#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DNAJC6	9829	hgsc.bcm.edu	37	1	65858514	65858515	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:65858514_65858515insA	ENST00000395325.3	+	12	1855_1856	c.1698_1699insA	c.(1699-1701)accfs	p.T567fs	DNAJC6_ENST00000371069.4_Frame_Shift_Ins_p.T624fs|DNAJC6_ENST00000263441.7_Frame_Shift_Ins_p.T554fs	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	567	Pro-rich.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)	p.T567fs*16(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						CTGCCACCTCCACCTCTGCGTC	0.525																																					p.S566fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1698_1699insA	1						.																																			65631103	SO:0001589	frameshift_variant	9829	exon12			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.1699dupA	1.37:g.65858515_65858515dupA	ENSP00000378735:p.Thr567fs	Somatic		Capture	SOLID	Phase_I	65631102	NM_014787	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Frame_Shift_Ins	INS	ENST00000395325.3	37	CCDS30739.1																																																																																				0.525	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
BCLAF1	9774	hgsc.bcm.edu	37	6	136599909	136599910	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr6:136599909_136599910insTG	ENST00000531224.1	-	4	361_362	c.109_110insCA	c.(109-111)aggfs	p.R37fs	BCLAF1_ENST00000530767.1_Frame_Shift_Ins_p.R37fs|BCLAF1_ENST00000392348.2_Splice_Site|BCLAF1_ENST00000527759.1_Splice_Site|BCLAF1_ENST00000527536.1_Frame_Shift_Ins_p.R37fs|BCLAF1_ENST00000353331.4_Splice_Site	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	37					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R37fs*32(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GGAACGAGACCTAGAACTAAAA	0.322																																					p.R37fs	Colon(142;1534 1789 5427 7063 28491)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.110_111insCA	6						.																																			136641603	SO:0001589	frameshift_variant	9774	exon4			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.109_110insCA	6.37:g.136599909_136599910insTG	ENSP00000435210:p.Arg37fs	None		Capture	SOLID	Phase_I	136641602	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Frame_Shift_Ins	INS	ENST00000531224.1	37	CCDS5177.1																																																																																				0.322	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
CLECL1	160365	hgsc.bcm.edu	37	12	9885707	9885708	+	Frame_Shift_Ins	INS	-	-	TAAGT	rs71929655|rs113575400|rs113222621|rs71045297|rs398070028		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:9885707_9885708insTAAGT	ENST00000327839.3	-	1	187_188	c.153_154insACTTA	c.(151-156)ttatcafs	p.S52fs		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.S52fs*26(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						GAAACTTCTGATAAGTAAATTG	0.401														2748	0.548722	0.7564	0.4597	5008	,	,		20040	0.38		0.496	False		,,,				2504	0.5593				p.S52fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.154_155insACTTA	12						.			2986,1278		1042,902,188						1.9	0.0		dbSNP_130	78	4130,4124		1066,1998,1063	no	frameshift	CLECL1	NM_172004.2		2108,2900,1251	A1A1,A1R,RR		49.9637,29.9719,43.1539				7116,5402				9776975	SO:0001589	frameshift_variant	160365	exon1			AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.149_153dupACTTA	12.37:g.9885708_9885712dupTAAGT	ENSP00000331766:p.Ser52fs	Somatic		Capture	SOLID	Phase_I	9776974	NM_172004		Frame_Shift_Ins	INS	ENST00000327839.3	37	CCDS8603.1																																																																																				0.401	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
CCDC6	8030	hgsc.bcm.edu	37	10	61592324	61592325	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr10:61592324_61592325insT	ENST00000263102.6	-	3	771_772	c.540_541insA	c.(538-543)aaactgfs	p.L181fs		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	181	5 X 29 AA tandem repeats.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)	p.L181fs*4(1)	CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		TCATTCTCCAGTTTTTTAATTT	0.366			T	RET	NSCLC																																p.L181fs			Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.541_542insA	10						.																																			61262331	SO:0001589	frameshift_variant	8030	exon3			S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.541dupA	10.37:g.61592330_61592330dupT	ENSP00000263102:p.Leu181fs	Somatic		Capture	SOLID	Phase_I	61262330	NM_005436	Q15250|Q6GSG7	Frame_Shift_Ins	INS	ENST00000263102.6	37	CCDS7257.1																																																																																				0.366	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
ANKHD1	54882	hgsc.bcm.edu	37	5	139876732	139876733	+	Frame_Shift_Ins	INS	-	-	GAACT			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:139876732_139876733insGAACT	ENST00000360839.2	+	15	3027_3028	c.2873_2874insGAACT	c.(2872-2877)cagcagfs	p.Q959fs	ANKHD1_ENST00000462121.1_3'UTR|ANKHD1_ENST00000297183.6_Frame_Shift_Ins_p.Q959fs|ANKHD1-EIF4EBP3_ENST00000532219.1_Frame_Shift_Ins_p.Q959fs	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	959						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGGTAATCAGCAGATTGTAG	0.446																																					p.Q958fs												.	.	0			c.2873_2874insGAACT	5						.																																			139856917	SO:0001589	frameshift_variant	404734	exon15			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	Exception_encountered	5.37:g.139876732_139876733insGAACT	ENSP00000354085:p.Gln959fs	None		Capture	SOLID	Phase_I	139856916	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Frame_Shift_Ins	INS	ENST00000360839.2	37	CCDS4225.1																																																																																				0.446	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
IGFBP3	3486	hgsc.bcm.edu	37	7	45956996	45956996	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr7:45956996A>T	ENST00000275521.6	-	2	579	c.446T>A	c.(445-447)gTg>gAg	p.V149E	IGFBP3_ENST00000381083.4_Missense_Mutation_p.V155E|IGFBP3_ENST00000381086.5_Missense_Mutation_p.V52E|IGFBP3_ENST00000465642.1_5'UTR	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	149	Ser/Thr-rich.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)			large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	CGGGCTCTCCACACTGCCGGC	0.507											OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V149E												.	.	0			c.T446A	7						.						63.0	62.0	62.0					7																	45956996		2203	4300	6503	45923521	SO:0001583	missense	3486	exon2				CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.446T>A	7.37:g.45956996A>T	ENSP00000275521:p.Val149Glu	None	935	Capture	SOLID	Phase_I	45923521	NM_000598	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	ENST00000275521.6	37	CCDS5505.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	12.24|12.24|12.24	1.877509|1.877509|1.877509	0.33162|0.33162|0.33162	.|.|.	.|.|.	ENSG00000146674|ENSG00000146674|ENSG00000146674	ENST00000417621|ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817|ENST00000428530	.|T;T;T;T|.	.|0.26660|.	.|2.37;1.72;2.38;1.92|.	5.55|5.55|5.55	-1.33|-1.33|-1.33	0.09172|0.09172|0.09172	.|.|.	.|3.390130|.	.|0.00559|.	.|N|.	.|0.000269|.	.|T|T	.|0.32071|0.32071	.|0.0817|0.0817	L|L|L	0.40543|0.40543|0.40543	1.245|1.245|1.245	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|B;B;B|.	.|0.12013|.	.|0.005;0.002;0.002|.	.|B;B;B|.	.|0.09377|.	.|0.003;0.004;0.003|.	.|T|T	.|0.31420|0.31420	.|-0.9944|-0.9944	.|10|5	.|0.07482|.	.|T|.	.|0.82|.	-6.8147|-6.8147|-6.8147	5.3427|5.3427|5.3427	0.15992|0.15992|0.15992	0.6955:0.0:0.1685:0.136|0.6955:0.0:0.1685:0.136|0.6955:0.0:0.1685:0.136	.|.|.	.|52;149;134|.	.|B3KWK7;P17936;B4DN53|.	.|.;IBP3_HUMAN;.|.	X|E|R	10|126;149;52;135;47;155;121;39|1	.|ENSP00000275521:V149E;ENSP00000370476:V52E;ENSP00000370473:V155E;ENSP00000389668:V39E|.	.|ENSP00000275521:V149E|.	C|V|W	-|-|-	3|2|1	2|0|0	IGFBP3|IGFBP3|IGFBP3	45923521|45923521|45923521	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.004000|0.004000|0.004000	0.04260|0.04260|0.04260	0.495000|0.495000|0.495000	0.22483|0.22483|0.22483	-0.399000|-0.399000|-0.399000	0.07668|0.07668|0.07668	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TGT|GTG|TGG		0.507	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3	NM_001013398	
LIMK1	3984	hgsc.bcm.edu	37	7	73526026	73526026	+	Missense_Mutation	SNP	G	G	A	rs141412371		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr7:73526026G>A	ENST00000336180.2	+	11	1384	c.1333G>A	c.(1333-1335)Gca>Aca	p.A445T	LIMK1_ENST00000538333.3_Missense_Mutation_p.A411T|LIMK1_ENST00000418310.1_Missense_Mutation_p.A475T	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	445	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.A445T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	CAAGGACATCGCATCAGGGAT	0.567																																					p.A445T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1333A	7						.	G	THR/ALA,THR/ALA	0,4406		0,0,2203	59.0	50.0	53.0		1231,1333	4.9	1.0	7	dbSNP_134	53	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	LIMK1	NM_001204426.1,NM_002314.3	58,58	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	411/614,445/648	73526026	2,13004	2203	4300	6503	73163962	SO:0001583	missense	3984	exon11			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1333G>A	7.37:g.73526026G>A	ENSP00000336740:p.Ala445Thr	Somatic		Capture	SOLID	Phase_I	73163962	NM_002314	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	ENST00000336180.2	37	CCDS5563.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369216	0.82463	0.0	2.33E-4	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	D;D;D	0.89746	-2.56;-2.56;-2.56	4.92	4.92	0.64577	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.111526	0.64402	D	0.000011	D	0.93838	0.8029	M	0.77712	2.385	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.66979	0.948;0.948	D	0.94650	0.7838	10	0.87932	D	0	-15.6137	15.6705	0.77270	0.0:0.0:1.0:0.0	.	411;445	B7Z6I8;P53667	.;LIMK1_HUMAN	T	475;445;445;411	ENSP00000409717:A475T;ENSP00000336740:A445T;ENSP00000444452:A411T	ENSP00000336740:A445T	A	+	1	0	LIMK1	73163962	1.000000	0.71417	0.989000	0.46669	0.559000	0.35586	7.337000	0.79256	2.272000	0.75746	0.543000	0.68304	GCA		0.567	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
CALCR	799	hgsc.bcm.edu	37	7	93108747	93108747	+	Missense_Mutation	SNP	C	C	T	rs544410123	byFrequency	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr7:93108747C>T	ENST00000394441.1	-	3	439	c.124G>A	c.(124-126)Gtc>Atc	p.V42I	CALCR_ENST00000421592.1_Missense_Mutation_p.V42I|CALCR_ENST00000359558.2_Missense_Mutation_p.V60I|CALCR_ENST00000360249.4_Missense_Mutation_p.V42I|CALCR_ENST00000426151.1_Missense_Mutation_p.V42I	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	60					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.V42I(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CGTCCTACGACGTAAAGAAAT	0.403													C|||	2	0.000399361	0.0	0.0	5008	,	,		17833	0.002		0.0	False		,,,				2504	0.0				p.V42I												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G124A	7						.						217.0	201.0	207.0					7																	93108747		2203	4300	6503	92946683	SO:0001583	missense	799	exon4			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.124G>A	7.37:g.93108747C>T	ENSP00000377959:p.Val42Ile	Somatic		Capture	SOLID	Phase_I	92946683	NM_001742	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	1.739	-0.492062	0.04322	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000535783;ENST00000394441;ENST00000426151	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.21	-10.4	0.00318	.	.	.	.	.	T	0.24661	0.0598	N	0.25647	0.755	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.13072	-1.0523	9	0.33141	T	0.24	.	4.8001	0.13292	0.2475:0.1518:0.0665:0.5343	.	60;42	F5H605;A4D1G6	.;.	I	60;42;42;42;42;42	ENSP00000352561:V60I;ENSP00000353385:V42I;ENSP00000399552:V42I;ENSP00000377959:V42I;ENSP00000389295:V42I	ENSP00000352561:V60I	V	-	1	0	CALCR	92946683	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.548000	0.00930	-4.171000	0.00068	-1.969000	0.00466	GTC		0.403	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
PPP1R9A	55607	hgsc.bcm.edu	37	7	94855372	94855372	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr7:94855372G>T	ENST00000433881.1	+	7	2522	c.1990G>T	c.(1990-1992)Gac>Tac	p.D664Y	PPP1R9A_ENST00000340694.4_Missense_Mutation_p.D664Y|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.D664Y|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.D664Y|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.D664Y|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.D686Y			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	664	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.D664Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TGAGAATGAGGACATGTTTTC	0.458										HNSCC(28;0.073)																											p.D664Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1990T	7						.						134.0	106.0	115.0					7																	94855372		2203	4300	6503	94693308	SO:0001583	missense	55607	exon6			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1990G>T	7.37:g.94855372G>T	ENSP00000398870:p.Asp664Tyr	Somatic		Capture	SOLID	Phase_I	94693308	NM_001166163	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.788529	0.70337	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.20598	2.06;2.09;2.09;2.09;2.09;2.09	5.12	5.12	0.69794	.	0.143106	0.64402	D	0.000009	T	0.45377	0.1339	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.89917	0.985;1.0;1.0;1.0;0.991	P;D;D;D;P	0.76071	0.845;0.987;0.987;0.95;0.804	T	0.33701	-0.9858	10	0.87932	D	0	.	19.1381	0.93436	0.0:0.0:1.0:0.0	.	664;664;686;664;664	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	Y	686;664;664;664;664;664	ENSP00000405514:D686Y;ENSP00000344524:D664Y;ENSP00000411342:D664Y;ENSP00000398870:D664Y;ENSP00000289495:D664Y;ENSP00000402893:D664Y	ENSP00000289495:D664Y	D	+	1	0	PPP1R9A	94693308	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	8.863000	0.92288	2.836000	0.97738	0.655000	0.94253	GAC		0.458	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
SLX4IP	128710	hgsc.bcm.edu	37	20	10603342	10603342	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr20:10603342G>C	ENST00000334534.5	+	8	722	c.542G>C	c.(541-543)aGc>aCc	p.S181T		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	181								p.S181T(1)									AGTGTCACGAGCAAATCGCAG	0.438																																					p.S181T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G542C	20						.						65.0	57.0	60.0					20																	10603342		2203	4300	6503	10551342	SO:0001583	missense	128710	exon8			AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	ENST00000334534.5:c.542G>C	20.37:g.10603342G>C	ENSP00000335557:p.Ser181Thr	Somatic		Capture	SOLID	Phase_I	10551342	NM_001009608	Q05CG2|Q05CT9	Missense_Mutation	SNP	ENST00000334534.5	37	CCDS33439.1	.	.	.	.	.	.	.	.	.	.	G	7.923	0.738977	0.15642	.	.	ENSG00000149346	ENST00000334534	T	0.56776	0.44	5.93	3.96	0.45880	.	0.379749	0.31519	N	0.007515	T	0.50973	0.1647	M	0.61703	1.905	0.18873	N	0.999981	P	0.49559	0.925	B	0.44044	0.439	T	0.48833	-0.9000	10	0.56958	D	0.05	0.07	10.067	0.42311	0.2071:0.0:0.7929:0.0	.	181	Q5VYV7	CT094_HUMAN	T	181	ENSP00000335557:S181T	ENSP00000335557:S181T	S	+	2	0	C20orf94	10551342	1.000000	0.71417	0.195000	0.23364	0.005000	0.04900	1.547000	0.36190	0.828000	0.34709	0.555000	0.69702	AGC		0.438	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078000.3	NM_001009608	
SLX4IP	128710	hgsc.bcm.edu	37	20	10603345	10603345	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr20:10603345A>C	ENST00000334534.5	+	8	725	c.545A>C	c.(544-546)aAa>aCa	p.K182T		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	182																	GTCACGAGCAAATCGCAGACC	0.438																																					p.K182T												.	.	0			c.A545C	20						.						67.0	59.0	62.0					20																	10603345		2203	4300	6503	10551345	SO:0001583	missense	128710	exon8			AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	ENST00000334534.5:c.545A>C	20.37:g.10603345A>C	ENSP00000335557:p.Lys182Thr	None		Capture	SOLID	Phase_I	10551345	NM_001009608	Q05CG2|Q05CT9	Missense_Mutation	SNP	ENST00000334534.5	37	CCDS33439.1	.	.	.	.	.	.	.	.	.	.	A	8.713	0.912602	0.17907	.	.	ENSG00000149346	ENST00000334534	T	0.57436	0.4	5.93	3.69	0.42338	.	0.330332	0.32068	N	0.006633	T	0.56307	0.1976	L	0.56769	1.78	0.18873	N	0.999984	D	0.53312	0.959	P	0.50659	0.647	T	0.51553	-0.8691	10	0.62326	D	0.03	-3.0439	10.4051	0.44252	0.868:0.0:0.132:0.0	.	182	Q5VYV7	CT094_HUMAN	T	182	ENSP00000335557:K182T	ENSP00000335557:K182T	K	+	2	0	C20orf94	10551345	1.000000	0.71417	0.055000	0.19348	0.004000	0.04260	2.928000	0.48908	0.502000	0.28037	0.454000	0.30748	AAA		0.438	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078000.3	NM_001009608	
CDC25B	994	hgsc.bcm.edu	37	20	3782577	3782577	+	Missense_Mutation	SNP	G	G	A	rs547724975		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr20:3782577G>A	ENST00000245960.5	+	10	1625	c.928G>A	c.(928-930)Gtc>Atc	p.V310I	CDC25B_ENST00000439880.2_Missense_Mutation_p.V296I|CDC25B_ENST00000379598.5_Missense_Mutation_p.V219I|CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000344256.6_Missense_Mutation_p.V246I|CDC25B_ENST00000340833.4_Missense_Mutation_p.V269I	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	310					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.V310I(1)|p.V331I(1)		NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						CCAGGACCTCGTCATGTACAG	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18444	0.0		0.0	False		,,,				2504	0.0				p.V296I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G886A	20						.						28.0	27.0	28.0					20																	3782577		2203	4300	6503	3730577	SO:0001583	missense	994	exon10				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.928G>A	20.37:g.3782577G>A	ENSP00000245960:p.Val310Ile	Somatic		Capture	SOLID	Phase_I	3730577	NM_004358	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	ENST00000245960.5	37	CCDS13067.1	.	.	.	.	.	.	.	.	.	.	G	4.823	0.153010	0.09185	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	4.22	-5.44	0.02624	.	0.749845	0.12498	N	0.463641	T	0.06096	0.0158	N	0.00972	-1.085	0.23704	N	0.997064	B;B;B;B;B;B	0.22276	0.012;0.067;0.006;0.004;0.004;0.01	B;B;B;B;B;B	0.21360	0.021;0.034;0.015;0.005;0.009;0.003	T	0.37596	-0.9699	10	0.28530	T	0.3	-20.7623	13.4284	0.61039	0.3782:0.0:0.6218:0.0	.	219;232;246;269;296;310	B4DQZ3;B4DRC3;B4DIG0;P30305-3;P30305-2;P30305	.;.;.;.;.;MPIP2_HUMAN	I	246;219;310;296;269	ENSP00000339125:V246I;ENSP00000368918:V219I;ENSP00000245960:V310I;ENSP00000405972:V296I;ENSP00000339170:V269I	ENSP00000245960:V310I	V	+	1	0	CDC25B	3730577	0.001000	0.12720	0.847000	0.33407	0.329000	0.28539	-0.530000	0.06179	-1.018000	0.03363	-0.948000	0.02665	GTC		0.632	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077779.2	NM_021874	
SLX4IP	128710	hgsc.bcm.edu	37	20	10603521	10603521	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr20:10603521G>A	ENST00000334534.5	+	8	901	c.721G>A	c.(721-723)Gaa>Aaa	p.E241K		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	241																	TCAAAAGCTGGAAAAAGTTAA	0.532																																					p.E241K												.	.	0			c.G721A	20						.						54.0	58.0	57.0					20																	10603521		2203	4300	6503	10551521	SO:0001583	missense	128710	exon8			AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	ENST00000334534.5:c.721G>A	20.37:g.10603521G>A	ENSP00000335557:p.Glu241Lys	None		Capture	SOLID	Phase_I	10551521	NM_001009608	Q05CG2|Q05CT9	Missense_Mutation	SNP	ENST00000334534.5	37	CCDS33439.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504444	0.85176	.	.	ENSG00000149346	ENST00000334534	T	0.54071	0.59	5.93	5.93	0.95920	.	0.146212	0.48286	D	0.000184	T	0.68274	0.2983	M	0.61703	1.905	0.45962	D	0.998786	D	0.65815	0.995	D	0.64144	0.922	T	0.69094	-0.5236	10	0.66056	D	0.02	-17.7358	15.4257	0.75048	0.068:0.0:0.932:0.0	.	241	Q5VYV7	CT094_HUMAN	K	241	ENSP00000335557:E241K	ENSP00000335557:E241K	E	+	1	0	C20orf94	10551521	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.449000	0.66619	2.821000	0.97095	0.555000	0.69702	GAA		0.532	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078000.3	NM_001009608	
TOX2	84969	hgsc.bcm.edu	37	20	42695444	42695444	+	Silent	SNP	C	C	T	rs372255529		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr20:42695444C>T	ENST00000358131.5	+	7	1585	c.1377C>T	c.(1375-1377)agC>agT	p.S459S	TOX2_ENST00000423191.2_Silent_p.S435S|TOX2_ENST00000341197.4_Silent_p.S477S|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000372999.1_Silent_p.S435S	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	459					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S435S(1)|p.S486S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCACCAGCAGCGGGGACTGGG	0.637																																					p.S435S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1305T	20						.	C	,,,	0,4406		0,0,2203	123.0	117.0	119.0		1305,1431,1377,1305	-2.5	1.0	20		119	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TOX2	NM_001098796.1,NM_001098797.1,NM_001098798.1,NM_032883.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	435/465,477/507,459/489,435/465	42695444	1,13005	2203	4300	6503	42128858	SO:0001819	synonymous_variant	84969	exon9			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1377C>T	20.37:g.42695444C>T		Somatic		Capture	SOLID	Phase_I	42128858	NM_032883	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	37	CCDS42875.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039590	0.55003	0.0	1.16E-4	ENSG00000124191	ENST00000372992;ENST00000413823	.	.	.	5.77	-2.53	0.06326	.	.	.	.	.	T	0.67297	0.2878	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69712	-0.5071	5	0.87932	D	0	.	11.0427	0.47840	0.0:0.4557:0.0:0.5443	.	.	.	.	V	84	.	ENSP00000362083:A84V	A	+	2	0	TOX2	42128858	0.782000	0.28689	0.966000	0.40874	0.708000	0.40852	0.265000	0.18515	-0.464000	0.06963	0.650000	0.86243	GCG		0.637	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2		
BMP7	655	hgsc.bcm.edu	37	20	55748260	55748260	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr20:55748260G>A	ENST00000395863.3	-	6	1647	c.1142C>T	c.(1141-1143)aCg>aTg	p.T381M	BMP7_ENST00000395864.3_Missense_Mutation_p.T315M|BMP7_ENST00000460817.1_5'UTR|BMP7_ENST00000450594.2_Missense_Mutation_p.T381M	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	381					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)	p.T381M(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			ACCCACCAGCGTCTGCACGAT	0.637																																					p.T381M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1142T	20						.						153.0	96.0	115.0					20																	55748260		2203	4300	6503	55181667	SO:0001583	missense	655	exon6				CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.1142C>T	20.37:g.55748260G>A	ENSP00000379204:p.Thr381Met	Somatic		Capture	SOLID	Phase_I	55181667	NM_001719	Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295693	0.81025	.	.	ENSG00000101144	ENST00000395863;ENST00000395864;ENST00000450594	D;D;D	0.89617	-2.54;-2.54;-2.54	4.84	3.88	0.44766	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95825	0.8641	H	0.94345	3.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96848	0.9623	10	0.87932	D	0	.	14.7344	0.69406	0.0:0.0:0.8539:0.1461	.	315;381;381	B1AKZ9;P18075;B1AL00	.;BMP7_HUMAN;.	M	381;315;381	ENSP00000379204:T381M;ENSP00000379205:T315M;ENSP00000398687:T381M	ENSP00000379204:T381M	T	-	2	0	BMP7	55181667	1.000000	0.71417	0.830000	0.32933	0.820000	0.46376	9.731000	0.98807	1.157000	0.42530	0.591000	0.81541	ACG		0.637	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		
RAB2B	84932	hgsc.bcm.edu	37	14	21931902	21931902	+	Silent	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr14:21931902C>T	ENST00000397762.1	-	6	487	c.387G>A	c.(385-387)gtG>gtA	p.V129V	RAB2B_ENST00000461909.1_5'UTR	NM_001163380.1|NM_032846.3	NP_001156852.1|NP_116235.2	Q8WUD1	RAB2B_HUMAN	RAB2B, member RAS oncogene family	129					positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.V129V(1)		NS(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6	all_cancers(95;0.000858)		Epithelial(56;1.53e-06)|all cancers(55;1.44e-05)	GBM - Glioblastoma multiforme(265;0.00391)		CTTCTCTCTTCACATCCCTGC	0.388																																					p.V83V	Melanoma(131;1007 1750 28652 34486 42672)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G249A	14						.						124.0	113.0	117.0					14																	21931902		2203	4300	6503	21001742	SO:0001819	synonymous_variant	84932	exon5			AK027730	CCDS9570.1	14q11.1	2006-12-18			ENSG00000129472	ENSG00000129472		"""RAB, member RAS oncogene"""	20246	protein-coding gene	gene with protein product		607466				12376746	Standard	NM_032846		Approved	FLJ14824	uc010tlt.2	Q8WUD1	OTTHUMG00000029693	ENST00000397762.1:c.387G>A	14.37:g.21931902C>T		Somatic		Capture	SOLID	Phase_I	21001742	NM_001163380	B2RD03|D3DS24|Q6NZ33	Silent	SNP	ENST00000397762.1	37	CCDS9570.1																																																																																				0.388	RAB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074053.4		
ABHD4	63874	hgsc.bcm.edu	37	14	23078695	23078695	+	Missense_Mutation	SNP	G	G	A	rs140739173	byFrequency	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr14:23078695G>A	ENST00000428304.2	+	6	888	c.818G>A	c.(817-819)cGa>cAa	p.R273Q	ABHD4_ENST00000544562.1_3'UTR	NM_022060.2	NP_071343.2	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4	273					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)	p.R273Q(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(3)|prostate(1)	14	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		ATGCTGGAGCGAATTCACTTG	0.498																																					p.R273Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G818A	14						.	G	GLN/ARG	0,4406		0,0,2203	96.0	92.0	93.0		818	3.8	1.0	14	dbSNP_134	93	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ABHD4	NM_022060.2	43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	273/343	23078695	2,13004	2203	4300	6503	22148535	SO:0001583	missense	63874	exon6			AK022878	CCDS9572.1	14q11.1	2006-10-06			ENSG00000100439	ENSG00000100439		"""Abhydrolase domain containing"""	20154	protein-coding gene	gene with protein product							Standard	NM_022060		Approved	FLJ12816	uc001wgm.3	Q8TB40	OTTHUMG00000028686	ENST00000428304.2:c.818G>A	14.37:g.23078695G>A	ENSP00000414558:p.Arg273Gln	Somatic		Capture	SOLID	Phase_I	22148535	NM_022060	B4DDH7|Q9H9E0	Missense_Mutation	SNP	ENST00000428304.2	37	CCDS9572.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026875	0.93518	0.0	2.33E-4	ENSG00000100439	ENST00000428304;ENST00000216327	D;D	0.84873	-1.91;-1.91	5.64	3.8	0.43715	.	0.000000	0.85682	D	0.000000	D	0.92648	0.7664	M	0.89715	3.055	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.93080	0.6490	10	0.66056	D	0.02	-5.6733	10.7318	0.46100	0.1596:0.0:0.8404:0.0	.	273	Q8TB40	ABHD4_HUMAN	Q	273;207	ENSP00000414558:R273Q;ENSP00000216327:R207Q	ENSP00000216327:R207Q	R	+	2	0	ABHD4	22148535	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.635000	0.83286	1.387000	0.46486	0.643000	0.83706	CGA		0.498	ABHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071623.3		
NOP9	161424	hgsc.bcm.edu	37	14	24772967	24772967	+	Silent	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr14:24772967G>A	ENST00000267425.3	+	7	1407	c.1314G>A	c.(1312-1314)cgG>cgA	p.R438R	NOP9_ENST00000396802.3_Silent_p.R438R	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	438							poly(A) RNA binding (GO:0044822)	p.R438R(1)									CCTCATCCCGGCAAGTGGCCT	0.532																																					p.R438R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1314A	14						.						77.0	73.0	74.0					14																	24772967		2203	4300	6503	23842807	SO:0001819	synonymous_variant	161424	exon7				CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.1314G>A	14.37:g.24772967G>A		Somatic		Capture	SOLID	Phase_I	23842807	NM_174913	A8MY76|Q8IVF0|Q8TBS6	Silent	SNP	ENST00000267425.3	37	CCDS9624.1	.	.	.	.	.	.	.	.	.	.	G	9.028	0.986581	0.18889	.	.	ENSG00000196943	ENST00000557362	.	.	.	5.32	3.41	0.39046	.	.	.	.	.	T	0.58623	0.2135	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55541	-0.8125	4	.	.	.	-19.0835	8.7225	0.34449	0.0824:0.4059:0.5117:0.0	.	.	.	.	D	64	.	.	G	+	2	0	C14orf21	23842807	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.331000	0.19733	1.411000	0.46957	0.655000	0.94253	GGC		0.532	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073186.2		
DCAF5	8816	hgsc.bcm.edu	37	14	69520613	69520613	+	Silent	SNP	A	A	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr14:69520613A>G	ENST00000341516.5	-	9	2937	c.2790T>C	c.(2788-2790)gaT>gaC	p.D930D	DCAF5_ENST00000554215.1_Silent_p.D848D|DCAF5_ENST00000557386.1_Silent_p.D929D|DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000556847.1_Silent_p.D848D	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	930					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)		p.D930D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						AATTCTCTGAATCTGTATCTT	0.393																																					p.D930D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2790C	14						.						66.0	72.0	70.0					14																	69520613		2203	4300	6503	68590366	SO:0001819	synonymous_variant	8816	exon9			AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2790T>C	14.37:g.69520613A>G		Somatic		Capture	SOLID	Phase_I	68590366	NM_003861	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Silent	SNP	ENST00000341516.5	37	CCDS32106.1																																																																																				0.393	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861	
NRXN3	9369	hgsc.bcm.edu	37	14	79175866	79175866	+	Missense_Mutation	SNP	G	G	A	rs200274508		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr14:79175866G>A	ENST00000554719.1	+	4	900	c.409G>A	c.(409-411)Gtg>Atg	p.V137M	NRXN3_ENST00000335750.5_Missense_Mutation_p.V137M|RP11-232C2.2_ENST00000555680.1_RNA	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	141	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.V137M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTTCTTTGCCGTGGAACTCCT	0.507																																					p.V137M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G409A	14						.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	139.0	142.0	141.0		409	5.4	1.0	14		141	1,8599	1.2+/-3.3	0,1,4299	yes	missense	NRXN3	NM_004796.4	21	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	137/1062	79175866	2,13004	2203	4300	6503	78245619	SO:0001583	missense	9369	exon4			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.409G>A	14.37:g.79175866G>A	ENSP00000451648:p.Val137Met	Somatic		Capture	SOLID	Phase_I	78245619	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	G	8.942	0.965968	0.18659	2.27E-4	1.16E-4	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557081	T;T;T	0.81330	-1.48;-1.48;-1.44	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.065942	0.64402	D	0.000012	D	0.83857	0.5345	L	0.28192	0.835	0.54753	D	0.99998	D;P	0.89917	1.0;0.533	D;B	0.74348	0.983;0.144	T	0.82550	-0.0401	9	.	.	.	.	19.1251	0.93380	0.0:0.0:1.0:0.0	.	510;137	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	M	510;508;137;137;81	ENSP00000451648:V137M;ENSP00000338349:V137M;ENSP00000450462:V81M	.	V	+	1	0	NRXN3	78245619	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	6.781000	0.75068	2.518000	0.84900	0.563000	0.77884	GTG		0.507	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
MKL1	57591	hgsc.bcm.edu	37	22	40816871	40816873	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	GGC	GGC	GGC	GGC	GGC	GGC	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr22:40816871_40816873delGGC	ENST00000355630.3	-	10	1449_1451	c.859_861delGCC	c.(859-861)gccdel	p.A287del	MKL1_ENST00000407029.1_In_Frame_Del_p.A287del|MKL1_ENST00000402042.1_In_Frame_Del_p.A237del|MKL1_ENST00000396617.3_In_Frame_Del_p.A287del	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	287					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CAGGCAGGATGGCCTGGTAGTTG	0.655			T	RBM15	acute megakaryocytic leukemia																																p.287_287del			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	.	0			c.859_861del	22						.																																			39146819	SO:0001651	inframe_deletion	57591	exon10			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.859_861delGCC	22.37:g.40816871_40816873delGGC	ENSP00000347847:p.Ala287del	None		Capture	SOLID	Phase_I	39146817	NM_020831	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	In_Frame_Del	DEL	ENST00000355630.3	37	CCDS14003.1																																																																																				0.655	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
ANKRD27	84079	hgsc.bcm.edu	37	19	33116787	33116787	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr19:33116787T>A	ENST00000306065.4	-	17	1780	c.1622A>T	c.(1621-1623)cAc>cTc	p.H541L		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	541					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CACGTCCTCGTGGCCGTAGGT	0.562																																					p.H541L												.	.	0			c.A1622T	19						.						91.0	64.0	73.0					19																	33116787		2203	4300	6503	37808627	SO:0001583	missense	84079	exon17			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1622A>T	19.37:g.33116787T>A	ENSP00000304292:p.His541Leu	None		Capture	SOLID	Phase_I	37808627	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.942139	0.73672	.	.	ENSG00000105186	ENST00000306065	T	0.66815	-0.23	5.65	5.65	0.86999	Ankyrin repeat-containing domain (3);	0.091536	0.47852	D	0.000215	T	0.79070	0.4384	M	0.65677	2.01	0.80722	D	1	D	0.63046	0.992	D	0.66084	0.941	T	0.81081	-0.1094	10	0.66056	D	0.02	-23.2035	14.4298	0.67240	0.0:0.0:0.0:1.0	.	541	Q96NW4	ANR27_HUMAN	L	541	ENSP00000304292:H541L	ENSP00000304292:H541L	H	-	2	0	ANKRD27	37808627	1.000000	0.71417	0.811000	0.32455	0.367000	0.29736	7.291000	0.78721	2.149000	0.67028	0.334000	0.21626	CAC		0.562	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
FPR2	2358	hgsc.bcm.edu	37	19	52272279	52272279	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr19:52272279G>A	ENST00000598776.1	+	2	1140	c.368G>A	c.(367-369)cGc>cAc	p.R123H	FPR2_ENST00000598953.1_Missense_Mutation_p.R123H|FPR2_ENST00000340023.6_Missense_Mutation_p.R123H	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	123					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)	p.R123H(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						GCACTGGACCGCTGCATTTGT	0.498																																					p.R123H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G368A	19						.						155.0	136.0	142.0					19																	52272279		2203	4300	6503	56964091	SO:0001583	missense	2358	exon2			M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.368G>A	19.37:g.52272279G>A	ENSP00000468897:p.Arg123His	Somatic		Capture	SOLID	Phase_I	56964091	NM_001462	A8K3E2	Missense_Mutation	SNP	ENST00000598776.1	37	CCDS12840.1	.	.	.	.	.	.	.	.	.	.	.	21.5	4.161350	0.78226	.	.	ENSG00000171049	ENST00000340023	D	0.97161	-4.27	3.47	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000002	D	0.97917	0.9315	H	0.94964	3.605	0.42447	D	0.992733	P	0.42161	0.772	P	0.47102	0.537	D	0.99521	1.0958	10	0.72032	D	0.01	.	12.7891	0.57522	0.0:0.0:1.0:0.0	.	123	P25090	FPR2_HUMAN	H	123	ENSP00000340191:R123H	ENSP00000340191:R123H	R	+	2	0	FPR2	56964091	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.026000	0.76455	1.952000	0.56665	0.491000	0.48974	CGC		0.498	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466912.2	NM_001005738	
PPP2R1A	5518	hgsc.bcm.edu	37	19	52715982	52715982	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr19:52715982C>T	ENST00000322088.6	+	5	605	c.547C>T	c.(547-549)Cgg>Tgg	p.R183W	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.R4W|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.R128W	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	183	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.R183W(22)|p.R183G(2)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CATGGTGCGGCGGGCCGCAGC	0.617			Mis		clear cell ovarian carcinoma																																p.R183W			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	.	24	Substitution - Missense(24)	ovary(16)|endometrium(4)|large_intestine(3)|pancreas(1)	c.C547T	19						.						69.0	57.0	61.0					19																	52715982		2203	4300	6503	57407794	SO:0001583	missense	5518	exon5				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.547C>T	19.37:g.52715982C>T	ENSP00000324804:p.Arg183Trp	Somatic		Capture	SOLID	Phase_I	57407794	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360081	0.82353	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.06528	3.29;3.29	4.5	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.114427	0.37136	N	0.002231	T	0.34193	0.0889	H	0.96333	3.805	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	T	0.40459	-0.9562	10	0.87932	D	0	-15.4468	10.2034	0.43099	0.1981:0.8019:0.0:0.0	.	128;183;183	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	W	173;103;183;128	ENSP00000324804:R183W;ENSP00000415067:R128W	ENSP00000324804:R183W	R	+	1	2	PPP2R1A	57407794	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.933000	0.63484	2.503000	0.84419	0.655000	0.94253	CGG		0.617	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
PRKCG	5582	hgsc.bcm.edu	37	19	54403957	54403957	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr19:54403957C>T	ENST00000263431.3	+	14	1811	c.1529C>T	c.(1528-1530)aCg>aTg	p.T510M	PRKCG_ENST00000542049.1_Missense_Mutation_p.T397M|PRKCG_ENST00000540413.1_Missense_Mutation_p.T510M	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	510	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.T510M(1)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TTCCCCGGGACGACAACCCGC	0.572																																					p.T510M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1529T	19						.						234.0	229.0	230.0					19																	54403957		2203	4300	6503	59095769	SO:0001583	missense	5582	exon14			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1529C>T	19.37:g.54403957C>T	ENSP00000263431:p.Thr510Met	Somatic		Capture	SOLID	Phase_I	59095769	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627546	0.28978	.	.	ENSG00000126583	ENST00000540413;ENST00000263431;ENST00000542049	T;T;T	0.66638	-0.22;-0.22;-0.22	4.24	2.0	0.26442	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.58666	0.2138	L	0.49699	1.58	0.26030	N	0.98175	D;B;B	0.57257	0.979;0.139;0.044	B;B;B	0.42771	0.397;0.041;0.003	T	0.49341	-0.8950	9	0.44086	T	0.13	.	8.8051	0.34932	0.1704:0.6652:0.1645:0.0	.	397;510;510	B7Z8Q0;F5H5C4;P05129	.;.;KPCG_HUMAN	M	510;510;397	ENSP00000443493:T510M;ENSP00000263431:T510M;ENSP00000438090:T397M	ENSP00000263431:T510M	T	+	2	0	PRKCG	59095769	0.045000	0.20229	0.138000	0.22173	0.948000	0.59901	0.467000	0.22035	0.336000	0.23639	0.462000	0.41574	ACG		0.572	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
PPP1R12C	54776	hgsc.bcm.edu	37	19	55607654	55607654	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr19:55607654G>A	ENST00000263433.3	-	7	1016	c.1001C>T	c.(1000-1002)gCg>gTg	p.A334V	PPP1R12C_ENST00000376393.2_Missense_Mutation_p.A334V|PPP1R12C_ENST00000435544.2_Missense_Mutation_p.A260V	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C									p.A334V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GCTAGAGGGCGCTTGGGGCTC	0.662																																					p.A334V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1001T	19						.						91.0	104.0	99.0					19																	55607654		2203	4300	6503	60299466	SO:0001583	missense	54776	exon7			AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.1001C>T	19.37:g.55607654G>A	ENSP00000263433:p.Ala334Val	Somatic		Capture	SOLID	Phase_I	60299466	NM_017607		Missense_Mutation	SNP	ENST00000263433.3	37	CCDS12916.1	.	.	.	.	.	.	.	.	.	.	g	2.032	-0.422165	0.04734	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.68765	-0.2;-0.2;-0.35	4.58	-8.5	0.00927	.	2.128820	0.02719	N	0.113741	T	0.28532	0.0706	N	0.01352	-0.895	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.20174	-1.0283	10	0.14656	T	0.56	.	4.1337	0.10160	0.1521:0.3837:0.3604:0.1038	.	260;334;334	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	V	334;334;260	ENSP00000263433:A334V;ENSP00000365573:A334V;ENSP00000387833:A260V	ENSP00000263433:A334V	A	-	2	0	PPP1R12C	60299466	0.000000	0.05858	0.022000	0.16811	0.004000	0.04260	-2.358000	0.01085	-1.122000	0.02945	-0.298000	0.09462	GCG		0.662	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
UBE2M	9040	hgsc.bcm.edu	37	19	59068448	59068448	+	Silent	SNP	C	C	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr19:59068448C>G	ENST00000253023.3	-	2	764	c.186G>C	c.(184-186)ctG>ctC	p.L62L	CHMP2A_ENST00000601220.1_5'Flank|CHMP2A_ENST00000312547.2_5'Flank|CHMP2A_ENST00000600118.1_5'Flank|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA	NM_003969.3	NP_003960.1	P61081	UBC12_HUMAN	ubiquitin-conjugating enzyme E2M	62					cellular protein modification process (GO:0006464)|positive regulation of neuron apoptotic process (GO:0043525)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)|ribosomal S6-glutamic acid ligase activity (GO:0018169)|ubiquitin-protein transferase activity (GO:0004842)	p.L62L(1)		large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	5		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GACAGATGACCAGCTTGAAGT	0.537																																					p.L62L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G186C	19						.						178.0	150.0	159.0					19																	59068448		2203	4300	6503	63760260	SO:0001819	synonymous_variant	9040	exon2			AB012191	CCDS12987.1	19q13.43	2011-05-19	2011-05-19		ENSG00000130725	ENSG00000130725		"""Ubiquitin-conjugating enzymes E2"""	12491	protein-coding gene	gene with protein product		603173	"""ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12)"", ""ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)"""			9694792	Standard	NM_003969		Approved	hUbc12, UBC12	uc002qtl.4	P61081		ENST00000253023.3:c.186G>C	19.37:g.59068448C>G		Somatic		Capture	SOLID	Phase_I	63760260	NM_003969	O76069|Q8VC50	Silent	SNP	ENST00000253023.3	37	CCDS12987.1																																																																																				0.537	UBE2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467097.1	NM_003969	
FAM110B	90362	hgsc.bcm.edu	37	8	59059400	59059400	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr8:59059400G>A	ENST00000361488.3	+	5	1491	c.611G>A	c.(610-612)cGc>cAc	p.R204H	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	204						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R204H(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				TCGGACATCCGCAAGGTGACC	0.657																																					p.R204H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G611A	8						.						67.0	64.0	65.0					8																	59059400		2203	4300	6503	59221954	SO:0001583	missense	90362	exon5			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.611G>A	8.37:g.59059400G>A	ENSP00000355204:p.Arg204His	Somatic		Capture	SOLID	Phase_I	59221954	NM_147189	Q5BM08|Q9Y4K2	Missense_Mutation	SNP	ENST00000361488.3	37	CCDS6170.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972709	0.74246	.	.	ENSG00000169122	ENST00000361488	T	0.34859	1.34	5.67	5.67	0.87782	.	0.067326	0.56097	D	0.000021	T	0.36441	0.0967	L	0.32530	0.975	0.51012	D	0.999908	D	0.62365	0.991	P	0.46299	0.511	T	0.03193	-1.1062	9	.	.	.	-30.6529	19.7587	0.96304	0.0:0.0:1.0:0.0	.	204	Q8TC76	F110B_HUMAN	H	204	ENSP00000355204:R204H	.	R	+	2	0	FAM110B	59221954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.829000	0.62737	2.676000	0.91093	0.561000	0.74099	CGC		0.657	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189	
TATDN1	83940	hgsc.bcm.edu	37	8	125499505	125499505	+	IGR	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr8:125499505C>T	ENST00000276692.6	-	0	1018				RNF139_ENST00000303545.3_Missense_Mutation_p.R539C|RP11-158K1.3_ENST00000518639.1_RNA	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.R539C(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			AAAAGGGAGCCGCTTACAAGA	0.358																																					p.R539C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1615T	8						.						63.0	64.0	64.0					8																	125499505		2203	4300	6503	125568686	SO:0001628	intergenic_variant	11236	exon2			AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		8.37:g.125499505C>T		Somatic		Capture	SOLID	Phase_I	125568686	NM_007218	B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	ENST00000276692.6	37	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764362	0.31228	.	.	ENSG00000170881	ENST00000303545	T	0.68765	-0.35	5.5	3.67	0.42095	.	0.337011	0.32578	N	0.005917	T	0.52964	0.1767	L	0.35854	1.095	0.39838	D	0.973073	P	0.42785	0.79	B	0.35688	0.208	T	0.58239	-0.7671	10	0.87932	D	0	0.0034	11.3572	0.49623	0.1336:0.609:0.2574:0.0	.	539	Q8WU17	RN139_HUMAN	C	539	ENSP00000304051:R539C	ENSP00000304051:R539C	R	+	1	0	RNF139	125568686	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	3.472000	0.53114	0.766000	0.33244	0.561000	0.74099	CGC		0.358	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381655.1	NM_032026	
RHOC	389	hgsc.bcm.edu	37	1	113244296	113244296	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:113244296G>A	ENST00000285735.2	-	6	1657	c.448C>T	c.(448-450)Cgg>Tgg	p.R150W	RHOC_ENST00000369632.2_Missense_Mutation_p.R150W|RHOC_ENST00000369633.2_Missense_Mutation_p.R150W|RHOC_ENST00000369638.2_Missense_Mutation_p.R150W|RHOC_ENST00000369637.1_Missense_Mutation_p.R150W|RHOC_ENST00000369636.2_Silent_p.T129T|RHOC_ENST00000339083.7_Missense_Mutation_p.R150W|RHOC_ENST00000369642.3_Missense_Mutation_p.R150W|RP11-426L16.10_ENST00000471038.2_5'Flank			P08134	RHOC_HUMAN	ras homolog family member C	150					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)	p.R150W(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCACTGATCCGGTTCGCCATG	0.582																																					p.R150W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C448T	1						.						119.0	104.0	109.0					1																	113244296		2203	4300	6503	113045819	SO:0001583	missense	389	exon6			BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.448C>T	1.37:g.113244296G>A	ENSP00000285735:p.Arg150Trp	Somatic		Capture	SOLID	Phase_I	113045819	NM_175744	B3KSW1|Q6ICN3	Missense_Mutation	SNP	ENST00000285735.2	37	CCDS854.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705074	0.68615	.	.	ENSG00000155366	ENST00000339083;ENST00000369633;ENST00000369642;ENST00000285735;ENST00000369638;ENST00000369637;ENST00000369632;ENST00000484054;ENST00000425265;ENST00000534717	T;T;T;T;T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	5.13	3.03	0.35002	Small GTP-binding protein domain (1);	.	.	.	.	T	0.77890	0.4198	M	0.85197	2.74	0.58432	D	0.999999	P	0.51933	0.949	P	0.48982	0.597	T	0.81156	-0.1061	9	0.87932	D	0	-3.7104	13.662	0.62372	0.0:0.0:0.3261:0.6739	.	150	P08134	RHOC_HUMAN	W	150;150;150;150;150;150;150;187;150;150	ENSP00000345236:R150W;ENSP00000358647:R150W;ENSP00000358656:R150W;ENSP00000285735:R150W;ENSP00000358652:R150W;ENSP00000358651:R150W;ENSP00000358646:R150W;ENSP00000434877:R187W;ENSP00000390823:R150W;ENSP00000436240:R150W	ENSP00000285735:R150W	R	-	1	2	RHOC	113045819	1.000000	0.71417	0.257000	0.24404	0.955000	0.61496	0.658000	0.24979	0.373000	0.24621	0.563000	0.77884	CGG		0.582	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032904.2	NM_175744	
DENND2C	163259	hgsc.bcm.edu	37	1	115168247	115168247	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:115168247C>T	ENST00000393274.1	-	4	984	c.359G>A	c.(358-360)cGg>cAg	p.R120Q	DENND2C_ENST00000393277.1_Missense_Mutation_p.R120Q|DENND2C_ENST00000393276.3_Missense_Mutation_p.R120Q|DENND2C_ENST00000481894.1_5'Flank	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	120					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R120P(1)|p.R120Q(1)		NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCTTTGACCCGAGAACATAC	0.348																																					p.R120Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G359A	1						.						83.0	83.0	83.0					1																	115168247		2203	4300	6503	114969770	SO:0001583	missense	163259	exon2				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.359G>A	1.37:g.115168247C>T	ENSP00000376955:p.Arg120Gln	Somatic		Capture	SOLID	Phase_I	114969770	NM_198459	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	37	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	C	0.072	-1.199550	0.01581	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.07800	3.84;3.8;3.16	5.78	-1.35	0.09114	.	5.356300	0.00744	N	0.001035	T	0.00875	0.0029	N	0.02391	-0.57	0.22199	N	0.9993	B;B	0.09022	0.002;0.002	B;B	0.08055	0.002;0.003	T	0.43065	-0.9414	10	0.05721	T	0.95	.	12.0155	0.53311	0.0:0.4344:0.0:0.5656	.	120;120	Q68D51;Q68D51-3	DEN2C_HUMAN;.	Q	120	ENSP00000376957:R120Q;ENSP00000376955:R120Q;ENSP00000376958:R120Q	ENSP00000358553:R120Q	R	-	2	0	DENND2C	114969770	0.000000	0.05858	0.944000	0.38274	0.137000	0.21094	-2.121000	0.01322	-0.115000	0.11915	-0.145000	0.13849	CGG		0.348	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
PRDM2	7799	hgsc.bcm.edu	37	1	14105474	14105474	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:14105474G>A	ENST00000235372.7	+	8	2040	c.1184G>A	c.(1183-1185)tGt>tAt	p.C395Y	PRDM2_ENST00000413440.1_Missense_Mutation_p.C194Y|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.C194Y|PRDM2_ENST00000311066.5_Missense_Mutation_p.C395Y	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C395Y(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TGCAAGTACTGTGGGAAAGCC	0.493																																					p.C194Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G581A	1						.						97.0	92.0	94.0					1																	14105474		2203	4300	6503	13978061	SO:0001583	missense	7799	exon3			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.1184G>A	1.37:g.14105474G>A	ENSP00000235372:p.Cys395Tyr	Somatic		Capture	SOLID	Phase_I	13978061	NM_001007257	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238665	0.58995	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2	5.48	5.48	0.80851	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.99975	0.9992	M	0.84773	2.715	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	D	0.95502	0.8578	10	0.87932	D	0	.	17.925	0.88980	0.0:0.0:1.0:0.0	.	395;253;395;395	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	Y	395;395;395;194;194	ENSP00000235372:C395Y;ENSP00000312352:C395Y;ENSP00000411103:C194Y;ENSP00000341621:C194Y	ENSP00000235372:C395Y	C	+	2	0	PRDM2	13978061	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.564000	0.86499	0.561000	0.74099	TGT		0.493	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
AMPD1	270	hgsc.bcm.edu	37	1	115217464	115217464	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:115217464C>T	ENST00000520113.2	-	13	1823	c.1808G>A	c.(1807-1809)cGa>cAa	p.R603Q	AMPD1_ENST00000369538.3_Missense_Mutation_p.R599Q|AMPD1_ENST00000353928.6_Missense_Mutation_p.R570Q			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	603					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.R570Q(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	ACAGTGAGGTCGGAACAGAAA	0.448																																					p.R603Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1808A	1						.						113.0	104.0	107.0					1																	115217464		2203	4300	6503	115018987	SO:0001583	missense	270	exon13			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1808G>A	1.37:g.115217464C>T	ENSP00000430075:p.Arg603Gln	Somatic		Capture	SOLID	Phase_I	115018987	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002614	0.74932	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.82711	-1.64;-1.64;-1.64	5.99	5.08	0.68730	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.92974	0.7764	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95270	0.8376	10	0.87932	D	0	-9.1285	16.7973	0.85605	0.1298:0.8702:0.0:0.0	.	599;570	Q5TF02;P23109	.;AMPD1_HUMAN	Q	603;599;570	ENSP00000430075:R603Q;ENSP00000358551:R599Q;ENSP00000316520:R570Q	ENSP00000316520:R570Q	R	-	2	0	AMPD1	115018987	1.000000	0.71417	0.990000	0.47175	0.023000	0.10783	7.745000	0.85046	1.536000	0.49237	0.655000	0.94253	CGA		0.448	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
KIF21B	23046	hgsc.bcm.edu	37	1	200967671	200967671	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:200967671T>G	ENST00000422435.2	-	14	2234	c.1918A>C	c.(1918-1920)Act>Cct	p.T640P	KIF21B_ENST00000360529.5_Missense_Mutation_p.T640P|KIF21B_ENST00000332129.2_Missense_Mutation_p.T640P|KIF21B_ENST00000461742.2_Missense_Mutation_p.T640P	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	640					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						ATCTCACAAGTCAGGTCGGCC	0.572																																					p.T640P												.	.	0			c.A1918C	1						.						88.0	82.0	84.0					1																	200967671		2203	4300	6503	199234294	SO:0001583	missense	23046	exon14			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.1918A>C	1.37:g.200967671T>G	ENSP00000411831:p.Thr640Pro	None		Capture	SOLID	Phase_I	199234294	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.114911	0.77210	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.31	4.16	0.48862	.	0.056328	0.64402	D	0.000001	T	0.56688	0.2002	M	0.84326	2.69	0.50171	D	0.999852	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.83275	0.991;0.996;0.991;0.996	T	0.60409	-0.7269	10	0.66056	D	0.02	.	11.539	0.50655	0.1343:0.0:0.0:0.8657	.	640;640;640;640	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	P	640	ENSP00000328494:T640P;ENSP00000353724:T640P;ENSP00000433808:T640P;ENSP00000411831:T640P	ENSP00000328494:T640P	T	-	1	0	KIF21B	199234294	1.000000	0.71417	0.990000	0.47175	0.798000	0.45092	5.937000	0.70162	0.830000	0.34757	-0.341000	0.08007	ACT		0.572	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
LYST	1130	hgsc.bcm.edu	37	1	235973559	235973559	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:235973559G>T	ENST00000389794.3	-	5	733	c.559C>A	c.(559-561)Ctg>Atg	p.L187M	LYST_ENST00000536965.1_Missense_Mutation_p.L187M|LYST_ENST00000389793.2_Missense_Mutation_p.L187M			Q99698	LYST_HUMAN	lysosomal trafficking regulator	187					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.L187M(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGATGCAGCAGATGGGGCCTT	0.433																																					p.L187M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C559A	1						.						192.0	184.0	186.0					1																	235973559		2203	4300	6503	234040182	SO:0001583	missense	1130	exon5			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.559C>A	1.37:g.235973559G>T	ENSP00000374444:p.Leu187Met	Somatic		Capture	SOLID	Phase_I	234040182	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	9.068	0.996114	0.19043	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.14266	2.52;2.52;2.52	5.75	1.62	0.23740	.	3.428320	0.00397	N	0.000046	T	0.17534	0.0421	L	0.40543	1.245	0.09310	N	1	P;P	0.39094	0.659;0.49	B;B	0.44278	0.445;0.264	T	0.13335	-1.0513	10	0.45353	T	0.12	.	5.0781	0.14642	0.0661:0.3624:0.3012:0.2703	.	187;187	Q99698-3;Q99698	.;LYST_HUMAN	M	187	ENSP00000374444:L187M;ENSP00000374443:L187M;ENSP00000438315:L187M	ENSP00000374443:L187M	L	-	1	2	LYST	234040182	0.000000	0.05858	0.027000	0.17364	0.996000	0.88848	-0.023000	0.12456	0.046000	0.15833	0.655000	0.94253	CTG		0.433	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
NID1	4811	hgsc.bcm.edu	37	1	236145041	236145041	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:236145041G>A	ENST00000264187.6	-	16	3179	c.3097C>T	c.(3097-3099)Cgc>Tgc	p.R1033C	NID1_ENST00000366595.3_Missense_Mutation_p.R900C	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	1033					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.R1033C(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	AAGATGTTGCGGCCAAGGTGA	0.488																																					p.R1033C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3097T	1						.						82.0	77.0	79.0					1																	236145041		2203	4300	6503	234211664	SO:0001583	missense	4811	exon16			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.3097C>T	1.37:g.236145041G>A	ENSP00000264187:p.Arg1033Cys	Somatic		Capture	SOLID	Phase_I	234211664	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	37	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910270	0.92107	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.96427	-4.01;-4.01	5.88	5.88	0.94601	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.98988	0.9655	H	0.97540	4.025	0.53688	D	0.999973	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99084	1.0838	10	0.87932	D	0	.	20.2265	0.98340	0.0:0.0:1.0:0.0	.	900;1033	P14543-2;P14543	.;NID1_HUMAN	C	1033;900	ENSP00000264187:R1033C;ENSP00000355554:R900C	ENSP00000264187:R1033C	R	-	1	0	NID1	234211664	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.455000	0.73497	2.769000	0.95229	0.655000	0.94253	CGC		0.488	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
SRRM1	10250	hgsc.bcm.edu	37	1	24993338	24993338	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:24993338C>A	ENST00000323848.9	+	13	1976	c.1661C>A	c.(1660-1662)cCc>cAc	p.P554H	SRRM1_ENST00000537199.1_3'UTR|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.P563H|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000447431.2_Missense_Mutation_p.P566H	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	554	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.P554H(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		TCCCCACCACCCACCAGAAGG	0.502																																					p.P554H	Ovarian(68;897 1494 3282 17478)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1661A	1						.						55.0	48.0	50.0					1																	24993338		2203	4300	6503	24865925	SO:0001583	missense	10250	exon13			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1661C>A	1.37:g.24993338C>A	ENSP00000326261:p.Pro554His	Somatic		Capture	SOLID	Phase_I	24865925	NM_005839	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.259728	0.59321	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.53857	0.6;0.76;0.64	5.66	4.69	0.59074	.	0.100459	0.44688	D	0.000426	T	0.57359	0.2048	M	0.62723	1.935	0.80722	D	1	B;B	0.31859	0.343;0.232	B;B	0.41088	0.347;0.188	T	0.57106	-0.7868	10	0.38643	T	0.18	-2.3179	15.0556	0.71910	0.1427:0.8573:0.0:0.0	.	566;554	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	H	554;566;563	ENSP00000326261:P554H;ENSP00000391430:P566H;ENSP00000363510:P563H	ENSP00000326261:P554H	P	+	2	0	SRRM1	24865925	0.992000	0.36948	0.808000	0.32385	0.874000	0.50279	4.132000	0.57977	2.654000	0.90174	0.650000	0.86243	CCC		0.502	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
ARID1A	8289	hgsc.bcm.edu	37	1	27105553	27105553	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:27105553C>T	ENST00000324856.7	+	20	5535	c.5164C>T	c.(5164-5166)Cga>Tga	p.R1722*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.R1505*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.R50*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.R1339*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1722					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R1722*(5)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ATATTTCCGACGATGCCTGAT	0.443			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.R1722X			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	5	Substitution - Nonsense(5)	large_intestine(2)|ovary(1)|stomach(1)|endometrium(1)	c.C5164T	1						.						181.0	199.0	193.0					1																	27105553		2203	4300	6503	26978140	SO:0001587	stop_gained	8289	exon20			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5164C>T	1.37:g.27105553C>T	ENSP00000320485:p.Arg1722*	Somatic		Capture	SOLID	Phase_I	26978140	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.312365|9.312365	0.99133|0.99133	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	4.71|4.71	2.75|2.75	0.32379|0.32379	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.68421	.|0.2999	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.66614	.|-0.5879	.|4	0.02654|.	T|.	1|.	-5.1918|-5.1918	13.8273|13.8273	0.63359|0.63359	0.2773:0.7227:0.0:0.0|0.2773:0.7227:0.0:0.0	.|.	.|.	.|.	.|.	X|M	1722;1505;1339;50|618	.|.	ENSP00000320485:R1722X|.	R|T	+|+	1|2	2|0	ARID1A|ARID1A	26978140|26978140	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.362000|4.362000	0.59467|0.59467	0.659000|0.659000	0.30945|0.30945	0.591000|0.591000	0.81541|0.81541	CGA|ACG		0.443	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ITGB3BP	23421	hgsc.bcm.edu	37	1	63920566	63920566	+	Missense_Mutation	SNP	T	T	C	rs374795494		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:63920566T>C	ENST00000271002.10	-	5	409	c.328A>G	c.(328-330)Ata>Gta	p.I110V	ITGB3BP_ENST00000461681.1_5'UTR|ITGB3BP_ENST00000371092.3_Missense_Mutation_p.I149V|ITGB3BP_ENST00000283568.8_Missense_Mutation_p.I110V	NM_014288.4	NP_055103.3	Q13352	CENPR_HUMAN	integrin beta 3 binding protein (beta3-endonexin)	110					apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)	p.I110V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9						CAAACCTGTATACTACTTAAA	0.313																																					p.I110V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A328G	1						.	T	VAL/ILE,VAL/ILE	1,4395	2.1+/-5.4	0,1,2197	65.0	62.0	63.0		445,328	1.5	0.5	1		63	0,8590		0,0,4295	no	missense,missense	ITGB3BP	NM_001206739.1,NM_014288.4	29,29	0,1,6492	CC,CT,TT		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	149/217,110/178	63920566	1,12985	2198	4295	6493	63693154	SO:0001583	missense	23421	exon5			U37139	CCDS30736.1, CCDS55603.1	1p31.3	2013-11-05			ENSG00000142856	ENSG00000142856			6157	protein-coding gene	gene with protein product	"""centromere protein R"""	605494				7593198, 10490654	Standard	NM_014288		Approved	NRIF3, HSU37139, TAP20, CENPR	uc001dbb.2	Q13352	OTTHUMG00000013364	ENST00000271002.10:c.328A>G	1.37:g.63920566T>C	ENSP00000271002:p.Ile110Val	Somatic		Capture	SOLID	Phase_I	63693154	NM_014288	B2R7D8|Q13353|Q5RJ42|Q5RJ44|Q5RJ45|Q7KYX2|Q96CD5|Q9UKB6	Missense_Mutation	SNP	ENST00000271002.10	37	CCDS30736.1	.	.	.	.	.	.	.	.	.	.	T	5.200	0.222360	0.09863	2.27E-4	0.0	ENSG00000142856	ENST00000271002;ENST00000371092;ENST00000283568	T;T;T	0.44482	0.92;0.92;0.92	5.58	1.55	0.23275	.	0.463174	0.20158	N	0.098019	T	0.17704	0.0425	L	0.47716	1.5	0.09310	N	0.999998	P;B;P;P	0.41784	0.738;0.409;0.762;0.664	B;B;B;B	0.42593	0.392;0.253;0.391;0.373	T	0.06881	-1.0802	10	0.59425	D	0.04	-10.5709	4.8974	0.13757	0.3604:0.0:0.2687:0.3709	.	110;70;149;110	Q13352-2;D3DQ59;Q13352-5;Q13352	.;.;.;CENPR_HUMAN	V	110;149;110	ENSP00000271002:I110V;ENSP00000360133:I149V;ENSP00000283568:I110V	ENSP00000271002:I110V	I	-	1	0	ITGB3BP	63693154	0.003000	0.15002	0.457000	0.27056	0.226000	0.24999	-0.170000	0.09897	0.339000	0.23719	0.477000	0.44152	ATA		0.313	ITGB3BP-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000037242.2	NM_014288	
ROR1	4919	hgsc.bcm.edu	37	1	64643423	64643423	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:64643423A>T	ENST00000371079.1	+	9	2074	c.1699A>T	c.(1699-1701)Aga>Tga	p.R567*	ROR1_ENST00000545203.1_Nonsense_Mutation_p.R18*	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	567	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> I (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						CCTCATCATGAGATCCCCACA	0.473																																					p.R567X												ROR1,large_intestine,NS,Substitution - Missense,-1	.	0			c.A1699T	1						.						72.0	73.0	73.0					1																	64643423		2203	4300	6503	64416011	SO:0001587	stop_gained	4919	exon9			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1699A>T	1.37:g.64643423A>T	ENSP00000360120:p.Arg567*	None		Capture	SOLID	Phase_I	64416011	NM_005012	Q5VVX6|Q66K77|Q92776	Nonsense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	C	44	10.594833	0.99434	.	.	ENSG00000185483	ENST00000371079;ENST00000544776;ENST00000545203	.	.	.	5.97	4.99	0.66335	.	0.000000	0.38005	N	0.001857	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.9701	0.86296	0.3394:0.6606:0.0:0.0	.	.	.	.	X	567;570;18	.	ENSP00000360120:R567X	R	+	1	2	ROR1	64416011	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	1.169000	0.31871	1.553000	0.49476	-0.121000	0.15023	AGA		0.473	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
TTLL7	79739	hgsc.bcm.edu	37	1	84356040	84356040	+	Missense_Mutation	SNP	C	C	T	rs146805080		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:84356040C>T	ENST00000260505.8	-	19	2710	c.2333G>A	c.(2332-2334)cGt>cAt	p.R778H	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	778					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)	p.R778H(1)		kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		CCCTTGGCCACGACTCCAGAG	0.373													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16907	0.0		0.0	False		,,,				2504	0.0				p.R778H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2333A	1						.						53.0	57.0	56.0					1																	84356040		2203	4299	6502	84128628	SO:0001583	missense	79739	exon19			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.2333G>A	1.37:g.84356040C>T	ENSP00000260505:p.Arg778His	Somatic		Capture	SOLID	Phase_I	84128628	NM_024686	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	CCDS690.2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	5.790	0.330097	0.10956	.	.	ENSG00000137941	ENST00000260505;ENST00000370704	T	0.02280	4.36	5.12	2.8	0.32819	.	0.047706	0.85682	N	0.000000	T	0.00144	0.0004	N	0.00092	-2.175	0.26616	N	0.97274	B	0.02656	0.0	B	0.01281	0.0	T	0.33979	-0.9847	10	0.02654	T	1	.	9.7849	0.40670	0.0:0.1418:0.0:0.8582	.	778	Q6ZT98	TTLL7_HUMAN	H	778;555	ENSP00000260505:R778H	ENSP00000260505:R778H	R	-	2	0	TTLL7	84128628	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.106000	0.50322	0.360000	0.24265	-0.295000	0.09555	CGT		0.373	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686	
OR2T11	127077	hgsc.bcm.edu	37	1	248789739	248789739	+	Missense_Mutation	SNP	G	G	A	rs144343861		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr1:248789739G>A	ENST00000330803.2	-	1	752	c.691C>T	c.(691-693)Cgc>Tgc	p.R231C		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R231C(1)		breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCTTTTTGCGACCTTCAGCA	0.517																																					p.R231C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C691T	1						.	G	CYS/ARG	1,4105		0,1,2052	67.0	67.0	67.0		691	1.1	0.0	1	dbSNP_134	67	2,8466		0,2,4232	yes	missense	OR2T11	NM_001001964.1	180	0,3,6284	AA,AG,GG		0.0236,0.0244,0.0239	probably-damaging	231/317	248789739	3,12571	2053	4234	6287	246856362	SO:0001583	missense	127077	exon1			BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.691C>T	1.37:g.248789739G>A	ENSP00000328934:p.Arg231Cys	Somatic		Capture	SOLID	Phase_I	246856362	NM_001001964	Q6IEY6	Missense_Mutation	SNP	ENST00000330803.2	37	CCDS31122.1	.	.	.	.	.	.	.	.	.	.	.	2.822	-0.244573	0.05906	2.44E-4	2.36E-4	ENSG00000183130	ENST00000330803	T	0.00337	8.05	4.24	1.06	0.20224	GPCR, rhodopsin-like superfamily (1);	0.379952	0.19350	N	0.116439	T	0.00440	0.0014	M	0.88842	2.985	0.09310	N	1	B	0.26400	0.148	B	0.27170	0.077	T	0.28839	-1.0031	10	0.62326	D	0.03	.	12.3938	0.55373	0.0:0.0:0.4139:0.5861	.	231	Q8NH01	O2T11_HUMAN	C	231	ENSP00000328934:R231C	ENSP00000328934:R231C	R	-	1	0	OR2T11	246856362	0.005000	0.15991	0.004000	0.12327	0.010000	0.07245	0.843000	0.27640	0.398000	0.25338	0.655000	0.94253	CGC		0.517	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964	
SIDT2	51092	hgsc.bcm.edu	37	11	117062606	117062606	+	Missense_Mutation	SNP	T	T	G	rs372741154		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr11:117062606T>G	ENST00000324225.4	+	19	2279	c.1748T>G	c.(1747-1749)aTg>aGg	p.M583R	SIDT2_ENST00000431081.2_Missense_Mutation_p.M580R|SIDT2_ENST00000532062.1_5'Flank	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	583					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)	p.M583R(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		ACATCGTTCATGTACATGATC	0.587																																					p.M583R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1748G	11						.						180.0	163.0	169.0					11																	117062606		2201	4296	6497	116567816	SO:0001583	missense	51092	exon19			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1748T>G	11.37:g.117062606T>G	ENSP00000314023:p.Met583Arg	Somatic		Capture	SOLID	Phase_I	116567816	NM_001040455	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	37	CCDS31682.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.214613	0.79352	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.29917	1.55;1.55;1.55	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.61800	0.2376	M	0.90483	3.12	0.80722	D	1	D;P;D;D	0.58620	0.977;0.731;0.983;0.981	P;P;D;D	0.69142	0.9;0.447;0.962;0.962	T	0.71303	-0.4633	10	0.87932	D	0	-23.4821	14.7092	0.69215	0.0:0.0:0.0:1.0	.	604;580;583;604	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	R	583;604;580	ENSP00000314023:M583R;ENSP00000278951:M604R;ENSP00000399635:M580R	ENSP00000278951:M604R	M	+	2	0	SIDT2	116567816	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.762000	0.85270	2.080000	0.62538	0.533000	0.62120	ATG		0.587	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
NADSYN1	55191	hgsc.bcm.edu	37	11	71192998	71192998	+	Silent	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr11:71192998G>T	ENST00000319023.2	+	13	1265	c.1077G>T	c.(1075-1077)ggG>ggT	p.G359G	NADSYN1_ENST00000526039.2_Intron|NADSYN1_ENST00000530055.1_5'UTR|NADSYN1_ENST00000539574.1_Silent_p.G99G	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	359	Ligase. {ECO:0000250}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)	p.G359G(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	TGAGTGGCGGGGTGGACAGCG	0.602																																					p.G359G	Ovarian(79;763 1781 6490 50276)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1077T	11						.						62.0	47.0	52.0					11																	71192998		2200	4294	6494	70870646	SO:0001819	synonymous_variant	55191	exon13			AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.1077G>T	11.37:g.71192998G>T		Somatic		Capture	SOLID	Phase_I	70870646	NM_018161	B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Silent	SNP	ENST00000319023.2	37	CCDS8201.1																																																																																				0.602	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	NM_018161	
ME3	10873	hgsc.bcm.edu	37	11	86160993	86160993	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr11:86160993C>A	ENST00000393324.3	-	9	1322	c.1069G>T	c.(1069-1071)Gta>Tta	p.V357L	ME3_ENST00000359636.2_Missense_Mutation_p.V357L|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000543262.1_Missense_Mutation_p.V357L	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	357					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.V357L(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GCCTTCGGTACACCTTCTTTC	0.527																																					p.V357L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1069T	11						.						161.0	149.0	153.0					11																	86160993		2202	4299	6501	85838641	SO:0001583	missense	10873	exon10			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1069G>T	11.37:g.86160993C>A	ENSP00000376998:p.Val357Leu	Somatic		Capture	SOLID	Phase_I	85838641	NM_001161586	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	1.833	-0.469310	0.04445	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.7	-0.387	0.12463	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.806605	0.11926	N	0.516238	T	0.10981	0.0268	N	0.01751	-0.74	0.20074	N	0.999931	B	0.02656	0.0	B	0.04013	0.001	T	0.34700	-0.9818	9	.	.	.	.	11.4877	0.50363	0.0:0.4183:0.0:0.5817	.	357	Q16798	MAON_HUMAN	L	357	ENSP00000352657:V357L;ENSP00000440246:V357L;ENSP00000376998:V357L;ENSP00000431182:V357L	.	V	-	1	0	ME3	85838641	0.000000	0.05858	0.055000	0.19348	0.873000	0.50193	-0.284000	0.08422	0.021000	0.15133	0.650000	0.86243	GTA		0.527	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
NCAPD3	23310	hgsc.bcm.edu	37	11	134080255	134080255	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr11:134080255C>T	ENST00000534548.2	-	4	540	c.476G>A	c.(475-477)cGg>cAg	p.R159Q		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	159					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.R159Q(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTTTCTTTTCCGATTCAAGTT	0.453																																					p.R159Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G476A	11						.						107.0	105.0	106.0					11																	134080255		2201	4297	6498	133585465	SO:0001583	missense	23310	exon4			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.476G>A	11.37:g.134080255C>T	ENSP00000433681:p.Arg159Gln	Somatic		Capture	SOLID	Phase_I	133585465	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407033	0.42715	.	.	ENSG00000151503	ENST00000534548	T	0.23552	1.9	5.44	1.29	0.21616	.	0.157021	0.52532	N	0.000062	T	0.12817	0.0311	N	0.21142	0.635	0.80722	D	1	B	0.26547	0.152	B	0.17722	0.019	T	0.16070	-1.0415	10	0.22706	T	0.39	-13.5676	6.4032	0.21650	0.0:0.6362:0.1291:0.2347	.	159	P42695	CNDD3_HUMAN	Q	159	ENSP00000433681:R159Q	ENSP00000431612:R159Q	R	-	2	0	NCAPD3	133585465	0.003000	0.15002	0.994000	0.49952	0.936000	0.57629	0.406000	0.21032	0.073000	0.16731	-0.136000	0.14681	CGG		0.453	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
SKIV2L	6499	hgsc.bcm.edu	37	6	31932046	31932046	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr6:31932046G>T	ENST00000375394.2	+	17	2011	c.1898G>T	c.(1897-1899)gGt>gTt	p.G633V	SKIV2L_ENST00000544581.1_Missense_Mutation_p.G440V	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	633	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.G633V(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CGCGGCCTGGGTGTGCACCAT	0.602																																					p.G633V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1898T	6						.						115.0	85.0	96.0					6																	31932046		1511	2708	4219	32040025	SO:0001583	missense	6499	exon17				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1898G>T	6.37:g.31932046G>T	ENSP00000364543:p.Gly633Val	Somatic		Capture	SOLID	Phase_I	32040025	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364462	0.82463	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.40756	1.02;1.02	5.95	5.95	0.96441	Helicase, C-terminal (2);	0.050218	0.85682	D	0.000000	T	0.64821	0.2633	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.67964	-0.5534	10	0.87932	D	0	-17.9378	19.1568	0.93514	0.0:0.0:1.0:0.0	.	633	Q15477	SKIV2_HUMAN	V	633;475;440	ENSP00000364543:G633V;ENSP00000442645:G440V	ENSP00000364543:G633V	G	+	2	0	SKIV2L	32040025	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	6.266000	0.72540	2.825000	0.97269	0.655000	0.94253	GGT		0.602	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
GSTA1	2938	hgsc.bcm.edu	37	6	52659007	52659007	+	Silent	SNP	G	G	A	rs368967369		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr6:52659007G>A	ENST00000334575.5	-	5	485	c.330C>T	c.(328-330)ccC>ccT	p.P110P	GSTA1_ENST00000493331.1_5'UTR	NM_145740.3	NP_665683.1	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	110	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|metabolic process (GO:0008152)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.P110P(1)		large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	12	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Glutathione(DB00143)	GTGGACATACGGGCAGAAGGA	0.393																																					p.P110P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C330T	6						.						184.0	175.0	178.0					6																	52659007		2203	4300	6503	52766966	SO:0001819	synonymous_variant	2938	exon5				CCDS4945.1	6p12.2	2012-06-21	2008-11-26		ENSG00000243955	ENSG00000243955	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4626	protein-coding gene	gene with protein product		138359	"""glutathione S-transferase A1"""			9503014	Standard	NM_145740		Approved		uc003paz.3	P08263	OTTHUMG00000014861	ENST00000334575.5:c.330C>T	6.37:g.52659007G>A		Somatic		Capture	SOLID	Phase_I	52766966	NM_145740	Q14750|Q5GHF8|Q5SZC1	Silent	SNP	ENST00000334575.5	37	CCDS4945.1																																																																																				0.393	GSTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040922.1		
MYH2	4620	hgsc.bcm.edu	37	17	10442638	10442638	+	Missense_Mutation	SNP	C	C	T	rs143204063	byFrequency	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:10442638C>T	ENST00000245503.5	-	14	1684	c.1300G>A	c.(1300-1302)Gtc>Atc	p.V434I	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.V434I|MYH2_ENST00000397183.2_Missense_Mutation_p.V434I	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	434	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.V434I(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TTCTCGTAGACGGCTTTGGCC	0.498													C|||	2	0.000399361	0.0	0.0	5008	,	,		19217	0.002		0.0	False		,,,				2504	0.0				p.V434I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1300A	17						.	C	ILE/VAL,ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	170.0	165.0	167.0		1300,1300	-3.8	0.9	17	dbSNP_134	167	0,8600		0,0,4300	yes	missense,missense	MYH2	NM_001100112.1,NM_017534.5	29,29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign	434/1942,434/1942	10442638	2,13004	2203	4300	6503	10383363	SO:0001583	missense	4620	exon14				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1300G>A	17.37:g.10442638C>T	ENSP00000245503:p.Val434Ile	Somatic		Capture	SOLID	Phase_I	10383363	NM_001100112	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	14.13	2.442203	0.43326	4.54E-4	0.0	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	T;T;T	0.69435	-0.4;-0.4;-0.4	5.43	-3.79	0.04320	Myosin head, motor domain (2);	0.549654	0.13792	U	0.362416	T	0.33556	0.0867	N	0.04260	-0.245	0.32333	N	0.560811	B;B	0.02656	0.0;0.0	B;B	0.10450	0.001;0.005	T	0.26815	-1.0092	10	0.16420	T	0.52	.	6.0026	0.19529	0.1154:0.4462:0.0:0.4384	.	434;434	Q567P6;Q9UKX2	.;MYH2_HUMAN	I	434	ENSP00000433944:V434I;ENSP00000245503:V434I;ENSP00000380367:V434I	ENSP00000245503:V434I	V	-	1	0	MYH2	10383363	0.000000	0.05858	0.896000	0.35187	0.978000	0.69477	-1.013000	0.03645	-0.577000	0.05967	0.585000	0.79938	GTC		0.498	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
SCO1	6341	hgsc.bcm.edu	37	17	10596173	10596173	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:10596173C>A	ENST00000255390.5	-	3	530	c.470G>T	c.(469-471)gGt>gTt	p.G157V	SCO1_ENST00000582053.1_5'Flank|SCO1_ENST00000577427.1_Splice_Site	NM_004589.2	NP_004580.1	O75880	SCO1_HUMAN	SCO1 cytochrome c oxidase assembly protein	157					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|respiratory chain complex IV assembly (GO:0008535)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)	copper ion binding (GO:0005507)	p.G157D(1)|p.G157V(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	10						TAACCACTGACCCAAGTAGTC	0.453																																					p.G157V	Melanoma(128;591 1731 19711 31891 44645)											.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G470T	17						.						120.0	102.0	108.0					17																	10596173		2203	4300	6503	10536898	SO:0001583	missense	6341	exon3			AF026852	CCDS11158.1	17p13.1	2012-10-15	2012-10-15		ENSG00000133028	ENSG00000133028		"""Mitochondrial respiratory chain complex assembly factors"""	10603	protein-coding gene	gene with protein product		603644	"""SCO (cytochrome oxidase deficient, yeast) homolog 1"", ""SCO cytochrome oxidase deficient homolog 1 (yeast)"""	SCOD1		9878253	Standard	NM_004589		Approved		uc002gmr.4	O75880	OTTHUMG00000130364	ENST00000255390.5:c.470G>T	17.37:g.10596173C>A	ENSP00000255390:p.Gly157Val	Somatic		Capture	SOLID	Phase_I	10536898	NM_004589	B2RDM0	Missense_Mutation	SNP	ENST00000255390.5	37	CCDS11158.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.6|25.6	4.649851|4.649851	0.87958|0.87958	.|.	.|.	ENSG00000133028|ENSG00000133028	ENST00000396047|ENST00000255390	.|D	.|0.98512	.|-4.97	6.08|6.08	6.08|6.08	0.98989|0.98989	.|Thioredoxin-like fold (2);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.99423	.|0.9796	H|H	0.97077|0.97077	3.935|3.935	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|D	.|0.98487	.|1.0608	.|10	.|0.87932	.|D	.|0	.|-19.8205	20.6721|20.6721	0.99693|0.99693	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|157	.|O75880	.|SCO1_HUMAN	.|V	-1|157	.|ENSP00000255390:G157V	.|ENSP00000255390:G157V	.|G	-|-	.|2	.|0	SCO1|SCO1	10536898|10536898	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.899000|0.899000	0.52679|0.52679	7.461000|7.461000	0.80834|0.80834	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	.|GGT		0.453	SCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252729.2	NM_004589	
GID4	79018	hgsc.bcm.edu	37	17	17962245	17962245	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:17962245G>T	ENST00000268719.4	+	4	843	c.670G>T	c.(670-672)Gag>Tag	p.E224*		NM_024052.4	NP_076957.3	Q8IVV7	GID4_HUMAN	GID complex subunit 4	224								p.E224*(1)									TGATTATGAAGAGCTGAAGAA	0.468																																					p.E224X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G670T	17						.						81.0	73.0	76.0					17																	17962245		2203	4300	6503	17902970	SO:0001587	stop_gained	79018	exon4			AK127580	CCDS11190.1	17p11.2	2013-07-31	2013-07-31	2012-07-20	ENSG00000141034	ENSG00000141034			28453	protein-coding gene	gene with protein product	"""vacuolar import and degradation 24"""		"""chromosome 17 open reading frame 39"", ""GID complex subunit 4, VID24 homolog (S. cerevisiae)"""	C17orf39		11997338	Standard	NM_024052		Approved	VID24	uc002gsg.1	Q8IVV7	OTTHUMG00000059398	ENST00000268719.4:c.670G>T	17.37:g.17962245G>T	ENSP00000268719:p.Glu224*	Somatic		Capture	SOLID	Phase_I	17902970	NM_024052	Q8TEB5|Q9BW50	Nonsense_Mutation	SNP	ENST00000268719.4	37	CCDS11190.1	.	.	.	.	.	.	.	.	.	.	G	38	6.885913	0.97908	.	.	ENSG00000141034	ENST00000268719	.	.	.	5.8	5.8	0.92144	.	0.227351	0.44097	D	0.000499	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-0.0404	20.063	0.97692	0.0:0.0:1.0:0.0	.	.	.	.	X	224	.	ENSP00000268719:E224X	E	+	1	0	C17orf39	17902970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.718000	0.84743	2.735000	0.93741	0.655000	0.94253	GAG		0.468	GID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132071.2	NM_024052	
SLC47A2	146802	hgsc.bcm.edu	37	17	19582151	19582151	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:19582151A>T	ENST00000325411.5	-	17	1707	c.1657T>A	c.(1657-1659)Ttc>Atc	p.F553I	SLC47A2_ENST00000350657.5_Missense_Mutation_p.F531I|SLC47A2_ENST00000463318.1_5'UTR	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	553					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)	p.F553I(1)|p.F531I(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	GGAGTCCTGAAGAAGTCCACG	0.587																																					p.F517I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1549A	17						.						53.0	46.0	48.0					17																	19582151		2203	4299	6502	19522743	SO:0001583	missense	146802	exon17			AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.1657T>A	17.37:g.19582151A>T	ENSP00000326671:p.Phe553Ile	Somatic		Capture	SOLID	Phase_I	19522743	NM_001099646	A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Missense_Mutation	SNP	ENST00000325411.5	37	CCDS11211.1	.	.	.	.	.	.	.	.	.	.	A	11.16	1.557873	0.27827	.	.	ENSG00000180638	ENST00000350657;ENST00000325411	T;T	0.28454	1.61;1.61	5.16	-0.338	0.12651	.	1.575060	0.03314	N	0.190874	T	0.22044	0.0531	L	0.34521	1.04	0.09310	N	1	B;B;B	0.10296	0.003;0.002;0.002	B;B;B	0.14023	0.005;0.01;0.001	T	0.13602	-1.0503	10	0.22706	T	0.39	-3.1202	4.3198	0.11011	0.3989:0.0:0.4284:0.1727	.	517;531;553	Q86VL8-3;Q86VL8-4;Q86VL8	.;.;S47A2_HUMAN	I	531;553	ENSP00000338084:F531I;ENSP00000326671:F553I	ENSP00000326671:F553I	F	-	1	0	SLC47A2	19522743	0.002000	0.14202	0.002000	0.10522	0.166000	0.22503	0.187000	0.16998	-0.108000	0.12066	0.460000	0.39030	TTC		0.587	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132242.2	NM_152908	
KCNJ12	3768	hgsc.bcm.edu	37	17	21318948	21318948	+	Silent	SNP	C	C	T	rs112314728		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:21318948C>T	ENST00000583088.1	+	3	1189	c.294C>T	c.(292-294)ttC>ttT	p.F98F	KCNJ12_ENST00000331718.5_Silent_p.F98F	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	98					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.F98F(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GGCTGCTGTTCGGCATCATCT	0.632										Prostate(3;0.18)																											p.F98F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C294T	17						.						126.0	81.0	96.0					17																	21318948		2203	4300	6503	21259541	SO:0001819	synonymous_variant	3768	exon3			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.294C>T	17.37:g.21318948C>T		Somatic		Capture	SOLID	Phase_I	21259541	NM_021012	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1																																																																																				0.632	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
SLFN11	91607	hgsc.bcm.edu	37	17	33679960	33679960	+	Silent	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:33679960G>T	ENST00000394566.1	-	7	2393	c.2121C>A	c.(2119-2121)acC>acA	p.T707T	SLFN11_ENST00000308377.4_Silent_p.T707T	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	707					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.T707T(2)		autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCAAGTGGCTGGTCTGAAAGT	0.493																																					p.T707T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C2121A	17						.						116.0	121.0	120.0					17																	33679960		2203	4300	6503	30704073	SO:0001819	synonymous_variant	91607	exon6			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2121C>A	17.37:g.33679960G>T		Somatic		Capture	SOLID	Phase_I	30704073	NM_001104589	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	37	CCDS11294.1																																																																																				0.493	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
KCNH4	23415	hgsc.bcm.edu	37	17	40314329	40314329	+	Silent	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:40314329G>T	ENST00000264661.3	-	15	2927	c.2595C>A	c.(2593-2595)ccC>ccA	p.P865P	KCNH4_ENST00000607371.1_Silent_p.P865P	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	865					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.P865P(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ATTCTGGGCTGGGCCTGGTCC	0.567																																					p.P865P	NSCLC(117;707 1703 2300 21308 31858)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2595A	17						.						98.0	78.0	84.0					17																	40314329		2203	4300	6503	37567855	SO:0001819	synonymous_variant	23415	exon15			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.2595C>A	17.37:g.40314329G>T		Somatic		Capture	SOLID	Phase_I	37567855	NM_012285		Silent	SNP	ENST00000264661.3	37	CCDS11420.1																																																																																				0.567	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
STAT3	6774	hgsc.bcm.edu	37	17	40498723	40498723	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:40498723G>A	ENST00000264657.5	-	3	449	c.137C>T	c.(136-138)gCg>gTg	p.A46V	STAT3_ENST00000389272.3_5'UTR|STAT3_ENST00000588969.1_Missense_Mutation_p.A46V|STAT3_ENST00000404395.3_Missense_Mutation_p.A46V|STAT3_ENST00000585517.1_Missense_Mutation_p.A46V	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	46					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A46V(2)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		TTTGCTGGCCGCATATGCCCT	0.433									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.A46V												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C137T	17						.						158.0	158.0	158.0					17																	40498723		2203	4300	6503	37752249	SO:0001583	missense	6774	exon3	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.137C>T	17.37:g.40498723G>A	ENSP00000264657:p.Ala46Val	Somatic		Capture	SOLID	Phase_I	37752249	NM_213662	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848324	0.91277	.	.	ENSG00000168610	ENST00000264657;ENST00000404395	T;T	0.51325	0.71;0.71	5.66	5.66	0.87406	STAT transcription factor, protein interaction (4);	0.219698	0.46758	D	0.000267	T	0.57577	0.2063	L	0.42632	1.34	0.80722	D	1	D;D;D	0.60160	0.987;0.981;0.981	P;P;P	0.56865	0.785;0.808;0.808	T	0.47156	-0.9139	10	0.30078	T	0.28	-22.3549	20.1041	0.97884	0.0:0.0:1.0:0.0	.	46;46;46	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	V	46	ENSP00000264657:A46V;ENSP00000384943:A46V	ENSP00000264657:A46V	A	-	2	0	STAT3	37752249	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	7.774000	0.85478	2.826000	0.97356	0.655000	0.94253	GCG		0.433	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
CNTNAP1	8506	hgsc.bcm.edu	37	17	40845550	40845550	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:40845550C>G	ENST00000264638.4	+	18	3205	c.2988C>G	c.(2986-2988)aaC>aaG	p.N996K	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	996	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CATACTGCAACCACGGTAAGT	0.552																																					p.N996K												.	.	0			c.C2988G	17						.						104.0	99.0	101.0					17																	40845550		2203	4300	6503	38099076	SO:0001583	missense	8506	exon18			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2988C>G	17.37:g.40845550C>G	ENSP00000264638:p.Asn996Lys	None		Capture	SOLID	Phase_I	38099076	NM_003632		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	C	6.895	0.534686	0.13188	.	.	ENSG00000108797	ENST00000264638	T	0.77877	-1.13	5.69	3.69	0.42338	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like, type 3 (1);	0.071506	0.64402	D	0.000020	T	0.56485	0.1988	N	0.10837	0.055	0.32217	N	0.575731	B	0.25904	0.137	B	0.28991	0.097	T	0.55302	-0.8162	10	0.16896	T	0.51	.	8.099	0.30846	0.0:0.6905:0.0:0.3095	.	996	P78357	CNTP1_HUMAN	K	996	ENSP00000264638:N996K	ENSP00000264638:N996K	N	+	3	2	CNTNAP1	38099076	0.081000	0.21417	1.000000	0.80357	0.870000	0.49936	0.151000	0.16283	0.727000	0.32360	0.561000	0.74099	AAC		0.552	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	
CDC27	996	hgsc.bcm.edu	37	17	45216162	45216162	+	Missense_Mutation	SNP	A	A	C	rs111227623		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:45216162A>C	ENST00000066544.3	-	13	1740	c.1647T>G	c.(1645-1647)gaT>gaG	p.D549E	CDC27_ENST00000527547.1_Missense_Mutation_p.D548E|CDC27_ENST00000446365.2_Missense_Mutation_p.D488E|CDC27_ENST00000531206.1_Missense_Mutation_p.D555E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	549					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.D549E(4)|p.D555E(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AAAGAGCAACATCTTTTTGAA	0.348																																					p.D555E												CDC27,lung,NS,Substitution - Missense,0	.	6	Substitution - Missense(6)	large_intestine(4)|ovary(1)|lung(1)	c.T1665G	17						.						46.0	51.0	49.0					17																	45216162		2202	4299	6501	42571161	SO:0001583	missense	996	exon13			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1647T>G	17.37:g.45216162A>C	ENSP00000066544:p.Asp549Glu	None		Capture	SOLID	Phase_I	42571161	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	6.981	0.550975	0.13374	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.65364	-0.14;-0.15;0.15;-0.12	5.57	-0.476	0.12100	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	N	0.01473	-0.845	0.48040	D	0.999577	B;B;B;B	0.27192	0.052;0.171;0.171;0.052	B;B;B;B	0.27715	0.021;0.082;0.082;0.021	T	0.36261	-0.9755	10	0.02654	T	1	-6.7614	9.4643	0.38802	0.6029:0.0:0.3971:0.0	.	488;548;555;549	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	E	549;555;488;548	ENSP00000066544:D549E;ENSP00000434614:D555E;ENSP00000392802:D488E;ENSP00000437339:D548E	ENSP00000066544:D549E	D	-	3	2	CDC27	42571161	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.462000	0.35266	-0.146000	0.11274	-0.256000	0.11100	GAT		0.348	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
MARCH10	162333	hgsc.bcm.edu	37	17	60802368	60802368	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:60802368A>G	ENST00000311269.5	-	7	2309	c.2035T>C	c.(2035-2037)Tgt>Cgt	p.C679R	MARCH10_ENST00000456609.2_Missense_Mutation_p.C679R|MARCH10_ENST00000583600.1_Missense_Mutation_p.C717R|RP11-156L14.1_ENST00000584597.1_RNA|RP11-156L14.1_ENST00000579201.1_RNA|MARCH10_ENST00000544856.2_Missense_Mutation_p.C678R|RP11-156L14.1_ENST00000582564.1_RNA|RP11-156L14.1_ENST00000577270.1_RNA	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	679					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						CTTCCCACACAGCCGCAAGGC	0.552																																					p.C679R												.	.	0			c.T2035C	17						.						87.0	94.0	92.0					17																	60802368		2203	4300	6503	58156100	SO:0001583	missense	162333	exon7			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.2035T>C	17.37:g.60802368A>G	ENSP00000311496:p.Cys679Arg	None		Capture	SOLID	Phase_I	58156100	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	ENST00000311269.5	37	CCDS11635.1	.	.	.	.	.	.	.	.	.	.	A	13.48	2.250538	0.39797	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	D;D;D	0.86097	-2.07;-2.07;-2.07	5.4	5.4	0.78164	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (2);	0.256448	0.30356	N	0.009815	D	0.95475	0.8530	H	0.98388	4.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.97165	0.9840	10	0.87932	D	0	-10.7831	14.7069	0.69198	1.0:0.0:0.0:0.0	.	678;678;679	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	R	679;679;678	ENSP00000416177:C679R;ENSP00000311496:C679R;ENSP00000443746:C678R	ENSP00000311496:C679R	C	-	1	0	MARCH10	58156100	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	8.903000	0.92573	2.185000	0.69588	0.528000	0.53228	TGT		0.552	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
KCNH6	81033	hgsc.bcm.edu	37	17	61613336	61613336	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr17:61613336A>T	ENST00000583023.1	+	6	1419	c.1408A>T	c.(1408-1410)Acc>Tcc	p.T470S	KCNH6_ENST00000581784.1_Intron|KCNH6_ENST00000580652.1_Missense_Mutation_p.T470S|KCNH6_ENST00000456941.2_Intron|KCNH6_ENST00000314672.5_Missense_Mutation_p.T470S	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	470					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CCTCTACTTCACCTTCAGCAG	0.612																																					p.T470S												.	.	0			c.A1408T	17						.						83.0	60.0	68.0					17																	61613336		2203	4300	6503	58967068	SO:0001583	missense	81033	exon6			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1408A>T	17.37:g.61613336A>T	ENSP00000463533:p.Thr470Ser	None		Capture	SOLID	Phase_I	58967068	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.606644	0.46527	.	.	ENSG00000173826	ENST00000314672	D	0.96913	-4.17	4.36	4.36	0.52297	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96399	0.8825	L	0.35542	1.07	0.80722	D	1	D;P;P;D	0.89917	0.988;0.747;0.924;1.0	D;P;P;D	0.80764	0.979;0.801;0.883;0.994	D	0.97053	0.9765	10	0.87932	D	0	.	13.7107	0.62667	1.0:0.0:0.0:0.0	.	347;470;470;470	B4DPJ3;B4DKC0;Q9H252;Q9H252-3	.;.;KCNH6_HUMAN;.	S	470	ENSP00000318212:T470S	ENSP00000318212:T470S	T	+	1	0	KCNH6	58967068	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.139000	0.94554	1.821000	0.53095	0.260000	0.18958	ACC		0.612	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
CDH8	1006	hgsc.bcm.edu	37	16	61854943	61854943	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr16:61854943C>A	ENST00000577390.1	-	6	1864	c.910G>T	c.(910-912)Gat>Tat	p.D304Y	CDH8_ENST00000584337.1_Missense_Mutation_p.D304Y|CDH8_ENST00000299345.6_Missense_Mutation_p.D304Y|CDH8_ENST00000577730.1_Missense_Mutation_p.D304Y	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	304	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.D304Y(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TCACCAATATCCTGATCATTG	0.433																																					p.D304Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G910T	16						.						161.0	121.0	134.0					16																	61854943		2203	4300	6503	60412444	SO:0001583	missense	1006	exon6			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.910G>T	16.37:g.61854943C>A	ENSP00000462701:p.Asp304Tyr	Somatic		Capture	SOLID	Phase_I	60412444	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749329	0.89753	.	.	ENSG00000150394	ENST00000299345	T	0.74737	-0.87	6.16	6.16	0.99307	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.92841	0.7723	H	0.98901	4.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.94667	0.7853	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	120;304	Q3LID3;P55286	.;CADH8_HUMAN	Y	304	ENSP00000299345:D304Y	ENSP00000299345:D304Y	D	-	1	0	CDH8	60412444	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.440000	0.80464	2.937000	0.99478	0.650000	0.86243	GAT		0.433	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
GAS8	2622	hgsc.bcm.edu	37	16	90102792	90102792	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr16:90102792T>C	ENST00000268699.4	+	6	676	c.554T>C	c.(553-555)aTt>aCt	p.I185T	GAS8_ENST00000536122.1_Missense_Mutation_p.I160T|GAS8_ENST00000540721.1_3'UTR	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8	185	Microtubule-binding.				cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		CTTTCAGAAATTGAGGCCAAG	0.527																																					p.I185T												.	.	0			c.T554C	16						.						77.0	74.0	75.0					16																	90102792		2198	4300	6498	88630293	SO:0001583	missense	2622	exon6			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.554T>C	16.37:g.90102792T>C	ENSP00000268699:p.Ile185Thr	None		Capture	SOLID	Phase_I	88630293	NM_001481	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094450	0.76870	.	.	ENSG00000141013	ENST00000536122;ENST00000268699;ENST00000540721	T;T	0.33654	1.41;1.4	5.58	5.58	0.84498	.	0.170249	0.53938	D	0.000056	T	0.48352	0.1495	M	0.65498	2.005	0.51767	D	0.999936	D;D;P	0.56287	0.975;0.968;0.917	P;P;P	0.50754	0.649;0.587;0.529	T	0.47420	-0.9119	9	.	.	.	-20.2015	15.7398	0.77882	0.0:0.0:0.0:1.0	.	156;102;185	B7Z1X3;Q68D98;O95995	.;.;GAS8_HUMAN	T	160;185;156	ENSP00000440977:I160T;ENSP00000268699:I185T	.	I	+	2	0	GAS8	88630293	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.055000	0.71103	2.126000	0.65437	0.533000	0.62120	ATT		0.527	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
A4GNT	51146	hgsc.bcm.edu	37	3	137843330	137843330	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	A	C	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr3:137843330C>A	ENST00000236709.3	-	3	1000	c.799G>T	c.(799-801)Gag>Tag	p.E267*		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	267					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						CGCCTCCACTCTCGATAGGAG	0.502																																					p.E267X												.	.	0			c.G799T	3						.						85.0	84.0	84.0					3																	137843330		2203	4300	6503	139326020	SO:0001587	stop_gained	51146	exon3			AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.799G>T	3.37:g.137843330C>A	ENSP00000236709:p.Glu267*	Germline		Capture	SOLID	Phase_I	139326020	NM_016161	Q0VDK1|Q0VDK2	Nonsense_Mutation	SNP	ENST00000236709.3	37	CCDS3097.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054783	0.75960	.	.	ENSG00000118017	ENST00000236709	.	.	.	5.31	-10.4	0.00318	.	1.706290	0.02885	N	0.133387	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-23.8889	19.4373	0.94801	0.0:0.1733:0.7184:0.1084	.	.	.	.	X	267	.	ENSP00000236709:E267X	E	-	1	0	A4GNT	139326020	0.000000	0.05858	0.000000	0.03702	0.986000	0.74619	-1.356000	0.02609	-1.711000	0.01395	0.563000	0.77884	GAG		0.502	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161	
ETV5	2119	hgsc.bcm.edu	37	3	185769904	185769904	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr3:185769904C>A	ENST00000306376.5	-	12	1472	c.1226G>T	c.(1225-1227)gGc>gTc	p.G409V	ETV5_ENST00000537818.1_Missense_Mutation_p.G451V|ETV5_ENST00000480706.1_5'UTR|ETV5_ENST00000434744.1_Missense_Mutation_p.G409V	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	409					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G409V(2)		breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			CTTCTGGATGCCCCAGCGCCG	0.532			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.G409V			Dom	yes		3	3q28	2119	ets variant gene 5		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1226T	3						.						111.0	104.0	107.0					3																	185769904		2203	4300	6503	187252598	SO:0001583	missense	2119	exon12			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.1226G>T	3.37:g.185769904C>A	ENSP00000306894:p.Gly409Val	Somatic		Capture	SOLID	Phase_I	187252598	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	37	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472960	0.84640	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	D;D;D	0.84730	-1.89;-1.89;-1.89	5.76	5.76	0.90799	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	D	0.95230	0.8453	H	0.95850	3.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96281	0.9206	10	0.87932	D	0	.	18.7291	0.91728	0.0:1.0:0.0:0.0	.	409;451	P41161;B7Z7D7	ETV5_HUMAN;.	V	409;409;451	ENSP00000306894:G409V;ENSP00000413755:G409V;ENSP00000441737:G451V	ENSP00000306894:G409V	G	-	2	0	ETV5	187252598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.706000	0.92434	0.591000	0.81541	GGC		0.532	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
TGFBR2	7048	hgsc.bcm.edu	37	3	30715624	30715624	+	Missense_Mutation	SNP	G	G	A	rs397516838		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr3:30715624G>A	ENST00000295754.5	+	5	1664	c.1282G>A	c.(1282-1284)Gaa>Aaa	p.E428K	TGFBR2_ENST00000359013.4_Missense_Mutation_p.E453K	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	428	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.E428K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CATGGCTCCAGAAGTCCTAGA	0.448																																					p.E428K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1282A	3						.						122.0	113.0	116.0					3																	30715624		2203	4300	6503	30690628	SO:0001583	missense	7048	exon5				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1282G>A	3.37:g.30715624G>A	ENSP00000295754:p.Glu428Lys	Somatic		Capture	SOLID	Phase_I	30690628	NM_003242	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	G	36	5.950018	0.97139	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.98732	-5.1;-5.1	6.02	6.02	0.97574	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99521	0.9829	H	0.96662	3.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98231	1.0483	10	0.87932	D	0	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	428;453	P37173;D2JYI1	TGFR2_HUMAN;.	K	428;453;258	ENSP00000295754:E428K;ENSP00000351905:E453K	ENSP00000295754:E428K	E	+	1	0	TGFBR2	30690628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAA		0.448	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
ADAMTS9	56999	hgsc.bcm.edu	37	3	64617589	64617589	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr3:64617589C>T	ENST00000498707.1	-	15	2530	c.2188G>A	c.(2188-2190)Gat>Aat	p.D730N	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.D702N	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	730	Cys-rich.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D730N(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		AAAACATGATCGCATCCAGCT	0.338																																					p.D730N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2188A	3						.						78.0	76.0	77.0					3																	64617589		2201	4299	6500	64592629	SO:0001583	missense	56999	exon15			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2188G>A	3.37:g.64617589C>T	ENSP00000418735:p.Asp730Asn	Somatic		Capture	SOLID	Phase_I	64592629	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	34	5.406041	0.96051	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.73575	-0.76;-0.76	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.89294	0.6674	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.98	D	0.89558	0.3804	10	0.62326	D	0.03	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	702;730;730;730	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	N	702;730	ENSP00000295903:D702N;ENSP00000418735:D730N	ENSP00000295903:D702N	D	-	1	0	ADAMTS9	64592629	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	GAT		0.338	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
LRRC15	131578	hgsc.bcm.edu	37	3	194080474	194080474	+	Silent	SNP	C	C	T	rs144761152	byFrequency	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr3:194080474C>T	ENST00000347624.3	-	2	1384	c.1299G>A	c.(1297-1299)ccG>ccA	p.P433P	LRRC15_ENST00000428839.1_Silent_p.P439P|LRRC15_ENST00000439944.2_Silent_p.P439P	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	433	LRRCT.				negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.P433P(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		AGTTGCGGAGCGGAAGGATGT	0.567																																					p.P433P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1299A	3						.						70.0	61.0	64.0					3																	194080474		2203	4300	6503	195561769	SO:0001819	synonymous_variant	131578	exon2			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1299G>A	3.37:g.194080474C>T		Somatic		Capture	SOLID	Phase_I	195561769	NM_130830	Q495Q6|Q7RTN7	Silent	SNP	ENST00000347624.3	37	CCDS3306.1																																																																																				0.567	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2		
FICD	11153	hgsc.bcm.edu	37	12	108912998	108912998	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:108912998C>G	ENST00000552695.1	+	3	1358	c.1123C>G	c.(1123-1125)Ctg>Gtg	p.L375V	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	375	Fido. {ECO:0000255|PROSITE- ProRule:PRU00791}.				negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						GACCTCCCGTCTGCTCATGAA	0.562																																					p.L375V												.	.	0			c.C1123G	12						.						164.0	153.0	157.0					12																	108912998		2203	4300	6503	107437128	SO:0001583	missense	11153	exon3			AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.1123C>G	12.37:g.108912998C>G	ENSP00000446479:p.Leu375Val	None		Capture	SOLID	Phase_I	107437128	NM_007076	O75406	Missense_Mutation	SNP	ENST00000552695.1	37	CCDS9116.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.460812	0.63513	.	.	ENSG00000198855	ENST00000552695	.	.	.	5.88	4.99	0.66335	Filamentation induced by cAMP/death on curing-related (3);	0.000000	0.85682	D	0.000000	T	0.80226	0.4584	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82483	-0.0435	9	0.87932	D	0	-13.9933	8.5238	0.33293	0.0:0.7396:0.1265:0.1339	.	375	Q9BVA6	FICD_HUMAN	V	375	.	ENSP00000446479:L375V	L	+	1	2	FICD	107437128	0.992000	0.36948	1.000000	0.80357	0.981000	0.71138	1.737000	0.38197	2.797000	0.96272	0.561000	0.74099	CTG		0.562	FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404842.1	NM_007076	
ACACB	32	hgsc.bcm.edu	37	12	109684018	109684018	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:109684018C>G	ENST00000338432.7	+	39	5455	c.5336C>G	c.(5335-5337)aCc>aGc	p.T1779S	ACACB_ENST00000543201.1_Missense_Mutation_p.T445S|ACACB_ENST00000377854.5_Missense_Mutation_p.T1709S|ACACB_ENST00000377848.3_Missense_Mutation_p.T1779S			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1779					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AGGTTTAAGACCCAGGAGTAC	0.488																																					p.T1779S												.	.	0			c.C5336G	12						.						88.0	91.0	90.0					12																	109684018		2203	4300	6503	108168401	SO:0001583	missense	32	exon38			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.5336C>G	12.37:g.109684018C>G	ENSP00000341044:p.Thr1779Ser	None		Capture	SOLID	Phase_I	108168401	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170436	0.57584	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201;ENST00000537347	D;D;D;D	0.96967	-4.15;-4.15;-4.19;-4.01	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.97195	0.9083	M	0.93462	3.42	0.80722	D	1	B	0.18310	0.027	B	0.22152	0.038	D	0.95695	0.8744	10	0.48119	T	0.1	.	19.2027	0.93717	0.0:1.0:0.0:0.0	.	1779	O00763	ACACB_HUMAN	S	1779;1779;1709;1010;445;104	ENSP00000341044:T1779S;ENSP00000367079:T1779S;ENSP00000367085:T1709S;ENSP00000444075:T445S	ENSP00000341044:T1779S	T	+	2	0	ACACB	108168401	1.000000	0.71417	0.963000	0.40424	0.649000	0.38597	6.066000	0.71185	2.618000	0.88619	0.561000	0.74099	ACC		0.488	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
TULP3	7289	hgsc.bcm.edu	37	12	3047391	3047391	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:3047391T>C	ENST00000448120.2	+	10	1186	c.1135T>C	c.(1135-1137)Ttc>Ctc	p.F379L	TULP3_ENST00000397132.2_Missense_Mutation_p.F379L	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	379					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)	p.F379L(1)		endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGTCCTCAACTTCCGTGGCCG	0.532																																					p.F379L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1135C	12						.						115.0	109.0	111.0					12																	3047391		2203	4300	6503	2917652	SO:0001583	missense	7289	exon10			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.1135T>C	12.37:g.3047391T>C	ENSP00000410051:p.Phe379Leu	Somatic		Capture	SOLID	Phase_I	2917652	NM_001160408	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	CCDS8519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	27.9|27.9	4.868988|4.868988	0.91587|0.91587	.|.	.|.	ENSG00000078246|ENSG00000078246	ENST00000228245;ENST00000544943;ENST00000542730;ENST00000448120;ENST00000397132|ENST00000541678;ENST00000538704	D;D;D|.	0.95377|.	-3.69;-3.69;-3.69|.	5.2|5.2	5.2|5.2	0.72013|0.72013	Tubby, C-terminal (4);Tubby, C-terminal, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88633|0.88633	0.6489|0.6489	H|H	0.98664|0.98664	4.295|4.295	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;1.0;0.998|.	D|D	0.92787|0.92787	0.6245|0.6245	10|5	0.87932|.	D|.	0|.	-5.1885|-5.1885	14.2606|14.2606	0.66083|0.66083	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	203;379;379|.	B7Z1E7;O75386;F8WBZ9|.	.;TULP3_HUMAN;.|.	L|P	379;106;203;379;379|55;44	ENSP00000442631:F106L;ENSP00000410051:F379L;ENSP00000380321:F379L|.	ENSP00000228245:F379L|.	F|L	+|+	1|2	0|0	TULP3|TULP3	2917652|2917652	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.625000|0.625000	0.37756|0.37756	8.037000|8.037000	0.88933|0.88933	1.955000|1.955000	0.56771|0.56771	0.529000|0.529000	0.55759|0.55759	TTC|CTT		0.532	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
CPNE8	144402	hgsc.bcm.edu	37	12	39124112	39124112	+	Silent	SNP	T	T	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:39124112T>C	ENST00000331366.5	-	11	867	c.771A>G	c.(769-771)agA>agG	p.R257R	CPNE8_ENST00000360449.3_Silent_p.R245R	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	257						extracellular vesicular exosome (GO:0070062)		p.R257R(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				GTGACTGCCCTCTAGAAAGTT	0.299																																					p.R257R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A771G	12						.						98.0	100.0	99.0					12																	39124112		2203	4297	6500	37410379	SO:0001819	synonymous_variant	144402	exon11			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.771A>G	12.37:g.39124112T>C		Somatic		Capture	SOLID	Phase_I	37410379	NM_153634	Q2TB41|Q86VY2	Silent	SNP	ENST00000331366.5	37	CCDS8733.1																																																																																				0.299	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403856.1	NM_153634	
MBD6	114785	hgsc.bcm.edu	37	12	57918892	57918892	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:57918892T>G	ENST00000355673.3	+	5	729	c.373T>G	c.(373-375)Tct>Gct	p.S125A	MBD6_ENST00000431731.2_Missense_Mutation_p.S125A	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	125						chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						CTCACACTCTTCTCCTGGTGA	0.542																																					p.S125A												.	.	0			c.T373G	12						.						57.0	51.0	53.0					12																	57918892		2203	4300	6503	56205159	SO:0001583	missense	114785	exon5			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.373T>G	12.37:g.57918892T>G	ENSP00000347896:p.Ser125Ala	None		Capture	SOLID	Phase_I	56205159	NM_052897	Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	ENST00000355673.3	37	CCDS8944.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.871915	0.51695	.	.	ENSG00000166987	ENST00000548887;ENST00000355673;ENST00000549623;ENST00000431731;ENST00000552659	.	.	.	4.28	4.28	0.50868	.	0.571402	0.15160	N	0.277233	T	0.49508	0.1561	N	0.08118	0	0.48975	D	0.999732	D	0.56035	0.974	D	0.67725	0.953	T	0.50118	-0.8865	9	0.44086	T	0.13	-8.4222	10.0286	0.42087	0.0:0.0:0.0:1.0	.	125	Q96DN6	MBD6_HUMAN	A	125;125;29;125;120	.	ENSP00000347896:S125A	S	+	1	0	MBD6	56205159	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.508000	0.35769	1.925000	0.55765	0.454000	0.30748	TCT		0.542	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
ACACB	32	hgsc.bcm.edu	37	12	109684010	109684013	+	Frame_Shift_Del	DEL	GTTT	GTTT	-	rs368375713		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	GTTT	GTTT	GTTT	GTTT	GTTT	GTTT	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:109684010_109684013delGTTT	ENST00000338432.7	+	39	5447_5450	c.5328_5331delGTTT	c.(5326-5331)aggtttfs	p.RF1776fs	ACACB_ENST00000543201.1_Frame_Shift_Del_p.RF442fs|ACACB_ENST00000377854.5_Frame_Shift_Del_p.RF1706fs|ACACB_ENST00000377848.3_Frame_Shift_Del_p.RF1776fs			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1776					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCAAAATGAGGTTTAAGACCCAGG	0.466																																					p.1776_1777del												.	.	0			c.5328_5331del	12						.																																			108168396	SO:0001589	frameshift_variant	32	exon38			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.5328_5331delGTTT	12.37:g.109684010_109684013delGTTT	ENSP00000341044:p.Arg1776fs	None		Capture	SOLID	Phase_I	108168393	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Frame_Shift_Del	DEL	ENST00000338432.7	37	CCDS31898.1																																																																																				0.466	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
ZNF605	100289635	hgsc.bcm.edu	37	12	133502722	133502722	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr12:133502722G>T	ENST00000360187.4	-	5	1511	c.1163C>A	c.(1162-1164)aCa>aAa	p.T388K	ZNF605_ENST00000392321.3_Missense_Mutation_p.T419K|ZNF605_ENST00000331711.7_5'Flank	NM_183238.3	NP_899061.1	Q86T29	ZN605_HUMAN	zinc finger protein 605	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(16)|large_intestine(5)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;9.24e-09)|Epithelial(86;2.11e-07)|all cancers(50;5.27e-06)		CTTCTCTCCTGTGTGAGTTAT	0.403																																					p.T388K												.	.	0			c.C1163A	12						.						1.0	1.0	1.0					12																	133502722		165	394	559	132012795	SO:0001583	missense	90462	exon5			AL832623	CCDS31938.1, CCDS53850.1	12q24.33	2013-01-08	2009-09-11	2009-09-11		ENSG00000196458		"""Zinc fingers, C2H2-type"", ""-"""	28068	protein-coding gene	gene with protein product							Standard	NM_183238		Approved		uc001uli.3	Q86T29		ENST00000360187.4:c.1163C>A	12.37:g.133502722G>T	ENSP00000353314:p.Thr388Lys	None		Capture	SOLID	Phase_I	132012795	NM_183238	B3KVG4|D3DXJ0|Q86T91	Missense_Mutation	SNP	ENST00000360187.4	37	CCDS31938.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579822	0.46006	.	.	ENSG00000196458	ENST00000360187;ENST00000392321	T;T	0.24538	1.85;1.85	3.62	3.62	0.41486	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33235	N	0.005123	T	0.23289	0.0563	M	0.66560	2.04	0.34709	D	0.727599	B;B	0.32781	0.384;0.009	B;B	0.20577	0.03;0.004	T	0.42899	-0.9424	10	0.87932	D	0	.	9.1435	0.36919	0.1093:0.0:0.8907:0.0	.	419;388	B3KVG4;Q86T29	.;ZN605_HUMAN	K	388;419	ENSP00000353314:T388K;ENSP00000376135:T419K	ENSP00000353314:T388K	T	-	2	0	ZNF605	132012795	1.000000	0.71417	0.889000	0.34880	0.647000	0.38526	3.455000	0.52993	2.040000	0.60383	0.484000	0.47621	ACA		0.403	ZNF605-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397135.2	NM_183238	
ANKDD1A	348094	hgsc.bcm.edu	37	15	65236887	65236887	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr15:65236887C>G	ENST00000380230.3	+	12	1133	c.1104C>G	c.(1102-1104)aaC>aaG	p.N368K	ANKDD1A_ENST00000357698.3_Intron|ANKDD1A_ENST00000395723.1_Intron|ANKDD1A_ENST00000395720.1_Missense_Mutation_p.N368K	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	368					signal transduction (GO:0007165)			p.N368K(1)		NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						TCCGCAGCAACCATGTCAGCC	0.512																																					p.N368K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1104G	15						.						93.0	80.0	84.0					15																	65236887		2202	4299	6501	63023940	SO:0001583	missense	348094	exon12				CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.1104C>G	15.37:g.65236887C>G	ENSP00000369579:p.Asn368Lys	Somatic		Capture	SOLID	Phase_I	63023940	NM_182703	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Missense_Mutation	SNP	ENST00000380230.3	37	CCDS10197.2	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912900	0.72983	.	.	ENSG00000166839	ENST00000380230;ENST00000395720	T;T	0.17213	2.29;2.29	5.23	5.23	0.72850	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000005	T	0.33089	0.0851	L	0.45744	1.44	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.01081	-1.1458	10	0.62326	D	0.03	-29.7915	11.8234	0.52252	0.0:0.9162:0.0:0.0838	.	368	Q495B1	AKD1A_HUMAN	K	368	ENSP00000369579:N368K;ENSP00000379070:N368K	ENSP00000369579:N368K	N	+	3	2	ANKDD1A	63023940	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.413000	0.34725	2.734000	0.93682	0.591000	0.81541	AAC		0.512	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	
SLC10A7	84068	hgsc.bcm.edu	37	4	147425059	147425059	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr4:147425059C>A	ENST00000507030.1	-	4	337	c.338G>T	c.(337-339)tGc>tTc	p.C113F	SLC10A7_ENST00000511315.1_5'UTR|SLC10A7_ENST00000432059.2_Missense_Mutation_p.C113F|SLC10A7_ENST00000264986.3_Missense_Mutation_p.L67F|SLC10A7_ENST00000511374.1_Missense_Mutation_p.L67F|SLC10A7_ENST00000335472.7_Missense_Mutation_p.C113F|SLC10A7_ENST00000394062.3_Missense_Mutation_p.C113F|SLC10A7_ENST00000394059.4_Missense_Mutation_p.C113F			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7	113					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.C113F(2)		endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					CGGAGGCATGCAACCTACTGT	0.378																																					p.C113F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G338T	4						.						64.0	61.0	62.0					4																	147425059		2203	4300	6503	147644509	SO:0001583	missense	84068	exon4			AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.338G>T	4.37:g.147425059C>A	ENSP00000421275:p.Cys113Phe	Somatic		Capture	SOLID	Phase_I	147644509	NM_001029998	A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Missense_Mutation	SNP	ENST00000507030.1	37	CCDS34073.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.161635|4.161635	0.78226|0.78226	.|.	.|.	ENSG00000120519|ENSG00000120519	ENST00000432059;ENST00000335472;ENST00000507030;ENST00000394062;ENST00000394059|ENST00000264986;ENST00000511374	.|.	.|.	.|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85314|0.85314	0.5668|0.5668	M|M	0.90650|0.90650	3.135|3.135	0.52099|0.52099	D|D	0.999947|0.999947	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.87578|.	0.998;0.998;0.998;0.998|.	D|D	0.86884|0.86884	0.2044|0.2044	8|6	.|0.51188	.|T	.|0.08	-12.1168|-12.1168	19.3919|19.3919	0.94585|0.94585	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	113;113;113;113|.	Q0GE19-3;Q0GE19;Q0GE19-5;Q0GE19-2|.	.;NTCP7_HUMAN;.;.|.	F|F	113|67	.|.	.|ENSP00000264986:L67F	C|L	-|-	2|3	0|2	SLC10A7|SLC10A7	147644509|147644509	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.818000|6.818000	0.75257|0.75257	2.589000|2.589000	0.87451|0.87451	0.536000|0.536000	0.68110|0.68110	TGC|TTG		0.378	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366932.1	NM_032128	
GLA	2717	hgsc.bcm.edu	37	X	100655688	100655688	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chrX:100655688C>T	ENST00000218516.3	-	4	626	c.605G>A	c.(604-606)tGt>tAt	p.C202Y	RPL36A-HNRNPH2_ENST00000409170.3_Intron|GLA_ENST00000479445.1_5'Flank	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	202			C -> W (in FD; dbSNP:rs28936082). {ECO:0000269|PubMed:10208848}.|C -> Y (in FD). {ECO:0000269|PubMed:9100224}.		glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)	p.C202Y(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						AGGCCACTCACAGGAGTACAC	0.408																																					p.C202Y	Colon(193;776 2816 31189 44474)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G605A	X	GRCh37	CM972777	GLA	M		.						72.0	64.0	67.0					X																	100655688		2203	4300	6503	100542344	SO:0001583	missense	2717	exon4			X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.605G>A	X.37:g.100655688C>T	ENSP00000218516:p.Cys202Tyr	Somatic		Capture	SOLID	Phase_I	100542344	NM_000169	Q6LER7	Missense_Mutation	SNP	ENST00000218516.3	37	CCDS14484.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978895	0.74360	.	.	ENSG00000102393	ENST00000218516	D	0.99936	-8.3	5.38	4.52	0.55395	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99926	0.9966	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95575	0.8641	9	0.87932	D	0	-15.2547	13.4697	0.61276	0.0:0.9226:0.0:0.0774	.	202	P06280	AGAL_HUMAN	Y	202	ENSP00000218516:C202Y	ENSP00000218516:C202Y	C	-	2	0	GLA	100542344	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.794000	0.85869	1.043000	0.40175	0.513000	0.50165	TGT		0.408	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057540.1		
ESX1	80712	hgsc.bcm.edu	37	X	103499212	103499212	+	Silent	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chrX:103499212G>A	ENST00000372588.4	-	2	212	c.129C>T	c.(127-129)gaC>gaT	p.D43D		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	43					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)	p.D43D(1)		endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						TATTCTCCTCGTCCTCTCCTC	0.587																																					p.D43D	Pancreas(200;1705 2227 25194 28471 45274)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C129T	X						.						176.0	161.0	166.0					X																	103499212		2203	4300	6503	103385868	SO:0001819	synonymous_variant	80712	exon2			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.129C>T	X.37:g.103499212G>A		Somatic		Capture	SOLID	Phase_I	103385868	NM_153448	B0QYU3|Q7Z6K7	Silent	SNP	ENST00000372588.4	37	CCDS14516.1																																																																																				0.587	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448	
DCAF12L1	139170	hgsc.bcm.edu	37	X	125685313	125685313	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chrX:125685313A>T	ENST00000371126.1	-	1	1521	c.1279T>A	c.(1279-1281)Ttt>Att	p.F427I		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	427								p.F427I(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						GCATTGGGAAACACTTCCATG	0.562																																					p.F427I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1279A	X						.						132.0	122.0	126.0					X																	125685313		2203	4300	6503	125512994	SO:0001583	missense	139170	exon1			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1279T>A	X.37:g.125685313A>T	ENSP00000360167:p.Phe427Ile	Somatic		Capture	SOLID	Phase_I	125512994	NM_178470	Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	A	7.157	0.585019	0.13749	.	.	ENSG00000198889	ENST00000371126	T	0.18174	2.23	3.85	0.202	0.15190	.	0.211237	0.24098	N	0.041573	T	0.09291	0.0229	N	0.20685	0.6	0.24104	N	0.995867	B	0.12630	0.006	B	0.11329	0.006	T	0.22243	-1.0222	10	0.48119	T	0.1	.	6.6766	0.23098	0.6598:0.0:0.3402:0.0	.	427	Q5VU92	DC121_HUMAN	I	427	ENSP00000360167:F427I	ENSP00000360167:F427I	F	-	1	0	DCAF12L1	125512994	1.000000	0.71417	0.005000	0.12908	0.020000	0.10135	2.863000	0.48396	-0.062000	0.13088	0.417000	0.27973	TTT		0.562	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
VGLL1	51442	hgsc.bcm.edu	37	X	135631053	135631053	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chrX:135631053C>A	ENST00000370634.3	+	3	690	c.520C>A	c.(520-522)Caa>Aaa	p.Q174K	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q174K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					TCTCCTCCAGCAAGACAGATG	0.602																																					p.Q174K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C520A	X						.						92.0	90.0	91.0					X																	135631053		2203	4300	6503	135458719	SO:0001583	missense	51442	exon3			AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.520C>A	X.37:g.135631053C>A	ENSP00000359668:p.Gln174Lys	Somatic		Capture	SOLID	Phase_I	135458719	NM_016267	Q5H915	Missense_Mutation	SNP	ENST00000370634.3	37	CCDS14658.1	.	.	.	.	.	.	.	.	.	.	C	7.651	0.682858	0.14907	.	.	ENSG00000102243	ENST00000370634	T	0.50001	0.76	5.61	2.85	0.33270	.	0.370583	0.33161	N	0.005209	T	0.32496	0.0831	L	0.34521	1.04	0.22354	N	0.999174	P	0.37061	0.58	B	0.35114	0.196	T	0.12451	-1.0547	10	0.45353	T	0.12	-0.6646	7.3392	0.26627	0.0:0.5956:0.3144:0.09	.	174	Q99990	VGLL1_HUMAN	K	174	ENSP00000359668:Q174K	ENSP00000359668:Q174K	Q	+	1	0	VGLL1	135458719	0.999000	0.42202	0.048000	0.18961	0.094000	0.18550	1.648000	0.37271	0.175000	0.19841	-0.218000	0.12543	CAA		0.602	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267	
BEND2	139105	hgsc.bcm.edu	37	X	18230761	18230761	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chrX:18230761G>T	ENST00000380033.4	-	4	548	c.416C>A	c.(415-417)cCa>cAa	p.P139Q	BEND2_ENST00000380030.3_Missense_Mutation_p.P139Q	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	139								p.P139Q(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						TAAATGTACTGGGTGGTTTAT	0.343																																					p.P139Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C416A	X						.						179.0	163.0	168.0					X																	18230761		2203	4299	6502	18140682	SO:0001583	missense	139105	exon4			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.416C>A	X.37:g.18230761G>T	ENSP00000369372:p.Pro139Gln	Somatic		Capture	SOLID	Phase_I	18140682	NM_153346	E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	37	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	G	6.990	0.552854	0.13374	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	T;T	0.30714	1.62;1.52	3.14	-2.89	0.05665	.	0.991621	0.08165	N	0.987916	T	0.23370	0.0565	N	0.14661	0.345	0.09310	N	1	D;D	0.58620	0.983;0.983	P;P	0.53401	0.725;0.725	T	0.13415	-1.0510	10	0.51188	T	0.08	.	4.6536	0.12606	0.3647:0.1685:0.4668:0.0	.	139;139	E9PFY2;Q8NDZ0	.;BEND2_HUMAN	Q	139	ENSP00000369372:P139Q;ENSP00000369369:P139Q	ENSP00000369369:P139Q	P	-	2	0	BEND2	18140682	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.185000	0.09684	-1.126000	0.02929	-0.508000	0.04489	CCA		0.343	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346	
FAM133A	286499	hgsc.bcm.edu	37	X	92964757	92964757	+	Silent	SNP	T	T	C	rs368517810		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chrX:92964757T>C	ENST00000355813.5	+	4	865	c.339T>C	c.(337-339)tcT>tcC	p.S113S	FAM133A_ENST00000322139.4_Silent_p.S113S|FAM133A_ENST00000538690.1_Silent_p.S113S|FAM133A_ENST00000332647.4_Silent_p.S113S	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	113	Lys-rich.|Ser-rich.							p.S113S(1)		breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						GCTCTGATTCTTCAAGCAGTT	0.358																																					p.S113S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T339C	X						.						14.0	13.0	13.0					X																	92964757		2169	4246	6415	92851413	SO:0001819	synonymous_variant	286499	exon5			AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.339T>C	X.37:g.92964757T>C		Somatic		Capture	SOLID	Phase_I	92851413	NM_001171110		Silent	SNP	ENST00000355813.5	37	CCDS14466.1																																																																																				0.358	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057452.1	NM_173698	
GAB3	139716	hgsc.bcm.edu	37	X	153927572	153927572	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chrX:153927572T>A	ENST00000369575.3	-	6	1370	c.1339A>T	c.(1339-1341)Aaa>Taa	p.K447*	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Nonsense_Mutation_p.K448*	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	447					macrophage differentiation (GO:0030225)			p.K447*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGCTTACATTTCCTCTGAGGC	0.507																																					p.K448X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A1342T	X						.						134.0	130.0	132.0					X																	153927572		2203	4300	6503	153580766	SO:0001587	stop_gained	139716	exon6			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1339A>T	X.37:g.153927572T>A	ENSP00000358588:p.Lys447*	Somatic		Capture	SOLID	Phase_I	153580766	NM_001081573	A6NHF8|E9PB44	Nonsense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	T	38	7.088362	0.98055	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	.	.	.	5.74	5.74	0.90152	.	0.191813	0.52532	D	0.000079	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.841	0.57802	0.0:0.0:0.0:1.0	.	.	.	.	X	447;448;448	.	ENSP00000358581:K448X	K	-	1	0	GAB3	153580766	1.000000	0.71417	0.992000	0.48379	0.968000	0.65278	5.372000	0.66156	1.940000	0.56252	0.430000	0.28490	AAA		0.507	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
ALK	238	hgsc.bcm.edu	37	2	29443698	29443698	+	Silent	SNP	T	T	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr2:29443698T>C	ENST00000389048.3	-	23	4425	c.3519A>G	c.(3517-3519)aaA>aaG	p.K1173K	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1173	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.K1173K(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GGTGGTTGAATTTGCTGCAGA	0.507			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.K1173K		yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3519G	2						.						45.0	47.0	46.0					2																	29443698		2203	4300	6503	29297202	SO:0001819	synonymous_variant	238	exon23	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3519A>G	2.37:g.29443698T>C		Somatic		Capture	SOLID	Phase_I	29297202	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	CCDS33172.1																																																																																				0.507	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
RTN4	57142	hgsc.bcm.edu	37	2	55253659	55253659	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr2:55253659C>A	ENST00000337526.6	-	3	1819	c.1576G>T	c.(1576-1578)Gag>Tag	p.E526*	RTN4_ENST00000402434.2_Intron|RTN4_ENST00000394611.2_Nonsense_Mutation_p.E320*|RTN4_ENST00000357376.3_Nonsense_Mutation_p.E320*|RTN4_ENST00000405240.1_Nonsense_Mutation_p.E320*|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000354474.6_Nonsense_Mutation_p.E294*|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000404909.1_Nonsense_Mutation_p.E320*	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	526					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.E320*(1)|p.E526*(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TAATCTGTCTCAGAATCCTGT	0.398																																					p.E526X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1576T	2						.						136.0	132.0	133.0					2																	55253659		2203	4300	6503	55107163	SO:0001587	stop_gained	57142	exon3			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1576G>T	2.37:g.55253659C>A	ENSP00000337838:p.Glu526*	Somatic		Capture	SOLID	Phase_I	55107163	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Nonsense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	C	32	5.110696	0.94292	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	.	.	.	5.94	4.1	0.47936	.	0.262523	0.36893	N	0.002343	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-2.3168	6.5476	0.22414	0.0:0.642:0.1566:0.2014	.	.	.	.	X	320;320;526;320;320;294	.	ENSP00000337838:E526X	E	-	1	0	RTN4	55107163	0.760000	0.28428	1.000000	0.80357	0.991000	0.79684	1.138000	0.31491	0.797000	0.33971	0.650000	0.86243	GAG		0.398	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
FAM154A	158297	hgsc.bcm.edu	37	9	18928984	18928984	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr9:18928984G>C	ENST00000380534.4	-	4	770	c.491C>G	c.(490-492)tCa>tGa	p.S164*	FAM154A_ENST00000380530.1_3'UTR|FAM154A_ENST00000542071.1_De_novo_Start_OutOfFrame	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	164								p.S164*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		AAACCTGACTGATGCCGGCTG	0.453																																					p.S164X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C491G	9						.						149.0	135.0	140.0					9																	18928984		2203	4300	6503	18918984	SO:0001587	stop_gained	158297	exon4			BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.491C>G	9.37:g.18928984G>C	ENSP00000369907:p.Ser164*	Somatic		Capture	SOLID	Phase_I	18918984	NM_153707	Q5VY58	Nonsense_Mutation	SNP	ENST00000380534.4	37	CCDS6487.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791239	0.50102	.	.	ENSG00000155875	ENST00000380534	.	.	.	5.1	5.1	0.69264	.	0.426630	0.20265	N	0.095800	.	.	.	.	.	.	0.53005	D	0.999965	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-9.3118	13.0795	0.59104	0.0:0.0:0.8388:0.1612	.	.	.	.	X	164	.	ENSP00000369907:S164X	S	-	2	0	FAM154A	18918984	0.658000	0.27402	0.007000	0.13788	0.003000	0.03518	4.912000	0.63335	2.644000	0.89710	0.655000	0.94253	TCA		0.453	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051811.1	NM_153707	
POSTN	10631	hgsc.bcm.edu	37	13	38164529	38164529	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr13:38164529C>G	ENST00000379747.4	-	4	538	c.421G>C	c.(421-423)Gct>Cct	p.A141P	POSTN_ENST00000379742.4_Missense_Mutation_p.A141P|POSTN_ENST00000541179.1_Missense_Mutation_p.A141P|POSTN_ENST00000379749.4_Missense_Mutation_p.A141P|POSTN_ENST00000541481.1_Missense_Mutation_p.A141P|POSTN_ENST00000379743.4_Missense_Mutation_p.A141P	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	141	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.A141P(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTGTCCCAAGCCTCATTACTC	0.388																																					p.A141P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G421C	13						.						98.0	82.0	88.0					13																	38164529		2203	4300	6503	37062529	SO:0001583	missense	10631	exon4			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.421G>C	13.37:g.38164529C>G	ENSP00000369071:p.Ala141Pro	Somatic		Capture	SOLID	Phase_I	37062529	NM_001135934	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030591	0.93575	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.97598	-4.45;-4.45;-4.45;-4.45;-4.45;-4.45	5.36	5.36	0.76844	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.99168	0.9712	H	0.98005	4.125	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;0.998;1.0;1.0	D	0.98959	1.0797	10	0.87932	D	0	-17.3876	19.0894	0.93221	0.0:1.0:0.0:0.0	.	141;141;141;141;141;141;141	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	P	141;141;141;141;141;141;58	ENSP00000437959:A141P;ENSP00000369073:A141P;ENSP00000369071:A141P;ENSP00000369067:A141P;ENSP00000369066:A141P;ENSP00000437953:A141P	ENSP00000369066:A141P	A	-	1	0	POSTN	37062529	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	7.487000	0.81328	2.515000	0.84797	0.650000	0.86243	GCT		0.388	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
SLC16A9	220963	hgsc.bcm.edu	37	10	61423992	61423992	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr10:61423992A>C	ENST00000395348.3	-	4	1065	c.429T>G	c.(427-429)atT>atG	p.I143M	SLC16A9_ENST00000395347.1_Missense_Mutation_p.I143M	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	143					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						TACCTGTTGAAATCAGGCCAA	0.398																																					p.I143M												.	.	0			c.T429G	10						.						98.0	93.0	95.0					10																	61423992		2203	4300	6503	61093998	SO:0001583	missense	220963	exon4			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.429T>G	10.37:g.61423992A>C	ENSP00000378757:p.Ile143Met	None		Capture	SOLID	Phase_I	61093998	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	37	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.743820	0.49151	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.37411	1.2;1.2	5.34	5.34	0.76211	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.244701	0.42294	D	0.000731	T	0.40015	0.1100	L	0.28115	0.83	0.80722	D	1	P	0.50369	0.934	P	0.52758	0.708	T	0.33650	-0.9860	10	0.66056	D	0.02	.	15.2923	0.73875	1.0:0.0:0.0:0.0	.	143	Q7RTY1	MOT9_HUMAN	M	143	ENSP00000378757:I143M;ENSP00000378756:I143M	ENSP00000378756:I143M	I	-	3	3	SLC16A9	61093998	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.827000	0.62723	2.011000	0.59026	0.533000	0.62120	ATT		0.398	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
GBF1	8729	hgsc.bcm.edu	37	10	104136853	104136853	+	Missense_Mutation	SNP	G	G	T	rs373502588		TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr10:104136853G>T	ENST00000369983.3	+	33	4707	c.4447G>T	c.(4447-4449)Gtg>Ttg	p.V1483L		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1483					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.V1483L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GGACGAAGGCGTGCCTGCCAG	0.562																																					p.V1484L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4450T	10						.						120.0	116.0	117.0					10																	104136853		2203	4300	6503	104126843	SO:0001583	missense	8729	exon33			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.4447G>T	10.37:g.104136853G>T	ENSP00000359000:p.Val1483Leu	Somatic		Capture	SOLID	Phase_I	104126843	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	8.495	0.862835	0.17178	.	.	ENSG00000107862	ENST00000369983	T	0.08458	3.09	4.96	4.96	0.65561	.	0.056495	0.64402	D	0.000001	T	0.05044	0.0135	N	0.16478	0.41	0.51482	D	0.99992	B;B;B	0.19445	0.007;0.003;0.036	B;B;B	0.23574	0.009;0.008;0.047	T	0.16867	-1.0388	10	0.05525	T	0.97	-14.5452	12.2249	0.54455	0.0885:0.0:0.9115:0.0	.	1483;1483;1483	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	L	1483	ENSP00000359000:V1483L	ENSP00000359000:V1483L	V	+	1	0	GBF1	104126843	1.000000	0.71417	0.988000	0.46212	0.786000	0.44442	7.344000	0.79328	2.564000	0.86499	0.561000	0.74099	GTG		0.562	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
MEGF10	84466	hgsc.bcm.edu	37	5	126784876	126784876	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:126784876C>T	ENST00000274473.6	+	23	3209	c.2942C>T	c.(2941-2943)cCg>cTg	p.P981L	MEGF10_ENST00000503335.2_Missense_Mutation_p.P981L|MEGF10_ENST00000510828.1_3'UTR	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	981	Necessary for formation of large intracellular vacuoles.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.P981L(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GGGACATTGCCGGCTGACTGG	0.498																																					p.P981L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2942T	5						.						82.0	87.0	86.0					5																	126784876		2203	4300	6503	126812775	SO:0001583	missense	84466	exon23			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2942C>T	5.37:g.126784876C>T	ENSP00000274473:p.Pro981Leu	Somatic		Capture	SOLID	Phase_I	126812775	NM_032446	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034036	0.54896	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	D;D	0.83755	-1.76;-1.76	5.67	5.67	0.87782	.	0.155530	0.42294	D	0.000738	T	0.81413	0.4817	M	0.68952	2.095	0.80722	D	1	B	0.31625	0.332	B	0.15052	0.012	T	0.79441	-0.1802	10	0.42905	T	0.14	-11.8657	19.7728	0.96373	0.0:1.0:0.0:0.0	.	981	Q96KG7	MEG10_HUMAN	L	981	ENSP00000423354:P981L;ENSP00000274473:P981L	ENSP00000274473:P981L	P	+	2	0	MEGF10	126812775	1.000000	0.71417	0.818000	0.32626	0.024000	0.10985	4.498000	0.60373	2.687000	0.91594	0.655000	0.94253	CCG		0.498	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
FBN2	2201	hgsc.bcm.edu	37	5	127599171	127599171	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:127599171G>A	ENST00000508053.1	-	69	9112	c.8138C>T	c.(8137-8139)aCg>aTg	p.T2713M	FBN2_ENST00000262464.4_Missense_Mutation_p.T2713M			P35556	FBN2_HUMAN	fibrillin 2	2713	EGF-like 47; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T2713M(3)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCCCCCCTCCGTGTTAGAGCA	0.587																																					p.T2713M												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.C8138T	5						.						86.0	89.0	88.0					5																	127599171		2203	4300	6503	127627070	SO:0001583	missense	2201	exon63			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8138C>T	5.37:g.127599171G>A	ENSP00000424571:p.Thr2713Met	Somatic		Capture	SOLID	Phase_I	127627070	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987338	0.74589	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.93189	-3.18;-3.18	5.23	3.37	0.38596	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.099134	0.43747	D	0.000534	D	0.92260	0.7545	L	0.58925	1.835	0.48511	D	0.99966	P	0.52170	0.951	P	0.48598	0.583	D	0.92047	0.5645	10	0.72032	D	0.01	.	10.845	0.46739	0.0716:0.0:0.7952:0.1332	.	2713	P35556	FBN2_HUMAN	M	2713	ENSP00000262464:T2713M;ENSP00000424571:T2713M	ENSP00000262464:T2713M	T	-	2	0	FBN2	127627070	1.000000	0.71417	0.962000	0.40283	0.739000	0.42172	7.704000	0.84595	2.701000	0.92244	0.650000	0.86243	ACG		0.587	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
DDX46	9879	hgsc.bcm.edu	37	5	134102684	134102684	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:134102684G>A	ENST00000354283.4	+	3	419	c.284G>A	c.(283-285)aGt>aAt	p.S95N	DDX46_ENST00000452510.2_Missense_Mutation_p.S95N			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	95	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.S95N(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CGCTCAAGGAGTAGAAGCCGG	0.488																																					p.S95N	Colon(13;391 453 4901 21675 24897)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G284A	5						.						50.0	59.0	56.0					5																	134102684		2203	4300	6503	134130583	SO:0001583	missense	9879	exon3				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.284G>A	5.37:g.134102684G>A	ENSP00000346236:p.Ser95Asn	Somatic		Capture	SOLID	Phase_I	134130583	NM_014829	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	ENST00000354283.4	37	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699781	0.48307	.	.	ENSG00000145833	ENST00000452510;ENST00000537371;ENST00000354283	T;T	0.36699	1.24;1.24	5.48	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.44008	0.1273	M	0.83774	2.66	0.58432	D	0.999997	B	0.25521	0.128	B	0.27887	0.084	T	0.38950	-0.9637	10	0.24483	T	0.36	-17.8717	15.527	0.75919	0.0:0.0:0.8607:0.1393	.	95	Q7L014	DDX46_HUMAN	N	95	ENSP00000416534:S95N;ENSP00000346236:S95N	ENSP00000346236:S95N	S	+	2	0	DDX46	134130583	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.538000	0.90634	1.277000	0.44412	0.655000	0.94253	AGT		0.488	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
ANKHD1	54882	hgsc.bcm.edu	37	5	139876359	139876359	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:139876359A>G	ENST00000360839.2	+	15	2654	c.2500A>G	c.(2500-2502)Ata>Gta	p.I834V	ANKHD1_ENST00000462121.1_3'UTR|ANKHD1_ENST00000297183.6_Missense_Mutation_p.I834V|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.I834V	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	834						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGAAGAAAATATTGAAAGA	0.373																																					p.I834V												.	.	0			c.A2500G	5						.						77.0	83.0	81.0					5																	139876359		2203	4300	6503	139856543	SO:0001583	missense	404734	exon15			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.2500A>G	5.37:g.139876359A>G	ENSP00000354085:p.Ile834Val	None		Capture	SOLID	Phase_I	139856543	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.564450	0.45694	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000421134;ENST00000532219	T;T;T;T	0.73681	-0.75;-0.77;-0.7;-0.77	5.76	5.76	0.90799	Ankyrin repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83175	0.5197	M	0.61703	1.905	0.58432	D	0.999999	P;P;P	0.51791	0.948;0.913;0.913	D;P;P	0.67103	0.949;0.891;0.891	T	0.80420	-0.1390	10	0.24483	T	0.36	.	16.0668	0.80887	1.0:0.0:0.0:0.0	.	834;834;834	Q8IWZ3-4;Q8IWZ2;Q8IWZ3	.;.;ANKH1_HUMAN	V	834;867;834;834;368;853;834	ENSP00000354085:I834V;ENSP00000297183:I834V;ENSP00000394489:I853V;ENSP00000432016:I834V	ENSP00000432016:I834V	I	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139856543	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.335000	0.96500	2.191000	0.70037	0.477000	0.44152	ATA		0.373	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHAC1	56135	hgsc.bcm.edu	37	5	140308811	140308811	+	Silent	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:140308811C>T	ENST00000253807.2	+	1	2334	c.2334C>T	c.(2332-2334)gcC>gcT	p.A778A	PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.A778A|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	778					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A778A(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAATGCTGCCGACCTGCGAA	0.473																																					p.A778A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2334T	5						.						123.0	115.0	118.0					5																	140308811		2203	4300	6503	140288995	SO:0001819	synonymous_variant	56135	exon1			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.2334C>T	5.37:g.140308811C>T		Somatic		Capture	SOLID	Phase_I	140288995	NM_031882	Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	37	CCDS4241.1																																																																																				0.473	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
PCDHB1	29930	hgsc.bcm.edu	37	5	140432843	140432843	+	Silent	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:140432843C>T	ENST00000306549.3	+	1	1865	c.1788C>T	c.(1786-1788)gaC>gaT	p.D596D		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	596	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D596D(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGATGGTGACTCAGGTCAGA	0.483																																					p.D596D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1788T	5						.						95.0	84.0	88.0					5																	140432843		2203	4300	6503	140413027	SO:0001819	synonymous_variant	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1788C>T	5.37:g.140432843C>T		Somatic		Capture	SOLID	Phase_I	140413027	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	37	CCDS4243.1																																																																																				0.483	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
AFAP1L1	134265	hgsc.bcm.edu	37	5	148695850	148695850	+	Silent	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:148695850G>A	ENST00000296721.4	+	11	1349	c.1251G>A	c.(1249-1251)gaG>gaA	p.E417E	AFAP1L1_ENST00000515000.1_Silent_p.E417E	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	417						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E417E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACCGAGGAGGAGGTTCCCT	0.637																																					p.E417E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1251A	5						.						59.0	61.0	61.0					5																	148695850		2203	4300	6503	148676043	SO:0001819	synonymous_variant	134265	exon11			AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.1251G>A	5.37:g.148695850G>A		Somatic		Capture	SOLID	Phase_I	148676043	NM_152406	Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Silent	SNP	ENST00000296721.4	37	CCDS34274.1																																																																																				0.637	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373443.1	NM_152406	
AFAP1L1	134265	hgsc.bcm.edu	37	5	148695854	148695854	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:148695854G>A	ENST00000296721.4	+	11	1353	c.1255G>A	c.(1255-1257)Gtt>Att	p.V419I	AFAP1L1_ENST00000515000.1_Missense_Mutation_p.V419I	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	419	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V419I(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAGGAGGAGGTTCCCTGCTG	0.637																																					p.V419I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1255A	5						.						58.0	60.0	59.0					5																	148695854		2203	4300	6503	148676047	SO:0001583	missense	134265	exon11			AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.1255G>A	5.37:g.148695854G>A	ENSP00000296721:p.Val419Ile	Somatic		Capture	SOLID	Phase_I	148676047	NM_152406	Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Missense_Mutation	SNP	ENST00000296721.4	37	CCDS34274.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352263	0.41700	.	.	ENSG00000157510	ENST00000296721;ENST00000515000	T;T	0.14391	2.51;2.51	5.69	4.77	0.60923	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.477519	0.24176	N	0.040853	T	0.11281	0.0275	L	0.43152	1.355	0.30032	N	0.813412	B;B	0.06786	0.001;0.001	B;B	0.16722	0.006;0.016	T	0.05338	-1.0891	10	0.25106	T	0.35	-6.5577	7.5047	0.27538	0.1102:0.1694:0.7204:0.0	.	419;419	Q8TED9-2;Q8TED9	.;AF1L1_HUMAN	I	419	ENSP00000296721:V419I;ENSP00000424427:V419I	ENSP00000296721:V419I	V	+	1	0	AFAP1L1	148676047	0.998000	0.40836	0.995000	0.50966	0.920000	0.55202	1.926000	0.40084	2.688000	0.91661	0.561000	0.74099	GTT		0.637	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373443.1	NM_152406	
CDH18	1016	hgsc.bcm.edu	37	5	19721471	19721471	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:19721471C>T	ENST00000507958.1	-	7	1618	c.628G>A	c.(628-630)Gtc>Atc	p.V210I	CDH18_ENST00000511273.1_Missense_Mutation_p.V210I|CDH18_ENST00000382275.1_Missense_Mutation_p.V210I|CDH18_ENST00000274170.4_Missense_Mutation_p.V210I|CDH18_ENST00000506372.1_Missense_Mutation_p.V210I|CDH18_ENST00000502796.1_Missense_Mutation_p.V210I			Q13634	CAD18_HUMAN	cadherin 18, type 2	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V210I(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TTAGGGTCGACGGAGAAGTAG	0.448																																					p.V210I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G628A	5						.						167.0	147.0	154.0					5																	19721471		2203	4300	6503	19757228	SO:0001583	missense	1016	exon5			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.628G>A	5.37:g.19721471C>T	ENSP00000425093:p.Val210Ile	Somatic		Capture	SOLID	Phase_I	19757228	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.885980	0.51908	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.5	5.5	0.81552	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	N	0.02985	-0.445	0.58432	D	0.999996	B;D	0.89917	0.346;1.0	B;D	0.65443	0.122;0.935	T	0.49688	-0.8913	9	.	.	.	.	17.9639	0.89094	0.0:1.0:0.0:0.0	.	210;210	B4DHG6;Q13634	.;CAD18_HUMAN	I	210;210;210;210;210;210;156;210	ENSP00000371710:V210I;ENSP00000425093:V210I;ENSP00000274170:V210I;ENSP00000424931:V210I;ENSP00000422138:V210I;ENSP00000427383:V156I;ENSP00000425854:V210I	.	V	-	1	0	CDH18	19757228	1.000000	0.71417	0.973000	0.42090	0.311000	0.27955	5.986000	0.70563	2.571000	0.86741	0.650000	0.86243	GTC		0.448	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
DUSP1	1843	hgsc.bcm.edu	37	5	172196015	172196015	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3514-01A-02W-0831-10	TCGA-AA-3514-10A-01W-0831-10	g.chr5:172196015A>T	ENST00000239223.3	-	4	1096	c.854T>A	c.(853-855)tTt>tAt	p.F285Y	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	285	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.F285Y(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		CACAAACTCAAAGGCCTCGTC	0.557																																					p.F285Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T854A	5						.						83.0	78.0	80.0					5																	172196015		2203	4300	6503	172128621	SO:0001583	missense	1843	exon4			X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.854T>A	5.37:g.172196015A>T	ENSP00000239223:p.Phe285Tyr	Somatic		Capture	SOLID	Phase_I	172128621	NM_004417	D3DQL9|Q2V508	Missense_Mutation	SNP	ENST00000239223.3	37	CCDS4380.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.426286	0.83667	.	.	ENSG00000120129	ENST00000239223;ENST00000457103;ENST00000434080	D	0.84442	-1.85	4.67	4.67	0.58626	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.050290	0.85682	D	0.000000	D	0.84215	0.5423	N	0.11698	0.16	0.80722	D	1	D;D	0.71674	0.976;0.998	D;D	0.87578	0.942;0.998	D	0.83386	0.0015	10	0.27082	T	0.32	.	14.123	0.65201	1.0:0.0:0.0:0.0	.	285;242	P28562;B4DNT2	DUS1_HUMAN;.	Y	285;258;220	ENSP00000239223:F285Y	ENSP00000239223:F285Y	F	-	2	0	DUSP1	172128621	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	1.729000	0.51567	0.533000	0.62120	TTT		0.557	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252943.3	NM_004417	
