#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HK1	3098	broad.mit.edu	37	10	71142350	71142350	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr10:71142350C>T	ENST00000359426.6	+	10	1477	c.1373C>T	c.(1372-1374)gCg>gTg	p.A458V	HK1_ENST00000448642.2_Missense_Mutation_p.A493V|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000360289.2_Missense_Mutation_p.A446V|HK1_ENST00000298649.3_Missense_Mutation_p.A457V|HK1_ENST00000404387.2_Missense_Mutation_p.A462V	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	458	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)	p.A462V(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						ATGGTGACGGCGGTGGCCTAC	0.622																																					p.A462V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1385T	10						.						37.0	37.0	37.0					10																	71142350		2203	4300	6503	70812356	SO:0001583	missense	3098	exon13			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1373C>T	10.37:g.71142350C>T	ENSP00000352398:p.Ala458Val	Somatic		Capture	Illumina HiSeq	Phase_I	70812356	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	C	36	5.741284	0.96873	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.97256	-4.31;-4.31;-4.31;-4.31;-4.31	5.69	5.69	0.88448	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	H	0.96889	3.9	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.996;1.0;1.0;1.0;0.998;0.994	D	0.98903	1.0777	10	0.62326	D	0.03	-20.7675	20.1521	0.98089	0.0:1.0:0.0:0.0	.	458;458;457;493;462;446	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	V	446;493;462;457;458;458	ENSP00000353433:A446V;ENSP00000402103:A493V;ENSP00000384774:A462V;ENSP00000298649:A457V;ENSP00000352398:A458V	ENSP00000298649:A457V	A	+	2	0	HK1	70812356	1.000000	0.71417	0.218000	0.23776	0.987000	0.75469	7.743000	0.85020	2.843000	0.97960	0.655000	0.94253	GCG		0.622	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
NDST2	8509	broad.mit.edu	37	10	75566083	75566083	+	Silent	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr10:75566083G>A	ENST00000309979.6	-	6	1954	c.1398C>T	c.(1396-1398)gcC>gcT	p.A466A	RP11-574K11.31_ENST00000603027.1_Silent_p.A466A|NDST2_ENST00000299641.4_Silent_p.A343A			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	466	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)	p.A466A(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					GGCGGTAGCGGGCAGGGCGGA	0.537																																					p.A466A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1398T	10						.						76.0	72.0	74.0					10																	75566083		2203	4300	6503	75236089	SO:0001819	synonymous_variant	8509	exon6			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1398C>T	10.37:g.75566083G>A		Somatic		Capture	Illumina HiSeq	Phase_I	75236089	NM_003635	Q2TB32|Q59H89	Silent	SNP	ENST00000309979.6	37	CCDS7335.1																																																																																				0.537	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635	
MRVI1	10335	broad.mit.edu	37	11	10615705	10615705	+	Silent	SNP	G	G	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr11:10615705G>T	ENST00000436272.1	-	15	2052	c.1974C>A	c.(1972-1974)ctC>ctA	p.L658L	MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000424001.1_Silent_p.L370L|MRVI1_ENST00000541483.1_Silent_p.L479L|MRVI1_ENST00000527509.2_Silent_p.L594L|MRVI1_ENST00000552103.1_Silent_p.L594L|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000558540.1_Silent_p.L370L|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000421747.1_Silent_p.L676L|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000547195.1_Silent_p.L594L|MRVI1_ENST00000531107.1_Silent_p.L677L|MRVI1_ENST00000545852.1_Silent_p.L370L|MRVI1_ENST00000423302.2_Silent_p.L685L|MRVI1_ENST00000534266.2_Silent_p.L370L			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	658					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)		p.L658L(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TTCCCAGCGTGAGGGACATGG	0.527																																					p.L594L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1782A	11						.						69.0	74.0	72.0					11																	10615705		2035	4180	6215	10572281	SO:0001819	synonymous_variant	10335	exon16			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1974C>A	11.37:g.10615705G>T		Somatic		Capture	Illumina HiSeq	Phase_I	10572281	NM_001100163	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	ENST00000436272.1	37																																																																																					0.527	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
TRIM68	55128	broad.mit.edu	37	11	4622349	4622349	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr11:4622349G>A	ENST00000300747.5	-	6	1104	c.815C>T	c.(814-816)tCt>tTt	p.S272F		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	272					protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S272F(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		CAAGCTCCAAGATTTGCTCCT	0.547																																					p.S272F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C815T	11						.						100.0	97.0	98.0					11																	4622349		2201	4298	6499	4578925	SO:0001583	missense	55128	exon6			AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.815C>T	11.37:g.4622349G>A	ENSP00000300747:p.Ser272Phe	Somatic		Capture	Illumina HiSeq	Phase_I	4578925	NM_018073	A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Missense_Mutation	SNP	ENST00000300747.5	37	CCDS31356.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399026	0.62177	.	.	ENSG00000167333	ENST00000300747;ENST00000526337	T;T	0.04502	3.61;3.61	5.12	5.12	0.69794	.	0.129364	0.36167	N	0.002746	T	0.06462	0.0166	L	0.41710	1.295	0.42380	D	0.992481	B	0.32939	0.391	B	0.33799	0.17	T	0.24012	-1.0172	10	0.62326	D	0.03	.	14.7603	0.69602	0.0:0.0:1.0:0.0	.	272	Q6AZZ1	TRI68_HUMAN	F	272;49	ENSP00000300747:S272F;ENSP00000434681:S49F	ENSP00000300747:S272F	S	-	2	0	TRIM68	4578925	0.006000	0.16342	1.000000	0.80357	0.904000	0.53231	0.681000	0.25320	2.764000	0.94973	0.561000	0.74099	TCT		0.547	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073	
OR52E4	390081	broad.mit.edu	37	11	5905829	5905829	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr11:5905829A>G	ENST00000316987.2	+	1	329	c.307A>G	c.(307-309)Atg>Gtg	p.M103V		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M103V(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTTCTTCAGATGTTCTTTAT	0.463																																					p.M103V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A307G	11						.						106.0	94.0	98.0					11																	5905829		2201	4296	6497	5862405	SO:0001583	missense	390081	exon1			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.307A>G	11.37:g.5905829A>G	ENSP00000321426:p.Met103Val	Somatic		Capture	Illumina HiSeq	Phase_I	5862405	NM_001005165	Q6IFG0	Missense_Mutation	SNP	ENST00000316987.2	37	CCDS31401.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296763	0.23650	.	.	ENSG00000180974	ENST00000316987	T	0.02916	4.11	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.07279	0.0184	M	0.77820	2.39	0.35807	D	0.823589	B	0.20459	0.045	B	0.31686	0.134	T	0.04796	-1.0926	10	0.40728	T	0.16	.	13.5744	0.61866	1.0:0.0:0.0:0.0	.	103	Q8NGH9	O52E4_HUMAN	V	103	ENSP00000321426:M103V	ENSP00000321426:M103V	M	+	1	0	OR52E4	5862405	0.998000	0.40836	1.000000	0.80357	0.440000	0.31957	0.766000	0.26560	2.072000	0.62099	0.523000	0.50628	ATG		0.463	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165	
SF3B2	10992	broad.mit.edu	37	11	65827045	65827045	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr11:65827045C>T	ENST00000322535.6	+	12	1429	c.1380C>T	c.(1378-1380)ttC>ttT	p.F460F	SF3B2_ENST00000528302.1_Silent_p.F443F	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	460					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)	p.F460F(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						TGAACCGCTTCACTGTGGCTG	0.547																																					p.F460F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1380T	11						.						75.0	79.0	78.0					11																	65827045		2201	4295	6496	65583621	SO:0001819	synonymous_variant	10992	exon12			U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1380C>T	11.37:g.65827045C>T		Somatic		Capture	Illumina HiSeq	Phase_I	65583621	NM_006842	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Silent	SNP	ENST00000322535.6	37	CCDS31612.1																																																																																				0.547	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
NPAT	4863	broad.mit.edu	37	11	108031818	108031818	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr11:108031818G>C	ENST00000278612.8	-	17	4100	c.3995C>G	c.(3994-3996)gCc>gGc	p.A1332G		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1332	Required for acceleration of G1 phase.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TAATGTGTGGGCAGCCATATT	0.468																																					p.A1332G												.	.	0			c.C3995G	11						.						89.0	90.0	90.0					11																	108031818		1902	4114	6016	107537028	SO:0001583	missense	4863	exon17			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3995C>G	11.37:g.108031818G>C	ENSP00000278612:p.Ala1332Gly	None		Capture	Illumina HiSeq	Phase_I	107537028	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675034	0.88445	.	.	ENSG00000149308	ENST00000278612	T	0.14893	2.47	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.44832	-0.9302	10	0.87932	D	0	-1.7599	18.9451	0.92620	0.0:0.0:1.0:0.0	.	1332	Q14207	NPAT_HUMAN	G	1332	ENSP00000278612:A1332G	ENSP00000278612:A1332G	A	-	2	0	NPAT	107537028	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.119000	0.94362	2.559000	0.86315	0.555000	0.69702	GCC		0.468	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
LRP1	4035	broad.mit.edu	37	12	57589551	57589552	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr12:57589551_57589552insC	ENST00000243077.3	+	53	9014_9015	c.8548_8549insC	c.(8548-8550)tccfs	p.S2850fs	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2850	LDL-receptor class A 18. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTCTGATGAGTCCCCCGAGTGT	0.634																																					p.S2850fs												.	.	0			c.8548_8549insC	12						.																																			55875819	SO:0001589	frameshift_variant	4035	exon53			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8553dupC	12.37:g.57589556_57589556dupC	ENSP00000243077:p.Ser2850fs	None		Capture	Illumina HiSeq	Phase_I	55875818	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Frame_Shift_Ins	INS	ENST00000243077.3	37	CCDS8932.1																																																																																				0.634	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
ACVR1B	91	broad.mit.edu	37	12	52370240	52370240	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr12:52370240G>A	ENST00000257963.4	+	3	538	c.461G>A	c.(460-462)cGt>cAt	p.R154H	ACVR1B_ENST00000415850.2_Missense_Mutation_p.R154H|ACVR1B_ENST00000541224.1_Missense_Mutation_p.R154H|ACVR1B_ENST00000426655.2_Missense_Mutation_p.R154H|ACVR1B_ENST00000542485.1_Missense_Mutation_p.R102H	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	154					activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.R154H(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TATCATCAGCGTGTCTATCAC	0.517																																					p.R102H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G305A	12						.						181.0	169.0	173.0					12																	52370240		2203	4300	6503	50656507	SO:0001583	missense	91	exon3				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.461G>A	12.37:g.52370240G>A	ENSP00000257963:p.Arg154His	Somatic		Capture	Illumina HiSeq	Phase_I	50656507	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845249	0.91197	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.93659	-2.25;-3.26;-2.11;-2.04;-2.08	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.95178	0.8437	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.76494	0.997;0.998;0.996;0.999	P;P;P;D	0.64042	0.902;0.836;0.872;0.921	D	0.95207	0.8322	10	0.59425	D	0.04	.	19.35	0.94379	0.0:0.0:1.0:0.0	.	154;154;154;154	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	H	154;154;154;154;102	ENSP00000257963:R154H;ENSP00000442656:R154H;ENSP00000390477:R154H;ENSP00000397550:R154H;ENSP00000442885:R102H	ENSP00000257963:R154H	R	+	2	0	ACVR1B	50656507	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	6.558000	0.73942	2.652000	0.90054	0.462000	0.41574	CGT		0.517	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
FRY	10129	broad.mit.edu	37	13	32798430	32798430	+	Silent	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr13:32798430G>A	ENST00000380250.3	+	37	5320	c.4824G>A	c.(4822-4824)ccG>ccA	p.P1608P		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1608						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P1608P(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CCAAGCAGCCGCAGCCCTTAC	0.562																																					p.P1608P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4824A	13						.						66.0	70.0	68.0					13																	32798430		1890	4117	6007	31696430	SO:0001819	synonymous_variant	10129	exon37			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.4824G>A	13.37:g.32798430G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31696430	NM_023037	Q9Y3N6	Silent	SNP	ENST00000380250.3	37	CCDS41875.1																																																																																				0.562	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
FREM2	341640	broad.mit.edu	37	13	39435628	39435628	+	Missense_Mutation	SNP	G	G	A	rs543458565	byFrequency	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr13:39435628G>A	ENST00000280481.7	+	15	7796	c.7580G>A	c.(7579-7581)cGc>cAc	p.R2527H		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2527					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2527H(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GCTAAATTGCGCTACACAGGC	0.463													G|||	3	0.000599042	0.0	0.0	5008	,	,		19182	0.0		0.0	False		,,,				2504	0.0031				p.R2527H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7580A	13						.						154.0	127.0	136.0					13																	39435628		2203	4300	6503	38333628	SO:0001583	missense	341640	exon15			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7580G>A	13.37:g.39435628G>A	ENSP00000280481:p.Arg2527His	Somatic		Capture	Illumina HiSeq	Phase_I	38333628	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796824	0.70567	.	.	ENSG00000150893	ENST00000280481	T	0.22336	1.96	4.82	3.97	0.46021	.	0.000000	0.85682	D	0.000000	T	0.44561	0.1299	M	0.69823	2.125	0.80722	D	1	D;P	0.89917	1.0;0.891	D;B	0.91635	0.999;0.221	T	0.42050	-0.9474	10	0.56958	D	0.05	.	13.3378	0.60528	0.0772:0.0:0.9228:0.0	.	2527;2527	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	H	2527	ENSP00000280481:R2527H	ENSP00000280481:R2527H	R	+	2	0	FREM2	38333628	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	5.617000	0.67716	1.140000	0.42260	0.655000	0.94253	CGC		0.463	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
OR4K1	79544	broad.mit.edu	37	14	20404021	20404021	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr14:20404021C>G	ENST00000285600.4	+	1	255	c.196C>G	c.(196-198)Ctt>Gtt	p.L66V		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L66V(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GCTCAGTAATCTTTCTTTCAT	0.383																																					p.L66V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C196G	14						.						268.0	282.0	278.0					14																	20404021		2203	4300	6503	19473861	SO:0001583	missense	79544	exon1				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.196C>G	14.37:g.20404021C>G	ENSP00000285600:p.Leu66Val	Somatic		Capture	Illumina HiSeq	Phase_I	19473861	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	16.08	3.022871	0.54683	.	.	ENSG00000155249	ENST00000285600	T	0.00507	6.92	4.66	4.66	0.58398	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000107	T	0.03783	0.0107	H	0.97852	4.09	0.33317	D	0.566806	D	0.89917	1.0	D	0.77557	0.99	T	0.03641	-1.1017	10	0.87932	D	0	.	15.0605	0.71947	0.0:1.0:0.0:0.0	.	66	Q8NGD4	OR4K1_HUMAN	V	66	ENSP00000285600:L66V	ENSP00000285600:L66V	L	+	1	0	OR4K1	19473861	0.023000	0.18921	0.999000	0.59377	0.993000	0.82548	0.311000	0.19380	2.408000	0.81797	0.655000	0.94253	CTT		0.383	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
METTL3	56339	broad.mit.edu	37	14	21971698	21971698	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr14:21971698T>C	ENST00000298717.4	-	3	492	c.341A>G	c.(340-342)gAt>gGt	p.D114G	METTL3_ENST00000538267.1_Missense_Mutation_p.D114G	NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	114					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)	p.D114G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		TTCTACCCCATCTTGAGTGGC	0.473																																					p.D114G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A341G	14						.						57.0	55.0	56.0					14																	21971698		2203	4300	6503	21041538	SO:0001583	missense	56339	exon3			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.341A>G	14.37:g.21971698T>C	ENSP00000298717:p.Asp114Gly	Somatic		Capture	Illumina HiSeq	Phase_I	21041538	NM_019852	O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	ENST00000298717.4	37	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	T	9.463	1.093543	0.20471	.	.	ENSG00000165819	ENST00000298717;ENST00000538267;ENST00000440691	T;T	0.33216	1.42;1.42	5.36	4.19	0.49359	.	0.568337	0.20528	N	0.090578	T	0.16642	0.0400	N	0.14661	0.345	0.34052	D	0.656295	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.11567	-1.0582	10	0.38643	T	0.18	.	6.6262	0.22830	0.0:0.0803:0.1575:0.7621	.	114;114;114	B4E2F6;B4DTN4;Q86U44	.;.;MTA70_HUMAN	G	114	ENSP00000298717:D114G;ENSP00000442316:D114G	ENSP00000298717:D114G	D	-	2	0	METTL3	21041538	0.989000	0.36119	1.000000	0.80357	0.996000	0.88848	0.647000	0.24812	1.022000	0.39626	0.460000	0.39030	GAT		0.473	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1	NM_019852	
SSTR1	6751	broad.mit.edu	37	14	38679632	38679632	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr14:38679632C>T	ENST00000267377.2	+	3	1655	c.1038C>T	c.(1036-1038)gcC>gcT	p.A346A		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	346					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.A346A(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	TGGACAACGCCGCGGAGGAGC	0.582																																					p.A346A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1038T	14						.						92.0	91.0	91.0					14																	38679632		2203	4300	6503	37749383	SO:0001819	synonymous_variant	6751	exon3				CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.1038C>T	14.37:g.38679632C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37749383	NM_001049		Silent	SNP	ENST00000267377.2	37	CCDS9666.1																																																																																				0.582	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
PPP1R13B	23368	broad.mit.edu	37	14	104212821	104212821	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr14:104212821C>A	ENST00000202556.9	-	9	1321	c.1039G>T	c.(1039-1041)Ggg>Tgg	p.G347W	PPP1R13B_ENST00000423488.2_5'UTR|PPP1R13B_ENST00000555391.1_5'Flank	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	347					intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				ATATAAGGCCCCACAGCAGCG	0.537																																					p.G347W												.	.	0			c.G1039T	14						.						49.0	56.0	54.0					14																	104212821		1967	4158	6125	103282574	SO:0001583	missense	23368	exon9			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.1039G>T	14.37:g.104212821C>A	ENSP00000202556:p.Gly347Trp	None		Capture	Illumina HiSeq	Phase_I	103282574	NM_015316	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	37	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019688	0.93462	.	.	ENSG00000088808	ENST00000202556;ENST00000380023	T	0.57752	0.38	5.62	5.62	0.85841	.	0.047096	0.85682	D	0.000000	T	0.70675	0.3251	L	0.57536	1.79	0.80722	D	1	D	0.67145	0.996	D	0.69824	0.966	T	0.72225	-0.4355	10	0.87932	D	0	.	19.645	0.95773	0.0:1.0:0.0:0.0	.	347	Q96KQ4	ASPP1_HUMAN	W	347;214	ENSP00000202556:G347W	ENSP00000202556:G347W	G	-	1	0	PPP1R13B	103282574	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.424000	0.80242	2.647000	0.89833	0.655000	0.94253	GGG		0.537	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
MEGF11	84465	broad.mit.edu	37	15	66386785	66386785	+	Missense_Mutation	SNP	T	T	G	rs201503694		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr15:66386785T>G	ENST00000409699.2	-	5	521	c.349A>C	c.(349-351)Acc>Ccc	p.T117P	MEGF11_ENST00000360698.4_Missense_Mutation_p.T117P|MEGF11_ENST00000395625.2_Missense_Mutation_p.T42P|MEGF11_ENST00000288745.3_Missense_Mutation_p.T42P|MEGF11_ENST00000422354.1_Missense_Mutation_p.T117P|MEGF11_ENST00000395614.1_5'UTR			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	117	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T117P(1)|p.T42P(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						CAGTGGCAGGTGTCCGGGGAA	0.637																																					p.T117P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A349C	15						.						22.0	22.0	22.0					15																	66386785		2176	4254	6430	64173839	SO:0001583	missense	84465	exon5			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.349A>C	15.37:g.66386785T>G	ENSP00000386908:p.Thr117Pro	Somatic		Capture	Illumina HiSeq	Phase_I	64173839	NM_032445	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	ENST00000409699.2	37	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185081	0.78677	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698	T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37	5.41	5.41	0.78517	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.64450	0.2599	M	0.87827	2.91	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.76575	0.983;0.988	T	0.69143	-0.5223	9	0.46703	T	0.11	.	14.6296	0.68647	0.0:0.0:0.0:1.0	.	117;42	A6BM72;A6BM72-2	MEG11_HUMAN;.	P	117;42;117;42;117	ENSP00000386908:T117P;ENSP00000288745:T42P;ENSP00000414475:T117P;ENSP00000378987:T42P;ENSP00000353919:T117P	ENSP00000288745:T42P	T	-	1	0	MEGF11	64173839	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.553000	0.60753	2.057000	0.61298	0.533000	0.62120	ACC		0.637	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
LAT	27040	broad.mit.edu	37	16	28997967	28997967	+	Silent	SNP	G	G	A	rs146679097		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr16:28997967G>A	ENST00000360872.5	+	6	495	c.417G>A	c.(415-417)tcG>tcA	p.S139S	LAT_ENST00000395461.3_Intron|LAT_ENST00000354453.4_Silent_p.S129S|LAT_ENST00000395456.2_Intron|LAT_ENST00000564277.1_Intron|LAT_ENST00000454369.2_Intron|LAT_ENST00000566177.1_Silent_p.S138S|RP11-264B17.3_ENST00000569969.1_RNA|RP11-264B17.5_ENST00000561471.1_RNA|LAT_ENST00000563964.1_Intron			O43561	LAT_HUMAN	linker for activation of T cells	139					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)	p.S139S(1)		large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CCCCTGTGTCGTTACCCCCAG	0.637																																					p.S139S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G417A	16						.	G	,,,	1,4393	2.1+/-5.4	0,1,2196	85.0	79.0	81.0		,,,417	-3.7	0.0	16	dbSNP_134	81	0,8600		0,0,4300	no	intron,intron,intron,coding-synonymous	LAT	NM_001014987.1,NM_001014988.1,NM_001014989.1,NM_014387.3	,,,	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	,,,	,,,139/263	28997967	1,12993	2197	4300	6497	28905468	SO:0001819	synonymous_variant	27040	exon6			AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.417G>A	16.37:g.28997967G>A		Somatic		Capture	Illumina HiSeq	Phase_I	28905468	NM_014387	B7WPI0|C7C5T6|G5E9K3|O43919	Silent	SNP	ENST00000360872.5	37	CCDS10647.1																																																																																				0.637	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
DYNC1LI2	1783	broad.mit.edu	37	16	66768139	66768139	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr16:66768139G>A	ENST00000258198.2	-	6	981	c.775C>T	c.(775-777)Cgg>Tgg	p.R259W	RP11-63M22.2_ENST00000569274.1_RNA|DYNC1LI2_ENST00000379482.2_Intron|DYNC1LI2_ENST00000440564.2_Missense_Mutation_p.R220W|DYNC1LI2_ENST00000443351.2_Missense_Mutation_p.R182W	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	259					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R259W(1)		central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		CAGAACCTCCGCAGGTGTGAC	0.532																																					p.R259W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C775T	16						.						132.0	103.0	113.0					16																	66768139		2200	4300	6500	65325640	SO:0001583	missense	1783	exon6			AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.775C>T	16.37:g.66768139G>A	ENSP00000258198:p.Arg259Trp	Somatic		Capture	Illumina HiSeq	Phase_I	65325640	NM_006141	A8K6V1|B4DZP4|Q8TAT3	Missense_Mutation	SNP	ENST00000258198.2	37	CCDS10818.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331614	0.81690	.	.	ENSG00000135720	ENST00000258198;ENST00000443351;ENST00000440564	T;T;T	0.37752	1.18;1.18;1.18	5.02	4.05	0.47172	.	0.162139	0.53938	D	0.000051	T	0.66416	0.2787	M	0.90705	3.14	0.80722	D	1	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	P;D;D;D	0.97110	0.817;0.998;0.993;1.0	T	0.75808	-0.3187	10	0.87932	D	0	-1.8795	14.8221	0.70082	0.0:0.0:0.8547:0.1453	.	220;259;182;259	B4E2E0;B4DHD8;B4DZP4;O43237	.;.;.;DC1L2_HUMAN	W	259;182;220	ENSP00000258198:R259W;ENSP00000394289:R182W;ENSP00000408566:R220W	ENSP00000258198:R259W	R	-	1	2	DYNC1LI2	65325640	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.026000	0.64103	1.440000	0.47531	0.655000	0.94253	CGG		0.532	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268846.1	NM_006141	
DPEP2	64174	broad.mit.edu	37	16	68023299	68023299	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr16:68023299G>A	ENST00000572888.1	-	8	1647	c.997C>T	c.(997-999)Cac>Tac	p.H333Y	DPEP2_ENST00000393847.1_Missense_Mutation_p.H333Y|DPEP2_ENST00000412757.2_Missense_Mutation_p.H333Y			Q9H4A9	DPEP2_HUMAN	dipeptidase 2	333					arachidonic acid metabolic process (GO:0019369)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)	p.H333Y(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		TGGTCGAAGTGATCTGGGGAG	0.582																																					p.H333Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C997T	16						.						106.0	83.0	90.0					16																	68023299		2198	4300	6498	66580800	SO:0001583	missense	64174	exon9			AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261	3.4.13.19		23028	protein-coding gene	gene with protein product		609925					Standard	NM_022355		Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.997C>T	16.37:g.68023299G>A	ENSP00000458977:p.His333Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	66580800	NM_022355	B2RCF8|Q6UX92|Q8TC95	Missense_Mutation	SNP	ENST00000572888.1	37	CCDS10857.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.213761	0.58452	.	.	ENSG00000167261	ENST00000393847;ENST00000412757;ENST00000322384	T;T	0.27890	1.64;1.64	4.39	4.39	0.52855	.	0.055844	0.64402	D	0.000001	T	0.69700	0.3140	H	0.98466	4.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	T	0.80390	-0.1402	10	0.87932	D	0	-8.6823	12.7642	0.57383	0.0:0.0:1.0:0.0	.	333;246	Q9H4A9;Q9H4A9-2	DPEP2_HUMAN;.	Y	333;333;246	ENSP00000377430:H333Y;ENSP00000412549:H333Y	ENSP00000314702:H246Y	H	-	1	0	DPEP2	66580800	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	6.125000	0.71627	2.744000	0.94065	0.561000	0.74099	CAC		0.582	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437026.1	NM_022355	
NLK	51701	broad.mit.edu	37	17	26449664	26449664	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr17:26449664C>T	ENST00000407008.3	+	2	1212	c.494C>T	c.(493-495)gCg>gTg	p.A165V		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Required for interaction with TAB2. {ECO:0000250}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.A165V(1)|p.A153V(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		AAGAGAGTAGCGCTCAAAAAG	0.398																																					p.A165V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C494T	17						.						138.0	138.0	138.0					17																	26449664		2203	4300	6503	23473791	SO:0001583	missense	51701	exon2			AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.494C>T	17.37:g.26449664C>T	ENSP00000384625:p.Ala165Val	Somatic		Capture	Illumina HiSeq	Phase_I	23473791	NM_016231	B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	ENST00000407008.3	37	CCDS11224.2	.	.	.	.	.	.	.	.	.	.	C	35	5.467829	0.96257	.	.	ENSG00000087095	ENST00000407008	T	0.72725	-0.68	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	L	0.49513	1.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82754	-0.0301	10	0.87932	D	0	-2.0223	18.6315	0.91361	0.0:1.0:0.0:0.0	.	165	Q9UBE8	NLK_HUMAN	V	165	ENSP00000384625:A165V	ENSP00000384625:A165V	A	+	2	0	NLK	23473791	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.638000	0.89438	0.591000	0.81541	GCG		0.398	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255607.3	NM_016231	
ACACA	31	broad.mit.edu	37	17	35487126	35487126	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr17:35487126A>G	ENST00000394406.2	-	46	5777	c.5587T>C	c.(5587-5589)Tac>Cac	p.Y1863H	ACACA_ENST00000360679.3_Missense_Mutation_p.Y1805H|ACACA_ENST00000353139.5_Missense_Mutation_p.Y1900H|ACACA_ENST00000361253.5_5'UTR|ACACA_ENST00000335166.5_Missense_Mutation_p.Y1785H	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1863	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.Y1900H(1)|p.Y1805H(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TTGGAGGTGTACACTTCCCGC	0.473																																					p.Y1900H	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T5698C	17						.						155.0	141.0	146.0					17																	35487126		2203	4300	6503	32561239	SO:0001583	missense	31	exon46			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5587T>C	17.37:g.35487126A>G	ENSP00000377928:p.Tyr1863His	Somatic		Capture	Illumina HiSeq	Phase_I	32561239	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.712134	0.89112	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.97906	-4.6;-4.6;-4.6;-4.6	5.83	5.83	0.93111	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98969	0.9649	M	0.91406	3.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;1.0	D	0.99686	1.1000	10	0.87932	D	0	-12.2523	16.1846	0.81942	1.0:0.0:0.0:0.0	.	562;1900;1863;1805	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	H	1900;1805;1863;1887;1785;562	ENSP00000344789:Y1900H;ENSP00000353898:Y1805H;ENSP00000377928:Y1863H;ENSP00000335323:Y1785H	ENSP00000335323:Y1785H	Y	-	1	0	ACACA	32561239	1.000000	0.71417	0.237000	0.24090	0.968000	0.65278	9.339000	0.96797	2.229000	0.72834	0.533000	0.62120	TAC		0.473	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
BRIP1	83990	broad.mit.edu	37	17	59761057	59761057	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr17:59761057G>C	ENST00000259008.2	-	20	3617	c.3350C>G	c.(3349-3351)tCa>tGa	p.S1117*		NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	1117					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1117*(1)		NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						ATCTCTATTTGAAGTGGACTG	0.353			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.S1117X		yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3350G	17						.						81.0	81.0	81.0					17																	59761057		2203	4300	6503	57115839	SO:0001587	stop_gained	83990	exon20			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.3350C>G	17.37:g.59761057G>C	ENSP00000259008:p.Ser1117*	Somatic		Capture	Illumina HiSeq	Phase_I	57115839	NM_032043	Q3MJE2|Q8NCI5	Nonsense_Mutation	SNP	ENST00000259008.2	37	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	G	38	7.039575	0.98021	.	.	ENSG00000136492	ENST00000259008	.	.	.	5.59	3.25	0.37280	.	1.257810	0.05502	N	0.558553	.	.	.	.	.	.	0.19575	N	0.999962	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.8369	5.457	0.16596	0.2971:0.0:0.7029:0.0	.	.	.	.	X	1117	.	.	S	-	2	0	BRIP1	57115839	0.784000	0.28713	0.053000	0.19242	0.351000	0.29236	2.795000	0.47861	1.497000	0.48584	0.557000	0.71058	TCA		0.353	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
TP53	7157	broad.mit.edu	37	17	7577573	7577573	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr17:7577573G>C	ENST00000269305.4	-	7	897	c.708C>G	c.(706-708)taC>taG	p.Y236*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Y236*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Y236*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Y236*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Nonsense_Mutation_p.Y236*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Y236*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	236	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y236*(12)|p.0?(8)|p.?(5)|p.Y236del(4)|p.Y236Y(2)|p.Y236_M237delYM(1)|p.Y236_M237insXX(1)|p.H233fs*6(1)|p.N235_Y236delNY(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.Y143*(1)|p.I232_Y236delIHYNY(1)|p.Y236_M237>*L(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGTTACACATGTAGTTGTAGT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y236X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-1 	.	41	Substitution - Nonsense(13)|Deletion - In frame(9)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(2)|Substitution - coding silent(2)|Insertion - In frame(1)|Complex - compound substitution(1)	upper_aerodigestive_tract(6)|biliary_tract(5)|large_intestine(5)|central_nervous_system(4)|oesophagus(4)|bone(4)|liver(3)|stomach(2)|breast(2)|lung(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|ovary(1)|pancreas(1)	c.C708G	17	GRCh37	CD951866	TP53	D		.						127.0	100.0	109.0					17																	7577573		2203	4300	6503	7518298	SO:0001587	stop_gained	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.708C>G	17.37:g.7577573G>C	ENSP00000269305:p.Tyr236*	Somatic		Capture	Illumina HiSeq	Phase_I	7518298	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842838	0.51057	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	4.09	4.09	0.47781	.	0.335105	0.32884	N	0.005532	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-12.7522	7.9496	0.30006	0.1082:0.0:0.8918:0.0	.	.	.	.	X	236;236;236;236;236;236;225;143;104;143	.	ENSP00000269305:Y236X	Y	-	3	2	TP53	7518298	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.890000	0.28295	2.564000	0.86499	0.462000	0.41574	TAC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MRC2	9902	broad.mit.edu	37	17	60758456	60758456	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr17:60758456G>C	ENST00000303375.5	+	18	3070	c.2668G>C	c.(2668-2670)Ggc>Cgc	p.G890R	RNU6-446P_ENST00000362827.1_RNA|MRC2_ENST00000446119.2_5'Flank	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	890	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.G890R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CTGGTGGATCGGCCTGCACAC	0.682																																					p.G890R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2668C	17						.						34.0	30.0	31.0					17																	60758456		2203	4299	6502	58112188	SO:0001583	missense	9902	exon18			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2668G>C	17.37:g.60758456G>C	ENSP00000307513:p.Gly890Arg	Somatic		Capture	Illumina HiSeq	Phase_I	58112188	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985994	0.93044	.	.	ENSG00000011028	ENST00000303375	T	0.67865	-0.29	4.9	4.9	0.64082	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	D	0.88455	0.6441	H	0.97659	4.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91979	0.5593	10	0.49607	T	0.09	-31.0745	18.0944	0.89483	0.0:0.0:1.0:0.0	.	890	Q9UBG0	MRC2_HUMAN	R	890	ENSP00000307513:G890R	ENSP00000307513:G890R	G	+	1	0	MRC2	58112188	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.795000	0.91872	2.251000	0.74343	0.561000	0.74099	GGC		0.682	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
LAMA3	3909	broad.mit.edu	37	18	21512243	21512243	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr18:21512243T>C	ENST00000313654.9	+	66	8937	c.8696T>C	c.(8695-8697)gTt>gCt	p.V2899A	LAMA3_ENST00000399516.3_Missense_Mutation_p.V2843A|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Missense_Mutation_p.V1234A|LAMA3_ENST00000269217.6_Missense_Mutation_p.V1290A	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2899	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.V2899A(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ATTAGCAATGTTTTTGTCCAG	0.473																																					p.V1234A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3701C	18						.						150.0	130.0	137.0					18																	21512243		2203	4300	6503	19766241	SO:0001583	missense	3909	exon28			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8696T>C	18.37:g.21512243T>C	ENSP00000324532:p.Val2899Ala	Somatic		Capture	Illumina HiSeq	Phase_I	19766241	NM_001127718	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081679	0.76528	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.81163	-1.46;-1.46;-1.46	5.91	5.91	0.95273	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.88051	0.6333	M	0.68317	2.08	0.47407	D	0.999412	D;D;D;D	0.76494	0.999;0.999;0.998;0.999	D;D;D;D	0.83275	0.994;0.996;0.951;0.977	D	0.87882	0.2678	9	0.46703	T	0.11	.	13.8716	0.63622	0.0:0.0:0.0:1.0	.	1234;1290;2843;2899	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	A	2899;2843;1290	ENSP00000324532:V2899A;ENSP00000382432:V2843A;ENSP00000269217:V1290A	ENSP00000269217:V1290A	V	+	2	0	LAMA3	19766241	0.580000	0.26733	0.202000	0.23494	0.928000	0.56348	2.817000	0.48034	2.254000	0.74563	0.533000	0.62120	GTT		0.473	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
ALPK2	115701	broad.mit.edu	37	18	56184320	56184320	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr18:56184320C>T	ENST00000361673.3	-	9	5973	c.5760G>A	c.(5758-5760)acG>acA	p.T1920T		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1920	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T1281T(1)|p.T1920T(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GCAGCTCCTCCGTGGCGATCT	0.547																																					p.T1920T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G5760A	18						.						113.0	104.0	107.0					18																	56184320		2203	4300	6503	54335300	SO:0001819	synonymous_variant	115701	exon9			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5760G>A	18.37:g.56184320C>T		Somatic		Capture	Illumina HiSeq	Phase_I	54335300	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2																																																																																				0.547	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
TNFRSF11A	8792	broad.mit.edu	37	18	60027225	60027225	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr18:60027225A>G	ENST00000586569.1	+	6	597	c.559A>G	c.(559-561)Aca>Gca	p.T187A	TNFRSF11A_ENST00000269485.7_Missense_Mutation_p.T187A	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	187					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)	p.T187A(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				ACATCATGGGACAGAGAAATC	0.428																																					p.T187A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A559G	18						.						117.0	106.0	110.0					18																	60027225		2203	4300	6503	58178205	SO:0001583	missense	8792	exon6			AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.559A>G	18.37:g.60027225A>G	ENSP00000465500:p.Thr187Ala	Somatic		Capture	Illumina HiSeq	Phase_I	58178205	NM_003839	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	ENST00000586569.1	37	CCDS11980.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591899	0.86953	.	.	ENSG00000141655	ENST00000382790;ENST00000269485	T	0.62232	0.04	4.89	4.89	0.63831	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.058087	0.64402	D	0.000002	T	0.76263	0.3963	M	0.92555	3.32	0.37651	D	0.922396	P;D	0.63880	0.805;0.993	B;P	0.50708	0.227;0.648	D	0.85022	0.0912	9	.	.	.	-15.363	12.319	0.54973	1.0:0.0:0.0:0.0	.	209;187	Q59EP9;Q9Y6Q6	.;TNR11_HUMAN	A	209;187	ENSP00000269485:T187A	.	T	+	1	0	TNFRSF11A	58178205	1.000000	0.71417	0.893000	0.35052	0.524000	0.34500	4.547000	0.60712	2.174000	0.68829	0.529000	0.55759	ACA		0.428	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2		
TLE2	7089	broad.mit.edu	37	19	3019712	3019712	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr19:3019712C>T	ENST00000262953.6	-	6	616	c.354G>A	c.(352-354)ctG>ctA	p.L118L	TLE2_ENST00000443826.3_Silent_p.L63L|TLE2_ENST00000586422.1_Silent_p.L63L|TLE2_ENST00000455444.2_Silent_p.L63L|TLE2_ENST00000426948.2_Silent_p.L131L|TLE2_ENST00000590536.1_Silent_p.L118L|TLE2_ENST00000447365.2_5'UTR|TLE2_ENST00000587217.1_5'UTR|TLE2_ENST00000591529.1_Silent_p.L131L	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	118	Gln-rich.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.L118L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGGCTGTTCAGCTCCCCCA	0.652																																					p.L63L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G189A	19						.						27.0	37.0	34.0					19																	3019712		2068	4199	6267	2970712	SO:0001819	synonymous_variant	7089	exon6			M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.354G>A	19.37:g.3019712C>T		Somatic		Capture	Illumina HiSeq	Phase_I	2970712	NM_001144762	B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Silent	SNP	ENST00000262953.6	37	CCDS45911.1																																																																																				0.652	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452194.2	NM_003260	
BABAM1	29086	broad.mit.edu	37	19	17387313	17387313	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr19:17387313A>C	ENST00000359435.4	+	7	772	c.579A>C	c.(577-579)aaA>aaC	p.K193N	BABAM1_ENST00000595632.1_Missense_Mutation_p.K118N|BABAM1_ENST00000447614.2_Missense_Mutation_p.K193N|BABAM1_ENST00000448635.2_3'UTR|BABAM1_ENST00000601043.1_Missense_Mutation_p.K193N|BABAM1_ENST00000598188.1_Missense_Mutation_p.K193N|CTD-2278I10.6_ENST00000596542.1_Missense_Mutation_p.K115N	NM_001033549.1	NP_001028721.1	Q9NWV8	BABA1_HUMAN	BRISC and BRCA1 A complex member 1	193	VWFA-like.				chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K193N(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5						GCCAGCAGAAAACTGAGCTTC	0.612																																					p.K193N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A579C	19						.						27.0	31.0	29.0					19																	17387313		1997	4141	6138	17248313	SO:0001583	missense	29086	exon7			AK000578	CCDS46012.1, CCDS74310.1	19p13.11	2011-02-21	2011-02-21	2011-01-31	ENSG00000105393	ENSG00000105393			25008	protein-coding gene	gene with protein product	"""Mediator of Rap80 Interactions and Targeting 40 kD"", ""new component of the BRCA1 A complex"""	612766	"""chromosome 19 open reading frame 62"""	C19orf62		11042152	Standard	NM_001288756		Approved	FLJ20571, HSPC142, NBA1, MERIT40	uc002nfv.3	Q9NWV8		ENST00000359435.4:c.579A>C	19.37:g.17387313A>C	ENSP00000352408:p.Lys193Asn	Somatic		Capture	Illumina HiSeq	Phase_I	17248313	NM_001033549	A8MQT0|B4DRY9|B4DVR1|Q6FIA0|Q9P018	Missense_Mutation	SNP	ENST00000359435.4	37	CCDS46012.1	.	.	.	.	.	.	.	.	.	.	A	9.910	1.209217	0.22205	.	.	ENSG00000105393	ENST00000359435;ENST00000447614;ENST00000448635;ENST00000300965	.	.	.	5.63	3.51	0.40186	.	0.055819	0.64402	D	0.000001	T	0.52933	0.1765	L	0.54323	1.7	0.20403	N	0.9999	D;P	0.76494	0.999;0.764	D;B	0.67548	0.952;0.215	T	0.41592	-0.9500	9	0.72032	D	0.01	-52.3172	7.3688	0.26790	0.2706:0.0:0.7294:0.0	.	118;193	Q9NWV8-3;Q9NWV8	.;BABA1_HUMAN	N	193;193;118;115	.	ENSP00000300965:K115N	K	+	3	2	BABAM1	17248313	1.000000	0.71417	0.995000	0.50966	0.047000	0.14425	3.494000	0.53273	0.720000	0.32209	-0.462000	0.05337	AAA		0.612	BABAM1-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463471.1	NM_014173	
FCGBP	8857	broad.mit.edu	37	19	40368844	40368844	+	Silent	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr19:40368844G>A	ENST00000221347.6	-	28	12511	c.12504C>T	c.(12502-12504)tcC>tcT	p.S4168S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4168	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.S4168S(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CGTCGGCCACGGAGACAGGCA	0.622																																					p.S4168S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C12504T	19						.						172.0	170.0	171.0					19																	40368844		2203	4300	6503	45060684	SO:0001819	synonymous_variant	8857	exon28			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12504C>T	19.37:g.40368844G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45060684	NM_003890	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FCER2	2208	broad.mit.edu	37	19	7754294	7754294	+	Missense_Mutation	SNP	T	T	G	rs200736793		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr19:7754294T>G	ENST00000346664.5	-	11	963	c.751A>C	c.(751-753)Acc>Ccc	p.T251P	FCER2_ENST00000360067.4_Missense_Mutation_p.T250P|FCER2_ENST00000597921.1_Missense_Mutation_p.T251P	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	251	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						CTCCGGCTGGTGGGCTCCCCT	0.687																																					p.T251P												.	.	0			c.A751C	19						.						6.0	7.0	7.0					19																	7754294		2120	4166	6286	7660294	SO:0001583	missense	2208	exon11			M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.751A>C	19.37:g.7754294T>G	ENSP00000264072:p.Thr251Pro	None		Capture	Illumina HiSeq	Phase_I	7660294	NM_002002		Missense_Mutation	SNP	ENST00000346664.5	37	CCDS12184.1	.	.	.	.	.	.	.	.	.	.	T	8.019	0.759209	0.15846	.	.	ENSG00000104921	ENST00000346664;ENST00000360067	T;T	0.17370	2.28;2.28	3.81	2.79	0.32731	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.11324	0.0276	N	0.20610	0.595	0.21147	N	0.999773	B	0.13145	0.007	B	0.19946	0.027	T	0.29243	-1.0018	9	0.87932	D	0	.	6.5431	0.22390	0.0:0.1197:0.0:0.8803	.	251	P06734	FCER2_HUMAN	P	251;250	ENSP00000264072:T251P;ENSP00000353178:T250P	ENSP00000264072:T251P	T	-	1	0	FCER2	7660294	1.000000	0.71417	0.379000	0.26080	0.001000	0.01503	2.492000	0.45311	0.311000	0.23014	-1.099000	0.02127	ACC		0.687	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461832.1	NM_002002	
STRN4	29888	broad.mit.edu	37	19	47223960	47223960	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr19:47223960G>A	ENST00000263280.6	-	17	2210	c.2161C>T	c.(2161-2163)Cgc>Tgc	p.R721C	STRN4_ENST00000594357.2_5'Flank|STRN4_ENST00000391910.3_Missense_Mutation_p.R728C|STRN4_ENST00000539396.1_Missense_Mutation_p.R602C	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	721						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.R721C(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		TGCTTCTTGCGGTGGGCCGTG	0.627																																					p.R728C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2182T	19						.						160.0	112.0	128.0					19																	47223960		2203	4300	6503	51915800	SO:0001583	missense	29888	exon17			AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.2161C>T	19.37:g.47223960G>A	ENSP00000263280:p.Arg721Cys	Somatic		Capture	Illumina HiSeq	Phase_I	51915800	NM_001039877	A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Missense_Mutation	SNP	ENST00000263280.6	37	CCDS12690.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082450	0.76528	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396	T;T;T	0.67865	-0.29;-0.24;-0.12	4.45	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	D	0.85120	0.5624	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.95	D	0.88983	0.3409	10	0.87932	D	0	-21.4832	16.0134	0.80420	0.0:0.0:1.0:0.0	.	728;721	F8VYA6;Q9NRL3	.;STRN4_HUMAN	C	728;721;602	ENSP00000375777:R728C;ENSP00000263280:R721C;ENSP00000440901:R602C	ENSP00000263280:R721C	R	-	1	0	STRN4	51915800	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.632000	0.67819	2.294000	0.77228	0.462000	0.41574	CGC		0.627	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466607.2		
UBL4B	164153	broad.mit.edu	37	1	110655266	110655266	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr1:110655266C>A	ENST00000334179.3	+	1	205	c.110C>A	c.(109-111)cCt>cAt	p.P37H	RP4-773N10.6_ENST00000554808.1_RNA	NM_203412.1	NP_981957.1	Q8N7F7	UBL4B_HUMAN	ubiquitin-like 4B	37	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	7		all_cancers(81;1.14e-05)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0236)|all cancers(265;0.0823)|Epithelial(280;0.0917)|Colorectal(144;0.109)|LUSC - Lung squamous cell carcinoma(189;0.134)		CTGAAGGTGCCTGAGGAGCAG	0.572																																					p.P37H												.	.	0			c.C110A	1						.						93.0	89.0	90.0					1																	110655266		2203	4300	6503	110456789	SO:0001583	missense	164153	exon1				CCDS820.1	1p13.3	2013-09-24			ENSG00000186150	ENSG00000186150			32309	protein-coding gene	gene with protein product		611127				16872915	Standard	NM_203412		Approved	FLJ25690	uc001dzc.3	Q8N7F7	OTTHUMG00000166989	ENST00000334179.3:c.110C>A	1.37:g.110655266C>A	ENSP00000334044:p.Pro37His	None		Capture	Illumina HiSeq	Phase_I	110456789	NM_203412		Missense_Mutation	SNP	ENST00000334179.3	37	CCDS820.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552002	0.65311	.	.	ENSG00000186150	ENST00000334179	T	0.79141	-1.24	4.6	4.6	0.57074	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.90421	0.7001	H	0.96175	3.78	0.49130	D	0.999759	D	0.89917	1.0	D	0.97110	1.0	D	0.92996	0.6419	10	0.87932	D	0	-17.8745	14.4158	0.67148	0.0:1.0:0.0:0.0	.	37	Q8N7F7	UBL4B_HUMAN	H	37	ENSP00000334044:P37H	ENSP00000334044:P37H	P	+	2	0	UBL4B	110456789	0.952000	0.32445	0.948000	0.38648	0.763000	0.43281	2.131000	0.42074	2.366000	0.80165	0.655000	0.94253	CCT		0.572	UBL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392303.1	NM_203412	
ADORA3	140	broad.mit.edu	37	1	112029214	112029214	+	Missense_Mutation	SNP	C	C	A	rs149995903		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr1:112029214C>A	ENST00000369716.4	-	4	999	c.866G>T	c.(865-867)cGc>cTc	p.R289L	ADORA3_ENST00000369717.4_Missense_Mutation_p.R208L	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.R208H(1)|p.R289L(1)|p.R289H(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	TCACCTGGAGCGGTCAGCCTT	0.532																																					p.R208L												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.G623T	1						.						87.0	78.0	81.0					1																	112029214		2203	4300	6503	111830737	SO:0001583	missense	140	exon4			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.866G>T	1.37:g.112029214C>A	ENSP00000358730:p.Arg289Leu	Somatic		Capture	Illumina HiSeq	Phase_I	111830737	NM_001081976	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000369716.4	37	CCDS838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.834|7.834	0.720562|0.720562	0.15372|0.15372	.|.	.|.	ENSG00000121933|ENSG00000121933	ENST00000414219;ENST00000442484|ENST00000369717;ENST00000369716;ENST00000355437;ENST00000443498	.|T;T	.|0.52983	.|2.49;0.64	4.61|4.61	-4.0|-4.0	0.04057|0.04057	.|.	.|0.932228	.|0.08991	.|N	.|0.864413	T|T	0.10423|0.10423	0.0255|0.0255	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B;B	.|0.23185	.|0.01;0.081	.|B;B	.|0.20577	.|0.027;0.03	T|T	0.30179|0.30179	-0.9987|-0.9987	5|10	.|0.25751	.|T	.|0.34	-1.9481|-1.9481	10.5228|10.5228	0.44929|0.44929	0.0:0.4493:0.0:0.5507|0.0:0.4493:0.0:0.5507	.|.	.|208;289	.|Q5QNY7;P33765-2	.|.;.	S|L	149;102|208;289;120;114	.|ENSP00000358731:R208L;ENSP00000358730:R289L	.|ENSP00000347612:R120L	A|R	-|-	1|2	0|0	ADORA3|ADORA3	111830737|111830737	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.015000|0.015000	0.08874|0.08874	-3.833000|-3.833000	0.00355|0.00355	-0.684000|-0.684000	0.05183|0.05183	-1.149000|-1.149000	0.01842|0.01842	GCT|CGC		0.532	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
GATAD2B	57459	broad.mit.edu	37	1	153792123	153792123	+	Missense_Mutation	SNP	T	T	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr1:153792123T>A	ENST00000368655.4	-	3	667	c.424A>T	c.(424-426)Atg>Ttg	p.M142L		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	142					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.M142L(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTTTCTTCCATTCTGGAACTG	0.398																																					p.M142L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A424T	1						.						109.0	113.0	112.0					1																	153792123		2203	4300	6503	152058747	SO:0001583	missense	57459	exon3			AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.424A>T	1.37:g.153792123T>A	ENSP00000357644:p.Met142Leu	Somatic		Capture	Illumina HiSeq	Phase_I	152058747	NM_020699	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.508418	0.44660	.	.	ENSG00000143614	ENST00000368655	T	0.27890	1.64	5.06	5.06	0.68205	.	0.103138	0.64402	D	0.000002	T	0.04952	0.0133	N	0.03608	-0.345	0.31040	N	0.716438	B	0.09022	0.002	B	0.08055	0.003	T	0.27434	-1.0074	10	0.25751	T	0.34	-8.4181	9.3416	0.38082	0.16:0.0:0.0:0.84	.	142	Q8WXI9	P66B_HUMAN	L	142	ENSP00000357644:M142L	ENSP00000357644:M142L	M	-	1	0	GATAD2B	152058747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.472000	0.60189	2.122000	0.65172	0.455000	0.32223	ATG		0.398	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699	
ILDR2	387597	broad.mit.edu	37	1	166891891	166891891	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr1:166891891C>T	ENST00000271417.3	-	8	1205	c.1150G>A	c.(1150-1152)Gca>Aca	p.A384T	ILDR2_ENST00000529071.1_Missense_Mutation_p.A365T|ILDR2_ENST00000469934.2_Missense_Mutation_p.A384T|ILDR2_ENST00000525740.1_Missense_Mutation_p.A257T|ILDR2_ENST00000526687.1_Missense_Mutation_p.A276T|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000528703.1_Missense_Mutation_p.A325T	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	384					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A384T(1)		NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						CCGCGGCTTGCCCCACTGCTG	0.577																																					p.A384T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1150A	1						.						165.0	174.0	171.0					1																	166891891		2203	4300	6503	165158515	SO:0001583	missense	387597	exon8			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1150G>A	1.37:g.166891891C>T	ENSP00000271417:p.Ala384Thr	Somatic		Capture	Illumina HiSeq	Phase_I	165158515	NM_199351		Missense_Mutation	SNP	ENST00000271417.3	37	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	C	3.019	-0.202277	0.06219	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000469934;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T;T	0.76316	0.57;-1.01;0.53;0.57;-1.01;-0.01	5.24	-10.5	0.00291	.	0.597505	0.17896	N	0.158344	T	0.14485	0.0350	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45760	-0.9239	10	0.13470	T	0.59	.	2.0316	0.03530	0.1148:0.2249:0.2286:0.4318	.	384	Q71H61	ILDR2_HUMAN	T	384;257;384;365;276;325	ENSP00000271417:A384T;ENSP00000436120:A257T;ENSP00000437008:A384T;ENSP00000436882:A365T;ENSP00000434273:A276T;ENSP00000432750:A325T	ENSP00000271417:A384T	A	-	1	0	ILDR2	165158515	0.000000	0.05858	0.005000	0.12908	0.856000	0.48823	-1.155000	0.03163	-2.005000	0.00959	-0.367000	0.07326	GCA		0.577	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351	
STX6	10228	broad.mit.edu	37	1	180971836	180971836	+	Splice_Site	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr1:180971836C>T	ENST00000258301.5	-	3	443	c.206G>A	c.(205-207)aGc>aAc	p.S69N	STX6_ENST00000542060.1_Intron	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	69					endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)	p.S69N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						TTCAACTATGCGTAGGTCAAA	0.368																																					p.S69N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G206A	1						.						128.0	122.0	124.0					1																	180971836		2201	4299	6500	179238459	SO:0001630	splice_region_variant	10228	exon3			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.206-1G>A	1.37:g.180971836C>T		Somatic		Capture	Illumina HiSeq	Phase_I	179238459	NM_005819	B2R652|B4DR17|Q5VY08|Q6FH83	Missense_Mutation	SNP	ENST00000258301.5	37	CCDS1341.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606871	0.28623	.	.	ENSG00000135823	ENST00000258301	.	.	.	5.58	4.67	0.58626	.	0.378650	0.34067	N	0.004282	T	0.54111	0.1838	L	0.34521	1.04	0.24451	N	0.99449	.	.	.	.	.	.	T	0.57207	-0.7851	6	0.19590	T	0.45	.	15.5677	0.76306	0.139:0.861:0.0:0.0	.	.	.	.	N	69	.	ENSP00000258301:S69N	S	-	2	0	STX6	179238459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.966000	0.76073	1.329000	0.45376	0.655000	0.94253	AGC		0.368	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085143.1	NM_005819	Missense_Mutation
FAM129A	116496	broad.mit.edu	37	1	184765071	184765071	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr1:184765071C>T	ENST00000367511.3	-	14	2020	c.1827G>A	c.(1825-1827)ctG>ctA	p.L609L	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	609				L -> P (in Ref. 7; BAB84965). {ECO:0000305}.	negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.L609L(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						TCTCACTACCCAGAACTCCTG	0.547																																					p.L609L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1827A	1						.						64.0	69.0	67.0					1																	184765071		2203	4300	6503	183031694	SO:0001819	synonymous_variant	116496	exon14			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.1827G>A	1.37:g.184765071C>T		Somatic		Capture	Illumina HiSeq	Phase_I	183031694	NM_052966	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Silent	SNP	ENST00000367511.3	37	CCDS1364.1																																																																																				0.547	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
RYR2	6262	broad.mit.edu	37	1	237754132	237754132	+	Missense_Mutation	SNP	T	T	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr1:237754132T>A	ENST00000366574.2	+	31	4317	c.4000T>A	c.(4000-4002)Ttg>Atg	p.L1334M	RYR2_ENST00000542537.1_Missense_Mutation_p.L1318M|RYR2_ENST00000360064.6_Missense_Mutation_p.L1332M	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1334	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L1332M(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAAGAATGACTTGGAAGATTA	0.517																																					p.L1334M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4000A	1						.						90.0	88.0	88.0					1																	237754132		1930	4137	6067	235820755	SO:0001583	missense	6262	exon31			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4000T>A	1.37:g.237754132T>A	ENSP00000355533:p.Leu1334Met	Somatic		Capture	Illumina HiSeq	Phase_I	235820755	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	t	16.29	3.081198	0.55753	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96716	-4.1;-4.07;-4.1	5.23	-4.84	0.03151	.	0.000000	0.46442	D	0.000287	D	0.86606	0.5973	N	0.08118	0	0.37930	D	0.931979	B	0.26195	0.144	B	0.24155	0.051	T	0.67776	-0.5583	10	0.42905	T	0.14	.	7.3114	0.26477	0.1074:0.552:0.1095:0.231	.	1334	Q92736	RYR2_HUMAN	M	1334;1332;1318	ENSP00000355533:L1334M;ENSP00000353174:L1332M;ENSP00000443798:L1318M	ENSP00000353174:L1332M	L	+	1	2	RYR2	235820755	0.000000	0.05858	0.040000	0.18447	0.986000	0.74619	-0.529000	0.06186	-0.974000	0.03550	0.533000	0.62120	TTG		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
GDF5	8200	broad.mit.edu	37	20	34025226	34025226	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr20:34025226C>T	ENST00000374372.1	-	3	986	c.483G>A	c.(481-483)ccG>ccA	p.P161P	GDF5_ENST00000374369.3_Silent_p.P161P			P43026	GDF5_HUMAN	growth differentiation factor 5	161					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)	p.P161P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GTGGGCGAAACGGCTCCTTGG	0.632																																					p.P161P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G483A	20						.						59.0	61.0	61.0					20																	34025226		2203	4300	6503	33488640	SO:0001819	synonymous_variant	8200	exon1			X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.483G>A	20.37:g.34025226C>T		Somatic		Capture	Illumina HiSeq	Phase_I	33488640	NM_000557	E1P5Q2|Q96SB1	Silent	SNP	ENST00000374372.1	37	CCDS13254.1																																																																																				0.632	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
SLC5A3	6526	broad.mit.edu	37	21	35469149	35469149	+	Missense_Mutation	SNP	A	A	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr21:35469149A>T	ENST00000381151.3	+	2	2164	c.1652A>T	c.(1651-1653)aAc>aTc	p.N551I	SLC5A3_ENST00000608209.1_Missense_Mutation_p.N551I|MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	551					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)	p.N551I(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						TCTAAGAAGAACCTGGTGGTG	0.458																																					p.N551I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1652T	21						.						88.0	80.0	82.0					21																	35469149		2203	4300	6503	34391019	SO:0001583	missense	6526	exon2				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1652A>T	21.37:g.35469149A>T	ENSP00000370543:p.Asn551Ile	Somatic		Capture	Illumina HiSeq	Phase_I	34391019	NM_006933	O43489	Missense_Mutation	SNP	ENST00000381151.3	37	CCDS33549.1	.	.	.	.	.	.	.	.	.	.	A	11.48	1.651568	0.29336	.	.	ENSG00000198743	ENST00000381151	T	0.63580	-0.05	5.91	-5.69	0.02428	.	.	.	.	.	T	0.39253	0.1071	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.25984	-1.0116	9	0.56958	D	0.05	.	3.9588	0.09401	0.4651:0.2052:0.2486:0.0811	.	551	P53794	SC5A3_HUMAN	I	551	ENSP00000370543:N551I	ENSP00000370543:N551I	N	+	2	0	SLC5A3	34391019	0.030000	0.19436	0.002000	0.10522	0.910000	0.53928	0.110000	0.15437	-1.005000	0.03417	-0.242000	0.12053	AAC		0.458	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1		
PIK3IP1	113791	broad.mit.edu	37	22	31685639	31685639	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr22:31685639T>G	ENST00000215912.5	-	4	537	c.354A>C	c.(352-354)gaA>gaC	p.E118D	PIK3IP1_ENST00000487265.2_Missense_Mutation_p.E39D|PIK3IP1_ENST00000402249.3_Missense_Mutation_p.E118D|PIK3IP1_ENST00000441972.1_Missense_Mutation_p.E118D|RP3-400N23.6_ENST00000440456.1_RNA	NM_052880.4	NP_443112.2	Q96FE7	P3IP1_HUMAN	phosphoinositide-3-kinase interacting protein 1	118					negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase catalytic subunit binding (GO:0036313)	p.E118D(1)		large_intestine(2)|lung(1)|ovary(1)	4						CTTCAGACGCTTCCTGGATTT	0.612																																					p.E118D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A354C	22						.						22.0	15.0	17.0					22																	31685639		2159	4237	6396	30015639	SO:0001583	missense	113791	exon4			BC011049	CCDS13893.1, CCDS46690.1	22q12.2	2007-04-13			ENSG00000100100	ENSG00000100100			24942	protein-coding gene	gene with protein product						12477932	Standard	NM_052880		Approved	HGFL, MGC17330	uc003akm.3	Q96FE7	OTTHUMG00000151256	ENST00000215912.5:c.354A>C	22.37:g.31685639T>G	ENSP00000215912:p.Glu118Asp	Somatic		Capture	Illumina HiSeq	Phase_I	30015639	NM_001135911	B4DRR9|D1MEI0|O00318|Q49A94|Q86YW2|Q8NCJ9	Missense_Mutation	SNP	ENST00000215912.5	37	CCDS13893.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.66|17.66	3.443926|3.443926	0.63067|0.63067	.|.	.|.	ENSG00000100100|ENSG00000100100	ENST00000215912;ENST00000416925;ENST00000441972;ENST00000487265;ENST00000402249|ENST00000443175	T;T;T;T|T	0.43688|0.61274	0.94;0.94;0.94;0.94|0.12	5.06|5.06	1.76|1.76	0.24704|0.24704	Kringle-like fold (1);|.	0.498029|.	0.22131|.	N|.	0.064193|.	T|T	0.46386|0.46386	0.1390|0.1390	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	D;D;P;D|.	0.76494|.	0.999;0.994;0.578;0.97|.	P;P;B;P|.	0.61070|.	0.883;0.826;0.221;0.584|.	T|T	0.38045|0.38045	-0.9679|-0.9679	10|7	0.39692|0.05721	T|T	0.17|0.95	-11.7194|-11.7194	7.2396|7.2396	0.26090|0.26090	0.0:0.6868:0.0:0.3132|0.0:0.6868:0.0:0.3132	.|.	118;118;39;118|.	B4DRR9;Q96FE7-2;D1MEI0;Q96FE7|.	.;.;.;P3IP1_HUMAN|.	D|T	118;96;118;39;118|141	ENSP00000215912:E118D;ENSP00000415608:E118D;ENSP00000441361:E39D;ENSP00000385204:E118D|ENSP00000414227:K141T	ENSP00000215912:E118D|ENSP00000414227:K141T	E|K	-|-	3|2	2|0	PIK3IP1|PIK3IP1	30015639|30015639	0.053000|0.053000	0.20554|0.20554	0.008000|0.008000	0.14137|0.14137	0.002000|0.002000	0.02628|0.02628	0.667000|0.667000	0.25112|0.25112	0.637000|0.637000	0.30526|0.30526	-0.242000|-0.242000	0.12053|0.12053	GAA|AAG		0.612	PIK3IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321939.1	NM_052880	
PNPLA3	80339	broad.mit.edu	37	22	44333108	44333108	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr22:44333108G>A	ENST00000216180.3	+	6	1108	c.935G>A	c.(934-936)tGg>tAg	p.W312*	PNPLA3_ENST00000423180.2_Nonsense_Mutation_p.W308*	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	312					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				ATCCTGCCCTGGGATGAGAGC	0.592																																					p.W312X												.	.	0			c.G935A	22						.						92.0	74.0	80.0					22																	44333108		2203	4300	6503	42664441	SO:0001587	stop_gained	80339	exon6				CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.935G>A	22.37:g.44333108G>A	ENSP00000216180:p.Trp312*	None		Capture	Illumina HiSeq	Phase_I	42664441	NM_025225	B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Nonsense_Mutation	SNP	ENST00000216180.3	37	CCDS14054.1	.	.	.	.	.	.	.	.	.	.	G	36	5.771348	0.96922	.	.	ENSG00000100344	ENST00000216180;ENST00000423180	.	.	.	4.99	3.94	0.45596	.	0.643571	0.15004	N	0.285962	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-10.3476	11.3903	0.49811	0.0:0.1835:0.8165:0.0	.	.	.	.	X	312;308	.	ENSP00000216180:W312X	W	+	2	0	PNPLA3	42664441	1.000000	0.71417	0.885000	0.34714	0.560000	0.35617	1.730000	0.38125	1.173000	0.42796	0.462000	0.41574	TGG		0.592	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318891.1	NM_025225	
MOV10L1	54456	broad.mit.edu	37	22	50555645	50555645	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr22:50555645G>A	ENST00000262794.5	+	9	1402	c.1319G>A	c.(1318-1320)cGa>cAa	p.R440Q	MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000395858.3_Missense_Mutation_p.R440Q|MOV10L1_ENST00000545383.1_Missense_Mutation_p.R440Q|MOV10L1_ENST00000540615.1_Missense_Mutation_p.R420Q	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	440					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.R440Q(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CTAATTGGGCGATACCTTGAA	0.388																																					p.R440Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1319A	22						.						98.0	97.0	97.0					22																	50555645		2203	4300	6503	48897772	SO:0001583	missense	54456	exon9			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1319G>A	22.37:g.50555645G>A	ENSP00000262794:p.Arg440Gln	Somatic		Capture	Illumina HiSeq	Phase_I	48897772	NM_001164104	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	ENST00000262794.5	37	CCDS14084.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000256	0.93227	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;D;D	0.89617	-2.36;-2.36;-1.96;-2.54	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.94899	0.8351	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.94583	0.7781	10	0.51188	T	0.08	-20.499	18.4598	0.90735	0.0:0.0:1.0:0.0	.	201;420;440;440	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	Q	440;440;440;420	ENSP00000438978:R440Q;ENSP00000262794:R440Q;ENSP00000379199:R440Q;ENSP00000438542:R420Q	ENSP00000262794:R440Q	R	+	2	0	MOV10L1	48897772	1.000000	0.71417	0.943000	0.38184	0.652000	0.38707	7.348000	0.79366	2.648000	0.89879	0.557000	0.71058	CGA		0.388	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
IRS1	3667	broad.mit.edu	37	2	227661233	227661234	+	In_Frame_Ins	INS	-	-	GGC			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:227661233_227661234insGGC	ENST00000305123.5	-	1	3241_3242	c.2221_2222insGCC	c.(2221-2223)tcc>tGCCcc	p.741_741S>CP	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	741					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GCTGGTGTTGGAGTCCCCCACT	0.569											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S741delinsCP												.	.	0			c.2222_2223insGCC	2						.																																			227369478	SO:0001652	inframe_insertion	3667	exon1				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2221_2222insGCC	2.37:g.227661233_227661234insGGC	ENSP00000304895:p.Ser741delinsCysPro	None	2321	Capture	Illumina HiSeq	Phase_I	227369477	NM_005544		In_Frame_Ins	INS	ENST00000305123.5	37	CCDS2463.1																																																																																				0.569	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
NOL10	79954	broad.mit.edu	37	2	10813646	10813646	+	Splice_Site	SNP	C	C	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:10813646C>A	ENST00000381685.5	-	5	432	c.327G>T	c.(325-327)aaG>aaT	p.K109N	NOL10_ENST00000345985.3_Splice_Site_p.K109N|NOL10_ENST00000538384.1_Splice_Site_p.K83N|NOL10_ENST00000542668.1_Splice_Site_p.K59N	NM_024894.3	NP_079170.2	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	109						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K109N(1)				Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		TAAAACATACCTTTGAGTAGT	0.279																																					p.K109N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G327T	2						.						48.0	48.0	48.0					2																	10813646		2203	4294	6497	10731097	SO:0001630	splice_region_variant	79954	exon5			AK024137	CCDS1673.2, CCDS58697.1, CCDS58698.1	2p25.1	2008-05-23			ENSG00000115761	ENSG00000115761			25862	protein-coding gene	gene with protein product			"""polyglutamine binding protein 5"""	PQBP5		12477932	Standard	NM_024894		Approved	FLJ14075	uc002raq.3	Q9BSC4	OTTHUMG00000119023	ENST00000381685.5:c.327+1G>T	2.37:g.10813646C>A		Somatic		Capture	Illumina HiSeq	Phase_I	10731097	NM_024894	A8K3R5|B4DLV0|Q53RC9|Q96TA5|Q9H7Y7|Q9H855	Missense_Mutation	SNP	ENST00000381685.5	37	CCDS1673.2	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918031	0.92249	.	.	ENSG00000115761	ENST00000345985;ENST00000381685;ENST00000542668;ENST00000538384	D;T;T;T	0.87103	-2.21;2.75;-0.24;2.81	5.49	5.49	0.81192	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.95868	0.8655	H	0.95745	3.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.96631	0.9467	10	0.87932	D	0	-29.5384	19.7435	0.96241	0.0:1.0:0.0:0.0	.	83;109;109	B4DLV0;Q9BSC4;Q9BSC4-2	.;NOL10_HUMAN;.	N	109;109;59;83	ENSP00000263837:K109N;ENSP00000371101:K109N;ENSP00000437625:K59N;ENSP00000439663:K83N	ENSP00000263837:K109N	K	-	3	2	NOL10	10731097	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.398000	0.79919	2.750000	0.94351	0.563000	0.77884	AAG		0.279	NOL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239227.1	NM_024894	Missense_Mutation
NMI	9111	broad.mit.edu	37	2	152139415	152139415	+	Silent	SNP	C	C	T	rs148602363		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:152139415C>T	ENST00000243346.5	-	2	518	c.48G>A	c.(46-48)tcG>tcA	p.S16S		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	16			S -> L (in dbSNP:rs1048135).		inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)	p.S16S(1)		endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		ATTCATCTGGCGAATGCTCCT	0.264																																					p.S16S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G48A	2						.	C		0,4398		0,0,2199	53.0	53.0	53.0		48	-4.0	0.0	2	dbSNP_134	53	1,8559	1.2+/-3.3	0,1,4279	no	coding-synonymous	NMI	NM_004688.2		0,1,6478	TT,TC,CC		0.0117,0.0,0.0077		16/308	152139415	1,12957	2199	4280	6479	151847661	SO:0001819	synonymous_variant	9111	exon2			U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.48G>A	2.37:g.152139415C>T		Somatic		Capture	Illumina HiSeq	Phase_I	151847661	NM_004688	B5BU69|Q53TI8|Q9BVE5	Silent	SNP	ENST00000243346.5	37	CCDS2192.1																																																																																				0.264	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254817.2	NM_004688	
RIF1	55183	broad.mit.edu	37	2	152320034	152320034	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:152320034C>G	ENST00000243326.5	+	29	4483	c.4000C>G	c.(4000-4002)Caa>Gaa	p.Q1334E	RIF1_ENST00000453091.2_Missense_Mutation_p.Q1334E|RIF1_ENST00000444746.2_Missense_Mutation_p.Q1334E|RIF1_ENST00000430328.2_Missense_Mutation_p.Q1334E|RIF1_ENST00000428287.2_Missense_Mutation_p.Q1334E			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.Q1334E(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TTTGCTTAATCAAACAGAATG	0.383																																					p.Q1334E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4000G	2						.						68.0	74.0	72.0					2																	152320034		2203	4300	6503	152028280	SO:0001583	missense	55183	exon30			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4000C>G	2.37:g.152320034C>G	ENSP00000243326:p.Gln1334Glu	Somatic		Capture	Illumina HiSeq	Phase_I	152028280	NM_001177664	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	C	0.588	-0.834402	0.02713	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.09350	2.99;2.99;2.99;2.99;2.99	4.7	0.526	0.17078	.	0.714394	0.14214	N	0.333876	T	0.04770	0.0129	L	0.31294	0.92	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.42732	-0.9434	10	0.02654	T	1	0.0359	0.8463	0.01161	0.2519:0.3821:0.1295:0.2365	.	1334;1334	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	E	1334	ENSP00000390181:Q1334E;ENSP00000414615:Q1334E;ENSP00000415691:Q1334E;ENSP00000243326:Q1334E;ENSP00000416123:Q1334E	ENSP00000243326:Q1334E	Q	+	1	0	RIF1	152028280	0.352000	0.24895	0.696000	0.30242	0.839000	0.47603	0.430000	0.21428	0.197000	0.20387	-0.310000	0.09108	CAA		0.383	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
GALNT13	114805	broad.mit.edu	37	2	154801141	154801141	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:154801141C>T	ENST00000392825.3	+	3	698	c.131C>T	c.(130-132)cCt>cTt	p.P44L	GALNT13_ENST00000409237.1_Missense_Mutation_p.P44L	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	44					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P44L(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TCTCTGCTGCCTGCATTGAGG	0.408																																					p.P44L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C131T	2						.						195.0	178.0	183.0					2																	154801141		2203	4300	6503	154509387	SO:0001583	missense	114805	exon3			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.131C>T	2.37:g.154801141C>T	ENSP00000376570:p.Pro44Leu	Somatic		Capture	Illumina HiSeq	Phase_I	154509387	NM_052917	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774509	0.70107	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.54866	0.61;0.55	5.43	5.43	0.79202	.	0.000000	0.47455	U	0.000230	T	0.51652	0.1687	L	0.54323	1.7	0.80722	D	1	B;B	0.10296	0.003;0.0	B;B	0.12156	0.007;0.004	T	0.47005	-0.9150	10	0.46703	T	0.11	.	17.7929	0.88561	0.0:1.0:0.0:0.0	.	44;44	Q08ER7;Q8IUC8	.;GLT13_HUMAN	L	44	ENSP00000376570:P44L;ENSP00000387239:P44L	ENSP00000376570:P44L	P	+	2	0	GALNT13	154509387	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.531000	0.81973	2.542000	0.85734	0.585000	0.79938	CCT		0.408	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917	
ZDBF2	57683	broad.mit.edu	37	2	207175897	207175897	+	Silent	SNP	T	T	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:207175897T>C	ENST00000374423.3	+	5	7031	c.6645T>C	c.(6643-6645)atT>atC	p.I2215I		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2215							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.I2215I(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CAATTTGGATTCGGACCAAAC	0.358																																					p.I2215I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T6645C	2						.						42.0	42.0	42.0					2																	207175897		1807	4082	5889	206884142	SO:0001819	synonymous_variant	57683	exon5			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6645T>C	2.37:g.207175897T>C		Somatic		Capture	Illumina HiSeq	Phase_I	206884142	NM_020923	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	37	CCDS46501.1																																																																																				0.358	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
TNS1	7145	broad.mit.edu	37	2	218713010	218713010	+	Missense_Mutation	SNP	A	A	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:218713010A>T	ENST00000171887.4	-	17	2307	c.1855T>A	c.(1855-1857)Tct>Act	p.S619T	TNS1_ENST00000430930.1_Missense_Mutation_p.S619T|TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000419504.1_Missense_Mutation_p.S619T	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	619					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.S619T(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		AAGGATTGAGAGCGGAACATA	0.642																																					p.S619T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1855A	2						.						61.0	52.0	55.0					2																	218713010		2203	4300	6503	218421255	SO:0001583	missense	7145	exon17			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1855T>A	2.37:g.218713010A>T	ENSP00000171887:p.Ser619Thr	Somatic		Capture	Illumina HiSeq	Phase_I	218421255	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	A	10.43	1.348414	0.24426	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	D;D;D;D	0.95001	-3.34;-3.32;-3.33;-3.58	4.57	4.57	0.56435	.	0.130694	0.52532	D	0.000061	D	0.96087	0.8725	M	0.63843	1.955	0.80722	D	1	D;P;P;D;D	0.63880	0.979;0.774;0.714;0.982;0.993	P;P;B;D;P	0.67548	0.628;0.497;0.287;0.952;0.753	D	0.95914	0.8925	10	0.49607	T	0.09	.	14.0929	0.65002	1.0:0.0:0.0:0.0	.	619;673;619;619;619	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	T	619;619;619;744	ENSP00000171887:S619T;ENSP00000408724:S619T;ENSP00000406016:S619T;ENSP00000405460:S744T	ENSP00000171887:S619T	S	-	1	0	TNS1	218421255	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.216000	0.51176	1.920000	0.55613	0.459000	0.35465	TCT		0.642	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
COL6A3	1293	broad.mit.edu	37	2	238274495	238274495	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr2:238274495G>A	ENST00000295550.4	-	12	6136	c.5684C>T	c.(5683-5685)tCg>tTg	p.S1895L	COL6A3_ENST00000346358.4_Missense_Mutation_p.S1695L|COL6A3_ENST00000347401.3_Missense_Mutation_p.S1694L|COL6A3_ENST00000353578.4_Missense_Mutation_p.S1689L|COL6A3_ENST00000472056.1_Missense_Mutation_p.S1288L|COL6A3_ENST00000409809.1_Missense_Mutation_p.S1689L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1895	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S1895L(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CACCGGGCCCGAGGGCGTGTT	0.632																																					p.S1288L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3863T	2						.						67.0	67.0	67.0					2																	238274495		2203	4300	6503	237939234	SO:0001583	missense	1293	exon9			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5684C>T	2.37:g.238274495G>A	ENSP00000295550:p.Ser1895Leu	Somatic		Capture	Illumina HiSeq	Phase_I	237939234	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	7.677	0.688184	0.14973	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	5.34	5.34	0.76211	von Willebrand factor, type A (2);	0.772734	0.11078	N	0.602119	T	0.45296	0.1335	L	0.54323	1.7	0.09310	N	1	D;D;P	0.56746	0.977;0.973;0.858	P;B;B	0.44946	0.465;0.439;0.163	T	0.39781	-0.9597	10	0.35671	T	0.21	.	14.9262	0.70881	0.0:0.2515:0.7485:0.0	.	1288;1689;1895	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	L	1895;1694;1689;1288;1689;1695	ENSP00000295550:S1895L;ENSP00000315609:S1694L;ENSP00000315873:S1689L;ENSP00000418285:S1288L;ENSP00000386844:S1689L;ENSP00000295546:S1695L	ENSP00000295550:S1895L	S	-	2	0	COL6A3	237939234	0.572000	0.26668	0.035000	0.18076	0.039000	0.13416	3.903000	0.56318	2.665000	0.90641	0.655000	0.94253	TCG		0.632	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
DNAJB8	165721	broad.mit.edu	37	3	128181993	128181993	+	Silent	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:128181993G>A	ENST00000469083.1	-	2	2653	c.96C>T	c.(94-96)ccC>ccT	p.P32P	DNAJB8_ENST00000319153.3_Silent_p.P32P|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	32	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)	p.P32P(1)		kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		GGTTCTTGTCGGGGTGCCAAC	0.567																																					p.P32P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C96T	3						.						141.0	141.0	141.0					3																	128181993		2203	4300	6503	129664683	SO:0001819	synonymous_variant	165721	exon3				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.96C>T	3.37:g.128181993G>A		Somatic		Capture	Illumina HiSeq	Phase_I	129664683	NM_153330	B3KWV7	Silent	SNP	ENST00000469083.1	37	CCDS3048.1																																																																																				0.567	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1	NM_153330	
PLXND1	23129	broad.mit.edu	37	3	129280692	129280692	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:129280692G>A	ENST00000324093.4	-	28	5058	c.4880C>T	c.(4879-4881)tCa>tTa	p.S1627L	PLXND1_ENST00000393239.1_Missense_Mutation_p.S1627L	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1627					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TTCCACCACTGAGGTGTCGTC	0.652																																					p.S1627L	Ovarian(97;366 1484 3738 22084 39045)											.	.	0			c.C4880T	3						.						79.0	71.0	74.0					3																	129280692		2203	4300	6503	130763382	SO:0001583	missense	23129	exon28			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.4880C>T	3.37:g.129280692G>A	ENSP00000317128:p.Ser1627Leu	None		Capture	Illumina HiSeq	Phase_I	130763382	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637312	0.87760	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.14022	2.54;2.54	4.85	4.85	0.62838	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.078294	0.53938	D	0.000060	T	0.40015	0.1100	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.995;0.999	T	0.37337	-0.9710	10	0.87932	D	0	.	17.9837	0.89150	0.0:0.0:1.0:0.0	.	222;1627	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	L	1627	ENSP00000317128:S1627L;ENSP00000376931:S1627L	ENSP00000317128:S1627L	S	-	2	0	PLXND1	130763382	1.000000	0.71417	0.174000	0.22961	0.529000	0.34654	9.693000	0.98684	2.244000	0.73946	0.462000	0.41574	TCA		0.652	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
STAG1	10274	broad.mit.edu	37	3	136141293	136141293	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:136141293C>A	ENST00000383202.2	-	19	2252	c.1996G>T	c.(1996-1998)Gta>Tta	p.V666L	STAG1_ENST00000236698.5_Missense_Mutation_p.V666L|STAG1_ENST00000536929.1_Missense_Mutation_p.V250L|STAG1_ENST00000434713.2_Missense_Mutation_p.V440L	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	666					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.V666L(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AATCGATCTACAAACTCATCA	0.358																																					p.V666L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1996T	3						.						119.0	116.0	117.0					3																	136141293		2203	4300	6503	137623983	SO:0001583	missense	10274	exon19			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1996G>T	3.37:g.136141293C>A	ENSP00000372689:p.Val666Leu	Somatic		Capture	Illumina HiSeq	Phase_I	137623983	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660664	0.67586	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.65	5.65	0.86999	Armadillo-type fold (1);	0.194086	0.45606	D	0.000351	T	0.33876	0.0878	L	0.56340	1.77	0.42832	D	0.994023	B;B;B	0.15930	0.015;0.014;0.015	B;B;B	0.19391	0.025;0.025;0.025	T	0.09314	-1.0680	10	0.22706	T	0.39	.	19.7806	0.96414	0.0:1.0:0.0:0.0	.	683;666;666	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	L	666;666;440;250	ENSP00000372689:V666L;ENSP00000236698:V666L;ENSP00000404396:V440L;ENSP00000445787:V250L	ENSP00000236698:V666L	V	-	1	0	STAG1	137623983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.860000	0.62961	2.668000	0.90789	0.644000	0.83932	GTA		0.358	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
IL20RB	53833	broad.mit.edu	37	3	136701188	136701188	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:136701188C>G	ENST00000329582.4	+	3	651	c.402C>G	c.(400-402)aaC>aaG	p.N134K	IL20RB_ENST00000309741.5_Missense_Mutation_p.N87K|IL20RB_ENST00000484501.1_Intron|IL20RB-AS1_ENST00000462176.2_RNA	NM_144717.3	NP_653318.2	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta	134	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homeostasis of number of cells within a tissue (GO:0048873)|immune response-inhibiting signal transduction (GO:0002765)|inflammatory response to antigenic stimulus (GO:0002437)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of type IV hypersensitivity (GO:0001808)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-4 production (GO:0032753)	integral component of membrane (GO:0016021)		p.N134K(2)		kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14						TTAATAGAAACTCAAGTAAGG	0.488																																					p.N134K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C402G	3						.						97.0	84.0	89.0					3																	136701188		2203	4300	6503	138183878	SO:0001583	missense	53833	exon3			BC033292	CCDS3093.1	3q22.3	2013-02-11			ENSG00000174564	ENSG00000174564		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	6004	protein-coding gene	gene with protein product		605621	"""fibronectin type III domain containing 6"""	FNDC6		11163236, 16703417	Standard	NM_144717		Approved	DIRS1, IL-20R2, MGC34923	uc003eri.2	Q6UXL0	OTTHUMG00000159779	ENST00000329582.4:c.402C>G	3.37:g.136701188C>G	ENSP00000328133:p.Asn134Lys	Somatic		Capture	Illumina HiSeq	Phase_I	138183878	NM_144717	B4DL40|Q6P438|Q8IYY5|Q8TAJ7	Missense_Mutation	SNP	ENST00000329582.4	37	CCDS3093.1	.	.	.	.	.	.	.	.	.	.	C	10.08	1.252980	0.22965	.	.	ENSG00000174564	ENST00000329582;ENST00000309741	T;T	0.74106	-0.81;-0.81	4.91	1.02	0.19986	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.242522	0.28354	N	0.015654	T	0.57066	0.2028	L	0.50333	1.59	0.34629	D	0.719425	P	0.39116	0.66	B	0.29942	0.109	T	0.57791	-0.7750	10	0.20519	T	0.43	-15.6049	6.5255	0.22299	0.0:0.5796:0.0:0.4204	.	134	Q6UXL0	I20RB_HUMAN	K	134;87	ENSP00000328133:N134K;ENSP00000311979:N87K	ENSP00000311979:N87K	N	+	3	2	IL20RB	138183878	0.973000	0.33851	1.000000	0.80357	0.152000	0.21847	-0.152000	0.10159	0.209000	0.20645	-0.424000	0.05967	AAC		0.488	IL20RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357277.2	NM_144717	
LRRC3B	116135	broad.mit.edu	37	3	26751513	26751513	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:26751513C>A	ENST00000396641.2	+	2	942	c.350C>A	c.(349-351)aCt>aAt	p.T117N	LRRC3B_ENST00000456208.2_Missense_Mutation_p.T117N|AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000417744.1_Missense_Mutation_p.T117N	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	117						integral component of membrane (GO:0016021)		p.T117N(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						ACCTTGCAGACTCTGGACTTG	0.473																																					p.T117N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C350A	3						.						64.0	60.0	61.0					3																	26751513		2203	4300	6503	26726517	SO:0001583	missense	116135	exon2			AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.350C>A	3.37:g.26751513C>A	ENSP00000379880:p.Thr117Asn	Somatic		Capture	Illumina HiSeq	Phase_I	26726517	NM_052953	Q5M8T0	Missense_Mutation	SNP	ENST00000396641.2	37	CCDS2644.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612986	0.28712	.	.	ENSG00000179796	ENST00000396641;ENST00000432040;ENST00000417744;ENST00000456208	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	6.17	5.29	0.74685	.	0.148413	0.64402	D	0.000008	D	0.85839	0.5790	N	0.24115	0.695	0.48185	D	0.9996	P	0.41080	0.737	B	0.42245	0.381	D	0.84451	0.0588	10	0.27785	T	0.31	-12.335	16.2932	0.82760	0.0:0.8569:0.1431:0.0	.	117	Q96PB8	LRC3B_HUMAN	N	117	ENSP00000379880:T117N;ENSP00000398184:T117N;ENSP00000406370:T117N;ENSP00000394940:T117N	ENSP00000379880:T117N	T	+	2	0	LRRC3B	26726517	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.820000	0.48057	1.594000	0.50039	0.655000	0.94253	ACT		0.473	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953	
TGM4	7047	broad.mit.edu	37	3	44951585	44951585	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:44951585C>G	ENST00000296125.4	+	11	1399	c.1331C>G	c.(1330-1332)tCc>tGc	p.S444C		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	444					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	CTTTCAGGCTCCTCTGAGGAG	0.532																																					p.S444C												.	.	0			c.C1331G	3						.						50.0	52.0	52.0					3																	44951585		2203	4300	6503	44926589	SO:0001583	missense	7047	exon11			BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.1331C>G	3.37:g.44951585C>G	ENSP00000296125:p.Ser444Cys	None		Capture	Illumina HiSeq	Phase_I	44926589	NM_003241	Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.209932	0.39003	.	.	ENSG00000163810	ENST00000296125	T	0.25414	1.8	2.45	1.48	0.22813	.	0.314797	0.21473	U	0.073975	T	0.53110	0.1776	M	0.90870	3.155	0.37646	D	0.922241	D	0.89917	1.0	D	0.74674	0.984	T	0.59979	-0.7352	10	0.87932	D	0	.	8.3445	0.32263	0.0:0.7384:0.2616:0.0	.	444	P49221	TGM4_HUMAN	C	444	ENSP00000296125:S444C	ENSP00000296125:S444C	S	+	2	0	TGM4	44926589	0.007000	0.16637	0.200000	0.23457	0.189000	0.23516	0.732000	0.26072	0.251000	0.21505	0.467000	0.42956	TCC		0.532	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
NICN1	84276	broad.mit.edu	37	3	49462421	49462421	+	Silent	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:49462421G>A	ENST00000273598.3	-	5	647	c.561C>T	c.(559-561)atC>atT	p.I187I	AMT_ENST00000395338.2_5'Flank|AMT_ENST00000458307.2_5'Flank|AMT_ENST00000546031.1_5'Flank|AMT_ENST00000538581.1_5'Flank|AMT_ENST00000476226.1_5'Flank|NICN1_ENST00000422593.1_5'UTR|NICN1_ENST00000436744.2_Silent_p.I149I|AMT_ENST00000273588.3_5'Flank|NICN1-AS1_ENST00000424915.1_RNA	NM_032316.3	NP_115692.1	Q9BSH3	NICN1_HUMAN	nicolin 1	187						microtubule (GO:0005874)|nucleus (GO:0005634)		p.I187I(1)		kidney(1)|large_intestine(3)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;4.52e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACTGGCCCGGATCATCTCTG	0.587																																					p.I187I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C561T	3						.						94.0	86.0	89.0					3																	49462421		2203	4300	6503	49437425	SO:0001819	synonymous_variant	84276	exon5			AJ299740	CCDS2798.1	3p21.31	2008-07-18			ENSG00000145029	ENSG00000145029			18317	protein-coding gene	gene with protein product		611516				12392556	Standard	NM_032316		Approved	MGC12936	uc003cwz.1	Q9BSH3	OTTHUMG00000156848	ENST00000273598.3:c.561C>T	3.37:g.49462421G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49437425	NM_032316	Q8IZQ2	Silent	SNP	ENST00000273598.3	37	CCDS2798.1																																																																																				0.587	NICN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346224.3	NM_032316	
ROBO2	6092	broad.mit.edu	37	3	77645842	77645842	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:77645842G>C	ENST00000461745.1	+	19	3695	c.2795G>C	c.(2794-2796)aGc>aCc	p.S932T	ROBO2_ENST00000487694.3_Missense_Mutation_p.S948T|ROBO2_ENST00000332191.8_Missense_Mutation_p.S932T	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	932					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.S932T(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCAGCCACGAGCTTGCCAGTA	0.423																																					p.E912D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2736C	3						.						121.0	121.0	121.0					3																	77645842		1843	4101	5944	77728532	SO:0001583	missense	6092	exon18			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2795G>C	3.37:g.77645842G>C	ENSP00000417164:p.Ser932Thr	Somatic		Capture	Illumina HiSeq	Phase_I	77728532	NM_001128929	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.85|17.85|17.85	3.490775|3.490775|3.490775	0.64074|0.64074|0.64074	.|.|.	.|.|.	ENSG00000185008|ENSG00000185008|ENSG00000185008	ENST00000490991|ENST00000471893|ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	.|.|T;T;T	.|.|0.62941	.|.|-0.01;0.03;0.02	6.16|6.16|6.16	6.16|6.16|6.16	0.99307|0.99307|0.99307	.|.|.	.|.|0.000000	.|.|0.53938	.|.|D	.|.|0.000045	T|T|T	0.72423|0.72423|0.72423	0.3458|0.3458|0.3458	L|L|L	0.55481|0.55481|0.55481	1.735|1.735|1.735	.|.|.	.|.|.	.|.|.	.|.|D;D;P	.|.|0.57899	.|.|0.968;0.981;0.934	.|.|P;P;P	.|.|0.56434	.|.|0.633;0.798;0.449	T|T|T	0.64984|0.64984|0.64984	-0.6278|-0.6278|-0.6278	4|4|9	.|.|0.27785	.|.|T	.|.|0.31	.|.|.	20.8598|20.8598|20.8598	0.99761|0.99761|0.99761	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|948;932;932	.|.|Q19AB5;F8W703;Q9HCK4	.|.|.;.;ROBO2_HUMAN	P|D|T	89|6|948;948;952;932;932	.|.|ENSP00000417335:S948T;ENSP00000417164:S932T;ENSP00000327536:S932T	.|.|ENSP00000327536:S932T	A|E|S	+|+|+	1|3|2	0|2|0	ROBO2|ROBO2|ROBO2	77728532|77728532|77728532	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.987000|0.987000|0.987000	0.45799|0.45799|0.45799	0.719000|0.719000|0.719000	0.41307|0.41307|0.41307	7.383000|7.383000|7.383000	0.79741|0.79741|0.79741	2.937000|2.937000|2.937000	0.99478|0.99478|0.99478	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GCT|GAG|AGC		0.423	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
ROBO1	6091	broad.mit.edu	37	3	79067611	79067611	+	Intron	SNP	T	T	A	rs371194414		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:79067611T>A	ENST00000464233.1	-	4	286				ROBO1_ENST00000436010.2_Start_Codon_SNP_p.M1L|ROBO1_ENST00000495273.1_Start_Codon_SNP_p.M1L|ROBO1_ENST00000467549.1_Start_Codon_SNP_p.M1L	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.M1L(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TCCGCAATCATTGTCCTCGGG	0.498																																					p.M1L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1T	3						.						62.0	65.0	64.0					3																	79067611		1912	4116	6028	79150301	SO:0001627	intron_variant	6091	exon1			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.173-79534A>T	3.37:g.79067611T>A		Somatic		Capture	Illumina HiSeq	Phase_I	79150301	NM_133631	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.570762	0.45798	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000495273;ENST00000467549	T;T;T	0.57273	0.42;0.41;0.41	4.85	4.85	0.62838	.	.	.	.	.	T	0.56659	0.2000	.	.	.	0.80722	D	1	B;B;B	0.29805	0.167;0.167;0.257	B;B;P	0.44623	0.267;0.267;0.455	T	0.53995	-0.8359	7	.	.	.	.	14.277	0.66187	0.0:0.0:0.0:1.0	.	1;1;1	B2RXI1;E9PD49;Q9Y6N7-4	.;.;.	L	1	ENSP00000406043:M1L;ENSP00000420637:M1L;ENSP00000417992:M1L	.	M	-	1	0	ROBO1	79150301	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.904000	0.63279	2.033000	0.60031	0.459000	0.35465	ATG		0.498	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
SPATA16	83893	broad.mit.edu	37	3	172737325	172737325	+	Missense_Mutation	SNP	G	G	A	rs141658177		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr3:172737325G>A	ENST00000351008.3	-	4	982	c.799C>T	c.(799-801)Cgt>Tgt	p.R267C		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	267					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)		p.R267C(1)		breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			GTTGCTTGACGAAGATGATTC	0.348																																					p.R267C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C799T	3						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	137.0	144.0	141.0		799	5.9	1.0	3	dbSNP_134	141	0,8600		0,0,4300	no	missense	SPATA16	NM_031955.5	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	267/570	172737325	1,13005	2203	4300	6503	174220019	SO:0001583	missense	83893	exon4			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.799C>T	3.37:g.172737325G>A	ENSP00000341765:p.Arg267Cys	Somatic		Capture	Illumina HiSeq	Phase_I	174220019	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336796	0.60963	2.27E-4	0.0	ENSG00000144962	ENST00000351008	T	0.78364	-1.17	5.95	5.95	0.96441	Tetratricopeptide-like helical (1);	0.092578	0.48286	D	0.000185	T	0.80319	0.4601	N	0.17082	0.46	0.52501	D	0.999953	D	0.89917	1.0	D	0.87578	0.998	T	0.80469	-0.1369	10	0.41790	T	0.15	-8.1046	17.2865	0.87143	0.0:0.0:1.0:0.0	.	267	Q9BXB7	SPT16_HUMAN	C	267	ENSP00000341765:R267C	ENSP00000341765:R267C	R	-	1	0	SPATA16	174220019	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	4.228000	0.58619	2.811000	0.96726	0.655000	0.94253	CGT		0.348	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
ANK2	287	broad.mit.edu	37	4	114257016	114257016	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr4:114257016G>A	ENST00000357077.4	+	30	3447	c.3394G>A	c.(3394-3396)Gaa>Aaa	p.E1132K	ANK2_ENST00000264366.6_Missense_Mutation_p.E1099K|ANK2_ENST00000506722.1_Missense_Mutation_p.E1123K|ANK2_ENST00000509550.1_Missense_Mutation_p.E308K|ANK2_ENST00000394537.3_Missense_Mutation_p.E1132K	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1132	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.E1132K(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGATAGCCCAGAAGACCTAGA	0.443																																					p.E1132K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3394A	4						.						82.0	84.0	83.0					4																	114257016		2203	4300	6503	114476465	SO:0001583	missense	287	exon30			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3394G>A	4.37:g.114257016G>A	ENSP00000349588:p.Glu1132Lys	Somatic		Capture	Illumina HiSeq	Phase_I	114476465	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.27|19.27	3.796162|3.796162	0.70567|0.70567	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550|ENST00000514960	T;T;T;T;T;T;T;T|.	0.74947|.	-0.39;-0.89;-0.89;-0.89;-0.89;-0.59;-0.56;-0.89|.	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	0.000000|.	0.52532|.	D|.	0.000072|.	D|D	0.82857|0.82857	0.5128|0.5128	M|M	0.85373|0.85373	2.75|2.75	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;P|.	0.89917|.	0.996;0.996;0.998;0.968;1.0;0.999;0.811|.	D;D;D;P;D;D;P|.	0.91635|.	0.976;0.983;0.983;0.888;0.999;0.972;0.879|.	D|D	0.84569|0.84569	0.0654|0.0654	10|5	0.87932|.	D|.	0|.	.|.	18.9343|18.9343	0.92579|0.92579	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	308;1099;144;1132;1132;1123;1123|.	E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5;F8WEF9|.	.;ANK2_HUMAN;.;.;.;.;.|.	K|K	1111;1045;1123;178;1147;1132;1132;1099;1123;308|144	ENSP00000423799:E1111K;ENSP00000421011:E1045K;ENSP00000421067:E1123K;ENSP00000424722:E1147K;ENSP00000378044:E1132K;ENSP00000349588:E1132K;ENSP00000264366:E1099K;ENSP00000426944:E308K|.	ENSP00000264366:E1099K|.	E|R	+|+	1|2	0|0	ANK2|ANK2	114476465|114476465	1.000000|1.000000	0.71417|0.71417	0.961000|0.961000	0.40146|0.40146	0.588000|0.588000	0.36517|0.36517	9.813000|9.813000	0.99286|0.99286	2.536000|2.536000	0.85505|0.85505	0.655000|0.655000	0.94253|0.94253	GAA|AGA		0.443	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
PCDH18	54510	broad.mit.edu	37	4	138451025	138451025	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr4:138451025C>T	ENST00000344876.4	-	1	2604	c.2218G>A	c.(2218-2220)Gaa>Aaa	p.E740K	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.E520K|PCDH18_ENST00000412923.2_Missense_Mutation_p.E740K	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	740					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E740K(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TAAGTTGATTCGGCCACCCTG	0.483																																					p.E740K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2218A	4						.						196.0	163.0	174.0					4																	138451025		2203	4300	6503	138670475	SO:0001583	missense	54510	exon1			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2218G>A	4.37:g.138451025C>T	ENSP00000355082:p.Glu740Lys	Somatic		Capture	Illumina HiSeq	Phase_I	138670475	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577002	0.86645	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.58506	0.44;0.43;0.33	5.53	5.53	0.82687	.	0.000000	0.44688	D	0.000439	T	0.74053	0.3666	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	0.999;0.987;1.0	P;P;P	0.58130	0.771;0.782;0.833	T	0.73805	-0.3867	10	0.45353	T	0.12	.	19.663	0.95879	0.0:1.0:0.0:0.0	.	520;740;740	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	K	740;740;520	ENSP00000355082:E740K;ENSP00000390688:E740K;ENSP00000425903:E520K	ENSP00000355082:E740K	E	-	1	0	PCDH18	138670475	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.269000	0.78482	2.871000	0.98454	0.655000	0.94253	GAA		0.483	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
ARAP2	116984	broad.mit.edu	37	4	36212304	36212304	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr4:36212304G>A	ENST00000303965.4	-	6	1684	c.1195C>T	c.(1195-1197)Cga>Tga	p.R399*		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	399					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.R399*(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTGTCCTCTCGAGGTATCCAA	0.338																																					p.R399X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1195T	4						.						129.0	136.0	134.0					4																	36212304		2203	4300	6503	35888699	SO:0001587	stop_gained	116984	exon6			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1195C>T	4.37:g.36212304G>A	ENSP00000302895:p.Arg399*	Somatic		Capture	Illumina HiSeq	Phase_I	35888699	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Nonsense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	G	44	10.840352	0.99476	.	.	ENSG00000047365	ENST00000303965	.	.	.	5.6	5.6	0.85130	.	0.405917	0.23795	N	0.044498	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.531	0.84359	0.0:0.0:1.0:0.0	.	.	.	.	X	399	.	ENSP00000302895:R399X	R	-	1	2	ARAP2	35888699	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.809000	0.69172	2.631000	0.89168	0.585000	0.79938	CGA		0.338	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
GABRG1	2565	broad.mit.edu	37	4	46053472	46053472	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr4:46053472G>C	ENST00000295452.4	-	8	1267	c.1100C>G	c.(1099-1101)aCt>aGt	p.T367S		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	367					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T367S(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCTGTCTTTAGTAGCAGTCTT	0.299																																					p.T367S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1100G	4						.						65.0	60.0	62.0					4																	46053472		2202	4298	6500	45748229	SO:0001583	missense	2565	exon8			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.1100C>G	4.37:g.46053472G>C	ENSP00000295452:p.Thr367Ser	Somatic		Capture	Illumina HiSeq	Phase_I	45748229	NM_173536	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	G	0.041	-1.284630	0.01398	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	D	0.85861	-2.04	5.63	5.63	0.86233	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.387660	0.04378	N	0.360204	D	0.85062	0.5611	L	0.59436	1.845	0.09310	N	1	B	0.16603	0.018	B	0.25987	0.065	T	0.66264	-0.5967	10	0.13470	T	0.59	.	13.6367	0.62227	0.0:0.2587:0.7413:0.0	.	367	Q8N1C3	GBRG1_HUMAN	S	367	ENSP00000295452:T367S	ENSP00000295452:T367S	T	-	2	0	GABRG1	45748229	0.058000	0.20735	0.052000	0.19188	0.009000	0.06853	2.530000	0.45641	2.659000	0.90383	0.650000	0.86243	ACT		0.299	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
FBXW7	55294	broad.mit.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	G	A	rs149680468		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr4:153247289G>A	ENST00000281708.4	-	10	2742	c.1513C>T	c.(1513-1515)Cgc>Tgc	p.R505C	FBXW7_ENST00000603841.1_Missense_Mutation_p.R505C|FBXW7_ENST00000393956.3_Missense_Mutation_p.R329C|FBXW7_ENST00000296555.5_Missense_Mutation_p.R387C|FBXW7_ENST00000603548.1_Missense_Mutation_p.R505C|FBXW7_ENST00000263981.5_Missense_Mutation_p.R425C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	505			R -> L (in an ovarian cancer cell line). {ECO:0000269|PubMed:11565033, ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R505C(60)|p.R505G(18)|p.R425C(14)|p.R266C(13)|p.R425G(9)|p.R266G(9)|p.R387G(6)|p.R387C(3)|p.R505S(3)|p.R387S(1)|p.?(1)|p.R425S(1)|p.R266S(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R425C			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	139	Substitution - Missense(138)|Unknown(1)	haematopoietic_and_lymphoid_tissue(44)|large_intestine(26)|endometrium(20)|urinary_tract(15)|lung(15)|upper_aerodigestive_tract(8)|skin(8)|ovary(2)|biliary_tract(1)	c.C1273T	4						.						167.0	156.0	160.0					4																	153247289		2203	4300	6503	153466739	SO:0001583	missense	55294	exon9			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1513C>T	4.37:g.153247289G>A	ENSP00000281708:p.Arg505Cys	Somatic		Capture	Illumina HiSeq	Phase_I	153466739	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722220	0.68959	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.72	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101576	0.64402	D	0.000001	T	0.78679	0.4321	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81858	-0.0739	10	0.87932	D	0	-12.0024	15.0746	0.72066	0.0681:0.0:0.9319:0.0	.	329;505;387;425	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	505;387;425;329	ENSP00000281708:R505C;ENSP00000296555:R387C;ENSP00000263981:R425C;ENSP00000377528:R329C	ENSP00000263981:R425C	R	-	1	0	FBXW7	153466739	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	9.772000	0.98984	1.559000	0.49555	-0.145000	0.13849	CGC		0.468	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
APC	324	broad.mit.edu	37	5	112116592	112116592	+	Nonsense_Mutation	SNP	C	C	T	rs587781392		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:112116592C>T	ENST00000457016.1	+	6	1017	c.637C>T	c.(637-639)Cga>Tga	p.R213*	APC_ENST00000508376.2_Nonsense_Mutation_p.R213*|APC_ENST00000257430.4_Nonsense_Mutation_p.R213*|RNU6-482P_ENST00000391068.1_RNA			P25054	APC_HUMAN	adenomatous polyposis coli	213	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R213*(20)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TATGGAAAAACGAGCACAGGT	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R223X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	20	Substitution - Nonsense(20)	large_intestine(19)|lung(1)	c.C667T	5	GRCh37	CM920027	APC	M		.						58.0	57.0	58.0					5																	112116592		2202	4300	6502	112144491	SO:0001587	stop_gained	324	exon5	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.637C>T	5.37:g.112116592C>T	ENSP00000413133:p.Arg213*	Somatic		Capture	Illumina HiSeq	Phase_I	112144491	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.046788	0.97231	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.56	3.74	0.42951	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0079	14.2561	0.66053	0.4075:0.5925:0.0:0.0	.	.	.	.	X	213;223;213;213;213	.	ENSP00000257430:R213X	R	+	1	2	APC	112144491	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.672000	0.46850	0.659000	0.30945	0.655000	0.94253	CGA		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DMXL1	1657	broad.mit.edu	37	5	118445894	118445894	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:118445894C>T	ENST00000311085.8	+	5	493	c.413C>T	c.(412-414)aCt>aTt	p.T138I	DMXL1_ENST00000539542.1_Missense_Mutation_p.T138I	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	138								p.T138I(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TGGTCCAATACTAACTTGGAG	0.313																																					p.T138I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C413T	5						.						61.0	65.0	63.0					5																	118445894		2202	4299	6501	118473793	SO:0001583	missense	1657	exon5			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.413C>T	5.37:g.118445894C>T	ENSP00000309690:p.Thr138Ile	Somatic		Capture	Illumina HiSeq	Phase_I	118473793	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	0.620	-0.821376	0.02755	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.66099	1.93;-0.19;2.92	4.65	-2.19	0.07015	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.769757	0.12581	N	0.456440	T	0.30479	0.0766	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.12528	-1.0544	10	0.33940	T	0.23	0.9339	4.918	0.13856	0.2246:0.3351:0.0:0.4403	.	138;138	F5H269;Q9Y485	.;DMXL1_HUMAN	I	138	ENSP00000427692:T138I;ENSP00000309690:T138I;ENSP00000439479:T138I	ENSP00000309690:T138I	T	+	2	0	DMXL1	118473793	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.137000	0.10389	-0.342000	0.08363	-0.471000	0.05019	ACT		0.313	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
RAD50	10111	broad.mit.edu	37	5	131976376	131976376	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:131976376C>T	ENST00000265335.6	+	24	4018	c.3631C>T	c.(3631-3633)Ctc>Ttc	p.L1211F	AC004041.2_ENST00000417516.1_RNA|AC004041.2_ENST00000457489.1_RNA|RAD50_ENST00000378823.3_Missense_Mutation_p.L1072F|AC004041.2_ENST00000458509.1_RNA|AC004041.2_ENST00000435042.1_RNA			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1211	Ala/Asp-rich (DA-box).				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.L1072F(1)|p.L1211F(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATTAGCCTCACTCATCATTCG	0.493								Homologous recombination																													p.L1211F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3631T	5						.						182.0	167.0	172.0					5																	131976376		2203	4300	6503	132004275	SO:0001583	missense	10111	exon24			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3631C>T	5.37:g.131976376C>T	ENSP00000265335:p.Leu1211Phe	Somatic		Capture	Illumina HiSeq	Phase_I	132004275	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	CCDS34233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.351606|5.351606	0.95830|0.95830	.|.	.|.	ENSG00000113522|ENSG00000113522	ENST00000378823;ENST00000265335|ENST00000455677	T;T|.	0.06849|.	3.25;3.25|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74230|0.74230	0.3689|0.3689	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.68364|0.68364	-0.5428|-0.5428	10|5	0.72032|.	D|.	0.01|.	-5.9409|-5.9409	20.8598|20.8598	0.99761|0.99761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1211|.	Q92878|.	RAD50_HUMAN|.	F|I	1072;1211|89	ENSP00000368100:L1072F;ENSP00000265335:L1211F|.	ENSP00000265335:L1211F|.	L|T	+|+	1|2	0|0	RAD50|RAD50	132004275|132004275	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.941000|0.941000	0.58515|0.58515	7.277000|7.277000	0.78572|0.78572	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CTC|ACT		0.493	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
ANKHD1	54882	broad.mit.edu	37	5	139819799	139819799	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:139819799G>T	ENST00000360839.2	+	4	867	c.713G>T	c.(712-714)gGa>gTa	p.G238V	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.G238V|ANKHD1_ENST00000394723.3_Missense_Mutation_p.G238V|ANKHD1_ENST00000394722.3_Missense_Mutation_p.G227V|ANKHD1_ENST00000297183.6_Missense_Mutation_p.G238V	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	238						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.G238V(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGAAGAAGGAGAAAGCCTG	0.393																																					p.G238V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G713T	5						.						149.0	147.0	148.0					5																	139819799		2203	4300	6503	139799983	SO:0001583	missense	404734	exon4			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.713G>T	5.37:g.139819799G>T	ENSP00000354085:p.Gly238Val	Somatic		Capture	Illumina HiSeq	Phase_I	139799983	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531734	0.85706	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000511151;ENST00000394722;ENST00000532219	T;T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.08;-0.81;-0.81	5.44	4.57	0.56435	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.87665	0.6234	M	0.93062	3.375	0.80722	D	1	P;P;P;D;D	0.53312	0.826;0.864;0.713;0.959;0.959	P;P;P;P;P	0.60173	0.612;0.743;0.662;0.87;0.803	D	0.90715	0.4630	10	0.87932	D	0	.	14.6066	0.68483	0.0711:0.0:0.9289:0.0	.	238;238;238;227;238	Q8IWZ3-5;Q8IWZ2;Q8IWZ3;Q8IWZ3-3;Q8IWZ3-2	.;.;ANKH1_HUMAN;.;.	V	238;252;238;238;238;238;224;227;238	ENSP00000354085:G238V;ENSP00000297183:G238V;ENSP00000394489:G238V;ENSP00000378212:G238V;ENSP00000421069:G224V;ENSP00000378211:G227V;ENSP00000432016:G238V	ENSP00000432016:G238V	G	+	2	0	ANKHD1-EIF4EBP3;ANKHD1	139799983	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.507000	0.97996	1.425000	0.47237	0.585000	0.79938	GGA		0.393	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
C5orf49	134121	broad.mit.edu	37	5	7832013	7832013	+	Missense_Mutation	SNP	C	C	A	rs373241801		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:7832013C>A	ENST00000399810.2	-	3	862	c.394G>T	c.(394-396)Gac>Tac	p.D132Y	C5orf49_ENST00000509627.1_Missense_Mutation_p.D130Y	NM_001089584.2	NP_001083053.1	A4QMS7	CE049_HUMAN	chromosome 5 open reading frame 49	132								p.D132Y(1)		large_intestine(3)|lung(5)|skin(1)	9						CTGGGGATGTCGTTCTTCCTG	0.582																																					p.D132Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G394T	5						.						119.0	126.0	124.0					5																	7832013		2006	4174	6180	7885013	SO:0001583	missense	134121	exon3				CCDS43300.1	5p15.31	2008-07-16			ENSG00000215217	ENSG00000215217			27028	protein-coding gene	gene with protein product						12477932	Standard	NM_001089584		Approved	LOC134121	uc003jea.5	A4QMS7	OTTHUMG00000161897	ENST00000399810.2:c.394G>T	5.37:g.7832013C>A	ENSP00000382708:p.Asp132Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	7885013	NM_001089584		Missense_Mutation	SNP	ENST00000399810.2	37	CCDS43300.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331232	0.60853	.	.	ENSG00000215217	ENST00000399810;ENST00000509627	T;T	0.32023	1.47;1.47	5.0	4.13	0.48395	.	.	.	.	.	T	0.38348	0.1037	L	0.47716	1.5	0.29243	N	0.872499	D	0.59767	0.986	P	0.55749	0.783	T	0.27331	-1.0077	9	0.66056	D	0.02	-27.0463	7.3044	0.26438	0.0:0.7372:0.1706:0.0922	.	132	A4QMS7	CE049_HUMAN	Y	132;130	ENSP00000382708:D132Y;ENSP00000426019:D130Y	ENSP00000382708:D132Y	D	-	1	0	C5orf49	7885013	0.821000	0.29204	0.983000	0.44433	0.798000	0.45092	2.422000	0.44696	1.241000	0.43820	0.555000	0.69702	GAC		0.582	C5orf49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366322.1	NM_001089584	
CDH18	1016	broad.mit.edu	37	5	19483620	19483620	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:19483620G>A	ENST00000507958.1	-	14	2662	c.1672C>T	c.(1672-1674)Cga>Tga	p.R558*	CDH18_ENST00000382275.1_Nonsense_Mutation_p.R558*|CDH18_ENST00000506372.1_Intron|CDH18_ENST00000274170.4_Nonsense_Mutation_p.R558*|CDH18_ENST00000502796.1_Intron			Q13634	CAD18_HUMAN	cadherin 18, type 2	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R558*(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TGAACAGTTCGACTAAATCTC	0.453																																					p.R558X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1672T	5						.						99.0	83.0	88.0					5																	19483620		2203	4300	6503	19519377	SO:0001587	stop_gained	1016	exon12			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1672C>T	5.37:g.19483620G>A	ENSP00000425093:p.Arg558*	Somatic		Capture	Illumina HiSeq	Phase_I	19519377	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Nonsense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	47	13.789498	0.99763	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	.	.	.	5.69	5.69	0.88448	.	0.071240	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3564	0.60631	0.0:0.0:0.8423:0.1577	.	.	.	.	X	558	.	.	R	-	1	2	CDH18	19519377	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.500000	0.81588	2.696000	0.92011	0.655000	0.94253	CGA		0.453	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
AGXT2	64902	broad.mit.edu	37	5	35040756	35040756	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:35040756C>T	ENST00000231420.6	-	2	301	c.101G>A	c.(100-102)cGg>cAg	p.R34Q		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	34					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.R34Q(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	TACTGATGTCCGGGAAGTACC	0.413																																					p.R34Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G101A	5						.						193.0	181.0	185.0					5																	35040756		2203	4300	6503	35076513	SO:0001583	missense	64902	exon2			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.101G>A	5.37:g.35040756C>T	ENSP00000231420:p.Arg34Gln	Somatic		Capture	Illumina HiSeq	Phase_I	35076513	NM_031900	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	ENST00000231420.6	37	CCDS3908.1	.	.	.	.	.	.	.	.	.	.	C	8.147	0.786484	0.16189	.	.	ENSG00000113492	ENST00000231420	D	0.81579	-1.51	5.46	4.58	0.56647	.	0.926908	0.09292	N	0.822162	T	0.69824	0.3154	L	0.36672	1.1	0.18873	N	0.999988	B;B	0.14012	0.005;0.009	B;B	0.04013	0.001;0.001	T	0.54649	-0.8262	10	0.13853	T	0.58	-0.5105	7.4953	0.27485	0.0:0.7372:0.1706:0.0922	.	34;34	E9PDL7;Q9BYV1	.;AGT2_HUMAN	Q	34	ENSP00000231420:R34Q	ENSP00000231420:R34Q	R	-	2	0	AGXT2	35076513	1.000000	0.71417	0.943000	0.38184	0.181000	0.23173	2.726000	0.47302	1.430000	0.47334	0.555000	0.69702	CGG		0.413	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900	
ESM1	11082	broad.mit.edu	37	5	54281072	54281072	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:54281072A>G	ENST00000381405.4	-	1	419	c.274T>C	c.(274-276)Ttt>Ctt	p.F92L	ESM1_ENST00000381403.4_Missense_Mutation_p.F92L|ESM1_ENST00000598310.1_Intron	NM_007036.4	NP_008967.1	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1	92	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of hepatocyte growth factor receptor signaling pathway (GO:1902204)|regulation of cell growth (GO:0001558)|sprouting angiogenesis (GO:0002040)	extracellular region (GO:0005576)	hepatocyte growth factor receptor binding (GO:0005171)|integrin binding (GO:0005178)	p.F92L(1)		breast(1)|kidney(1)|large_intestine(4)|lung(4)	10		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			TCTTCACCAAAAGGATCCTCC	0.567																																					p.F92L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T274C	5						.						102.0	104.0	103.0					5																	54281072		2203	4300	6503	54316829	SO:0001583	missense	11082	exon1			X89426	CCDS3963.1, CCDS47206.1	5q11	2008-02-05			ENSG00000164283	ENSG00000164283			3466	protein-coding gene	gene with protein product		601521				8702785	Standard	NM_001135604		Approved		uc003jpk.3	Q9NQ30	OTTHUMG00000097010	ENST00000381405.4:c.274T>C	5.37:g.54281072A>G	ENSP00000370812:p.Phe92Leu	Somatic		Capture	Illumina HiSeq	Phase_I	54316829	NM_007036	B2R4G3|Q15330|Q3V4E3|Q96ES3	Missense_Mutation	SNP	ENST00000381405.4	37	CCDS3963.1	.	.	.	.	.	.	.	.	.	.	A	17.74	3.463777	0.63513	.	.	ENSG00000164283	ENST00000381405;ENST00000381403	T;T	0.60171	0.21;0.21	5.56	5.56	0.83823	Insulin-like growth factor-binding protein, IGFBP (2);	0.056331	0.64402	D	0.000001	T	0.66056	0.2751	L	0.38175	1.15	0.51482	D	0.999922	D;D	0.62365	0.991;0.982	P;D	0.67548	0.696;0.952	T	0.64803	-0.6321	10	0.37606	T	0.19	-9.2524	15.3811	0.74658	1.0:0.0:0.0:0.0	.	92;92	Q3V4E3;Q9NQ30	.;ESM1_HUMAN	L	92	ENSP00000370812:F92L;ENSP00000370810:F92L	ENSP00000370810:F92L	F	-	1	0	ESM1	54316829	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	9.061000	0.93913	2.103000	0.63969	0.460000	0.39030	TTT		0.567	ESM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214099.2	NM_007036	
MAP1B	4131	broad.mit.edu	37	5	71492298	71492298	+	Missense_Mutation	SNP	T	T	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:71492298T>A	ENST00000296755.7	+	5	3414	c.3116T>A	c.(3115-3117)aTg>aAg	p.M1039K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1039					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.M1039K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CCGGAAAAAATGGAAGCTGAA	0.517																																					p.M1039K	Melanoma(17;367 822 11631 31730 47712)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3116A	5						.						152.0	155.0	154.0					5																	71492298		2203	4300	6503	71528054	SO:0001583	missense	4131	exon5			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3116T>A	5.37:g.71492298T>A	ENSP00000296755:p.Met1039Lys	Somatic		Capture	Illumina HiSeq	Phase_I	71528054	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.129970	0.00338	.	.	ENSG00000131711	ENST00000296755	T	0.02709	4.19	5.86	-8.26	0.01021	.	2.324680	0.01314	N	0.010731	T	0.01905	0.0060	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.01281	0.0;0.0	T	0.39800	-0.9596	10	0.29301	T	0.29	4.2435	12.8139	0.57654	0.1196:0.6328:0.0:0.2476	.	913;1039	A2BDK6;P46821	.;MAP1B_HUMAN	K	1039	ENSP00000296755:M1039K	ENSP00000296755:M1039K	M	+	2	0	MAP1B	71528054	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.812000	0.04496	-1.243000	0.02519	-0.256000	0.11100	ATG		0.517	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
PCDHB10	56126	broad.mit.edu	37	5	140573170	140573170	+	Missense_Mutation	SNP	G	G	A	rs377570572		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr5:140573170G>A	ENST00000239446.4	+	1	1229	c.1045G>A	c.(1045-1047)Gta>Ata	p.V349I		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	349					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V349I(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAACTGATCGTATCATCATT	0.428																																					p.V349I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1045A	5						.						93.0	93.0	93.0					5																	140573170		2203	4300	6503	140553354	SO:0001583	missense	56126	exon1			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1045G>A	5.37:g.140573170G>A	ENSP00000239446:p.Val349Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140553354	NM_018930	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.372541	0.00015	.	.	ENSG00000120324	ENST00000239446	T	0.01767	4.65	3.41	2.22	0.28083	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.00875	0.0029	N	0.05199	-0.095	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47381	-0.9122	9	0.02654	T	1	.	5.5231	0.16943	0.6665:0.2286:0.105:0.0	.	349	Q9UN67	PCDBA_HUMAN	I	349	ENSP00000239446:V349I	ENSP00000239446:V349I	V	+	1	0	PCDHB10	140553354	0.000000	0.05858	0.072000	0.20136	0.021000	0.10359	-1.930000	0.01557	0.522000	0.28464	-0.358000	0.07595	GTA		0.428	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
ROS1	6098	broad.mit.edu	37	6	117609655	117609655	+	Nonstop_Mutation	SNP	T	T	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr6:117609655T>A	ENST00000368508.3	-	43	7242	c.7044A>T	c.(7042-7044)taA>taT	p.*2348Y	ROS1_ENST00000368507.3_Nonstop_Mutation_p.*2342Y	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	0					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.*2348Y(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AACAACGCTATTAATCAGACC	0.418			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.X2348Y			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	.	2	Nonstop extension(2)	large_intestine(2)	c.A7044T	6						.						96.0	88.0	91.0					6																	117609655		2203	4300	6503	117716348	SO:0001578	stop_lost	6098	exon43			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.7044A>T	6.37:g.117609655T>A		Somatic		Capture	Illumina HiSeq	Phase_I	117716348	NM_002944	Q15368|Q5TDB5	Nonstop_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.325916	0.24080	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	.	.	.	4.18	4.18	0.49190	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5683	0.39411	0.0:0.0:0.0:1.0	.	.	.	.	Y	2348;2342	.	.	X	-	3	2	ROS1	117716348	0.587000	0.26791	0.760000	0.31359	0.177000	0.22998	0.541000	0.23207	1.756000	0.51951	0.460000	0.39030	TAA		0.418	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
PCMT1	5110	broad.mit.edu	37	6	150071059	150071059	+	Missense_Mutation	SNP	G	G	C	rs200097071		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr6:150071059G>C	ENST00000367380.5	+	1	229	c.22G>C	c.(22-24)Gcc>Ccc	p.A8P	NUP43_ENST00000463048.3_5'Flank|PCMT1_ENST00000367384.2_Missense_Mutation_p.A66P|PCMT1_ENST00000367378.1_Missense_Mutation_p.A66P|PCMT1_ENST00000544496.1_Missense_Mutation_p.A8P|PCMT1_ENST00000464889.1_Missense_Mutation_p.A66P	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase	8					protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		ATCCGGCGGCGCCAGCCACTC	0.647																																					p.A66P												.	.	0			c.G196C	6						.						26.0	30.0	29.0					6																	150071059		2202	4298	6500	150112752	SO:0001583	missense	5110	exon1				CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794	ENST00000367380.5:c.22G>C	6.37:g.150071059G>C	ENSP00000356350:p.Ala8Pro	None		Capture	Illumina HiSeq	Phase_I	150112752	NM_005389	A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	Missense_Mutation	SNP	ENST00000367380.5	37		.	.	.	.	.	.	.	.	.	.	G	21.2	4.111214	0.77210	.	.	ENSG00000120265	ENST00000367384;ENST00000367378;ENST00000464889;ENST00000367380;ENST00000544496	T;T;T;T;T	0.51071	0.94;0.94;0.94;0.94;0.72	5.34	4.46	0.54185	.	0.062472	0.64402	D	0.000007	T	0.50171	0.1600	L	0.60455	1.87	0.51767	D	0.999938	P;D;B;B;D;P	0.71674	0.879;0.998;0.297;0.049;0.998;0.47	P;D;B;B;D;B	0.64237	0.452;0.923;0.114;0.068;0.923;0.269	T	0.49624	-0.8920	10	0.34782	T	0.22	-8.53	13.8891	0.63726	0.0738:0.0:0.9262:0.0	.	8;66;8;66;66;8	B7Z972;F8WAX2;P22061-2;F8WAV5;F8WDT3;P22061	.;.;.;.;.;PIMT_HUMAN	P	66;66;66;8;8	ENSP00000356354:A66P;ENSP00000356348:A66P;ENSP00000420813:A66P;ENSP00000356350:A8P;ENSP00000438247:A8P	ENSP00000356348:A66P	A	+	1	0	PCMT1	150112752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.084000	0.50143	1.230000	0.43646	0.655000	0.94253	GCC		0.647	PCMT1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
SYNE1	23345	broad.mit.edu	37	6	152683344	152683344	+	Silent	SNP	C	C	T	rs145287138		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr6:152683344C>T	ENST00000367255.5	-	64	10861	c.10260G>A	c.(10258-10260)gcG>gcA	p.A3420A	SYNE1_ENST00000448038.1_Silent_p.A3427A|SYNE1_ENST00000265368.4_Silent_p.A3420A|SYNE1_ENST00000423061.1_Silent_p.A3427A|SYNE1_ENST00000341594.5_Silent_p.A3439A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3420					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A3420A(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCCGCAGCTCCGCATGCTGCC	0.483										HNSCC(10;0.0054)																											p.A3427A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G10281A	6						.	C	,	0,4406		0,0,2203	132.0	117.0	122.0		10281,10260	-10.6	0.0	6	dbSNP_134	122	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SYNE1	NM_033071.3,NM_182961.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	3427/8750,3420/8798	152683344	1,13005	2203	4300	6503	152725037	SO:0001819	synonymous_variant	23345	exon64			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10260G>A	6.37:g.152683344C>T		Somatic		Capture	Illumina HiSeq	Phase_I	152725037	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
KIAA0319	9856	broad.mit.edu	37	6	24556954	24556954	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr6:24556954C>T	ENST00000378214.3	-	18	3262	c.2738G>A	c.(2737-2739)tGc>tAc	p.C913Y	KIAA0319_ENST00000430948.2_Missense_Mutation_p.C868Y|KIAA0319_ENST00000537886.1_Missense_Mutation_p.C913Y|KIAA0319_ENST00000543707.1_Missense_Mutation_p.C913Y|KIAA0319_ENST00000535378.1_Missense_Mutation_p.C904Y	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	913					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C913Y(1)		breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						CTTCAGAAGGCAACCTGCAAA	0.483																																					p.C913Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2738A	6						.						77.0	70.0	72.0					6																	24556954		2203	4300	6503	24664933	SO:0001583	missense	9856	exon18			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2738G>A	6.37:g.24556954C>T	ENSP00000367459:p.Cys913Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	24664933	NM_001168377	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	ENST00000378214.3	37	CCDS34348.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559066	0.45590	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.32988	1.6;1.46;1.51;1.43;1.43	4.02	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.50429	0.1615	M	0.86740	2.835	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.998;0.996	T	0.62699	-0.6799	10	0.72032	D	0.01	-12.7709	13.9279	0.63975	0.0:0.8464:0.1536:0.0	.	913;904;913	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	Y	913;904;868;913;913	ENSP00000439700:C913Y;ENSP00000442403:C904Y;ENSP00000401086:C868Y;ENSP00000367459:C913Y;ENSP00000437656:C913Y	ENSP00000367459:C913Y	C	-	2	0	KIAA0319	24664933	1.000000	0.71417	0.252000	0.24328	0.363000	0.29612	6.824000	0.75288	1.006000	0.39211	0.555000	0.69702	TGC		0.483	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809	
LPA	4018	broad.mit.edu	37	6	161006128	161006128	+	Silent	SNP	C	C	G	rs535318353	byFrequency	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr6:161006128C>G	ENST00000316300.5	-	26	4283	c.4239G>C	c.(4237-4239)tcG>tcC	p.S1413S	LPA_ENST00000447678.1_Silent_p.S1413S			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3921	Kringle 13. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.S1413S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GTGTCATAGACGACCAAGACT	0.448																																					p.S1413S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4239C	6						.						222.0	223.0	223.0					6																	161006128		2187	4295	6482	160926118	SO:0001819	synonymous_variant	4018	exon27			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4239G>C	6.37:g.161006128C>G		Somatic		Capture	Illumina HiSeq	Phase_I	160926118	NM_005577	Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	37	CCDS43523.1																																																																																				0.448	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
MUC17	140453	broad.mit.edu	37	7	100681256	100681256	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:100681256G>C	ENST00000306151.4	+	3	6623	c.6559G>C	c.(6559-6561)Gac>Cac	p.D2187H		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2187	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.D2187H(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTCCTGTTGACACCAGCAC	0.483																																					p.D2187H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6559C	7						.						270.0	271.0	270.0					7																	100681256		2203	4300	6503	100467976	SO:0001583	missense	140453	exon3			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6559G>C	7.37:g.100681256G>C	ENSP00000302716:p.Asp2187His	Somatic		Capture	Illumina HiSeq	Phase_I	100467976	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	4.103	0.017120	0.07959	.	.	ENSG00000169876	ENST00000306151	T	0.03065	4.06	0.683	0.683	0.17998	.	.	.	.	.	T	0.02970	0.0088	N	0.19112	0.55	0.09310	N	1	D	0.54964	0.969	B	0.43413	0.419	T	0.49615	-0.8921	9	0.46703	T	0.11	.	7.3005	0.26418	1.0E-4:0.0:0.9999:0.0	.	2187	Q685J3	MUC17_HUMAN	H	2187	ENSP00000302716:D2187H	ENSP00000302716:D2187H	D	+	1	0	MUC17	100467976	0.000000	0.05858	0.006000	0.13384	0.052000	0.14988	-2.232000	0.01205	0.681000	0.31386	0.134000	0.15878	GAC		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
RELN	5649	broad.mit.edu	37	7	103230095	103230095	+	Missense_Mutation	SNP	A	A	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:103230095A>T	ENST00000428762.1	-	28	4252	c.4093T>A	c.(4093-4095)Ttt>Att	p.F1365I	RELN_ENST00000343529.5_Missense_Mutation_p.F1365I|RELN_ENST00000424685.2_Missense_Mutation_p.F1365I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1365					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.F1365I(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CATTCTTCAAAGTCCCCTGTG	0.448																																					p.F1365I	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4093A	7						.						224.0	200.0	208.0					7																	103230095		2203	4300	6503	103017331	SO:0001583	missense	5649	exon28				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4093T>A	7.37:g.103230095A>T	ENSP00000392423:p.Phe1365Ile	Somatic		Capture	Illumina HiSeq	Phase_I	103017331	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.312270	0.81358	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.40476	1.03;1.95;1.03	5.48	5.48	0.80851	.	0.057808	0.64402	D	0.000001	T	0.42314	0.1197	L	0.54323	1.7	0.44006	D	0.996716	B;B	0.33120	0.246;0.398	B;B	0.33042	0.157;0.155	T	0.42849	-0.9427	10	0.66056	D	0.02	.	15.8521	0.78940	1.0:0.0:0.0:0.0	.	1365;1365	P78509-2;P78509	.;RELN_HUMAN	I	1365	ENSP00000392423:F1365I;ENSP00000345694:F1365I;ENSP00000388446:F1365I	ENSP00000345694:F1365I	F	-	1	0	RELN	103017331	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.647000	0.91057	2.210000	0.71456	0.460000	0.39030	TTT		0.448	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
RELN	5649	broad.mit.edu	37	7	103629639	103629639	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:103629639C>T	ENST00000428762.1	-	1	324	c.165G>A	c.(163-165)gtG>gtA	p.V55V	RELN_ENST00000343529.5_Silent_p.V55V|RELN_ENST00000424685.2_Silent_p.V55V	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	55	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.V55V(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGGAAATGAGCACCTCGCCCT	0.652																																					p.V55V	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G165A	7						.						58.0	60.0	59.0					7																	103629639		2203	4300	6503	103416875	SO:0001819	synonymous_variant	5649	exon1				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.165G>A	7.37:g.103629639C>T		Somatic		Capture	Illumina HiSeq	Phase_I	103416875	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																				0.652	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
ISPD	729920	broad.mit.edu	37	7	16415862	16415862	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:16415862G>A	ENST00000407010.2	-	3	538	c.539C>T	c.(538-540)gCa>gTa	p.A180V	ISPD_ENST00000399310.3_Intron	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	180					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)	p.A180V(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						AATGGCTCCTGCTGCCTGAAG	0.413										Multiple Myeloma(15;0.18)																											p.A180V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C539T	7						.						67.0	64.0	65.0					7																	16415862		1922	4123	6045	16382387	SO:0001583	missense	729920	exon3			AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.539C>T	7.37:g.16415862G>A	ENSP00000385478:p.Ala180Val	Somatic		Capture	Illumina HiSeq	Phase_I	16382387	NM_001101426	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	37		.	.	.	.	.	.	.	.	.	.	G	25.8	4.675818	0.88445	.	.	ENSG00000214960	ENST00000407010	D	0.85773	-2.03	5.38	5.38	0.77491	4-diphosphocytidyl-2C-methyl-D-erythritol synthase (1);	0.152719	0.42548	U	0.000692	D	0.84556	0.5498	N	0.24115	0.695	0.80722	D	1	D	0.55800	0.973	P	0.54174	0.744	D	0.83985	0.0334	10	0.36615	T	0.2	-16.3183	19.5032	0.95104	0.0:0.0:1.0:0.0	.	180	A4D126	ISPD_HUMAN	V	180	ENSP00000385478:A180V	ENSP00000385478:A180V	A	-	2	0	ISPD	16382387	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	8.874000	0.92363	2.669000	0.90835	0.650000	0.86243	GCA		0.413	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426	
COBL	23242	broad.mit.edu	37	7	51095441	51095441	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:51095441G>A	ENST00000265136.7	-	10	3517	c.3352C>T	c.(3352-3354)Cac>Tac	p.H1118Y	COBL_ENST00000395542.2_Missense_Mutation_p.H1200Y	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1118	WH2 1. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.H1118Y(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CCCGCAGAGTGGATGGCTTCC	0.567																																					p.H1118Y	NSCLC(189;2119 2138 12223 30818 34679)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3352T	7						.						121.0	105.0	111.0					7																	51095441		2203	4300	6503	51062935	SO:0001583	missense	23242	exon10			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3352C>T	7.37:g.51095441G>A	ENSP00000265136:p.His1118Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	51062935	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737522	0.69304	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.27	4.37	0.52481	Actin-binding WH2 (3);	0.513699	0.16487	N	0.212293	T	0.58206	0.2106	L	0.51422	1.61	0.32931	D	0.517197	D;D;D;D;D	0.76494	0.998;0.995;0.969;0.991;0.999	P;P;P;P;D	0.68483	0.876;0.836;0.715;0.805;0.958	T	0.68546	-0.5380	10	0.62326	D	0.03	.	14.7844	0.69790	0.0:0.1452:0.8548:0.0	.	1118;1175;1118;1200;660	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	Y	1118;1010;1003;1200	ENSP00000265136:H1118Y;ENSP00000401204:H1010Y;ENSP00000413498:H1003Y;ENSP00000378912:H1200Y	ENSP00000265136:H1118Y	H	-	1	0	COBL	51062935	1.000000	0.71417	0.982000	0.44146	0.899000	0.52679	6.884000	0.75600	1.163000	0.42636	0.563000	0.77884	CAC		0.567	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
CDK14	5218	broad.mit.edu	37	7	90377060	90377060	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:90377060C>G	ENST00000380050.3	+	4	565	c.434C>G	c.(433-435)tCt>tGt	p.S145C	CDK14_ENST00000436577.2_Intron|CDK14_ENST00000265741.3_Missense_Mutation_p.S127C|CDK14_ENST00000406263.1_Missense_Mutation_p.S99C			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	145	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.S127C(1)		breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GGGGAAGGATCTTATGCTACA	0.343																																					p.S127C	GBM(83;1228 1256 8311 16577 31299)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C380G	7						.						125.0	129.0	128.0					7																	90377060		2203	4298	6501	90214996	SO:0001583	missense	5218	exon3				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.434C>G	7.37:g.90377060C>G	ENSP00000369390:p.Ser145Cys	Somatic		Capture	Illumina HiSeq	Phase_I	90214996	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	C	27.1	4.803510	0.90623	.	.	ENSG00000058091	ENST00000449528;ENST00000446224;ENST00000430760;ENST00000456689;ENST00000380050;ENST00000265741;ENST00000406263	T;T;T;T;T;T;T	0.68479	3.1;3.1;3.1;3.1;-0.33;-0.33;-0.33	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86590	0.5969	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.976;0.995	D	0.88397	0.3012	10	0.87932	D	0	-13.6604	20.3593	0.98849	0.0:1.0:0.0:0.0	.	127;145	O94921-2;O94921	.;CDK14_HUMAN	C	99;99;99;99;145;127;99	ENSP00000393616:S99C;ENSP00000410770:S99C;ENSP00000394570:S99C;ENSP00000406848:S99C;ENSP00000369390:S145C;ENSP00000265741:S127C;ENSP00000385034:S99C	ENSP00000265741:S127C	S	+	2	0	CDK14	90214996	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.472000	0.80996	2.807000	0.96579	0.591000	0.81541	TCT		0.343	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
LHFPL3	375612	broad.mit.edu	37	7	103969499	103969499	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:103969499delG	ENST00000401970.2	+	1	352	c.230delG	c.(229-231)aggfs	p.R77fs	LHFPL3_ENST00000424859.1_Frame_Shift_Del_p.R77fs|LHFPL3_ENST00000535008.1_Frame_Shift_Del_p.R91fs|LHFPL3_ENST00000543266.1_Frame_Shift_Del_p.R91fs			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	91						integral component of membrane (GO:0016021)		p.G92fs*25(1)		kidney(1)|large_intestine(2)|lung(6)	9						CTGACCTGCAGGGGCAGCTTC	0.612																																					p.R91fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.272delG	7						.						48.0	54.0	52.0					7																	103969499		1987	4192	6179	103756735	SO:0001589	frameshift_variant	375612	exon1			AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.230delG	7.37:g.103969499delG	ENSP00000385374:p.Arg77fs	Somatic		Capture	Illumina HiSeq	Phase_I	103756735	NM_199000	A1L383|A4D0Q5	Frame_Shift_Del	DEL	ENST00000401970.2	37																																																																																					0.612	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000348284.1	NM_199000	
LRRN3	54674	broad.mit.edu	37	7	110763219	110763219	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr7:110763219C>A	ENST00000422987.3	+	2	1222	c.391C>A	c.(391-393)Ctg>Atg	p.L131M	IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000452895.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.L131M|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.L131M	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	131					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L131M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ACTTACTGAACTGCCTGAAAA	0.363																																					p.L131M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C391A	7						.						82.0	84.0	84.0					7																	110763219		2203	4300	6503	110550455	SO:0001583	missense	54674	exon2			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.391C>A	7.37:g.110763219C>A	ENSP00000412417:p.Leu131Met	Somatic		Capture	Illumina HiSeq	Phase_I	110550455	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.769129	0.31320	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	6.03	5.16	0.70880	.	0.000000	0.46442	D	0.000300	T	0.80082	0.4558	M	0.86343	2.81	0.46774	D	0.999197	D	0.89917	1.0	D	0.97110	1.0	T	0.80801	-0.1220	10	0.35671	T	0.21	.	12.3792	0.55297	0.0:0.8652:0.0:0.1348	.	131	Q9H3W5	LRRN3_HUMAN	M	131	ENSP00000312001:L131M;ENSP00000397312:L131M;ENSP00000412417:L131M;ENSP00000407927:L131M	ENSP00000312001:L131M	L	+	1	2	LRRN3	110550455	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.122000	0.41987	1.567000	0.49668	0.557000	0.71058	CTG		0.363	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
ABRA	137735	broad.mit.edu	37	8	107773724	107773724	+	Silent	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr8:107773724C>T	ENST00000311955.3	-	2	741	c.687G>A	c.(685-687)gaG>gaA	p.E229E		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.E229E(2)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			AGTTGAGTTTCTCTGTAAATC	0.433																																					p.E229E												.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.G687A	8						.						56.0	54.0	54.0					8																	107773724		2203	4300	6503	107842900	SO:0001819	synonymous_variant	137735	exon2			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.687G>A	8.37:g.107773724C>T		Somatic		Capture	Illumina HiSeq	Phase_I	107842900	NM_139166		Silent	SNP	ENST00000311955.3	37	CCDS6305.1																																																																																				0.433	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
TRHR	7201	broad.mit.edu	37	8	110100327	110100327	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr8:110100327T>G	ENST00000518632.1	+	2	937	c.586T>G	c.(586-588)Ttt>Gtt	p.F196V	TRHR_ENST00000311762.2_Missense_Mutation_p.F196V			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	196					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)	p.F196V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CCTAATGGACTTTGGTGTCTT	0.398																																					p.F196V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T586G	8						.						120.0	112.0	115.0					8																	110100327		2203	4300	6503	110169503	SO:0001583	missense	7201	exon1				CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.586T>G	8.37:g.110100327T>G	ENSP00000430711:p.Phe196Val	Somatic		Capture	Illumina HiSeq	Phase_I	110169503	NM_003301	Q2M339	Missense_Mutation	SNP	ENST00000518632.1	37	CCDS6311.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.099131	0.76983	.	.	ENSG00000174417	ENST00000518632;ENST00000311762	T;T	0.71817	-0.6;-0.6	6.17	6.17	0.99709	GPCR, rhodopsin-like superfamily (1);	0.043057	0.85682	D	0.000000	D	0.84000	0.5376	M	0.84219	2.685	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	T	0.82671	-0.0342	10	0.27082	T	0.32	-49.6772	16.0034	0.80327	0.0:0.0:0.0:1.0	.	196	P34981	TRFR_HUMAN	V	196	ENSP00000430711:F196V;ENSP00000309818:F196V	ENSP00000309818:F196V	F	+	1	0	TRHR	110169503	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.033000	0.88852	2.371000	0.80710	0.533000	0.62120	TTT		0.398	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
SMARCA2	6595	broad.mit.edu	37	9	2054607	2054607	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr9:2054607C>T	ENST00000382203.1	+	6	1266	c.1057C>T	c.(1057-1059)Cgc>Tgc	p.R353C	SMARCA2_ENST00000349721.2_Missense_Mutation_p.R353C|SMARCA2_ENST00000357248.2_Missense_Mutation_p.R353C|SMARCA2_ENST00000382194.1_Missense_Mutation_p.R353C			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	353					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.R353C(1)|p.R349C(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		ACTTCAGGCCCGCATAGCTCA	0.393																																					p.R353C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1057T	9						.						92.0	104.0	100.0					9																	2054607		2203	4300	6503	2044607	SO:0001583	missense	6595	exon6			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1057C>T	9.37:g.2054607C>T	ENSP00000371638:p.Arg353Cys	Somatic		Capture	Illumina HiSeq	Phase_I	2044607	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494812	0.85069	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	D;D;T;D;D	0.89552	-2.51;-2.53;2.52;-2.51;-2.53	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.92996	0.7771	M	0.78916	2.43	0.80722	D	1	D;D	0.65815	0.993;0.995	P;P	0.52710	0.707;0.609	D	0.93243	0.6628	10	0.87932	D	0	-12.7474	20.3334	0.98727	0.0:1.0:0.0:0.0	.	353;353	P51531-2;P51531	.;SMCA2_HUMAN	C	353	ENSP00000265773:R353C;ENSP00000349788:R353C;ENSP00000392081:R353C;ENSP00000371638:R353C;ENSP00000371629:R353C	ENSP00000265773:R353C	R	+	1	0	SMARCA2	2044607	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	4.692000	0.61746	2.818000	0.97014	0.591000	0.81541	CGC		0.393	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
RIC1	57589	broad.mit.edu	37	9	5747357	5747357	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr9:5747357G>A	ENST00000414202.2	+	12	1495	c.1304G>A	c.(1303-1305)gGa>gAa	p.G435E	KIAA1432_ENST00000381532.2_Missense_Mutation_p.G356E|KIAA1432_ENST00000449720.2_Missense_Mutation_p.G356E|KIAA1432_ENST00000251879.6_Missense_Mutation_p.G435E|KIAA1432_ENST00000418622.3_Missense_Mutation_p.G356E	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.G356E(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TTGAACTGTGGAGAGGCTTCA	0.468																																					p.G356E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1067A	9						.						125.0	115.0	118.0					9																	5747357		2203	4300	6503	5737357	SO:0001583	missense	57589	exon11																														ENST00000414202.2:c.1304G>A	9.37:g.5747357G>A	ENSP00000416696:p.Gly435Glu	Somatic		Capture	Illumina HiSeq	Phase_I	5737357	NM_020829		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.334817|5.334817	0.95758|0.95758	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720|ENST00000545641	T;T;T;T;T|.	0.41400|.	1.0;1.0;1.0;1.0;1.0|.	6.05|6.05	6.05|6.05	0.98169|0.98169	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.74816|.	0.3766|.	M|M	0.62266|0.62266	1.93|1.93	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.976|.	D;D;P|.	0.80764|.	0.989;0.994;0.698|.	T|.	0.70160|.	-0.4948|.	10|.	0.46703|.	T|.	0.11|.	-17.6749|-17.6749	20.2117|20.2117	0.98287|0.98287	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	356;435;435|.	B7ZM67;Q4ADV7;G5E932|.	.;RIC1_HUMAN;.|.	E|X	435;435;356;356;356|363	ENSP00000251879:G435E;ENSP00000416696:G435E;ENSP00000370943:G356E;ENSP00000402240:G356E;ENSP00000398823:G356E|.	ENSP00000251879:G435E|.	G|W	+|+	2|3	0|0	KIAA1432|KIAA1432	5737357|5737357	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	9.281000|9.281000	0.95811|0.95811	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	GGA|TGG		0.468	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
TAF1L	138474	broad.mit.edu	37	9	32631850	32631850	+	Missense_Mutation	SNP	C	C	T	rs374466609		TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr9:32631850C>T	ENST00000242310.4	-	1	3817	c.3728G>A	c.(3727-3729)cGg>cAg	p.R1243Q	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1243					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.R1243Q(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AATCCTCCGCCGTTCTTTCCG	0.448																																					p.R1243Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3728A	9						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	96.0	94.0	95.0		3728	-0.1	0.8	9		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	TAF1L	NM_153809.2	43	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	1243/1827	32631850	2,13004	2203	4300	6503	32621850	SO:0001583	missense	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3728G>A	9.37:g.32631850C>T	ENSP00000418379:p.Arg1243Gln	Somatic		Capture	Illumina HiSeq	Phase_I	32621850	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123080	0.56613	2.27E-4	1.16E-4	ENSG00000122728	ENST00000242310	T	0.63096	-0.02	1.04	-0.0542	0.13815	.	0.106321	0.64402	D	0.000005	T	0.50377	0.1612	L	0.29908	0.895	0.42707	D	0.993631	D	0.62365	0.991	P	0.50270	0.636	T	0.50233	-0.8852	10	0.66056	D	0.02	.	4.9434	0.13976	0.0:0.7269:0.0:0.2731	.	1243	Q8IZX4	TAF1L_HUMAN	Q	1243	ENSP00000418379:R1243Q	ENSP00000418379:R1243Q	R	-	2	0	TAF1L	32621850	1.000000	0.71417	0.842000	0.33263	0.158000	0.22134	4.926000	0.63433	0.507000	0.28148	0.195000	0.17529	CGG		0.448	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
UBE2R2	54926	broad.mit.edu	37	9	33917140	33917140	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr9:33917140G>A	ENST00000263228.3	+	5	813	c.622G>A	c.(622-624)Gac>Aac	p.D208N		NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2	208	Asp/Glu-rich (acidic).				protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.D208N(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		TTTGCTTTACGACGACTTGTa	0.468																																					p.D208N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G622A	9						.						189.0	155.0	167.0					9																	33917140		2203	4300	6503	33907140	SO:0001583	missense	54926	exon5			AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797	ENST00000263228.3:c.622G>A	9.37:g.33917140G>A	ENSP00000263228:p.Asp208Asn	Somatic		Capture	Illumina HiSeq	Phase_I	33907140	NM_017811	D3DRL5|Q9NX64	Missense_Mutation	SNP	ENST00000263228.3	37	CCDS6546.1	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573183	0.65765	.	.	ENSG00000107341	ENST00000263228	T	0.57907	0.37	5.93	5.93	0.95920	Ubiquitin-conjugating enzyme/RWD-like (1);	0.108387	0.64402	D	0.000003	T	0.72890	0.3517	M	0.76002	2.32	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.66488	-0.5911	10	0.25106	T	0.35	-11.0377	20.3363	0.98740	0.0:0.0:1.0:0.0	.	208	Q712K3	UB2R2_HUMAN	N	208	ENSP00000263228:D208N	ENSP00000263228:D208N	D	+	1	0	UBE2R2	33907140	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.721000	0.98766	2.814000	0.96858	0.563000	0.77884	GAC		0.468	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052118.1	NM_017811	
KCNT1	57582	broad.mit.edu	37	9	138664706	138664706	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chr9:138664706C>G	ENST00000263604.3	+	19	2097	c.2097C>G	c.(2095-2097)gaC>gaG	p.D699E	KCNT1_ENST00000487664.1_Missense_Mutation_p.D673E|KCNT1_ENST00000298480.5_Missense_Mutation_p.D718E|KCNT1_ENST00000491806.2_Missense_Mutation_p.D685E|KCNT1_ENST00000371757.2_Missense_Mutation_p.D718E|KCNT1_ENST00000488444.2_Missense_Mutation_p.D699E|KCNT1_ENST00000486577.2_Missense_Mutation_p.D677E|KCNT1_ENST00000490355.2_Missense_Mutation_p.D697E			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	699					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.D718E(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AACTGGCCGACAGCTCAGCCC	0.716																																					p.D718E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2154G	9						.						15.0	14.0	15.0					9																	138664706		2181	4255	6436	137804527	SO:0001583	missense	57582	exon19			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2097C>G	9.37:g.138664706C>G	ENSP00000263604:p.Asp699Glu	Somatic		Capture	Illumina HiSeq	Phase_I	137804527	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	C	14.38	2.517631	0.44763	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16	3.88	2.97	0.34412	.	0.120057	0.56097	D	0.000040	D	0.88983	0.6586	M	0.77820	2.39	0.48452	D	0.99965	B;B;P;P	0.40032	0.04;0.027;0.699;0.533	B;B;P;B	0.46975	0.063;0.037;0.533;0.347	D	0.87609	0.2502	10	0.54805	T	0.06	-15.7827	11.2413	0.48970	0.0:0.9082:0.0:0.0918	.	685;718;673;699	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	E	673;718;718;677;685;699;697;699	ENSP00000417851:D673E;ENSP00000298480:D718E;ENSP00000360822:D718E;ENSP00000263604:D699E	ENSP00000263604:D699E	D	+	3	2	KCNT1	137804527	1.000000	0.71417	0.997000	0.53966	0.515000	0.34225	3.593000	0.54001	0.613000	0.30089	0.579000	0.79373	GAC		0.716	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
SH2D1A	4068	broad.mit.edu	37	X	123480541	123480541	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chrX:123480541G>A	ENST00000371139.4	+	1	348	c.49G>A	c.(49-51)Gag>Aag	p.E17K	SH2D1A_ENST00000491950.1_3'UTR|SH2D1A_ENST00000477673.2_Missense_Mutation_p.E17K|SH2D1A_ENST00000360027.4_Missense_Mutation_p.E17K|STAG2_ENST00000469481.1_Intron	NM_001114937.2|NM_002351.4	NP_001108409.1|NP_002342.1	O60880	SH21A_HUMAN	SH2 domain containing 1A	17	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|humoral immune response (GO:0006959)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)	p.E17K(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GGAAACCGGCGAGAAGCTCCT	0.577																																					p.E17K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G49A	X						.						131.0	100.0	111.0					X																	123480541		2203	4300	6503	123308222	SO:0001583	missense	4068	exon1			AL023657	CCDS14608.1, CCDS48162.1	Xq25	2014-09-17	2010-04-21		ENSG00000183918	ENSG00000183918		"""SH2 domain containing"""	10820	protein-coding gene	gene with protein product	"""Duncan's disease"""	300490	"""lymphoproliferative syndrome"", ""SH2 domain protein 1A"""	IMD5, LYP		9771704, 9774102	Standard	NM_001114937		Approved	XLP, MTCP1, DSHP, XLPD, EBVS, SAP	uc004euf.4	O60880	OTTHUMG00000022344	ENST00000371139.4:c.49G>A	X.37:g.123480541G>A	ENSP00000360181:p.Glu17Lys	Somatic		Capture	Illumina HiSeq	Phase_I	123308222	NM_001114937	A8MSW0|O95383|O95384|O95385|O95386|Q6FGS6|Q9UNR0	Missense_Mutation	SNP	ENST00000371139.4	37	CCDS14608.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333167	0.81801	.	.	ENSG00000183918	ENST00000371139;ENST00000360027;ENST00000394475	D;D	0.91740	-2.9;-2.9	5.51	5.51	0.81932	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.97173	0.9076	H	0.94964	3.605	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98254	1.0495	10	0.87932	D	0	-3.649	15.6564	0.77140	0.0:0.0:1.0:0.0	.	17;17	O60880-4;O60880	.;SH21A_HUMAN	K	17	ENSP00000360181:E17K;ENSP00000353126:E17K	ENSP00000353126:E17K	E	+	1	0	SH2D1A	123308222	1.000000	0.71417	0.978000	0.43139	0.476000	0.33039	7.515000	0.81761	2.292000	0.77174	0.513000	0.50165	GAG		0.577	SH2D1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058174.1	NM_002351	
DMD	1756	broad.mit.edu	37	X	31950218	31950218	+	De_novo_Start_OutOfFrame	SNP	T	T	A			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chrX:31950218T>A	ENST00000474231.1	-	0	401				DMD_ENST00000357033.4_Missense_Mutation_p.K2247N|DMD_ENST00000378707.3_De_novo_Start_OutOfFrame|DMD_ENST00000541735.1_De_novo_Start_OutOfFrame|DMD_ENST00000343523.2_De_novo_Start_OutOfFrame|DMD_ENST00000359836.1_De_novo_Start_OutOfFrame|DMD_ENST00000378677.2_Missense_Mutation_p.K2243N	NM_004021.2	NP_004012	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.K2242N(1)|p.K2243N(1)|p.K906N(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CAAGCTTTTCTTTTAGTTGCT	0.343																																					p.K906N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A2718T	X						.						110.0	104.0	106.0					X																	31950218		2202	4300	6502	31860139			1756	exon18			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000474231.1:c.-640A>T	X.37:g.31950218T>A		Somatic		Capture	Illumina HiSeq	Phase_I	31860139	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	De_novo_Start_OutOfFrame	SNP	ENST00000474231.1	37		.	.	.	.	.	.	.	.	.	.	t	12.93	2.085330	0.36758	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.53206	0.63;0.63	5.95	2.08	0.27032	.	0.196711	0.23985	U	0.042640	T	0.19725	0.0474	N	0.12182	0.205	0.58432	D	0.999998	B;B;B;B;B;B	0.12630	0.006;0.0;0.0;0.0;0.001;0.0	B;B;B;B;B;B	0.09377	0.004;0.001;0.0;0.001;0.001;0.001	T	0.06481	-1.0824	10	0.08599	T	0.76	.	2.0832	0.03640	0.1312:0.162:0.1329:0.5739	.	906;2239;2247;2243;906;903	P11532-2;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;.;DMD_HUMAN;.;.;.	N	2239;906;903;2243;2247;2247;2124	ENSP00000367948:K2243N;ENSP00000354923:K2247N	ENSP00000354923:K2247N	K	-	3	2	DMD	31860139	1.000000	0.71417	0.995000	0.50966	0.945000	0.59286	1.344000	0.33941	0.851000	0.35264	0.478000	0.44815	AAA		0.343	DMD-016	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000356267.1	NM_004006	
FMR1NB	158521	broad.mit.edu	37	X	147062932	147062932	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3807-01A-01W-0995-10	TCGA-A6-3807-11A-01W-0995-10	g.chrX:147062932C>T	ENST00000370467.3	+	1	84	c.10C>T	c.(10-12)Cat>Tat	p.H4Y		NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	4						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)		p.H4Y(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CATGTCTTCACATAGGAGGAA	0.617																																					p.H4Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10T	X						.						99.0	76.0	84.0					X																	147062932		2203	4300	6503	146870624	SO:0001583	missense	158521	exon1				CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.10C>T	X.37:g.147062932C>T	ENSP00000359498:p.His4Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	146870624	NM_152578	D3DWT3	Missense_Mutation	SNP	ENST00000370467.3	37	CCDS14683.1	.	.	.	.	.	.	.	.	.	.	C	5.925	0.354752	0.11239	.	.	ENSG00000176988	ENST00000370467	T	0.50001	0.76	1.65	-0.245	0.13027	.	.	.	.	.	T	0.24198	0.0586	N	0.08118	0	0.09310	N	1	B	0.25048	0.117	B	0.28553	0.091	T	0.23368	-1.0190	9	0.72032	D	0.01	-0.3544	2.9295	0.05795	0.202:0.2941:0.504:0.0	.	4	Q8N0W7	FMR1N_HUMAN	Y	4	ENSP00000359498:H4Y	ENSP00000359498:H4Y	H	+	1	0	FMR1NB	146870624	0.001000	0.12720	0.004000	0.12327	0.030000	0.12068	0.325000	0.19628	-0.154000	0.11118	-0.280000	0.10049	CAT		0.617	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058667.1	NM_152578	
