	SLITRK2_ENST00000428560.2_Missense_Mutation_p.C696F|SLITRK2_ENST00000447897.2_Missense_Mutation_p.C696F|SLITRK2_ENST00000434188.2_Missense_Mutation_p.C696F|SLITRK2_ENST00000413937.2_Missense_Mutation_p.C696F|TMEM257_ENST00000408967.2_5'Flank			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	696					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.C696F(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGTCAGATGTGCCAAAACCCC	0.468																																					p.C696F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2087T	X						.						71.0	68.0	69.0					X																	144906030		2203	4300	6503	144713722	SO:0001583	missense	84631	exon3			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2087G>T	X.37:g.144906030G>T	ENSP00000359521:p.Cys696Phe	Somatic		Capture	SOLID	Phase_I	144713722	NM_001144006	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.605920	0.66445	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.69033	0.3066	M	0.68593	2.085	0.80722	D	1	D	0.67145	0.996	D	0.64506	0.926	T	0.72427	-0.4297	10	0.66056	D	0.02	-6.3967	15.3882	0.74718	0.0:0.0:1.0:0.0	.	696	Q9H156	SLIK2_HUMAN	F	696	ENSP00000334374:C696F;ENSP00000411681:C696F;ENSP00000359521:C696F;ENSP00000397015:C696F;ENSP00000407347:C696F;ENSP00000412010:C696F	ENSP00000334374:C696F	C	+	2	0	SLITRK2	144713722	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.030000	0.88816	2.224000	0.72417	0.513000	0.50165	TGC		0.468	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
GFPT1	2673	hgsc.bcm.edu	37	2	69586450	69586450	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr2:69586450C>T	ENST00000357308.4	-	5	536	c.358G>A	c.(358-360)Gtt>Att	p.V120I	GFPT1_ENST00000361060.5_Missense_Mutation_p.V120I	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	120	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)	p.V120I(1)		endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						TTGTGAATAACGATAAATTCT	0.313																																					p.V120I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G358A	2						.						63.0	69.0	67.0					2																	69586450		2203	4300	6503	69439954	SO:0001583	missense	2673	exon5				CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.358G>A	2.37:g.69586450C>T	ENSP00000349860:p.Val120Ile	Somatic		Capture	SOLID	Phase_I	69439954	NM_002056	Q53QE6|Q9BXF8	Missense_Mutation	SNP	ENST00000357308.4	37	CCDS58713.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.758585	0.69763	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.76709	-1.04;-1.04	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.78336	0.4267	L	0.42487	1.325	0.80722	D	1	D	0.60575	0.988	P	0.51385	0.668	T	0.76639	-0.2885	10	0.33940	T	0.23	-24.622	17.1804	0.86853	0.0:1.0:0.0:0.0	.	120	Q06210-2	.	I	120	ENSP00000349860:V120I;ENSP00000354347:V120I	ENSP00000349860:V120I	V	-	1	0	GFPT1	69439954	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.320000	0.79064	2.699000	0.92147	0.563000	0.77884	GTT		0.313	GFPT1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
SESTD1	91404	hgsc.bcm.edu	37	2	179986578	179986578	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr2:179986578C>T	ENST00000428443.3	-	13	1677	c.1361G>A	c.(1360-1362)gGa>gAa	p.G454E		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	454							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.G454E(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TACATCCTTTCCATAGGCCCA	0.398																																					p.G454E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1361A	2						.						111.0	106.0	108.0					2																	179986578		2203	4300	6503	179694823	SO:0001583	missense	91404	exon13			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1361G>A	2.37:g.179986578C>T	ENSP00000415332:p.Gly454Glu	Somatic		Capture	SOLID	Phase_I	179694823	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.918608	0.52546	.	.	ENSG00000187231	ENST00000428443	T	0.06371	3.31	5.18	5.18	0.71444	.	0.101972	0.64402	D	0.000003	T	0.05318	0.0141	N	0.17082	0.46	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.47086	-0.9144	9	.	.	.	-9.6583	18.0499	0.89344	0.0:1.0:0.0:0.0	.	454	Q86VW0	SESD1_HUMAN	E	454	ENSP00000415332:G454E	.	G	-	2	0	SESTD1	179694823	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.138000	0.77305	2.584000	0.87258	0.467000	0.42956	GGA		0.398	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
SECISBP2	79048	hgsc.bcm.edu	37	9	91972403	91972403	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr9:91972403C>T	ENST00000375807.3	+	15	2262	c.2191C>T	c.(2191-2193)Cgc>Tgc	p.R731C	SECISBP2_ENST00000339901.4_Missense_Mutation_p.R658C|SECISBP2_ENST00000534113.2_Missense_Mutation_p.R663C	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	731					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.R731S(1)|p.R731C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						TGCTCTCAACCGCAAAGCTCT	0.502																																					p.R731C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C2191T	9						.						233.0	215.0	221.0					9																	91972403		2203	4300	6503	91162223	SO:0001583	missense	79048	exon15			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.2191C>T	9.37:g.91972403C>T	ENSP00000364965:p.Arg731Cys	Somatic		Capture	SOLID	Phase_I	91162223	NM_024077	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	37	CCDS6683.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984577	0.74474	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113	T;T;T	0.78364	-1.17;-1.17;-1.17	4.68	3.77	0.43336	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	D	0.87402	0.6168	M	0.80508	2.5	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.88930	0.3372	10	0.87932	D	0	-12.5001	12.9376	0.58325	0.0:0.9211:0.0:0.0789	.	738;658;731	Q59H19;Q96T21-2;Q96T21	.;.;SEBP2_HUMAN	C	731;737;658;663	ENSP00000364965:R731C;ENSP00000364959:R658C;ENSP00000436650:R663C	ENSP00000364959:R658C	R	+	1	0	SECISBP2	91162223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.808000	0.47963	1.314000	0.45095	0.555000	0.69702	CGC		0.502	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
AKNA	80709	hgsc.bcm.edu	37	9	117124175	117124175	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr9:117124175T>G	ENST00000307564.4	-	9	2094	c.1933A>C	c.(1933-1935)Ata>Cta	p.I645L	AKNA_ENST00000374075.5_Missense_Mutation_p.I564L|AKNA_ENST00000312033.3_Missense_Mutation_p.I645L|AKNA_ENST00000223791.3_Missense_Mutation_p.I105L|AKNA_ENST00000374088.3_Missense_Mutation_p.I645L	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	645					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.I645L(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						AGACGGTATATCTCTGCCTCC	0.567																																					p.I645L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1933C	9						.						62.0	63.0	63.0					9																	117124175		2203	4300	6503	116163996	SO:0001583	missense	80709	exon9			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1933A>C	9.37:g.117124175T>G	ENSP00000303769:p.Ile645Leu	Somatic		Capture	SOLID	Phase_I	116163996	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.337120	0.60963	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000223791;ENST00000374075;ENST00000312033	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000016	T	0.51753	0.1693	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	T	0.53479	-0.8433	10	0.87932	D	0	-9.7572	11.7613	0.51905	0.0:0.0:0.0:1.0	.	645;564	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	L	645;486;645;105;564;645	ENSP00000303769:I645L;ENSP00000363201:I645L;ENSP00000223791:I105L;ENSP00000363188:I564L;ENSP00000309222:I645L	ENSP00000223791:I105L	I	-	1	0	AKNA	116163996	1.000000	0.71417	0.999000	0.59377	0.460000	0.32559	3.872000	0.56085	2.281000	0.76405	0.533000	0.62120	ATA		0.567	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
DIS3	22894	hgsc.bcm.edu	37	13	73346856	73346856	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr13:73346856T>C	ENST00000377767.4	-	9	1461	c.1361A>G	c.(1360-1362)aAg>aGg	p.K454R	DIS3_ENST00000545453.1_Missense_Mutation_p.K292R|DIS3_ENST00000377780.4_Missense_Mutation_p.K424R	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	454					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.K454R(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		CCAGGGCATCTTTGGCAGAAA	0.358										Multiple Myeloma(4;0.011)																											p.K424R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1271G	13						.						102.0	104.0	104.0					13																	73346856		2203	4300	6503	72244857	SO:0001583	missense	22894	exon9			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1361A>G	13.37:g.73346856T>C	ENSP00000366997:p.Lys454Arg	Somatic		Capture	SOLID	Phase_I	72244857	NM_001128226	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.837962	0.50951	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.44482	0.92;0.92;0.92	5.52	4.29	0.51040	.	0.042179	0.85682	N	0.000000	T	0.35799	0.0944	L	0.45470	1.425	0.53688	D	0.999979	B;B	0.06786	0.001;0.0	B;B	0.12837	0.008;0.002	T	0.09818	-1.0657	10	0.30854	T	0.27	.	11.9253	0.52817	0.0:0.0695:0.0:0.9305	.	424;454	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	R	454;424;292	ENSP00000366997:K454R;ENSP00000367011:K424R;ENSP00000440058:K292R	ENSP00000366997:K454R	K	-	2	0	DIS3	72244857	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	5.859000	0.69539	0.971000	0.38288	0.533000	0.62120	AAG		0.358	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953	
CUBN	8029	hgsc.bcm.edu	37	10	16867060	16867060	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr10:16867060C>T	ENST00000377833.4	-	67	10851	c.10786G>A	c.(10786-10788)Gtg>Atg	p.V3596M		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3596	CUB 27. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.V3596M(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGGAAGCCACGAAGGGAGCT	0.383																																					p.V3596M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10786A	10						.						72.0	60.0	64.0					10																	16867060		2203	4300	6503	16907066	SO:0001583	missense	8029	exon67			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10786G>A	10.37:g.16867060C>T	ENSP00000367064:p.Val3596Met	Somatic		Capture	SOLID	Phase_I	16907066	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	4.423	0.078286	0.08485	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.30714	1.52	5.56	-0.641	0.11490	CUB (5);	1.744360	0.03523	N	0.221351	T	0.32010	0.0815	M	0.77486	2.375	0.09310	N	0.999999	B	0.26195	0.144	B	0.22386	0.039	T	0.12941	-1.0528	10	0.34782	T	0.22	.	2.2853	0.04124	0.1271:0.2827:0.1248:0.4653	.	3596	O60494	CUBN_HUMAN	M	3596;437	ENSP00000367064:V3596M	ENSP00000367064:V3596M	V	-	1	0	CUBN	16907066	0.001000	0.12720	0.001000	0.08648	0.254000	0.26022	0.007000	0.13174	-0.405000	0.07599	-0.766000	0.03442	GTG		0.383	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CTNNA3	29119	hgsc.bcm.edu	37	10	69299389	69299389	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr10:69299389C>T	ENST00000433211.2	-	4	505	c.331G>A	c.(331-333)Gac>Aac	p.D111N	CTNNA3_ENST00000373744.4_Missense_Mutation_p.D111N|CTNNA3_ENST00000545309.1_Missense_Mutation_p.D111N	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.D111N(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						AAACAGGGGTCATCTGTAAAT	0.443																																					p.D111N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G331A	10						.						72.0	72.0	72.0					10																	69299389		2203	4300	6503	68969395	SO:0001583	missense	29119	exon4			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.331G>A	10.37:g.69299389C>T	ENSP00000389714:p.Asp111Asn	Somatic		Capture	SOLID	Phase_I	68969395	NM_013266		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711765	0.89112	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309;ENST00000330298;ENST00000540598	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.18	5.18	0.71444	.	0.000000	0.49916	D	0.000122	T	0.72003	0.3407	L	0.41356	1.27	0.47009	D	0.999288	D;D;D	0.69078	0.997;0.981;0.997	D;P;D	0.83275	0.996;0.86;0.994	T	0.73177	-0.4065	10	0.52906	T	0.07	-15.253	15.5958	0.76578	0.0:1.0:0.0:0.0	.	111;111;111	F2Z2R0;Q9UI47-2;Q9UI47	.;.;CTNA3_HUMAN	N	111	ENSP00000389714:D111N;ENSP00000362849:D111N;ENSP00000441444:D111N;ENSP00000330570:D111N	ENSP00000330570:D111N	D	-	1	0	CTNNA3	68969395	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.084000	0.71335	2.393000	0.81446	0.585000	0.79938	GAC		0.443	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
PCDHB2	56133	hgsc.bcm.edu	37	5	140475253	140475253	+	Silent	SNP	G	G	A			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr5:140475253G>A	ENST00000194155.4	+	1	1027	c.879G>A	c.(877-879)acG>acA	p.T293T		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	293	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T293T(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGCAAAACGTTTCGATTAA	0.418																																					p.T293T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G879A	5						.						81.0	83.0	82.0					5																	140475253		2203	4300	6503	140455437	SO:0001819	synonymous_variant	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.879G>A	5.37:g.140475253G>A		Somatic		Capture	SOLID	Phase_I	140455437	NM_018936	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																				0.418	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
KIAA0825	285600	hgsc.bcm.edu	37	5	93856191	93856191	+	Nonsense_Mutation	SNP	A	A	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr5:93856191A>C	ENST00000329378.7	-	5	981	c.732T>G	c.(730-732)taT>taG	p.Y244*	KIAA0825_ENST00000312498.7_Nonsense_Mutation_p.Y244*|KIAA0825_ENST00000427991.2_Nonsense_Mutation_p.Y244*|KIAA0825_ENST00000513200.3_Nonsense_Mutation_p.Y244*	NM_173665.2	NP_775936.1	Q8IV33	K0825_HUMAN	KIAA0825	244								p.Y244*(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TTGTACTTTGATATCCATGAG	0.303																																					p.Y244X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.T732G	5						.						63.0	66.0	65.0					5																	93856191		2203	4298	6501	93881947	SO:0001587	stop_gained	285600	exon5			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000329378.7:c.732T>G	5.37:g.93856191A>C	ENSP00000331385:p.Tyr244*	Somatic		Capture	SOLID	Phase_I	93881947	NM_001145678	O94914|Q6ZNN2	Nonsense_Mutation	SNP	ENST00000329378.7	37	CCDS4070.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.099017	0.76870	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498;ENST00000329378	.	.	.	5.51	2.57	0.30868	.	1.892270	0.01596	N	0.021839	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1236	0.36801	0.3204:0.0:0.6796:0.0	.	.	.	.	X	244	.	ENSP00000312205:Y244X	Y	-	3	2	KIAA0825	93881947	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	1.453000	0.35167	0.599000	0.29845	0.477000	0.44152	TAT		0.303	KIAA0825-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371180.2	NM_173665	
PCDHB13	56123	hgsc.bcm.edu	37	5	140594929	140594929	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2678-01A-01W-0831-10	TCGA-A6-2678-10A-01W-0831-10	g.chr5:140594929G>C	ENST00000341948.4	+	1	1421	c.1234G>C	c.(1234-1236)Gaa>Caa	p.E412Q		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E412Q(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTAGACAGAGAAAGCAGAGC	0.468																																					p.E412Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1234C	5						.						105.0	98.0	100.0					5																	140594929		2203	4300	6503	140575113	SO:0001583	missense	56123	exon1			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1234G>C	5.37:g.140594929G>C	ENSP00000345491:p.Glu412Gln	Somatic		Capture	SOLID	Phase_I	140575113	NM_018933	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	N	22.2	4.257187	0.80246	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.72942	-0.7	3.5	3.5	0.40072	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.90480	0.7018	H	0.99156	4.45	0.46458	D	0.999059	D	0.89917	1.0	D	0.97110	1.0	D	0.94522	0.7728	9	0.87932	D	0	.	15.0196	0.71621	0.0:0.0:1.0:0.0	.	412	Q9Y5F0	PCDBD_HUMAN	Q	412	ENSP00000345491:E412Q	ENSP00000345491:E412Q	E	+	1	0	PCDHB13	140575113	1.000000	0.71417	0.223000	0.23860	0.204000	0.24138	9.775000	0.98995	1.671000	0.50874	0.298000	0.19748	GAA		0.468	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
