#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OSBPL3	26031	hgsc.bcm.edu	37	7	24892202	24892203	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:24892202_24892203insTC	ENST00000313367.2	-	11	1529_1530	c.1078_1079insGA	c.(1078-1080)aaafs	p.K360fs	OSBPL3_ENST00000409069.1_Frame_Shift_Ins_p.K329fs|OSBPL3_ENST00000353930.1_Frame_Shift_Ins_p.K360fs|OSBPL3_ENST00000431825.2_Frame_Shift_Ins_p.K329fs|OSBPL3_ENST00000396431.1_Frame_Shift_Ins_p.K329fs|OSBPL3_ENST00000352860.1_Frame_Shift_Ins_p.K329fs|OSBPL3_ENST00000396429.1_Frame_Shift_Ins_p.K360fs	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	360					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.K360fs*3(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CTGCTTCAGTTTCTCTCTCTCC	0.431																																					p.K329fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.986_987insGA	7						.																																			24858728	SO:0001589	frameshift_variant	26031	exon10			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.1077_1078dupGA	7.37:g.24892211_24892212dupTC	ENSP00000315410:p.Lys360fs	Somatic		Capture	SOLID	Phase_I	24858727	NM_145320	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Frame_Shift_Ins	INS	ENST00000313367.2	37	CCDS5390.1																																																																																				0.431	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
ZNF616	90317	hgsc.bcm.edu	37	19	52618187	52618188	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:52618187_52618188insT	ENST00000600228.1	-	4	2490_2491	c.2229_2230insA	c.(2227-2232)aaacctfs	p.P744fs	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	744					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P744fs*3(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CATTTATAAGGTTTTTTGCCAG	0.391																																					p.P744fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2230_2231insA	19						.																																			57310000	SO:0001589	frameshift_variant	90317	exon4			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.2230dupA	19.37:g.52618193_52618193dupT	ENSP00000471000:p.Pro744fs	Somatic		Capture	SOLID	Phase_I	57309999	NM_178523	B3KRV1|Q0P658|Q658V7	Frame_Shift_Ins	INS	ENST00000600228.1	37	CCDS33090.1																																																																																				0.391	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892	
ZNF558	148156	hgsc.bcm.edu	37	19	8932732	8932733	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:8932732_8932733insT	ENST00000601372.1	-	6	777_778	c.66_67insA	c.(64-69)aaaggafs	p.G23fs	ZNF558_ENST00000301475.1_Frame_Shift_Ins_p.G23fs|ZNF558_ENST00000599938.1_5'Flank|CTD-2529P6.3_ENST00000594006.1_RNA|ZNF558_ENST00000444186.2_5'Flank			Q96NG5	ZN558_HUMAN	zinc finger protein 558	23					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G23fs*10(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						TGTGTGTGTCCTTTTTGCTGAG	0.52																																					p.G23fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.67_68insA	19						.																																			8793733	SO:0001589	frameshift_variant	148156	exon2			AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.67dupA	19.37:g.8932737_8932737dupT	ENSP00000471277:p.Gly23fs	Somatic		Capture	SOLID	Phase_I	8793732	NM_144693	A8K5F0|B7Z798	Frame_Shift_Ins	INS	ENST00000601372.1	37	CCDS12208.1																																																																																				0.520	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459955.2	NM_144693	
NEK7	140609	hgsc.bcm.edu	37	1	198222297	198222298	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:198222297_198222298insA	ENST00000367385.4	+	3	527_528	c.185_186insA	c.(184-189)ttaaaafs	p.LK62fs	NEK7_ENST00000538004.1_Frame_Shift_Ins_p.LK62fs|NEK7_ENST00000367383.1_Frame_Shift_Ins_p.LK62fs	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	62	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.V65fs*5(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						CCAGTAGCTTTAAAAAAAGTGC	0.317																																					p.L62fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.185_186insA	1						.																																			196488921	SO:0001589	frameshift_variant	140609	exon3			AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.192dupA	1.37:g.198222304_198222304dupA	ENSP00000356355:p.Leu62fs	Somatic		Capture	SOLID	Phase_I	196488920	NM_133494	A6NGT8	Frame_Shift_Ins	INS	ENST00000367385.4	37	CCDS1394.1																																																																																				0.317	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086550.2	NM_133494	
GBP3	2635	hgsc.bcm.edu	37	1	89479039	89479040	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:89479039_89479040insT	ENST00000370481.4	-	6	916_917	c.696_697insA	c.(694-699)aaatgtfs	p.C233fs	GBP3_ENST00000475853.2_5'Flank	NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	266	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.C233fs*17(1)		breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		AAGACAAAACATTTTTTCTTTG	0.406																																					p.C233fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.697_698insA	1						.																																			89251628	SO:0001589	frameshift_variant	2635	exon6			BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.697dupA	1.37:g.89479045_89479045dupT	ENSP00000359512:p.Cys233fs	Somatic		Capture	SOLID	Phase_I	89251627	NM_018284	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Frame_Shift_Ins	INS	ENST00000370481.4	37	CCDS717.2																																																																																				0.406	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284	
ZBED9	114821	hgsc.bcm.edu	37	6	28542707	28542708	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:28542707_28542708insT	ENST00000452236.2	-	3	2391_2392	c.1774_1775insA	c.(1774-1776)agcfs	p.S592fs	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.S592fs*4(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						CTCAGGAGGGCTTTTTTCAGCC	0.371																																					p.S592fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1775_1776insA	6						.																																			28650687	SO:0001589	frameshift_variant	114821	exon3																														ENST00000452236.2:c.1775dupA	6.37:g.28542713_28542713dupT	ENSP00000395259:p.Ser592fs	Somatic		Capture	SOLID	Phase_I	28650686	NM_052923		Frame_Shift_Ins	INS	ENST00000452236.2	37	CCDS34355.1																																																																																				0.371	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
F13A1	2162	hgsc.bcm.edu	37	6	6197470	6197471	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:6197470_6197471insG	ENST00000264870.3	-	9	1466_1467	c.1201_1202insC	c.(1201-1203)cagfs	p.Q401fs		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	401					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.Q401fs*4(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GCTATTTTCCTGGGGGGTGCTG	0.48																																					p.Q401fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1202_1203insC	6	GRCh37	CI984023|CM960522	F13A1	I|M		.																																			6142470	SO:0001589	frameshift_variant	2162	exon9			M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1202dupC	6.37:g.6197476_6197476dupG	ENSP00000264870:p.Gln401fs	Somatic		Capture	SOLID	Phase_I	6142469	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Frame_Shift_Ins	INS	ENST00000264870.3	37	CCDS4496.1																																																																																				0.480	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
CTSD	1509	hgsc.bcm.edu	37	11	1780829	1780830	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:1780829_1780830insG	ENST00000236671.2	-	3	400_401	c.268_269insC	c.(268-270)cagfs	p.Q90fs	AC068580.6_ENST00000449248.1_RNA|RP11-295K3.1_ENST00000427721.1_5'Flank	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	90					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)	p.Q90fs*50(1)		endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGTGAAGCACTGGGGGGGCGTC	0.649																																					p.Q90fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.269_270insC	11						.																																			1737406	SO:0001589	frameshift_variant	1509	exon3			M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.269dupC	11.37:g.1780836_1780836dupG	ENSP00000236671:p.Gln90fs	Somatic		Capture	SOLID	Phase_I	1737405	NM_001909	Q6IB57	Frame_Shift_Ins	INS	ENST00000236671.2	37	CCDS7725.1																																																																																				0.649	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
FGD6	55785	hgsc.bcm.edu	37	12	95531314	95531315	+	In_Frame_Ins	INS	-	-	CAG	rs200227122		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:95531314_95531315insCAG	ENST00000343958.4	-	7	3200_3201	c.2977_2978insCTG	c.(2977-2979)gtt>gCTGtt	p.992_993insA	FGD6_ENST00000546711.1_In_Frame_Ins_p.992_993insA|FGD6_ENST00000549499.1_In_Frame_Ins_p.992_993insA	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	992	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.			A -> T (in Ref. 2; AAH13319). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.A992_V993insA(1)		breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						TTCTCTAACAACAGCAGCAAAA	0.332																																					p.V993delinsAV												.	.	1	Insertion - In frame(1)	large_intestine(1)	c.2978_2979insCTG	12						.																																			94055446	SO:0001652	inframe_insertion	55785	exon7			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.2975_2977dupCTG	12.37:g.95531318_95531320dupCAG	ENSP00000344446:p.Ala992_Ala992dup	Somatic		Capture	SOLID	Phase_I	94055445	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	In_Frame_Ins	INS	ENST00000343958.4	37	CCDS31878.1																																																																																				0.332	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
ZNF106	64397	hgsc.bcm.edu	37	15	42743992	42743993	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:42743992_42743993insT	ENST00000263805.4	-	2	734_735	c.408_409insA	c.(406-411)aaagatfs	p.D137fs	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	137					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.D137fs*4(1)									TTAAAGCCATCTTTTTCCCATT	0.49																																					p.D137fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.409_410insA	15						.																																			40531285	SO:0001589	frameshift_variant	64397	exon2			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.409dupA	15.37:g.42743997_42743997dupT	ENSP00000263805:p.Asp137fs	Somatic		Capture	SOLID	Phase_I	40531284	NM_022473	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Frame_Shift_Ins	INS	ENST00000263805.4	37	CCDS32208.1																																																																																				0.490	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
FAM47C	442444	hgsc.bcm.edu	37	X	37026749	37026750	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:37026749_37026750insC	ENST00000358047.3	+	1	318_319	c.266_267insC	c.(265-270)gaccccfs	p.DP89fs		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	89								p.K91fs*66(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCCCAAGCTGACCCCAAAAGCA	0.535																																					p.D89fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.266_267insC	X						.																																			36936671	SO:0001589	frameshift_variant	442444	exon1			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.270dupC	X.37:g.37026753_37026753dupC	ENSP00000367913:p.Asp89fs	Somatic		Capture	SOLID	Phase_I	36936670	NM_001013736	Q6ZU46	Frame_Shift_Ins	INS	ENST00000358047.3	37	CCDS35227.1																																																																																				0.535	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
TIGD4	201798	hgsc.bcm.edu	37	4	153691289	153691290	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:153691289_153691290insTT	ENST00000304337.2	-	2	1687_1688	c.867_868insAA	c.(865-870)tcttttfs	p.F290fs		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	290	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.F290fs*8(1)		breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					TGTGCTGGAAAAGACTCAACAA	0.391																																					p.F290fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.868_869insAA	4						.																																			153910740	SO:0001589	frameshift_variant	201798	exon2			AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.867_868insAA	4.37:g.153691289_153691290insTT	ENSP00000355162:p.Phe290fs	Somatic		Capture	SOLID	Phase_I	153910739	NM_145720	Q96LP5	Frame_Shift_Ins	INS	ENST00000304337.2	37	CCDS34079.1																																																																																				0.391	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	NM_145720	
DYSF	8291	hgsc.bcm.edu	37	2	71730414	71730415	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:71730414_71730415insC	ENST00000258104.3	+	4	584_585	c.307_308insC	c.(307-309)gccfs	p.A103fs	DYSF_ENST00000409762.1_Frame_Shift_Ins_p.A103fs|DYSF_ENST00000410020.3_Frame_Shift_Ins_p.A104fs|DYSF_ENST00000409366.1_Frame_Shift_Ins_p.A104fs|DYSF_ENST00000409744.1_Frame_Shift_Ins_p.A104fs|DYSF_ENST00000394120.2_Frame_Shift_Ins_p.A104fs|DYSF_ENST00000409582.3_Frame_Shift_Ins_p.A103fs|DYSF_ENST00000413539.2_Frame_Shift_Ins_p.A103fs|DYSF_ENST00000429174.2_Frame_Shift_Ins_p.A103fs|DYSF_ENST00000409651.1_Frame_Shift_Ins_p.A104fs|DYSF_ENST00000410041.1_Frame_Shift_Ins_p.A104fs	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	103					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.L105fs*43(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CAGCTTCAATGCCCCCCTGCTG	0.589																																					p.A103fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.307_308insC	2						.																																			71583923	SO:0001589	frameshift_variant	8291	exon4			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.313dupC	2.37:g.71730420_71730420dupC	ENSP00000258104:p.Ala103fs	Somatic		Capture	SOLID	Phase_I	71583922	NM_001130981	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Frame_Shift_Ins	INS	ENST00000258104.3	37	CCDS1918.1																																																																																				0.589	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
GCFC2	6936	hgsc.bcm.edu	37	2	75893155	75893156	+	Frame_Shift_Ins	INS	-	-	T	rs572775709	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:75893155_75893156insT	ENST00000321027.3	-	16	2260_2261	c.2127_2128insA	c.(2125-2130)aaatggfs	p.W710fs	MRPL19_ENST00000409374.1_Intron|MRPL19_ENST00000358788.6_Intron|GCFC2_ENST00000541687.1_3'UTR|GCFC2_ENST00000409857.3_Frame_Shift_Ins_p.W672fs	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	710					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.W710fs*3(1)									TTTTCAAACCATTTTTCTGGTA	0.342																																					p.W710fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2128_2129insA	2						.																																			75746664	SO:0001589	frameshift_variant	6936	exon16			AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.2128dupA	2.37:g.75893160_75893160dupT	ENSP00000318690:p.Trp710fs	Somatic		Capture	SOLID	Phase_I	75746663	NM_003203	A4UHQ8|O95032|Q53TY0|Q6P2F2	Frame_Shift_Ins	INS	ENST00000321027.3	37	CCDS1961.1																																																																																				0.342	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252255.2	NM_003203	
SECISBP2	79048	hgsc.bcm.edu	37	9	91943617	91943618	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:91943617_91943618insA	ENST00000375807.3	+	5	688_689	c.617_618insA	c.(616-621)gcaaaafs	p.AK206fs	SECISBP2_ENST00000339901.4_Frame_Shift_Ins_p.AK133fs|SECISBP2_ENST00000470305.1_3'UTR|SECISBP2_ENST00000534113.2_Frame_Shift_Ins_p.AK138fs	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	206					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.N208fs*8(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						AGAATCATTGCAAAAAATGTAT	0.356																																					p.A206fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.617_618insA	9						.																																			91133438	SO:0001589	frameshift_variant	79048	exon5			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.623dupA	9.37:g.91943623_91943623dupA	ENSP00000364965:p.Ala206fs	Somatic		Capture	SOLID	Phase_I	91133437	NM_024077	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Frame_Shift_Ins	INS	ENST00000375807.3	37	CCDS6683.1																																																																																				0.356	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
SYCE1	93426	hgsc.bcm.edu	37	10	135371674	135371675	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:135371674_135371675insT	ENST00000343131.5	-	5	419_420	c.315_316insA	c.(313-318)aaacaafs	p.Q106fs	SYCE1_ENST00000368517.3_Frame_Shift_Ins_p.Q70fs|SYCE1_ENST00000432597.2_Frame_Shift_Ins_p.Q70fs|SPRN_ENST00000541506.1_Intron	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	106					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.Q106fs*17(1)|p.Q70fs*17(1)		breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CAAATACCTTGTTTTTTGCTCA	0.51																																					p.Q106fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.316_317insA	10						.																																			135221665	SO:0001589	frameshift_variant	93426	exon5			AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.316dupA	10.37:g.135371680_135371680dupT	ENSP00000341282:p.Gln106fs	Somatic		Capture	SOLID	Phase_I	135221664	NM_001143764	B2RC80|Q9BWU3|Q9BWU4	Frame_Shift_Ins	INS	ENST00000343131.5	37	CCDS44501.1																																																																																				0.510	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564	
PCDHB11	56125	hgsc.bcm.edu	37	5	140580150	140580151	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:140580150_140580151insT	ENST00000354757.3	+	1	803_804	c.803_804insT	c.(802-807)gatttafs	p.L269fs	PCDHB11_ENST00000536699.1_5'UTR	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	269	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L269fs*8(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAGCTTGGGATTTAGACTCTG	0.386																																					p.D268fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.803_804insT	5						.																																			140560335	SO:0001589	frameshift_variant	56125	exon1			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.806dupT	5.37:g.140580153_140580153dupT	ENSP00000346802:p.Leu269fs	Somatic		Capture	SOLID	Phase_I	140560334	NM_018931	B4DSF7|Q2M223	Frame_Shift_Ins	INS	ENST00000354757.3	37	CCDS4253.1																																																																																				0.386	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
LARP1	23367	hgsc.bcm.edu	37	5	154173389	154173390	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:154173389_154173390insC	ENST00000336314.4	+	6	691_692	c.667_668insC	c.(667-669)gccfs	p.A223fs		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	300					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.T303fs*19(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CGTGCCCGTGGCCCCCCCCACC	0.644																																					p.A223fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.667_668insC	5						.																																			154153583	SO:0001589	frameshift_variant	23367	exon6			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.675dupC	5.37:g.154173397_154173397dupC	ENSP00000336721:p.Ala223fs	Somatic		Capture	SOLID	Phase_I	154153582	NM_015315	O94836|Q8N4M2|Q8NB73|Q9UFD7	Frame_Shift_Ins	INS	ENST00000336314.4	37	CCDS4328.1																																																																																				0.644	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
ZNF800	168850	hgsc.bcm.edu	37	7	127013801	127013801	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:127013801C>T	ENST00000393313.1	-	5	2180	c.1589G>A	c.(1588-1590)cGg>cAg	p.R530Q	ZNF800_ENST00000485577.1_5'Flank|ZNF800_ENST00000393312.1_Missense_Mutation_p.R530Q|ZNF800_ENST00000265827.3_Missense_Mutation_p.R530Q			Q2TB10	ZN800_HUMAN	zinc finger protein 800	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R530Q(2)|p.R530L(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						ATCACGTTTCCGACGAGTTTC	0.358																																					p.R530Q												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.G1589A	7						.						76.0	70.0	72.0					7																	127013801		2203	4299	6502	126801037	SO:0001583	missense	168850	exon5			AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.1589G>A	7.37:g.127013801C>T	ENSP00000376989:p.Arg530Gln	Somatic		Capture	SOLID	Phase_I	126801037	NM_176814	Q9HBN0	Missense_Mutation	SNP	ENST00000393313.1	37	CCDS5795.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944902	0.73672	.	.	ENSG00000048405	ENST00000393313;ENST00000265827;ENST00000393312	T;T;T	0.78003	-1.14;-1.14;-1.14	6.07	6.07	0.98685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.80701	0.4673	L	0.29908	0.895	0.36632	D	0.876347	D;D	0.76494	0.999;0.999	P;P	0.59703	0.862;0.862	T	0.77440	-0.2587	8	.	.	.	-22.2381	19.6475	0.95784	0.0:1.0:0.0:0.0	.	433;530	B7Z4V7;Q2TB10	.;ZN800_HUMAN	Q	530	ENSP00000376989:R530Q;ENSP00000265827:R530Q;ENSP00000376988:R530Q	.	R	-	2	0	ZNF800	126801037	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.456000	0.80751	2.885000	0.99019	0.655000	0.94253	CGG		0.358	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141823.1	NM_176814	
KLF14	136259	hgsc.bcm.edu	37	7	130418034	130418034	+	Missense_Mutation	SNP	C	C	T	rs142413259		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:130418034C>T	ENST00000310992.4	-	1	854	c.827G>A	c.(826-828)cGc>cAc	p.R276H		NM_138693.2	NP_619638.2	Q8TD94	KLF14_HUMAN	Kruppel-like factor 14	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R276H(1)		large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(18;0.0435)					GGTTGGGTGGCGGCGAGCATG	0.652																																					p.R276H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G827A	7						.	C	HIS/ARG	0,4406		0,0,2203	58.0	53.0	55.0		827	4.4	1.0	7	dbSNP_134	55	1,8597		0,1,4298	no	missense	KLF14	NM_138693.2	29	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	276/324	130418034	1,13003	2203	4299	6502	130068574	SO:0001583	missense	136259	exon1			AF490374	CCDS5825.1	7q32.3	2014-05-06			ENSG00000174595	ENSG00000266265		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	23025	protein-coding gene	gene with protein product		609393				17480121	Standard	NM_138693		Approved	BTEB5	uc003vqk.2	Q8TD94	OTTHUMG00000188298	ENST00000310992.4:c.827G>A	7.37:g.130418034C>T	ENSP00000310878:p.Arg276His	Somatic		Capture	SOLID	Phase_I	130068574	NM_138693	Q19A42|Q19A43	Missense_Mutation	SNP	ENST00000310992.4	37	CCDS5825.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460523	0.84317	0.0	1.16E-4	ENSG00000174595	ENST00000310992	T	0.70282	-0.47	4.41	4.41	0.53225	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33670	N	0.004661	T	0.78610	0.4310	L	0.55990	1.75	0.47214	D	0.999352	D	0.89917	1.0	D	0.71656	0.974	T	0.79995	-0.1568	10	0.72032	D	0.01	.	11.2262	0.48886	0.0:0.8134:0.1866:0.0	.	276	Q8TD94	KLF14_HUMAN	H	276	ENSP00000310878:R276H	ENSP00000310878:R276H	R	-	2	0	KLF14	130068574	0.829000	0.29322	1.000000	0.80357	0.967000	0.64934	0.418000	0.21230	2.374000	0.81015	0.561000	0.74099	CGC		0.652	KLF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338013.1	NM_138693	
DGKI	9162	hgsc.bcm.edu	37	7	137150705	137150705	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:137150705G>A	ENST00000288490.5	-	27	2585	c.2585C>T	c.(2584-2586)cCg>cTg	p.P862L	DGKI_ENST00000453654.2_Missense_Mutation_p.P572L|DGKI_ENST00000446122.1_Missense_Mutation_p.P844L|DGKI_ENST00000424189.2_Missense_Mutation_p.P875L	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	862					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.P862L(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TGTCCCCGCCGGCTGTGACAC	0.527																																					p.P862L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2585T	7						.						65.0	66.0	66.0					7																	137150705		2203	4300	6503	136801245	SO:0001583	missense	9162	exon27			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2585C>T	7.37:g.137150705G>A	ENSP00000288490:p.Pro862Leu	Somatic		Capture	SOLID	Phase_I	136801245	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762795	0.31228	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.32988	1.97;1.43;1.64	5.82	4.71	0.59529	.	0.114332	0.64402	D	0.000009	T	0.22627	0.0546	N	0.22421	0.69	0.29559	N	0.850796	B;B	0.15473	0.002;0.013	B;B	0.12156	0.002;0.007	T	0.14337	-1.0476	10	0.72032	D	0.01	.	12.36	0.55197	0.0:0.0:0.3042:0.6958	.	572;862	E9PFX6;O75912	.;DGKI_HUMAN	L	572;820;865;862;844	ENSP00000392161:P572L;ENSP00000288490:P862L;ENSP00000399131:P844L	ENSP00000288490:P862L	P	-	2	0	DGKI	136801245	0.999000	0.42202	0.994000	0.49952	0.608000	0.37181	2.876000	0.48498	1.099000	0.41499	0.655000	0.94253	CCG		0.527	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
TBXAS1	6916	hgsc.bcm.edu	37	7	139635991	139635991	+	Splice_Site	SNP	C	C	T	rs139976441	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:139635991C>T	ENST00000336425.5	+	9	724	c.335C>T	c.(334-336)gCg>gTg	p.A112V	TBXAS1_ENST00000458722.1_Splice_Site_p.A112V|TBXAS1_ENST00000448866.1_Splice_Site_p.A112V|TBXAS1_ENST00000416849.2_Splice_Site_p.A113V|TBXAS1_ENST00000462275.1_3'UTR|TBXAS1_ENST00000411653.1_Splice_Site_p.A112V|TBXAS1_ENST00000414508.2_Splice_Site_p.A113V|TBXAS1_ENST00000425687.1_Splice_Site_p.A45V|TBXAS1_ENST00000436047.2_Splice_Site_p.A113V|TBXAS1_ENST00000263552.6_Splice_Site_p.A113V			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	112					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)	p.A113V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	TCCCAACAGGCGTCGGGTTTG	0.517																																					p.A113V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C338T	7						.	C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	138.0	137.0	137.0		338,338,338,134,338	2.1	0.6	7	dbSNP_134	137	4,8596	3.7+/-12.6	0,4,4296	yes	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	TBXAS1	NM_001061.4,NM_001130966.2,NM_001166253.1,NM_001166254.1,NM_030984.3	64,64,64,64,64	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign,benign,benign,benign,benign	113/535,113/535,113/581,45/467,113/461	139635991	4,13002	2203	4300	6503	139282460	SO:0001630	splice_region_variant	6916	exon5			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.334-1C>T	7.37:g.139635991C>T		Somatic		Capture	SOLID	Phase_I	139282460	NM_001061	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	ENST00000336425.5	37		.	.	.	.	.	.	.	.	.	.	C	9.087	1.000671	0.19121	0.0	4.65E-4	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000438104;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	5.41	2.1	0.27182	.	0.534875	0.19846	N	0.104756	T	0.43144	0.1234	N	0.17278	0.47	0.31550	N	0.658836	B;B;B;B;B;B;B	0.20780	0.026;0.047;0.004;0.021;0.033;0.048;0.012	B;B;B;B;B;B;B	0.22753	0.01;0.041;0.006;0.012;0.03;0.015;0.009	T	0.32903	-0.9889	10	0.24483	T	0.36	.	4.3089	0.10960	0.1711:0.4904:0.0:0.3385	.	93;113;64;45;113;113;112	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	V	45;113;112;112;113;113;113;112;112;112	ENSP00000388736:A45V;ENSP00000263552:A113V;ENSP00000388612:A112V;ENSP00000338087:A112V;ENSP00000389414:A113V;ENSP00000392361:A113V;ENSP00000392702:A113V;ENSP00000402536:A112V;ENSP00000411274:A112V;ENSP00000411326:A112V	ENSP00000263552:A113V	A	+	2	0	TBXAS1	139282460	0.205000	0.23458	0.575000	0.28536	0.088000	0.18126	0.452000	0.21795	0.614000	0.30107	0.655000	0.94253	GCG		0.517	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000348373.1		Missense_Mutation
CLCN1	1180	hgsc.bcm.edu	37	7	143029514	143029514	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:143029514G>A	ENST00000343257.2	+	11	1256	c.1169G>A	c.(1168-1170)cGc>cAc	p.R390H		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	390					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.R390H(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTTTTCAGCCGCCTGCTGTAT	0.483																																					p.R390H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1169A	7						.						172.0	165.0	168.0					7																	143029514		2203	4300	6503	142739636	SO:0001583	missense	1180	exon11			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1169G>A	7.37:g.143029514G>A	ENSP00000339867:p.Arg390His	Somatic		Capture	SOLID	Phase_I	142739636	NM_000083	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999268	0.74818	.	.	ENSG00000188037	ENST00000343257	D	0.94723	-3.5	5.29	3.46	0.39613	Chloride channel, core (2);	0.196884	0.56097	D	0.000038	D	0.96827	0.8964	M	0.84683	2.71	0.49483	D	0.999798	D	0.76494	0.999	D	0.66351	0.943	D	0.95593	0.8656	10	0.33940	T	0.23	.	14.385	0.66938	0.0:0.0:0.6161:0.3839	.	390	P35523	CLCN1_HUMAN	H	390	ENSP00000339867:R390H	ENSP00000339867:R390H	R	+	2	0	CLCN1	142739636	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.340000	0.59328	0.600000	0.29862	-0.196000	0.12772	CGC		0.483	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
OR2F1	26211	hgsc.bcm.edu	37	7	143657546	143657546	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:143657546T>C	ENST00000392899.1	+	1	520	c.483T>C	c.(481-483)gcT>gcC	p.A161A	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	161					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A161A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TGCAGACTGCTATCACCTTTC	0.532																																					p.A161A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T483C	7						.						148.0	125.0	133.0					7																	143657546		2203	4300	6503	143288479	SO:0001819	synonymous_variant	26211	exon1			U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.483T>C	7.37:g.143657546T>C		Somatic		Capture	SOLID	Phase_I	143288479	NM_012369	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Silent	SNP	ENST00000392899.1	37	CCDS5887.1																																																																																				0.532	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
GNA12	2768	hgsc.bcm.edu	37	7	2834685	2834685	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:2834685G>A	ENST00000275364.3	-	2	564	c.402C>T	c.(400-402)ttC>ttT	p.F134F	GNA12_ENST00000544127.1_Silent_p.F58F|GNA12_ENST00000407904.3_Silent_p.F75F	NM_007353.2	NP_031379.2	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein) alpha 12	134					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic digit morphogenesis (GO:0042733)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|platelet activation (GO:0030168)|regulation of cell shape (GO:0008360)|regulation of fibroblast migration (GO:0010762)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)|response to drug (GO:0042493)|Rho protein signal transduction (GO:0007266)	brush border membrane (GO:0031526)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.F134F(1)		endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		CCTTGTTCTCGAAGGCCATCA	0.552																																					p.F134F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	7						.						135.0	133.0	133.0					7																	2834685		2203	4300	6503	2801211	SO:0001819	synonymous_variant	2768	exon2			L01694	CCDS5335.1, CCDS64584.1, CCDS64583.1	7p22.3	2006-07-08			ENSG00000146535	ENSG00000146535			4380	protein-coding gene	gene with protein product		604394				8423800, 16247467	Standard	NM_007353		Approved	gep	uc003smu.3	Q03113	OTTHUMG00000023064	ENST00000275364.3:c.402C>T	7.37:g.2834685G>A		Somatic		Capture	SOLID	Phase_I	2801211	NM_007353	A4D204|B3KXS2|B7Z3F7|Q2T9L1|Q5PPR5|Q86UM8|Q8TD71|Q9UDU9	Silent	SNP	ENST00000275364.3	37	CCDS5335.1																																																																																				0.552	GNA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241608.1	NM_007353	
SDK1	221935	hgsc.bcm.edu	37	7	4189019	4189019	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:4189019C>T	ENST00000404826.2	+	30	4688	c.4549C>T	c.(4549-4551)Cga>Tga	p.R1517*	SDK1_ENST00000389531.3_Nonsense_Mutation_p.R1517*	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1517	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R1517*(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CATGCAGGTGCGAGAGCTGCC	0.662																																					p.R1517X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4549T	7						.						40.0	36.0	37.0					7																	4189019		2203	4300	6503	4155545	SO:0001587	stop_gained	221935	exon30			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4549C>T	7.37:g.4189019C>T	ENSP00000385899:p.Arg1517*	Somatic		Capture	SOLID	Phase_I	4155545	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Nonsense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	46	12.682557	0.99688	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	.	.	.	5.12	5.12	0.69794	.	0.123853	0.36628	N	0.002484	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3039	0.66373	0.1492:0.8508:0.0:0.0	.	.	.	.	X	1517	.	ENSP00000374182:R1517X	R	+	1	2	SDK1	4155545	0.032000	0.19561	1.000000	0.80357	0.958000	0.62258	0.854000	0.27791	2.391000	0.81399	0.462000	0.41574	CGA		0.662	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
EIF2AK1	27102	hgsc.bcm.edu	37	7	6068293	6068293	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:6068293G>T	ENST00000199389.6	-	13	1629	c.1483C>A	c.(1483-1485)Ctg>Atg	p.L495M	ANKRD61_ENST00000409061.1_5'Flank|EIF2AK1_ENST00000536084.1_Missense_Mutation_p.L371M	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	495	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)	p.L495M(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		GAAGCGTACAGACAAGTACCC	0.398																																					p.L494M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1480A	7						.						204.0	163.0	177.0					7																	6068293		2203	4300	6503	6034819	SO:0001583	missense	27102	exon13			BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1483C>A	7.37:g.6068293G>T	ENSP00000199389:p.Leu495Met	Somatic		Capture	SOLID	Phase_I	6034819	NM_001134335	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	ENST00000199389.6	37	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.729954	0.69074	.	.	ENSG00000086232	ENST00000199389;ENST00000536084;ENST00000426957	T;T	0.65549	-0.16;-0.16	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.079395	0.52532	D	0.000068	T	0.74465	0.3720	L	0.60904	1.88	0.41878	D	0.990308	D;D;P	0.89917	0.999;1.0;0.932	D;D;P	0.80764	0.958;0.994;0.883	T	0.75422	-0.3323	10	0.51188	T	0.08	-13.3768	13.2812	0.60214	0.0755:0.0:0.9245:0.0	.	371;494;495	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	M	495;371;122	ENSP00000199389:L495M;ENSP00000445784:L371M	ENSP00000199389:L495M	L	-	1	2	EIF2AK1	6034819	1.000000	0.71417	0.930000	0.37139	0.985000	0.73830	3.202000	0.51067	2.473000	0.83533	0.550000	0.68814	CTG		0.398	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
HOXA2	3199	hgsc.bcm.edu	37	7	27140435	27140435	+	Silent	SNP	G	G	T	rs138070555		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:27140435G>T	ENST00000222718.5	-	2	1351	c.1041C>A	c.(1039-1041)tcC>tcA	p.S347S	HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000428939.3_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	347					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S347S(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						GACTGTCGAGGGAACCTGGCA	0.463																																					p.S347S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1041A	7						.						85.0	85.0	85.0					7																	27140435		2203	4300	6503	27106960	SO:0001819	synonymous_variant	3199	exon2				CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.1041C>A	7.37:g.27140435G>T		Somatic		Capture	SOLID	Phase_I	27106960	NM_006735	A1L4K3|B2RMW3	Silent	SNP	ENST00000222718.5	37	CCDS5403.1																																																																																				0.463	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2		
HOXA4	3201	hgsc.bcm.edu	37	7	27168963	27168963	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:27168963G>A	ENST00000360046.5	-	2	909	c.844C>T	c.(844-846)Cga>Tga	p.R282*	HOXA3_ENST00000317201.2_5'Flank|HOXA3_ENST00000521401.1_Intron|HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA-AS2_ENST00000521159.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA4_ENST00000428284.2_Nonsense_Mutation_p.R282*	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	282					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R282*(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						TTGGAGGATCGCATCTTGGTG	0.597																																					p.R282X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C844T	7						.						298.0	244.0	262.0					7																	27168963		2203	4300	6503	27135488	SO:0001587	stop_gained	3201	exon2				CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.844C>T	7.37:g.27168963G>A	ENSP00000353151:p.Arg282*	Somatic		Capture	SOLID	Phase_I	27135488	NM_002141	A4D180|O43366	Nonsense_Mutation	SNP	ENST00000360046.5	37	CCDS5405.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.472279|4.472279	0.84533|0.84533	.|.	.|.	ENSG00000197576|ENSG00000197576	ENST00000511914|ENST00000360046;ENST00000428284	.|.	.|.	.|.	5.29|5.29	4.39|4.39	0.52855|0.52855	.|.	.|0.000000	.|0.34750	.|N	.|0.003707	T|.	0.36331|.	0.0963|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34551|.	-0.9824|.	3|.	.|0.02654	.|T	.|1	.|.	15.0296|15.0296	0.71696|0.71696	0.0:0.0:0.8466:0.1534|0.0:0.0:0.8466:0.1534	.|.	.|.	.|.	.|.	V|X	101|282	.|.	.|ENSP00000353151:R282X	A|R	-|-	2|1	0|2	HOXA4|HOXA4	27135488|27135488	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.930000|0.930000	0.56654|0.56654	5.651000|5.651000	0.67951|0.67951	1.188000|1.188000	0.43014|0.43014	-0.410000|-0.410000	0.06199|0.06199	GCG|CGA		0.597	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4		
AQP1	358	hgsc.bcm.edu	37	7	30963159	30963159	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:30963159T>C	ENST00000311813.4	+	4	780	c.725T>C	c.(724-726)gTg>gCg	p.V242A	AQP1_ENST00000509504.1_Missense_Mutation_p.V419A|AQP1_ENST00000441328.2_Missense_Mutation_p.V159A|AQP1_ENST00000409611.1_Missense_Mutation_p.V191A|AQP1_ENST00000409899.1_Missense_Mutation_p.V127A|AQP1_ENST00000482461.1_3'UTR|AQP1_ENST00000434909.2_Missense_Mutation_p.V302A	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	242					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.V242A(1)		kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	ACAGACCGCGTGAAGGTGTGG	0.597																																					p.V159A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T476C	7						.						54.0	46.0	48.0					7																	30963159		2203	4300	6503	30929684	SO:0001583	missense	358	exon5			M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.725T>C	7.37:g.30963159T>C	ENSP00000311165:p.Val242Ala	Somatic		Capture	SOLID	Phase_I	30929684	NM_001185060	B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Missense_Mutation	SNP	ENST00000311813.4	37	CCDS5431.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.167045	0.38217	.	.	ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000250424	ENST00000434909;ENST00000265298;ENST00000311813;ENST00000413400;ENST00000441328;ENST00000409899;ENST00000409611;ENST00000509504	D;D;D;D;D;D	0.94330	-2.33;-2.03;-3.0;-3.4;-3.02;-2.33	5.07	5.07	0.68467	Aquaporin-like (1);	0.433554	0.27420	N	0.019450	D	0.86847	0.6031	L	0.40543	1.245	0.31299	N	0.688506	B;P;B;B	0.35363	0.257;0.497;0.005;0.006	B;B;B;B	0.27380	0.046;0.079;0.012;0.008	D	0.83454	0.0050	10	0.12766	T	0.61	3.2309	11.2296	0.48903	0.0:0.0:0.0:1.0	.	302;191;127;242	B4E220;E7EM69;E9PC21;P29972	.;.;.;AQP1_HUMAN	A	302;147;242;227;159;127;191;419	ENSP00000395059:V302A;ENSP00000311165:V242A;ENSP00000405698:V159A;ENSP00000386712:V127A;ENSP00000387178:V191A;ENSP00000421315:V419A	ENSP00000265298:V147A	V	+	2	0	RP5-877J2.1;AQP1	30929684	1.000000	0.71417	0.957000	0.39632	0.249000	0.25844	7.233000	0.78125	1.900000	0.55004	0.448000	0.29417	GTG		0.597	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215002.3	NM_000385	
FIGNL1	63979	hgsc.bcm.edu	37	7	50514561	50514561	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:50514561T>G	ENST00000419119.1	-	2	1978	c.425A>C	c.(424-426)gAg>gCg	p.E142A	FIGNL1_ENST00000395556.2_Missense_Mutation_p.E142A|FIGNL1_ENST00000356889.4_Missense_Mutation_p.E142A|FIGNL1_ENST00000433017.1_Missense_Mutation_p.E142A|FIGNL1_ENST00000435566.1_3'UTR			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	142					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)	p.E142A(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				GACAGTGGCCTCCTTATGGAT	0.423																																					p.E142A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A425C	7						.						111.0	109.0	110.0					7																	50514561		2203	4300	6503	50482055	SO:0001583	missense	63979	exon4			AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.425A>C	7.37:g.50514561T>G	ENSP00000410811:p.Glu142Ala	Somatic		Capture	SOLID	Phase_I	50482055	NM_001042762	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	ENST00000419119.1	37	CCDS5510.1	.	.	.	.	.	.	.	.	.	.	T	7.279	0.608668	0.14002	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.49	0.389	0.16269	.	0.496630	0.20700	N	0.087287	T	0.15176	0.0366	L	0.60455	1.87	0.22639	N	0.998906	B	0.09022	0.002	B	0.06405	0.002	T	0.35276	-0.9795	10	0.10902	T	0.67	-5.674	5.6931	0.17841	0.0:0.3874:0.1461:0.4666	.	142	Q6PIW4	FIGL1_HUMAN	A	142	ENSP00000349356:E142A;ENSP00000378924:E142A;ENSP00000399997:E142A;ENSP00000410811:E142A	ENSP00000349356:E142A	E	-	2	0	FIGNL1	50482055	0.003000	0.15002	0.019000	0.16419	0.879000	0.50718	0.038000	0.13862	0.108000	0.17862	0.460000	0.39030	GAG		0.423	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762	
COBL	23242	hgsc.bcm.edu	37	7	51094248	51094248	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:51094248T>A	ENST00000265136.7	-	11	3664	c.3499A>T	c.(3499-3501)Agg>Tgg	p.R1167W	COBL_ENST00000395542.2_Missense_Mutation_p.R1249W	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1167	WH2 2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.R1167W(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CTTACCTTCCTCAGGCTGCAG	0.642																																					p.R1167W	NSCLC(189;2119 2138 12223 30818 34679)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3499T	7						.						78.0	69.0	72.0					7																	51094248		2203	4300	6503	51061742	SO:0001583	missense	23242	exon11			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3499A>T	7.37:g.51094248T>A	ENSP00000265136:p.Arg1167Trp	Somatic		Capture	SOLID	Phase_I	51061742	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.266731	0.59540	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.0	1.25	0.21368	Actin-binding WH2 (3);	0.792533	0.10142	N	0.710778	T	0.59252	0.2180	L	0.27053	0.805	0.29825	N	0.830513	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.947;0.983;0.993;0.983;0.997	T	0.57711	-0.7764	10	0.72032	D	0.01	.	11.3126	0.49372	0.0:0.0:0.4179:0.5821	.	1167;1224;1167;1249;709	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	W	1167;1059;1052;1249	ENSP00000265136:R1167W;ENSP00000401204:R1059W;ENSP00000413498:R1052W;ENSP00000378912:R1249W	ENSP00000265136:R1167W	R	-	1	2	COBL	51061742	0.945000	0.32115	0.936000	0.37596	0.505000	0.33919	2.261000	0.43276	-0.037000	0.13646	0.460000	0.39030	AGG		0.642	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
COBL	23242	hgsc.bcm.edu	37	7	51096959	51096959	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:51096959G>A	ENST00000265136.7	-	10	1999	c.1834C>T	c.(1834-1836)Cgt>Tgt	p.R612C	COBL_ENST00000395542.2_Missense_Mutation_p.R694C	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	612					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.R612C(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					AAGGCCACACGGATTCCTTTT	0.527																																					p.R612C	NSCLC(189;2119 2138 12223 30818 34679)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1834T	7						.						86.0	81.0	83.0					7																	51096959		2203	4300	6503	51064453	SO:0001583	missense	23242	exon10			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.1834C>T	7.37:g.51096959G>A	ENSP00000265136:p.Arg612Cys	Somatic		Capture	SOLID	Phase_I	51064453	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.52|16.52	3.145719|3.145719	0.57044|0.57044	.|.	.|.	ENSG00000106078|ENSG00000106078	ENST00000452534|ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542;ENST00000457306	.|T;T;T;T	.|0.25250	.|1.81;1.81;1.81;1.81	5.7|5.7	0.657|0.657	0.17850|0.17850	.|.	.|1.867390	.|0.02939	.|N	.|0.140267	T|T	0.29783|0.29783	0.0744|0.0744	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	.|D;D;D;P;D	.|0.69078	.|0.997;0.997;0.997;0.924;0.994	.|P;P;B;B;P	.|0.50049	.|0.627;0.627;0.424;0.409;0.629	T|T	0.32107|0.32107	-0.9919|-0.9919	5|10	.|0.54805	.|T	.|0.06	.|.	8.8814|8.8814	0.35376|0.35376	0.0:0.0922:0.3544:0.5533|0.0:0.0922:0.3544:0.5533	.|.	.|612;669;612;694;154	.|O75128-3;O75128-7;O75128;O75128-2;O75128-6	.|.;.;COBL_HUMAN;.;.	L|C	587|612;504;497;694;110	.|ENSP00000265136:R612C;ENSP00000401204:R504C;ENSP00000413498:R497C;ENSP00000378912:R694C	.|ENSP00000265136:R612C	P|R	-|-	2|1	0|0	COBL|COBL	51064453|51064453	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.413000|0.413000	0.21148|0.21148	0.181000|0.181000	0.19994|0.19994	0.650000|0.650000	0.86243|0.86243	CCG|CGT		0.527	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
EGFR	1956	hgsc.bcm.edu	37	7	55259466	55259466	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:55259466A>C	ENST00000275493.2	+	21	2701	c.2524A>C	c.(2524-2526)Aac>Cac	p.N842H	EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Missense_Mutation_p.N797H|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Missense_Mutation_p.N789H	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.N842D(2)|p.N842H(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GGCAGCCAGGAACGTACTGGT	0.537		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.N842H		yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	EGFR,stomach,NS,Substitution - Missense,0	.	3	Substitution - Missense(3)	lung(1)|large_intestine(1)|stomach(1)	c.A2524C	7						.						120.0	105.0	110.0					7																	55259466		2203	4300	6503	55226960	SO:0001583	missense	1956	exon21	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2524A>C	7.37:g.55259466A>C	ENSP00000275493:p.Asn842His	Somatic		Capture	SOLID	Phase_I	55226960	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.886611	0.91814	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.86366	-2.11;-2.11;-2.11	5.82	5.82	0.92795	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95947	0.8680	H	0.97564	4.03	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.989;1.0	D	0.97355	0.9966	10	0.87932	D	0	.	15.0046	0.71501	1.0:0.0:0.0:0.0	.	797;842	Q504U8;P00533	.;EGFR_HUMAN	H	797;712;842;789	ENSP00000415559:N797H;ENSP00000275493:N842H;ENSP00000395243:N789H	ENSP00000275493:N842H	N	+	1	0	EGFR	55226960	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.184000	0.94893	2.221000	0.72209	0.528000	0.53228	AAC		0.537	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
ZNF713	349075	hgsc.bcm.edu	37	7	56007310	56007310	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:56007310A>G	ENST00000429591.2	+	4	942	c.904A>G	c.(904-906)Ata>Gta	p.I302V	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	302					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I302V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AAAGCCTTTTATATGCAATGG	0.403																																					p.I302V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A904G	7						.						85.0	90.0	88.0					7																	56007310		2203	4300	6503	55974804	SO:0001583	missense	349075	exon4			AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.904A>G	7.37:g.56007310A>G	ENSP00000416662:p.Ile302Val	Somatic		Capture	SOLID	Phase_I	55974804	NM_182633		Missense_Mutation	SNP	ENST00000429591.2	37	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	A	4.687	0.127793	0.08981	.	.	ENSG00000178665	ENST00000429591	T	0.35973	1.28	3.11	1.94	0.25998	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.380247	0.19620	N	0.109938	T	0.12475	0.0303	N	0.02368	-0.58	0.18873	N	0.999986	B	0.02656	0.0	B	0.04013	0.001	T	0.14062	-1.0486	10	0.56958	D	0.05	.	2.7161	0.05188	0.6497:0.0:0.1265:0.2238	.	302	Q8N859	ZN713_HUMAN	V	302	ENSP00000416662:I302V	ENSP00000416662:I302V	I	+	1	0	ZNF713	55974804	0.000000	0.05858	1.000000	0.80357	0.675000	0.39556	-0.774000	0.04684	0.579000	0.29504	0.383000	0.25322	ATA		0.403	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633	
LIMK1	3984	hgsc.bcm.edu	37	7	73522254	73522254	+	Silent	SNP	C	C	T	rs538666208	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:73522254C>T	ENST00000336180.2	+	9	1170	c.1119C>T	c.(1117-1119)ttC>ttT	p.F373F	LIMK1_ENST00000538333.3_Silent_p.F339F|LIMK1_ENST00000418310.1_Silent_p.F403F	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.F373F(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	TGATCCGGTTCGACGAGGAGA	0.582													C|||	2	0.000399361	0.0	0.0	5008	,	,		18749	0.0		0.0	False		,,,				2504	0.002				p.F373F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1119T	7						.						158.0	81.0	107.0					7																	73522254		2202	4296	6498	73160190	SO:0001819	synonymous_variant	3984	exon9			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1119C>T	7.37:g.73522254C>T		Somatic		Capture	SOLID	Phase_I	73160190	NM_002314	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Silent	SNP	ENST00000336180.2	37	CCDS5563.1																																																																																				0.582	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
CACNA2D1	781	hgsc.bcm.edu	37	7	81596912	81596912	+	Splice_Site	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:81596912C>T	ENST00000356253.5	-	30	2754	c.2499G>A	c.(2497-2499)ccG>ccA	p.P833P	CACNA2D1_ENST00000535308.1_Splice_Site_p.P33P|CACNA2D1_ENST00000356860.3_Splice_Site_p.P821P			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	833					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.P821P(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AATATCTTACCGGATCTCTGA	0.254																																					p.P821P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2463A	7						.						12.0	12.0	12.0					7																	81596912		2115	4162	6277	81434848	SO:0001630	splice_region_variant	781	exon30			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2499+1G>A	7.37:g.81596912C>T		Somatic		Capture	SOLID	Phase_I	81434848	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Silent	SNP	ENST00000356253.5	37																																																																																					0.254	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			Silent
C7orf62	219557	hgsc.bcm.edu	37	7	88423925	88423925	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:88423925A>G	ENST00000297203.2	-	2	517	c.332T>C	c.(331-333)cTt>cCt	p.L111P	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	111								p.L111P(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						ATAATCTAAAAGAACTTTGTA	0.368																																					p.L111P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T332C	7						.						56.0	57.0	56.0					7																	88423925		2203	4300	6503	88261861	SO:0001583	missense	219557	exon2			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.332T>C	7.37:g.88423925A>G	ENSP00000297203:p.Leu111Pro	Somatic		Capture	SOLID	Phase_I	88261861	NM_152706		Missense_Mutation	SNP	ENST00000297203.2	37	CCDS34678.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.979984	0.34942	.	.	ENSG00000164645	ENST00000297203	T	0.30448	1.53	6.06	6.06	0.98353	.	0.068796	0.64402	D	0.000016	T	0.54663	0.1872	M	0.74881	2.28	0.54753	D	0.999988	D	0.89917	1.0	D	0.71870	0.975	T	0.58763	-0.7579	10	0.87932	D	0	-2.54	13.0163	0.58759	1.0:0.0:0.0:0.0	.	111	Q8TBZ9	CG062_HUMAN	P	111	ENSP00000297203:L111P	ENSP00000297203:L111P	L	-	2	0	C7orf62	88261861	0.995000	0.38212	0.161000	0.22692	0.002000	0.02628	4.470000	0.60175	2.323000	0.78572	0.528000	0.53228	CTT		0.368	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706	
PTCD1	26024	hgsc.bcm.edu	37	7	99017737	99017737	+	Silent	SNP	G	G	A	rs114658645	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:99017737G>A	ENST00000292478.4	-	8	2206	c.1956C>T	c.(1954-1956)gaC>gaT	p.D652D	PTCD1_ENST00000555673.1_Silent_p.D701D|ATP5J2-PTCD1_ENST00000413834.1_Silent_p.D701D	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	652					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.D652D(1)		endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CTCGGAAGCCGTCAATCTTCT	0.547													G|||	166	0.033147	0.0098	0.0432	5008	,	,		18400	0.0486		0.0308	False		,,,				2504	0.044				p.D652D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1956T	7						.	G	,	54,4352	53.6+/-89.4	1,52,2150	109.0	117.0	114.0		2103,1956	-1.3	1.0	7	dbSNP_132	114	338,8262	116.6+/-176.3	10,318,3972	no	coding-synonymous,coding-synonymous	PTCD1,ATP5J2-PTCD1	NM_001198879.1,NM_015545.3	,	11,370,6122	AA,AG,GG		3.9302,1.2256,3.014	,	701/750,652/701	99017737	392,12614	2203	4300	6503	98855673	SO:0001819	synonymous_variant	26024	exon8			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1956C>T	7.37:g.99017737G>A		Somatic		Capture	SOLID	Phase_I	98855673	NM_015545	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	37	CCDS34691.1																																																																																				0.547	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
ZKSCAN1	7586	hgsc.bcm.edu	37	7	99631749	99631750	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:99631749_99631750delAG	ENST00000324306.6	+	6	1855_1856	c.1621_1622delAG	c.(1621-1623)agafs	p.R541fs	ZKSCAN1_ENST00000535170.1_Frame_Shift_Del_p.R328fs|ZKSCAN1_ENST00000426572.1_Frame_Shift_Del_p.R505fs	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	541					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R543fs*3(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			AATCCATGCCAGAGAGAGAGCC	0.52																																					p.541_541del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1621_1622del	7						.																																			99469686	SO:0001589	frameshift_variant	7586	exon6			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1621_1622delAG	7.37:g.99631757_99631758delAG	ENSP00000323148:p.Arg541fs	Somatic		Capture	SOLID	Phase_I	99469685	NM_003439	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Frame_Shift_Del	DEL	ENST00000324306.6	37	CCDS34698.1																																																																																				0.520	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439	
TAF6	6878	hgsc.bcm.edu	37	7	99709351	99709351	+	Splice_Site	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:99709351G>A	ENST00000344095.4	-	9	1425	c.900C>T	c.(898-900)taC>taT	p.Y300Y	TAF6_ENST00000453269.2_Splice_Site_p.Y300Y|TAF6_ENST00000437822.2_Splice_Site_p.Y337Y|TAF6_ENST00000452041.1_Splice_Site_p.Y300Y|TAF6_ENST00000418432.2_Splice_Site_p.Y224Y|TAF6_ENST00000472509.1_Splice_Site_p.Y357Y|TAF6_ENST00000497233.1_5'Flank	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	300					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y300Y(2)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GATCACTCACGTATTTTTCTA	0.542																																					p.Y300Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.C900T	7						.						114.0	97.0	103.0					7																	99709351		2203	4300	6503	99547287	SO:0001630	splice_region_variant	6878	exon9				CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.900+1C>T	7.37:g.99709351G>A		Somatic		Capture	SOLID	Phase_I	99547287	NM_005641	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	37	CCDS5686.1																																																																																				0.542	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	Silent
AGFG2	3268	hgsc.bcm.edu	37	7	100153284	100153284	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:100153284G>A	ENST00000300176.4	+	6	925	c.803G>A	c.(802-804)gGc>gAc	p.G268D	AGFG2_ENST00000262935.4_3'UTR|AGFG2_ENST00000474713.1_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	268					regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.G268D(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTTAGCAGTGGCCCCAGCTCT	0.532																																					p.G268D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G803A	7						.						144.0	134.0	137.0					7																	100153284		2203	4300	6503	99991220	SO:0001583	missense	3268	exon6			AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.803G>A	7.37:g.100153284G>A	ENSP00000300176:p.Gly268Asp	Somatic		Capture	SOLID	Phase_I	99991220	NM_006076	O75429|Q96AB9|Q96GL4	Missense_Mutation	SNP	ENST00000300176.4	37	CCDS5697.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.017121	0.54576	.	.	ENSG00000106351	ENST00000300176	T	0.22539	1.95	5.49	4.56	0.56223	.	0.343153	0.35235	N	0.003353	T	0.09905	0.0243	N	0.08118	0	0.80722	D	1	B	0.27229	0.172	B	0.22386	0.039	T	0.23940	-1.0174	10	0.17832	T	0.49	-35.1635	11.487	0.50358	0.0:0.1811:0.8188:0.0	.	268	O95081	AGFG2_HUMAN	D	268	ENSP00000300176:G268D	ENSP00000300176:G268D	G	+	2	0	AGFG2	99991220	0.996000	0.38824	1.000000	0.80357	0.923000	0.55619	1.860000	0.39428	2.594000	0.87642	0.585000	0.79938	GGC		0.532	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342769.1	NM_006076	
NOS3	4846	hgsc.bcm.edu	37	7	150709475	150709475	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr7:150709475G>A	ENST00000297494.3	+	24	3378	c.3021G>A	c.(3019-3021)ttG>ttA	p.L1007L	ATG9B_ENST00000377974.2_3'UTR|ATG9B_ENST00000444312.1_3'UTR|ATG9B_ENST00000494791.1_5'UTR|NOS3_ENST00000477227.1_3'UTR|ATG9B_ENST00000605938.1_3'UTR|NOS3_ENST00000461406.1_Silent_p.L801L	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.L1007L(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATCCCAGCTTGCCCTGCATCC	0.622																																					p.L1007L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3021A	7						.						33.0	26.0	29.0					7																	150709475		2201	4298	6499	150340408	SO:0001819	synonymous_variant	4846	exon24				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.3021G>A	7.37:g.150709475G>A		Somatic		Capture	SOLID	Phase_I	150340408	NM_000603	Q495E5	Silent	SNP	ENST00000297494.3	37	CCDS5912.1																																																																																				0.622	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603	
DEFB128	245939	hgsc.bcm.edu	37	20	170261	170261	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:170261T>G	ENST00000334391.4	-	1	61	c.4A>C	c.(4-6)Aag>Cag	p.K2Q		NM_001037732.1	NP_001032821.1	Q7Z7B8	DB128_HUMAN	defensin, beta 128	2					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.K2Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		all_cancers(10;0.00499)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			AGAAACAGCTTCATATTTACA	0.393																																					p.K2Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4C	20						.						133.0	136.0	135.0					20																	170261		2203	4300	6503	118261	SO:0001583	missense	245939	exon1			AF525930	CCDS33430.1	20p13	2011-03-29			ENSG00000185982	ENSG00000185982		"""Defensins, beta"""	18106	protein-coding gene	gene with protein product	"""defensin, beta 28"""					11854508, 16033865	Standard	NM_001037732		Approved	DEFB-28	uc002wcz.1	Q7Z7B8	OTTHUMG00000043057	ENST00000334391.4:c.4A>C	20.37:g.170261T>G	ENSP00000335382:p.Lys2Gln	Somatic		Capture	SOLID	Phase_I	118261	NM_001037732	B2RU29	Missense_Mutation	SNP	ENST00000334391.4	37	CCDS33430.1	.	.	.	.	.	.	.	.	.	.	t	12.85	2.062273	0.36373	.	.	ENSG00000185982	ENST00000334391	T	0.20881	2.04	4.4	4.4	0.53042	.	0.000000	0.47093	D	0.000246	T	0.40094	0.1103	.	.	.	0.25401	N	0.988443	D	0.89917	1.0	D	0.87578	0.998	T	0.11036	-1.0604	9	0.46703	T	0.11	-27.7017	10.327	0.43798	0.0:0.0:0.0:1.0	.	2	Q7Z7B8	DB128_HUMAN	Q	2	ENSP00000335382:K2Q	ENSP00000335382:K2Q	K	-	1	0	DEFB128	118261	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.875000	0.48491	2.207000	0.71202	0.468000	0.43344	AAG		0.393	DEFB128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101361.2	NM_001037732	
C20orf96	140680	hgsc.bcm.edu	37	20	270299	270299	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:270299G>A	ENST00000360321.2	-	3	226	c.88C>T	c.(88-90)Cag>Tag	p.Q30*	C20orf96_ENST00000400269.3_Intron|C20orf96_ENST00000382369.5_Intron	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	30								p.Q30*(1)		endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TGCTTGGACTGCTGCCATGGA	0.453																																					p.Q30X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C88T	20						.						157.0	130.0	139.0					20																	270299		2203	4300	6503	218299	SO:0001587	stop_gained	140680	exon3			AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.88C>T	20.37:g.270299G>A	ENSP00000353470:p.Gln30*	Somatic		Capture	SOLID	Phase_I	218299	NM_153269	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Nonsense_Mutation	SNP	ENST00000360321.2	37	CCDS12994.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741235	0.69304	.	.	ENSG00000196476	ENST00000360321	.	.	.	3.74	-1.28	0.09318	.	0.988340	0.08218	N	0.979598	.	.	.	.	.	.	0.46416	D	0.999036	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-10.1616	0.6467	0.00819	0.2348:0.2009:0.3772:0.1871	.	.	.	.	X	30	.	ENSP00000353470:Q30X	Q	-	1	0	C20orf96	218299	0.859000	0.29813	0.664000	0.29753	0.324000	0.28378	0.515000	0.22801	-0.190000	0.10465	-0.391000	0.06502	CAG		0.453	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077439.2	NM_153269	
KIF16B	55614	hgsc.bcm.edu	37	20	16496283	16496283	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:16496283G>A	ENST00000354981.2	-	4	415	c.258C>T	c.(256-258)gtC>gtT	p.V86V	KIF16B_ENST00000408042.1_Silent_p.V86V|KIF16B_ENST00000378003.2_5'UTR|KIF16B_ENST00000355755.3_Silent_p.V86V	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	86	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)	p.V86V(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						CAGACTTCACGACATCTGTGC	0.373																																					p.V86V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C258T	20						.						101.0	92.0	95.0					20																	16496283		2203	4300	6503	16444283	SO:0001819	synonymous_variant	55614	exon4			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.258C>T	20.37:g.16496283G>A		Somatic		Capture	SOLID	Phase_I	16444283	NM_024704	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																				0.373	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
CPXM1	56265	hgsc.bcm.edu	37	20	2775070	2775070	+	Silent	SNP	G	G	A	rs550041299		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:2775070G>A	ENST00000380605.2	-	14	2035	c.1971C>T	c.(1969-1971)ggC>ggT	p.G657G		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	657					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.G657G(1)		endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						AATAATCCCCGCCCCACGCTG	0.597													g|||	1	0.000199681	0.0	0.0014	5008	,	,		18354	0.0		0.0	False		,,,				2504	0.0				p.G583G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1749T	20						.						53.0	52.0	53.0					20																	2775070		2203	4300	6503	2723070	SO:0001819	synonymous_variant	56265	exon14			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1971C>T	20.37:g.2775070G>A		Somatic		Capture	SOLID	Phase_I	2723070	NM_001184699	Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	ENST00000380605.2	37	CCDS13033.1																																																																																				0.597	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
ENTPD6	955	hgsc.bcm.edu	37	20	25206149	25206149	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:25206149T>C	ENST00000376652.4	+	15	1534	c.1371T>C	c.(1369-1371)atT>atC	p.I457I	ENTPD6_ENST00000354989.5_Silent_p.I440I|ENTPD6_ENST00000485936.1_3'UTR|ENTPD6_ENST00000433259.2_Nonstop_Mutation_p.*438R|ENTPD6_ENST00000360031.2_Silent_p.I456I			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	457					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)	p.I457I(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						CTCGGAAAATTGACAATGTTG	0.537																																					p.I440I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1320C	20						.						156.0	156.0	156.0					20																	25206149		2203	4300	6503	25154149	SO:0001819	synonymous_variant	955	exon14			AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.1371T>C	20.37:g.25206149T>C		Somatic		Capture	SOLID	Phase_I	25154149	NM_001114089	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Silent	SNP	ENST00000376652.4	37	CCDS13170.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.494|6.494	0.459301|0.459301	0.12342|0.12342	.|.	.|.	ENSG00000197586|ENSG00000197586	ENST00000376666|ENST00000376641;ENST00000433259	.|.	.|.	.|.	5.77|5.77	-5.79|-5.79	0.02354|0.02354	.|.	.|.	.|.	.|.	.|.	T|.	0.28699|.	0.0711|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35624|.	-0.9781|.	4|.	.|.	.|.	.|.	-22.3245|-22.3245	9.1668|9.1668	0.37056|0.37056	0.0:0.4931:0.1095:0.3975|0.0:0.4931:0.1095:0.3975	.|.	.|.	.|.	.|.	S|R	295|368;438	.|.	.|.	L|X	+|+	2|1	0|0	ENTPD6|ENTPD6	25154149|25154149	0.774000|0.774000	0.28592|0.28592	0.000000|0.000000	0.03702|0.03702	0.912000|0.912000	0.54170|0.54170	-0.265000|-0.265000	0.08644|0.08644	-1.149000|-1.149000	0.02843|0.02843	-0.609000|-0.609000	0.04063|0.04063	TTG|TGA		0.537	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078414.2		
PXMP4	11264	hgsc.bcm.edu	37	20	32298470	32298470	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:32298470C>T	ENST00000409299.3	-	3	358	c.266G>A	c.(265-267)cGt>cAt	p.R89H	PXMP4_ENST00000217398.3_Missense_Mutation_p.V96M|PXMP4_ENST00000344022.3_Intron	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	89						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)		p.R89H(1)		NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						CTGCAGGGCACGGAGACCCTT	0.547																																					p.R89H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G266A	20						.						141.0	119.0	127.0					20																	32298470		2203	4300	6503	31762131	SO:0001583	missense	11264	exon3			AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.266G>A	20.37:g.32298470C>T	ENSP00000386385:p.Arg89His	Somatic		Capture	SOLID	Phase_I	31762131	NM_007238	A2A2I7|Q9H0T4	Missense_Mutation	SNP	ENST00000409299.3	37	CCDS13225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.08|10.08	1.251313|1.251313	0.22880|0.22880	.|.	.|.	ENSG00000101417|ENSG00000101417	ENST00000409299|ENST00000217398	T|.	0.31247|.	1.5|.	5.22|5.22	4.27|4.27	0.50696|0.50696	.|.	0.760688|.	0.12927|.	N|.	0.427645|.	T|T	0.12347|0.12347	0.0300|0.0300	N|N	0.11255|0.11255	0.115|0.115	0.09310|0.09310	N|N	1|1	B|P	0.06786|0.38280	0.001|0.625	B|B	0.08055|0.24541	0.003|0.054	T|T	0.08617|0.08617	-1.0713|-1.0713	10|8	0.16896|0.31617	T|T	0.51|0.26	-5.0884|-5.0884	6.5227|6.5227	0.22285|0.22285	0.3037:0.6047:0.0:0.0916|0.3037:0.6047:0.0:0.0916	.|.	89|96	Q9Y6I8|B4DWH1	PXMP4_HUMAN|.	H|M	89|96	ENSP00000386385:R89H|.	ENSP00000386385:R89H|ENSP00000217398:V96M	R|V	-|-	2|1	0|0	PXMP4|PXMP4	31762131|31762131	0.977000|0.977000	0.34250|0.34250	0.142000|0.142000	0.22268|0.22268	0.985000|0.985000	0.73830|0.73830	2.499000|2.499000	0.45372|0.45372	1.176000|1.176000	0.42840|0.42840	0.655000|0.655000	0.94253|0.94253	CGT|GTG		0.547	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078739.2	NM_007238	
PXMP4	11264	hgsc.bcm.edu	37	20	32298480	32298480	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:32298480T>C	ENST00000409299.3	-	3	348	c.256A>G	c.(256-258)Aag>Gag	p.K86E	PXMP4_ENST00000217398.3_Silent_p.T92T|PXMP4_ENST00000344022.3_Intron	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	86						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)		p.K86E(1)		NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						CGGAGACCCTTGTAGGTGAAC	0.572																																					p.K86E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A256G	20						.						131.0	109.0	117.0					20																	32298480		2203	4300	6503	31762141	SO:0001583	missense	11264	exon3			AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.256A>G	20.37:g.32298480T>C	ENSP00000386385:p.Lys86Glu	Somatic		Capture	SOLID	Phase_I	31762141	NM_007238	A2A2I7|Q9H0T4	Missense_Mutation	SNP	ENST00000409299.3	37	CCDS13225.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661590	0.88154	.	.	ENSG00000101417	ENST00000409299	T	0.32023	1.47	5.22	4.11	0.48088	.	0.093038	0.64402	D	0.000001	T	0.63757	0.2538	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.70952	-0.4732	10	0.87932	D	0	-23.2256	10.7244	0.46059	0.0:0.0762:0.0:0.9238	.	86	Q9Y6I8	PXMP4_HUMAN	E	86	ENSP00000386385:K86E	ENSP00000386385:K86E	K	-	1	0	PXMP4	31762141	1.000000	0.71417	0.979000	0.43373	0.979000	0.70002	8.007000	0.88571	0.824000	0.34613	-0.290000	0.09829	AAG		0.572	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078739.2	NM_007238	
ATRN	8455	hgsc.bcm.edu	37	20	3575196	3575196	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:3575196C>T	ENST00000262919.5	+	20	3461	c.3393C>T	c.(3391-3393)ggC>ggT	p.G1131G	ATRN_ENST00000446916.2_Silent_p.G1131G	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	1131	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.G1131G(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						CCACCAAGGGCGTCAAGGGGG	0.592																																					p.G1131G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3393T	20						.						89.0	73.0	78.0					20																	3575196		2203	4300	6503	3523196	SO:0001819	synonymous_variant	8455	exon20			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.3393C>T	20.37:g.3575196C>T		Somatic		Capture	SOLID	Phase_I	3523196	NM_139322	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Silent	SNP	ENST00000262919.5	37	CCDS13053.1																																																																																				0.592	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
TRPC4AP	26133	hgsc.bcm.edu	37	20	33593572	33593572	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:33593572A>G	ENST00000252015.2	-	16	1951	c.1862T>C	c.(1861-1863)cTg>cCg	p.L621P	TRPC4AP_ENST00000539834.1_Missense_Mutation_p.L223P|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.L613P|TRPC4AP_ENST00000432634.2_Missense_Mutation_p.L582P			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	621					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)	p.L621P(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GGAGTCCACCAGGGAGCTGTT	0.557																																					p.L613P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1838C	20						.						106.0	94.0	98.0					20																	33593572		2203	4300	6503	33057233	SO:0001583	missense	26133	exon16			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1862T>C	20.37:g.33593572A>G	ENSP00000252015:p.Leu621Pro	Somatic		Capture	SOLID	Phase_I	33057233	NM_199368	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640625	0.87859	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000001	T	0.69015	0.3064	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.79784	0.985;0.993;0.993	T	0.73232	-0.4048	10	0.87932	D	0	.	15.7981	0.78428	1.0:0.0:0.0:0.0	.	582;613;621	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	P	621;613;223;582;606	ENSP00000252015:L621P;ENSP00000400614:L613P;ENSP00000446090:L223P;ENSP00000400497:L582P	ENSP00000252015:L621P	L	-	2	0	TRPC4AP	33057233	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	9.311000	0.96282	2.126000	0.65437	0.533000	0.62120	CTG		0.557	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
KIAA1755	85449	hgsc.bcm.edu	37	20	36870261	36870261	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:36870261T>C	ENST00000279024.4	-	3	543	c.272A>G	c.(271-273)cAc>cGc	p.H91R		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	91								p.H91R(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GGGTGCCAAGTGGACCACAAC	0.557																																					p.H91R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A272G	20						.						68.0	66.0	66.0					20																	36870261		2203	4300	6503	36303675	SO:0001583	missense	85449	exon3			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.272A>G	20.37:g.36870261T>C	ENSP00000279024:p.His91Arg	Somatic		Capture	SOLID	Phase_I	36303675	NM_001029864	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	T	17.07	3.294511	0.60086	.	.	ENSG00000149633	ENST00000279024	T	0.11169	2.8	5.59	5.59	0.84812	.	0.115631	0.39407	N	0.001373	T	0.29491	0.0735	M	0.71581	2.175	0.46725	D	0.999177	D	0.76494	0.999	P	0.60789	0.879	T	0.01692	-1.1294	10	0.66056	D	0.02	.	14.9525	0.71086	0.0:0.0:0.0:1.0	.	91	Q5JYT7	K1755_HUMAN	R	91	ENSP00000279024:H91R	ENSP00000279024:H91R	H	-	2	0	KIAA1755	36303675	1.000000	0.71417	1.000000	0.80357	0.186000	0.23388	8.040000	0.89188	2.127000	0.65507	0.459000	0.35465	CAC		0.557	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
DHX35	60625	hgsc.bcm.edu	37	20	37612377	37612377	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:37612377A>T	ENST00000252011.3	+	4	336	c.303A>T	c.(301-303)agA>agT	p.R101S	DHX35_ENST00000373323.4_Missense_Mutation_p.R70S|DHX35_ENST00000373325.2_Missense_Mutation_p.R101S	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	101	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.R101S(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				CTGAAGGAAGAGTGGTAGGAG	0.433																																					p.R70S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A210T	20						.						143.0	142.0	143.0					20																	37612377		2203	4300	6503	37045791	SO:0001583	missense	60625	exon3			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.303A>T	20.37:g.37612377A>T	ENSP00000252011:p.Arg101Ser	Somatic		Capture	SOLID	Phase_I	37045791	NM_001190809	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	37	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	A	13.92	2.379891	0.42207	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000441485	T;T;T;T	0.10005	3.19;3.19;4.09;2.92	5.5	4.41	0.53225	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.145914	0.64402	D	0.000010	T	0.10035	0.0246	L	0.35487	1.065	0.50467	D	0.999876	P;P	0.40144	0.692;0.704	B;B	0.39840	0.311;0.113	T	0.07558	-1.0766	10	0.62326	D	0.03	.	10.4799	0.44687	0.922:0.0:0.0779:0.0	.	70;101	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	S	101;101;70;66	ENSP00000362422:R101S;ENSP00000252011:R101S;ENSP00000362420:R70S;ENSP00000414630:R66S	ENSP00000252011:R101S	R	+	3	2	DHX35	37045791	1.000000	0.71417	0.998000	0.56505	0.298000	0.27526	1.671000	0.37513	1.030000	0.39839	0.528000	0.53228	AGA		0.433	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
TTPAL	79183	hgsc.bcm.edu	37	20	43108902	43108902	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:43108902G>A	ENST00000372904.3	+	3	406	c.263G>A	c.(262-264)cGc>cAc	p.R88H	TTPAL_ENST00000262605.4_Missense_Mutation_p.R88H|TTPAL_ENST00000372906.2_Missense_Mutation_p.R88H	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	88						intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)	p.R88H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						CTCCGAGCCCGCAAGTTTGAT	0.567																																					p.R88H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G263A	20						.						72.0	50.0	57.0					20																	43108902		2203	4300	6503	42542316	SO:0001583	missense	79183	exon2			BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.263G>A	20.37:g.43108902G>A	ENSP00000361995:p.Arg88His	Somatic		Capture	SOLID	Phase_I	42542316	NM_001039199	E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Missense_Mutation	SNP	ENST00000372904.3	37	CCDS13332.2	.	.	.	.	.	.	.	.	.	.	G	35	5.485036	0.96323	.	.	ENSG00000124120	ENST00000262605;ENST00000372904;ENST00000372906;ENST00000456317	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	5.37	5.37	0.77165	Phosphatidylinositol transfer protein-like, N-terminal (1);Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97401	0.9996	10	0.46703	T	0.11	-22.4988	19.1187	0.93353	0.0:0.0:1.0:0.0	.	88	Q9BTX7	TTPAL_HUMAN	H	88	ENSP00000262605:R88H;ENSP00000361995:R88H;ENSP00000361997:R88H;ENSP00000412720:R88H	ENSP00000262605:R88H	R	+	2	0	TTPAL	42542316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.845000	0.99498	2.496000	0.84212	0.655000	0.94253	CGC		0.567	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106886.2	NM_024331	
ZSWIM3	140831	hgsc.bcm.edu	37	20	44506389	44506389	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:44506389G>A	ENST00000255152.2	+	2	1401	c.1192G>A	c.(1192-1194)Gtc>Atc	p.V398I	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.V392I	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	398							zinc ion binding (GO:0008270)	p.V398I(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				CCTAGACATTGTCACCAGCAA	0.507																																					p.V398I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1192A	20						.						93.0	72.0	79.0					20																	44506389		2203	4300	6503	43939796	SO:0001583	missense	140831	exon2			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1192G>A	20.37:g.44506389G>A	ENSP00000255152:p.Val398Ile	Somatic		Capture	SOLID	Phase_I	43939796	NM_080752	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867172	0.32977	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.26660	1.76;1.72	5.41	4.46	0.54185	.	0.181773	0.38605	N	0.001635	T	0.15046	0.0363	N	0.20986	0.625	0.31249	N	0.694228	B;B	0.16603	0.018;0.018	B;B	0.15052	0.012;0.012	T	0.15350	-1.0440	10	0.15499	T	0.54	-23.9242	9.1948	0.37222	0.2028:0.0:0.7972:0.0	.	392;398	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	I	398;392	ENSP00000255152:V398I;ENSP00000406313:V392I	ENSP00000255152:V398I	V	+	1	0	ZSWIM3	43939796	0.972000	0.33761	0.893000	0.35052	0.997000	0.91878	1.706000	0.37878	1.526000	0.49068	0.655000	0.94253	GTC		0.507	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
SPATA25	128497	hgsc.bcm.edu	37	20	44515364	44515364	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:44515364A>T	ENST00000372519.3	-	2	520	c.476T>A	c.(475-477)aTg>aAg	p.M159K		NM_080608.3	NP_542175.1	Q9BR10	SPT25_HUMAN	spermatogenesis associated 25	159					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.M159K(1)									AGCGATCATCATGGCGAGGGT	0.622																																					p.M159K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T476A	20						.						72.0	71.0	71.0					20																	44515364		2203	4300	6503	43948771	SO:0001583	missense	128497	exon2			AL008726	CCDS13383.1	20q13.12	2011-11-24	2011-11-24	2011-11-24	ENSG00000149634	ENSG00000149634			16158	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 165"""	C20orf165		19240080	Standard	NM_080608		Approved	dJ337O18.8, TSG23	uc002xqf.3	Q9BR10	OTTHUMG00000032628	ENST00000372519.3:c.476T>A	20.37:g.44515364A>T	ENSP00000361597:p.Met159Lys	Somatic		Capture	SOLID	Phase_I	43948771	NM_080608		Missense_Mutation	SNP	ENST00000372519.3	37	CCDS13383.1	.	.	.	.	.	.	.	.	.	.	A	19.85	3.903966	0.72754	.	.	ENSG00000149634	ENST00000372519	T	0.52526	0.66	5.53	5.53	0.82687	.	0.086236	0.51477	D	0.000100	T	0.50548	0.1622	L	0.34521	1.04	0.46499	D	0.999076	D	0.64830	0.994	P	0.54924	0.764	T	0.54077	-0.8347	10	0.87932	D	0	-14.5619	13.2823	0.60222	1.0:0.0:0.0:0.0	.	159	Q9BR10	CT165_HUMAN	K	159	ENSP00000361597:M159K	ENSP00000361597:M159K	M	-	2	0	C20orf165	43948771	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.844000	0.62846	2.324000	0.78689	0.533000	0.62120	ATG		0.622	SPATA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079541.1		
MMP9	4318	hgsc.bcm.edu	37	20	44639628	44639628	+	Silent	SNP	C	C	T	rs564979879		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:44639628C>T	ENST00000372330.3	+	4	607	c.588C>T	c.(586-588)ccC>ccT	p.P196P	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	196					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P196P(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	CTCCTGGCCCCGGCATTCAGG	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18210	0.0		0.0	False		,,,				2504	0.001				p.P196P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C588T	20						.						86.0	80.0	82.0					20																	44639628		2203	4300	6503	44073035	SO:0001819	synonymous_variant	4318	exon4				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.588C>T	20.37:g.44639628C>T		Somatic		Capture	SOLID	Phase_I	44073035	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Silent	SNP	ENST00000372330.3	37	CCDS13390.1																																																																																				0.607	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
SLC12A5	57468	hgsc.bcm.edu	37	20	44680391	44680391	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:44680391C>T	ENST00000454036.2	+	18	2377	c.2328C>T	c.(2326-2328)ggC>ggT	p.G776G	SLC12A5_ENST00000243964.3_Silent_p.G753G	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	776					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.G753G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TGCGTGATGGCGTGTCCCATC	0.602																																					p.G753G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2259T	20						.						112.0	102.0	106.0					20																	44680391		2203	4300	6503	44113798	SO:0001819	synonymous_variant	57468	exon18			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2328C>T	20.37:g.44680391C>T		Somatic		Capture	SOLID	Phase_I	44113798	NM_020708	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	37	CCDS46610.1																																																																																				0.602	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
ZNF334	55713	hgsc.bcm.edu	37	20	45130075	45130075	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:45130075T>C	ENST00000347606.4	-	5	2085	c.1903A>G	c.(1903-1905)Aaa>Gaa	p.K635E	ZNF334_ENST00000457685.2_Missense_Mutation_p.K597E|ZNF334_ENST00000593880.1_Missense_Mutation_p.K658E	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	635					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K635E(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CGGTAGGTTTTCCCACATTGA	0.403																																					p.K635E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1903G	20						.						141.0	135.0	137.0					20																	45130075		2203	4300	6503	44563482	SO:0001583	missense	55713	exon5			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1903A>G	20.37:g.45130075T>C	ENSP00000255129:p.Lys635Glu	Somatic		Capture	SOLID	Phase_I	44563482	NM_018102	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	37	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	T	10.13	1.265054	0.23136	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.27104	1.69;1.69	3.45	2.34	0.29019	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33089	0.0851	M	0.85859	2.78	0.09310	N	1	B;B;B	0.21147	0.02;0.052;0.02	B;B;B	0.25506	0.026;0.061;0.026	T	0.37079	-0.9721	9	0.87932	D	0	.	6.8967	0.24260	0.0:0.1165:0.0:0.8835	.	597;635;658	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	E	597;635	ENSP00000402582:K597E;ENSP00000255129:K635E	ENSP00000255129:K635E	K	-	1	0	ZNF334	44563482	0.988000	0.35896	0.081000	0.20488	0.607000	0.37147	3.103000	0.50298	0.515000	0.28320	0.482000	0.46254	AAA		0.403	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
SLC23A2	9962	hgsc.bcm.edu	37	20	4842674	4842674	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:4842674C>T	ENST00000379333.1	-	15	1936	c.1544G>A	c.(1543-1545)cGg>cAg	p.R515Q	SLC23A2_ENST00000424750.2_Missense_Mutation_p.R401Q|SLC23A2_ENST00000338244.1_Missense_Mutation_p.R515Q	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	515					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.R515Q(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						AAAGAGGTTCCGGGAAGAATT	0.468																																					p.R515Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1544A	20						.						90.0	93.0	92.0					20																	4842674		2203	4300	6503	4790674	SO:0001583	missense	9962	exon15			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1544G>A	20.37:g.4842674C>T	ENSP00000368637:p.Arg515Gln	Somatic		Capture	SOLID	Phase_I	4790674	NM_203327	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	37	CCDS13085.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682381	0.88542	.	.	ENSG00000089057	ENST00000379333;ENST00000338244;ENST00000424750	T;T;T	0.22539	1.95;1.95;1.95	5.35	3.3	0.37823	.	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	M	0.91768	3.24	0.54753	D	0.99998	P;D	0.76494	0.706;0.999	B;D	0.65573	0.321;0.936	T	0.58132	-0.7690	10	0.87932	D	0	-19.614	11.0119	0.47667	0.146:0.7135:0.1406:0.0	.	401;515	B4DJZ1;Q9UGH3	.;S23A2_HUMAN	Q	515;515;401	ENSP00000368637:R515Q;ENSP00000344322:R515Q;ENSP00000406601:R401Q	ENSP00000344322:R515Q	R	-	2	0	SLC23A2	4790674	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.487000	0.81328	0.663000	0.31027	0.462000	0.41574	CGG		0.468	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
SULF2	55959	hgsc.bcm.edu	37	20	46365516	46365516	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:46365516G>A	ENST00000359930.4	-	3	1197	c.346C>T	c.(346-348)Ccc>Tcc	p.P116S	SULF2_ENST00000478766.1_5'UTR|SULF2_ENST00000361612.4_Missense_Mutation_p.P116S|SULF2_ENST00000484875.1_Missense_Mutation_p.P116S|SULF2_ENST00000467815.1_Missense_Mutation_p.P116S	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	116					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.P116S(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TGCCAGGAGGGCGAGGAGCAG	0.612																																					p.P116S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C346T	20						.						230.0	164.0	186.0					20																	46365516		2203	4300	6503	45798923	SO:0001583	missense	55959	exon3			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.346C>T	20.37:g.46365516G>A	ENSP00000353007:p.Pro116Ser	Somatic		Capture	SOLID	Phase_I	45798923	NM_198596	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033252	0.93575	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815;ENST00000437955	D;D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92;-3.38	5.34	5.34	0.76211	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.221758	0.47093	D	0.000241	D	0.97278	0.9110	M	0.70108	2.13	0.80722	D	1	P;D;D	0.76494	0.911;0.999;0.999	P;P;D	0.65140	0.466;0.888;0.932	D	0.97599	1.0122	10	0.62326	D	0.03	-17.0079	19.0439	0.93012	0.0:0.0:1.0:0.0	.	116;116;116	G3XAE6;Q8IWU5-2;Q8IWU5	.;.;SULF2_HUMAN	S	116	ENSP00000353007:P116S;ENSP00000418290:P116S;ENSP00000354662:P116S;ENSP00000418442:P116S;ENSP00000410026:P116S	ENSP00000353007:P116S	P	-	1	0	SULF2	45798923	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.858000	0.99539	2.502000	0.84385	0.561000	0.74099	CCC		0.612	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
NFATC2	4773	hgsc.bcm.edu	37	20	50049066	50049066	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:50049066G>A	ENST00000396009.3	-	9	2479	c.2260C>T	c.(2260-2262)Cgg>Tgg	p.R754W	NFATC2_ENST00000371564.3_Missense_Mutation_p.R754W|NFATC2_ENST00000609943.1_Missense_Mutation_p.R734W|NFATC2_ENST00000609507.1_Missense_Mutation_p.R535W|NFATC2_ENST00000414705.1_Missense_Mutation_p.R734W|NFATC2_ENST00000610033.1_Missense_Mutation_p.R535W	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	754					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R754W(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CTCTTGCTCCGCTGGTAGAGT	0.687																																					p.R754W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2260T	20						.						17.0	20.0	19.0					20																	50049066		2201	4299	6500	49482473	SO:0001583	missense	4773	exon9			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2260C>T	20.37:g.50049066G>A	ENSP00000379330:p.Arg754Trp	Somatic		Capture	SOLID	Phase_I	49482473	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.472378	0.63737	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.15487	2.42;2.42;2.43	5.45	3.29	0.37713	.	0.128605	0.50627	D	0.000110	T	0.29491	0.0735	L	0.36672	1.1	0.38949	D	0.958314	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.947;0.993;0.965;0.947	T	0.09662	-1.0664	10	0.87932	D	0	-26.9305	11.7957	0.52098	0.0:0.0:0.3723:0.6276	.	734;734;754;754	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	W	754;754;734	ENSP00000360619:R754W;ENSP00000379330:R754W;ENSP00000396471:R734W	ENSP00000360619:R754W	R	-	1	2	NFATC2	49482473	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	3.290000	0.51755	1.239000	0.43787	0.650000	0.86243	CGG		0.687	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
BCAS1	8537	hgsc.bcm.edu	37	20	52570074	52570074	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:52570074G>A	ENST00000395961.3	-	11	1743	c.1577C>T	c.(1576-1578)aCa>aTa	p.T526I	BCAS1_ENST00000434986.2_Missense_Mutation_p.T192I|BCAS1_ENST00000371435.2_Missense_Mutation_p.T448I|BCAS1_ENST00000371440.3_Missense_Mutation_p.T535I	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	526						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.T526I(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			GGCCTGCTCTGTGCACTGGGC	0.552																																					p.T526I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1577T	20						.						258.0	199.0	219.0					20																	52570074		2203	4300	6503	52003481	SO:0001583	missense	8537	exon11			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.1577C>T	20.37:g.52570074G>A	ENSP00000379290:p.Thr526Ile	Somatic		Capture	SOLID	Phase_I	52003481	NM_003657	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	37	CCDS13444.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.816|7.816	0.716685|0.716685	0.15306|0.15306	.|.	.|.	ENSG00000064787|ENSG00000064787	ENST00000422805|ENST00000448484;ENST00000371440;ENST00000448710;ENST00000395961;ENST00000371435;ENST00000434986	.|T;T;T;T;T	.|0.05925	.|3.37;3.37;3.37;3.37;3.37	5.17|5.17	-0.0349|-0.0349	0.13894|0.13894	.|.	.|1.710450	.|0.02921	.|N	.|0.137916	.|T	.|0.05456	.|0.0144	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B	.|0.29988	.|0.029;0.2;0.029;0.114;0.264;0.264	.|B;B;B;B;B;B	.|0.26770	.|0.014;0.073;0.014;0.032;0.042;0.042	.|T	.|0.38112	.|-0.9676	.|10	.|0.54805	.|T	.|0.06	0.046|0.046	6.0584|6.0584	0.19824|0.19824	0.2669:0.1397:0.5934:0.0|0.2669:0.1397:0.5934:0.0	.|.	.|526;192;535;448;526;526	.|B2RCQ5;B4DFL4;O75363-2;G3XAF7;A0AVG7;O75363	.|.;.;.;.;.;BCAS1_HUMAN	X|I	189|397;535;326;526;448;192	.|ENSP00000396361:T397I;ENSP00000360495:T535I;ENSP00000379290:T526I;ENSP00000360490:T448I;ENSP00000409956:T192I	.|ENSP00000360490:T448I	Q|T	-|-	1|2	0|0	BCAS1|BCAS1	52003481|52003481	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.048000|0.048000	0.14542|0.14542	-0.515000|-0.515000	0.06290|0.06290	-0.257000|-0.257000	0.09459|0.09459	0.555000|0.555000	0.69702|0.69702	CAG|ACA		0.552	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657	
GNAS	2778	hgsc.bcm.edu	37	20	57478839	57478839	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:57478839T>A	ENST00000371085.3	+	5	849	c.425T>A	c.(424-426)tTc>tAc	p.F142Y	GNAS_ENST00000306090.10_Missense_Mutation_p.F128Y|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000354359.7_Missense_Mutation_p.F143Y|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.F127Y|GNAS_ENST00000371102.4_Missense_Mutation_p.F771Y|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371095.3_Missense_Mutation_p.F128Y|GNAS_ENST00000371100.4_Missense_Mutation_p.F785Y	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	142					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.F785Y(1)|p.F142Y(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GACTTTGACTTCCCTCCCGTA	0.587			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.F128Y	Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T383A	20						.						259.0	232.0	241.0					20																	57478839		2203	4300	6503	56912234	SO:0001583	missense	2778	exon4			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.425T>A	20.37:g.57478839T>A	ENSP00000360126:p.Phe142Tyr	Somatic		Capture	SOLID	Phase_I	56912234	NM_080426	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.814280	0.50527	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000349036;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	5.81	5.81	0.92471	G protein alpha subunit, helical insertion (4);	0.000000	0.85682	D	0.000000	D	0.83069	0.5174	N	0.05510	-0.035	0.80722	D	1	B;B;B;B	0.29301	0.002;0.002;0.0;0.241	B;B;B;B	0.43331	0.019;0.019;0.008;0.416	T	0.78795	-0.2064	10	0.12430	T	0.62	.	15.1392	0.72599	0.0:0.0:0.0:1.0	.	142;143;127;785	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	Y	785;771;159;128;142;143;127;128	ENSP00000360141:F785Y;ENSP00000360143:F771Y;ENSP00000265621:F159Y;ENSP00000360136:F128Y;ENSP00000360126:F142Y;ENSP00000346328:F143Y;ENSP00000265620:F127Y;ENSP00000304472:F128Y	ENSP00000265620:F127Y	F	+	2	0	GNAS	56912234	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.915000	0.48805	2.218000	0.71995	0.533000	0.62120	TTC		0.587	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
ANGPT4	51378	hgsc.bcm.edu	37	20	855020	855020	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:855020G>T	ENST00000381922.3	-	8	1360	c.1258C>A	c.(1258-1260)Cag>Aag	p.Q420K	ANGPT4_ENST00000546022.1_Intron	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	420	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.Q420K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						AGGCTGCTCTGGCGCCCTGCT	0.612																																					p.Q420K	Pancreas(181;481 2077 3259 31286 49856)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1258A	20						.						95.0	76.0	83.0					20																	855020		2203	4300	6503	803020	SO:0001583	missense	51378	exon8			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.1258C>A	20.37:g.855020G>T	ENSP00000371347:p.Gln420Lys	Somatic		Capture	SOLID	Phase_I	803020	NM_015985	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	ENST00000381922.3	37	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.921165	0.00498	.	.	ENSG00000101280	ENST00000381922	T	0.76186	-1.0	5.25	3.22	0.36961	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.079254	0.51477	N	0.000092	T	0.56615	0.1997	N	0.16037	0.36	0.38864	D	0.956558	B	0.18461	0.028	B	0.18871	0.023	T	0.49523	-0.8931	10	0.32370	T	0.25	.	12.0194	0.53333	0.0:0.0:0.5312:0.4688	.	420	Q9Y264	ANGP4_HUMAN	K	420	ENSP00000371347:Q420K	ENSP00000371347:Q420K	Q	-	1	0	ANGPT4	803020	1.000000	0.71417	0.463000	0.27130	0.005000	0.04900	3.813000	0.55636	0.543000	0.28864	0.655000	0.94253	CAG		0.612	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985	
CHGB	1114	hgsc.bcm.edu	37	20	5903381	5903381	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:5903381T>C	ENST00000378961.4	+	4	795	c.591T>C	c.(589-591)gcT>gcC	p.A197A		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	197						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)	p.A197A(1)		breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						CACAAAACGCTTTTCTCAATG	0.473																																					p.A197A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T591C	20						.						83.0	88.0	86.0					20																	5903381		2203	4300	6503	5851381	SO:0001819	synonymous_variant	1114	exon4				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.591T>C	20.37:g.5903381T>C		Somatic		Capture	SOLID	Phase_I	5851381	NM_001819	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Silent	SNP	ENST00000378961.4	37	CCDS13092.1																																																																																				0.473	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819	
CDH26	60437	hgsc.bcm.edu	37	20	58569315	58569315	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr20:58569315G>A	ENST00000244047.5	+	11	1748	c.1437G>A	c.(1435-1437)ccG>ccA	p.P479P	CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000348616.4_Silent_p.P479P|CDH26_ENST00000350849.6_5'Flank|CDH26_ENST00000244049.3_5'Flank			Q8IXH8	CAD26_HUMAN	cadherin 26	479	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.		P -> L (in dbSNP:rs6071067).		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P479P(2)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GCTTCCCACCGCAGACTGCTA	0.517																																					p.P479P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1437A	20						.						86.0	75.0	79.0					20																	58569315		2203	4300	6503	58002710	SO:0001819	synonymous_variant	60437	exon11			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1437G>A	20.37:g.58569315G>A		Somatic		Capture	SOLID	Phase_I	58002710	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Silent	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	G	3.816	-0.038766	0.07497	.	.	ENSG00000124215	ENST00000370991	.	.	.	4.4	-8.8	0.00817	.	.	.	.	.	T	0.28067	0.0692	.	.	.	0.21020	N	0.99981	.	.	.	.	.	.	T	0.32375	-0.9909	4	.	.	.	.	10.5674	0.45181	0.5324:0.121:0.3466:0.0	.	.	.	.	H	71	.	.	R	+	2	0	CDH26	58002710	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-7.240000	0.00041	-2.175000	0.00771	-1.619000	0.00793	CGC		0.517	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
TEP1	7011	hgsc.bcm.edu	37	14	20864842	20864842	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:20864842G>T	ENST00000262715.5	-	10	1637	c.1597C>A	c.(1597-1599)Ctg>Atg	p.L533M	TEP1_ENST00000556935.1_Missense_Mutation_p.L425M	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	533	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		ACCCGCAGCAGGTTGCACAGG	0.552																																					p.L533M												.	.	0			c.C1597A	14						.						106.0	91.0	96.0					14																	20864842		2203	4300	6503	19934682	SO:0001583	missense	7011	exon10				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1597C>A	14.37:g.20864842G>T	ENSP00000262715:p.Leu533Met	Somatic		Capture	SOLID	Phase_I	19934682	NM_007110	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256983	0.39896	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.23754	1.89;1.89	5.59	3.66	0.41972	TROVE (2);	0.184358	0.43260	D	0.000584	T	0.26011	0.0634	L	0.37800	1.135	0.80722	D	1	D;D	0.55172	0.958;0.97	P;P	0.55785	0.763;0.784	T	0.07654	-1.0761	10	0.27785	T	0.31	-12.3879	3.6982	0.08372	0.0832:0.1375:0.5207:0.2586	.	425;533	G3V5X7;Q99973	.;TEP1_HUMAN	M	533;533;425	ENSP00000262715:L533M;ENSP00000452574:L425M	ENSP00000262715:L533M	L	-	1	2	TEP1	19934682	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.113000	0.41902	1.379000	0.46325	-0.140000	0.14226	CTG		0.552	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
DAD1	1603	hgsc.bcm.edu	37	14	23057896	23057897	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	AA	AA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:23057896_23057897delAA	ENST00000250498.4	-	1	278_279	c.167_168delTT	c.(166-168)tttfs	p.F56fs	DAD1_ENST00000543337.1_Intron|DAD1_ENST00000538631.1_Frame_Shift_Del_p.F56fs	NM_001344.2	NP_001335.1	P61803	DAD1_HUMAN	defender against cell death 1	56					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.F56fs*40(1)		large_intestine(2)|ovary(2)|prostate(1)	5	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0156)		AGCCCGAGAGAAAAGAGTTGAA	0.49																																					p.56_56del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.167_168del	14						.																																			22127737	SO:0001589	frameshift_variant	1603	exon1			AK223129	CCDS9571.1	14q11.2	2013-03-06			ENSG00000129562	ENSG00000129562			2664	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 2 homolog (S. cerevisiae)"", ""oligosaccharyltransferase subunit 2 (non-catalytic)"""	600243					Standard	NM_001344		Approved	OST2	uc001wgl.2	P61803	OTTHUMG00000028685	ENST00000250498.4:c.167_168delTT	14.37:g.23057898_23057899delAA	ENSP00000250498:p.Phe56fs	Somatic		Capture	SOLID	Phase_I	22127736	NM_001344	D3DS25|O08552|O70364|P46966|P46968|Q6FGA3|Q96GB7	Frame_Shift_Del	DEL	ENST00000250498.4	37	CCDS9571.1																																																																																				0.490	DAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071617.2	NM_001344	
ACIN1	22985	hgsc.bcm.edu	37	14	23549650	23549650	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:23549650C>T	ENST00000262710.1	-	6	1395	c.1068G>A	c.(1066-1068)caG>caA	p.Q356Q	ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Silent_p.Q356Q|ACIN1_ENST00000605057.1_Silent_p.Q298Q|ACIN1_ENST00000457657.1_Silent_p.Q316Q	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	356	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q356Q(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CCTTCTCCTGCTGCTGTCTGG	0.453																																					p.Q356Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1068A	14						.						105.0	94.0	98.0					14																	23549650		2203	4300	6503	22619490	SO:0001819	synonymous_variant	22985	exon6			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1068G>A	14.37:g.23549650C>T		Somatic		Capture	SOLID	Phase_I	22619490	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	ENST00000262710.1	37	CCDS9587.1																																																																																				0.453	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
AP1G2	8906	hgsc.bcm.edu	37	14	24030796	24030796	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:24030796C>A	ENST00000308724.5	-	17	2537	c.1782G>T	c.(1780-1782)caG>caT	p.Q594H	RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_Missense_Mutation_p.Q594H|RP11-66N24.4_ENST00000555446.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	594					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)	p.Q594H(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CCTCATCAGCCTGAGGGCCAT	0.557																																					p.Q594H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1782T	14						.						69.0	58.0	62.0					14																	24030796		2203	4300	6503	23100636	SO:0001583	missense	8906	exon18			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1782G>T	14.37:g.24030796C>A	ENSP00000312442:p.Gln594His	Somatic		Capture	SOLID	Phase_I	23100636	NM_003917	D3DS51|O75504	Missense_Mutation	SNP	ENST00000308724.5	37	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.264217	0.23136	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852;ENST00000554477	T;T	0.12672	2.66;2.66	4.9	0.704	0.18121	Armadillo-like helical (1);Armadillo-type fold (1);	0.260909	0.31847	N	0.006963	T	0.09113	0.0225	L	0.38531	1.155	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.21621	-1.0240	10	0.51188	T	0.08	-5.7228	5.1489	0.15000	0.0:0.5494:0.159:0.2916	.	594;449	O75843;Q86V28	AP1G2_HUMAN;.	H	594;594;363;449;56	ENSP00000312442:Q594H;ENSP00000380309:Q594H	ENSP00000312442:Q594H	Q	-	3	2	AP1G2	23100636	0.359000	0.24955	0.064000	0.19789	0.702000	0.40608	0.079000	0.14782	0.269000	0.21961	0.511000	0.50034	CAG		0.557	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	
AP1G2	8906	hgsc.bcm.edu	37	14	24032996	24032996	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:24032996C>A	ENST00000308724.5	-	11	1916	c.1161G>T	c.(1159-1161)caG>caT	p.Q387H	RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_Missense_Mutation_p.Q387H|AP1G2_ENST00000556277.1_5'Flank	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	387					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)	p.Q387H(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CCAGAAAGGCCTGCAGCTCTT	0.582																																					p.Q387H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1161T	14						.						76.0	69.0	71.0					14																	24032996		2203	4300	6503	23102836	SO:0001583	missense	8906	exon12			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1161G>T	14.37:g.24032996C>A	ENSP00000312442:p.Gln387His	Somatic		Capture	SOLID	Phase_I	23102836	NM_003917	D3DS51|O75504	Missense_Mutation	SNP	ENST00000308724.5	37	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245981	0.59103	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852	T;T	0.27256	1.68;1.68	4.71	2.85	0.33270	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.075482	0.56097	D	0.000021	T	0.31358	0.0794	N	0.22421	0.69	0.40079	D	0.976112	D;D	0.65815	0.99;0.995	D;D	0.67231	0.91;0.95	T	0.12344	-1.0551	10	0.87932	D	0	-15.7049	9.3285	0.38008	0.0:0.8168:0.0:0.1831	.	387;242	O75843;Q86V28	AP1G2_HUMAN;.	H	387;387;156;242	ENSP00000312442:Q387H;ENSP00000380309:Q387H	ENSP00000312442:Q387H	Q	-	3	2	AP1G2	23102836	1.000000	0.71417	0.999000	0.59377	0.783000	0.44284	2.063000	0.41423	1.194000	0.43101	0.557000	0.71058	CAG		0.582	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	
NOVA1	4857	hgsc.bcm.edu	37	14	26917693	26917693	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:26917693T>C	ENST00000539517.2	-	5	1313	c.996A>G	c.(994-996)ttA>ttG	p.L332L	NOVA1_ENST00000465357.2_Silent_p.L308L|NOVA1_ENST00000267422.7_Silent_p.L210L	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	335	Ala-rich.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L332L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		GACCTAAACCTAAAGTGTTGA	0.502																																					p.L332L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A996G	14						.						46.0	44.0	44.0					14																	26917693		2203	4300	6503	25987533	SO:0001819	synonymous_variant	4857	exon5			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.996A>G	14.37:g.26917693T>C		Somatic		Capture	SOLID	Phase_I	25987533	NM_002515	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	ENST00000539517.2	37	CCDS32061.1																																																																																				0.502	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491	
KTN1	3895	hgsc.bcm.edu	37	14	56138334	56138334	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:56138334G>T	ENST00000395314.3	+	36	3467	c.3399G>T	c.(3397-3399)caG>caT	p.Q1133H	KTN1_ENST00000416613.1_Missense_Mutation_p.Q1133H|KTN1_ENST00000438792.2_Missense_Mutation_p.Q1104H|KTN1_ENST00000395308.1_Missense_Mutation_p.Q1110H|KTN1_ENST00000395311.1_Missense_Mutation_p.Q1110H|KTN1_ENST00000395309.3_Missense_Mutation_p.Q1133H|KTN1_ENST00000554507.1_Missense_Mutation_p.Q399H|KTN1_ENST00000413890.2_Missense_Mutation_p.Q1110H|KTN1_ENST00000555573.1_Missense_Mutation_p.Q138H	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	1133					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q1133H(2)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						CATTGTTACAGCTAGAGTGTG	0.323			T	RET	papillary thryoid																																p.Q1104H			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3312T	14						.						98.0	99.0	99.0					14																	56138334		2203	4300	6503	55208087	SO:0001583	missense	3895	exon35				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.3399G>T	14.37:g.56138334G>T	ENSP00000378725:p.Gln1133His	Somatic		Capture	SOLID	Phase_I	55208087	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648916	0.67358	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613;ENST00000554507;ENST00000553624;ENST00000555573	T;T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.52	2.66	0.31614	.	0.000000	0.50627	D	0.000109	T	0.66268	0.2772	M	0.79123	2.44	0.45806	D	0.998684	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.997;0.999;0.999	T	0.68618	-0.5361	10	0.59425	D	0.04	-10.5399	11.5596	0.50769	0.2617:0.0:0.7383:0.0	.	138;1133;399;1104;1110;1133	B7Z6P3;B4DZ88;G3V4Y7;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;.;.;KTN1_HUMAN	H	1110;1133;1104;1133;1110;1110;1133;399;94;138	ENSP00000394992:Q1110H;ENSP00000378720:Q1133H;ENSP00000391964:Q1104H;ENSP00000378725:Q1133H;ENSP00000378719:Q1110H;ENSP00000378722:Q1110H;ENSP00000388807:Q1133H;ENSP00000452073:Q399H;ENSP00000452445:Q94H;ENSP00000451698:Q138H	ENSP00000378719:Q1110H	Q	+	3	2	KTN1	55208087	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.221000	0.32503	0.806000	0.34183	0.650000	0.86243	CAG		0.323	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
TMEM260	54916	hgsc.bcm.edu	37	14	57072307	57072307	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:57072307T>G	ENST00000261556.6	+	5	664	c.542T>G	c.(541-543)tTc>tGc	p.F181C	TMEM260_ENST00000536419.1_5'UTR|TMEM260_ENST00000538838.1_Missense_Mutation_p.F181C	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	181						integral component of membrane (GO:0016021)		p.F181C(1)									ATTGGTGCTTTCTGCTGTGGC	0.274																																					p.F181C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T542G	14						.						128.0	136.0	133.0					14																	57072307		2202	4298	6500	56142060	SO:0001583	missense	54916	exon5			AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.542T>G	14.37:g.57072307T>G	ENSP00000261556:p.Phe181Cys	Somatic		Capture	SOLID	Phase_I	56142060	NM_017799	A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.182961	0.78677	.	.	ENSG00000070269	ENST00000261556;ENST00000538838	T;T	0.58358	1.09;0.34	5.42	5.42	0.78866	.	0.053565	0.85682	D	0.000000	T	0.73071	0.3540	M	0.83118	2.625	0.80722	D	1	D	0.63880	0.993	D	0.63597	0.916	T	0.78041	-0.2359	10	0.72032	D	0.01	-17.3387	15.5363	0.76004	0.0:0.0:0.0:1.0	.	181	Q9NX78	CN101_HUMAN	C	181	ENSP00000261556:F181C;ENSP00000441934:F181C	ENSP00000261556:F181C	F	+	2	0	C14orf101	56142060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.872000	0.87187	2.076000	0.62316	0.451000	0.29950	TTC		0.274	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
GPHN	10243	hgsc.bcm.edu	37	14	67389594	67389594	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:67389594G>C	ENST00000315266.5	+	7	1789	c.668G>C	c.(667-669)gGt>gCt	p.G223A	GPHN_ENST00000478722.1_Missense_Mutation_p.G223A|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000305960.9_Missense_Mutation_p.G192A|GPHN_ENST00000459628.1_Missense_Mutation_p.G205A|GPHN_ENST00000543237.1_Missense_Mutation_p.G236A	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	223	Interaction with GABARAP. {ECO:0000250}.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.G223A(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		AAAGACAGTGGTGTTGCTTCA	0.488			T	MLL	AL																																p.G223A			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G668C	14						.						112.0	107.0	108.0					14																	67389594		2203	4300	6503	66459347	SO:0001583	missense	10243	exon7			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.668G>C	14.37:g.67389594G>C	ENSP00000312771:p.Gly223Ala	Somatic		Capture	SOLID	Phase_I	66459347	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909215	0.92107	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960;ENST00000555456	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.64929	0.2643	N	0.19112	0.55	0.80722	D	1	D;P;D;P;D	0.76494	0.999;0.941;0.999;0.911;0.981	D;P;D;B;P	0.79108	0.992;0.561;0.981;0.265;0.728	T	0.70666	-0.4809	9	0.72032	D	0.01	-8.2636	18.5485	0.91055	0.0:0.0:1.0:0.0	.	192;236;223;223;205	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	A	223;223;205;236;192;156	.	ENSP00000303019:G192A	G	+	2	0	GPHN	66459347	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.550000	0.98110	2.392000	0.81423	0.650000	0.86243	GGT		0.488	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
SLC39A9	55334	hgsc.bcm.edu	37	14	69908982	69908982	+	Splice_Site	SNP	C	C	T	rs373683599		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:69908982C>T	ENST00000336643.5	+	3	1080	c.402C>T	c.(400-402)gaC>gaT	p.D134D	SLC39A9_ENST00000555245.1_3'UTR|SLC39A9_ENST00000557046.1_Splice_Site_p.D134D|SLC39A9_ENST00000031146.4_Intron|SLC39A9_ENST00000556605.1_Splice_Site_p.D134D	NM_018375.4	NP_060845.2	Q9NUM3	S39A9_HUMAN	solute carrier family 39, member 9	134					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.D134D(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|skin(1)|stomach(1)	14				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		ATTCTACTGACGGTGAGTGGC	0.453																																					p.D134D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	14						.	C		0,4406		0,0,2203	285.0	248.0	260.0		402	-6.9	1.0	14		260	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous-near-splice	SLC39A9	NM_018375.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		134/308	69908982	1,13005	2203	4300	6503	68978735	SO:0001630	splice_region_variant	55334	exon3				CCDS9795.1, CCDS58327.1, CCDS58328.1	14q24.1	2013-07-17	2013-07-17			ENSG00000029364		"""Solute carriers"""	20182	protein-coding gene	gene with protein product							Standard	NM_018375		Approved	FLJ11274	uc001xle.3	Q9NUM3		ENST00000336643.5:c.403+1C>T	14.37:g.69908982C>T		Somatic		Capture	SOLID	Phase_I	68978735	NM_018375	G3V5J8|Q53HN3|Q5MJQ0|Q6P2Q1|Q86WY2	Silent	SNP	ENST00000336643.5	37	CCDS9795.1																																																																																				0.453	SLC39A9-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412446.1	NM_018375	Silent
SLC8A3	6547	hgsc.bcm.edu	37	14	70634150	70634150	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:70634150C>A	ENST00000381269.2	-	2	1743	c.990G>T	c.(988-990)aaG>aaT	p.K330N	SLC8A3_ENST00000357887.3_Missense_Mutation_p.K330N|SLC8A3_ENST00000356921.2_Missense_Mutation_p.K330N|SLC8A3_ENST00000534137.1_Missense_Mutation_p.K330N|SLC8A3_ENST00000528359.1_Missense_Mutation_p.K330N	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	330					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.K330N(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GATCTAAGTCCTTCTCTGGGT	0.512																																					p.K330N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G990T	14						.						97.0	101.0	100.0					14																	70634150		2203	4300	6503	69703903	SO:0001583	missense	6547	exon2			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.990G>T	14.37:g.70634150C>A	ENSP00000370669:p.Lys330Asn	Somatic		Capture	SOLID	Phase_I	69703903	NM_033262	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.311371	0.40895	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.37058	1.3;1.22;1.36;1.3;1.36	5.85	4.95	0.65309	.	0.050543	0.85682	D	0.000000	T	0.60444	0.2269	M	0.83953	2.67	0.80722	D	1	D;D;D;D	0.65815	0.985;0.975;0.991;0.995	D;P;D;D	0.79108	0.913;0.821;0.992;0.992	T	0.62661	-0.6807	10	0.41790	T	0.15	.	11.4006	0.49868	0.0:0.8604:0.0:0.1396	.	330;330;330;330	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	N	330	ENSP00000349392:K330N;ENSP00000370669:K330N;ENSP00000350560:K330N;ENSP00000436688:K330N;ENSP00000433531:K330N	ENSP00000349392:K330N	K	-	3	2	SLC8A3	69703903	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.291000	0.33330	1.437000	0.47472	0.655000	0.94253	AAG		0.512	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
ZFYVE1	53349	hgsc.bcm.edu	37	14	73491087	73491087	+	Missense_Mutation	SNP	G	G	A	rs200748460	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:73491087G>A	ENST00000556143.1	-	2	850	c.130C>T	c.(130-132)Cgc>Tgc	p.R44C	ZFYVE1_ENST00000318876.5_Missense_Mutation_p.R44C|ZFYVE1_ENST00000553891.1_Missense_Mutation_p.R44C	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	44					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)	p.R44C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		TCCTCGCAGCGGAGACACTGC	0.567													G|||	4	0.000798722	0.0	0.0	5008	,	,		20280	0.003		0.0	False		,,,				2504	0.001				p.R44C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C130T	14						.						96.0	89.0	91.0					14																	73491087		2203	4300	6503	72560840	SO:0001583	missense	53349	exon2			AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.130C>T	14.37:g.73491087G>A	ENSP00000450742:p.Arg44Cys	Somatic		Capture	SOLID	Phase_I	72560840	NM_021260	J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Missense_Mutation	SNP	ENST00000556143.1	37	CCDS9811.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	15.34	2.803659	0.50315	.	.	ENSG00000165861	ENST00000553891;ENST00000318876;ENST00000556143	T;T;T	0.65178	-0.14;-0.13;-0.13	5.66	4.77	0.60923	.	0.118728	0.64402	D	0.000013	T	0.61739	0.2371	L	0.27053	0.805	0.80722	D	1	D;D	0.71674	0.998;0.994	P;P	0.54100	0.742;0.556	T	0.67090	-0.5758	10	0.87932	D	0	-18.2863	14.5518	0.68073	0.07:0.0:0.93:0.0	.	44;44	G3V5N8;Q9HBF4	.;ZFYV1_HUMAN	C	44	ENSP00000452442:R44C;ENSP00000326921:R44C;ENSP00000450742:R44C	ENSP00000326921:R44C	R	-	1	0	ZFYVE1	72560840	1.000000	0.71417	0.984000	0.44739	0.027000	0.11550	5.295000	0.65692	1.424000	0.47217	-0.225000	0.12378	CGC		0.567	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413172.1	NM_021260	
ELMSAN1	91748	hgsc.bcm.edu	37	14	74206047	74206047	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:74206047C>A	ENST00000286523.5	-	2	1447	c.665G>T	c.(664-666)gGc>gTc	p.G222V	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_Missense_Mutation_p.G222V	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	222	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G222V(1)									CACCTGGTGGCCGAATGCCAG	0.652																																					p.G222V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G665T	14						.						36.0	40.0	39.0					14																	74206047		2203	4300	6503	73275800	SO:0001583	missense	91748	exon2			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.665G>T	14.37:g.74206047C>A	ENSP00000286523:p.Gly222Val	Somatic		Capture	SOLID	Phase_I	73275800	NM_001043318	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763505	0.69763	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.45276	0.91;0.91;0.91;0.9	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000003	T	0.54271	0.1848	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.56469	-0.7974	10	0.49607	T	0.09	-15.5142	18.1433	0.89647	0.0:1.0:0.0:0.0	.	222;222	A0PJD3;Q6PJG2	.;CN043_HUMAN	V	222	ENSP00000377634:G222V;ENSP00000286523:G222V;ENSP00000407767:G222V;ENSP00000402380:G222V	ENSP00000286523:G222V	G	-	2	0	C14orf43	73275800	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.084000	0.76866	2.281000	0.76405	0.462000	0.41574	GGC		0.652	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
PTPN21	11099	hgsc.bcm.edu	37	14	88935311	88935311	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:88935311A>G	ENST00000556564.1	-	18	3629	c.3345T>C	c.(3343-3345)acT>acC	p.T1115T	PTPN21_ENST00000328736.3_Silent_p.T1115T	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	1115	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)	p.T1115T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCACCACGCCAGTCCTTCCTA	0.532																																					p.T1115T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3345C	14						.						128.0	105.0	113.0					14																	88935311		2203	4300	6503	88005064	SO:0001819	synonymous_variant	11099	exon18			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.3345T>C	14.37:g.88935311A>G		Somatic		Capture	SOLID	Phase_I	88005064	NM_007039		Silent	SNP	ENST00000556564.1	37	CCDS9884.1																																																																																				0.532	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
PTPN21	11099	hgsc.bcm.edu	37	14	88935991	88935991	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:88935991C>T	ENST00000556564.1	-	17	3371	c.3087G>A	c.(3085-3087)acG>acA	p.T1029T	PTPN21_ENST00000328736.3_Silent_p.T1029T	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	1029	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)	p.T1029T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GGAACCGGGTCGTGATCTTAA	0.537																																					p.T1029T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3087A	14						.						149.0	121.0	130.0					14																	88935991		2203	4300	6503	88005744	SO:0001819	synonymous_variant	11099	exon17			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.3087G>A	14.37:g.88935991C>T		Somatic		Capture	SOLID	Phase_I	88005744	NM_007039		Silent	SNP	ENST00000556564.1	37	CCDS9884.1																																																																																				0.537	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
TRIP11	9321	hgsc.bcm.edu	37	14	92472045	92472045	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:92472045G>A	ENST00000267622.4	-	11	2648	c.2275C>T	c.(2275-2277)Ctg>Ttg	p.L759L		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	759					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.L759L(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TCATGTTCCAGCTGTAAGGCA	0.353			T	PDGFRB	AML																																p.L759L	Ovarian(84;609 1888 9852 42686)		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2275T	14						.						201.0	205.0	204.0					14																	92472045		2203	4300	6503	91541798	SO:0001819	synonymous_variant	9321	exon11			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.2275C>T	14.37:g.92472045G>A		Somatic		Capture	SOLID	Phase_I	91541798	NM_004239	B2RUT2|O14689|O15154|O95949	Silent	SNP	ENST00000267622.4	37	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.989405	0.00439	.	.	ENSG00000100815	ENST00000554357	.	.	.	6.07	-1.59	0.08453	.	.	.	.	.	T	0.51856	0.1699	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46076	-0.9217	4	.	.	.	.	7.4308	0.27126	0.2795:0.1892:0.5313:0.0	.	.	.	.	V	474	.	.	A	-	2	0	TRIP11	91541798	0.306000	0.24490	0.068000	0.19968	0.004000	0.04260	0.348000	0.20031	-0.047000	0.13423	-0.234000	0.12200	GCT		0.353	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
SERPINA4	5267	hgsc.bcm.edu	37	14	95035830	95035830	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:95035830C>T	ENST00000557004.1	+	5	1603	c.1182C>T	c.(1180-1182)cgC>cgT	p.R394R	SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000298841.5_Silent_p.R394R|SERPINA4_ENST00000555095.1_Silent_p.R394R			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	394					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R394R(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		AGACCAATCGCCACATCCTGC	0.572																																					p.R394R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1182T	14						.						103.0	79.0	88.0					14																	95035830		2203	4300	6503	94105583	SO:0001819	synonymous_variant	5267	exon5			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.1182C>T	14.37:g.95035830C>T		Somatic		Capture	SOLID	Phase_I	94105583	NM_006215	Q53XB5|Q86TR9|Q96BZ5	Silent	SNP	ENST00000557004.1	37	CCDS9927.1																																																																																				0.572	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102471466	102471466	+	Missense_Mutation	SNP	G	G	A	rs200722698		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr14:102471466G>A	ENST00000360184.4	+	26	5490	c.5326G>A	c.(5326-5328)Gcg>Acg	p.A1776T		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1776	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.A1776T(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGGAGATGCCGCGCCCTTGCA	0.587																																					p.A1776T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5326A	14						.						91.0	62.0	72.0					14																	102471466		2203	4300	6503	101541219	SO:0001583	missense	1778	exon26			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.5326G>A	14.37:g.102471466G>A	ENSP00000348965:p.Ala1776Thr	Somatic		Capture	SOLID	Phase_I	101541219	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	3.160	-0.172299	0.06421	.	.	ENSG00000197102	ENST00000360184	T	0.29397	1.57	5.75	5.75	0.90469	.	0.435749	0.27504	N	0.019072	T	0.13500	0.0327	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.12477	-1.0546	10	0.28530	T	0.3	.	7.5375	0.27719	0.1958:0.0:0.8042:0.0	.	1776	Q14204	DYHC1_HUMAN	T	1776	ENSP00000348965:A1776T	ENSP00000348965:A1776T	A	+	1	0	DYNC1H1	101541219	0.019000	0.18553	0.077000	0.20336	0.070000	0.16714	1.389000	0.34453	2.705000	0.92388	0.655000	0.94253	GCG		0.587	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
TFIP11	24144	hgsc.bcm.edu	37	22	26892749	26892749	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:26892749T>C	ENST00000407690.1	-	11	1826	c.1543A>G	c.(1543-1545)Att>Gtt	p.I515V	TFIP11_ENST00000407431.1_Missense_Mutation_p.I515V|TFIP11_ENST00000496523.1_5'Flank|TFIP11_ENST00000407148.1_Missense_Mutation_p.I515V|TFIP11_ENST00000405938.1_Missense_Mutation_p.I515V	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	515					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)	p.I515V(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						CACACAGGAATAATGTGCACC	0.468																																					p.I515V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1543G	22						.						166.0	137.0	147.0					22																	26892749		2203	4300	6503	25222749	SO:0001583	missense	24144	exon11			AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.1543A>G	22.37:g.26892749T>C	ENSP00000384421:p.Ile515Val	Somatic		Capture	SOLID	Phase_I	25222749	NM_012143	O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Missense_Mutation	SNP	ENST00000407690.1	37	CCDS13838.1	.	.	.	.	.	.	.	.	.	.	T	13.27	2.188205	0.38609	.	.	ENSG00000100109	ENST00000407690;ENST00000407431;ENST00000407148;ENST00000442693;ENST00000405938	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.23	5.23	0.72850	GC-rich sequence DNA-binding factor domain (1);	0.129173	0.52532	D	0.000063	T	0.30854	0.0778	L	0.38838	1.175	0.35919	D	0.831631	B	0.09022	0.002	B	0.06405	0.002	T	0.35574	-0.9783	10	0.59425	D	0.04	-33.0708	6.6056	0.22724	0.0:0.0803:0.1561:0.7635	.	515	Q9UBB9	TFP11_HUMAN	V	515;515;515;200;515	ENSP00000384421:I515V;ENSP00000383892:I515V;ENSP00000385861:I515V;ENSP00000384297:I515V	ENSP00000384297:I515V	I	-	1	0	TFIP11	25222749	0.969000	0.33509	0.860000	0.33809	0.961000	0.63080	1.615000	0.36922	2.196000	0.70406	0.459000	0.35465	ATT		0.468	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320750.1	NM_001008697	
AP1B1	162	hgsc.bcm.edu	37	22	29745285	29745285	+	Silent	SNP	G	G	A	rs201186929		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:29745285G>A	ENST00000405198.1	-	10	1390	c.1359C>T	c.(1357-1359)ggC>ggT	p.G453G	AP1B1_ENST00000402502.1_Silent_p.G453G|AP1B1_ENST00000357586.2_Silent_p.G453G|AP1B1_ENST00000415447.1_Silent_p.G453G|AP1B1_ENST00000356015.2_Silent_p.G453G|AP1B1_ENST00000432560.2_Silent_p.G453G|AP1B1_ENST00000317368.7_Silent_p.G453G			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	453					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.G453G(1)		endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGCGTACTCGCCCACAATCC	0.602																																					p.G453G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1359T	22						.	G	,,	0,4406		0,0,2203	117.0	100.0	106.0		1359,1359,1359	2.2	1.0	22		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	AP1B1	NM_001127.3,NM_001166019.1,NM_145730.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	453/950,453/920,453/940	29745285	1,13005	2203	4300	6503	28075285	SO:0001819	synonymous_variant	162	exon11			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.1359C>T	22.37:g.29745285G>A		Somatic		Capture	SOLID	Phase_I	28075285	NM_001166019	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Silent	SNP	ENST00000405198.1	37	CCDS13855.1	.	.	.	.	.	.	.	.	.	.	G	6.992	0.553183	0.13374	0.0	1.16E-4	ENSG00000100280	ENST00000415756	.	.	.	5.64	2.19	0.27852	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-36.7721	12.6207	0.56601	0.0:0.4705:0.4079:0.1216	.	.	.	.	X	166	.	.	R	-	1	2	AP1B1	28075285	0.406000	0.25344	1.000000	0.80357	0.556000	0.35491	-0.407000	0.07178	0.713000	0.32060	-0.181000	0.13052	CGA		0.602	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127	
THOC5	8563	hgsc.bcm.edu	37	22	29925211	29925211	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:29925211C>A	ENST00000490103.1	-	9	987	c.865G>T	c.(865-867)Gca>Tca	p.A289S	THOC5_ENST00000397871.1_Missense_Mutation_p.A289S|THOC5_ENST00000397873.2_Missense_Mutation_p.A289S|THOC5_ENST00000397872.1_Missense_Mutation_p.A289S|CTA-256D12.11_ENST00000411969.1_RNA	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	289					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)	p.A289S(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCTTCGATTGCCACAGATAAC	0.542																																					p.A289S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G865T	22						.						158.0	139.0	145.0					22																	29925211		2203	4300	6503	28255211	SO:0001583	missense	8563	exon9			AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.865G>T	22.37:g.29925211C>A	ENSP00000420306:p.Ala289Ser	Somatic		Capture	SOLID	Phase_I	28255211	NM_003678	O60839|Q9UPZ5	Missense_Mutation	SNP	ENST00000490103.1	37	CCDS13859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.737|5.737	0.320371|0.320371	0.10845|0.10845	.|.	.|.	ENSG00000100296|ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873|ENST00000443089	T;T;T;T|.	0.20463|.	2.07;2.07;2.07;2.07|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.323851|.	0.35936|.	N|.	0.002897|.	T|T	0.19046|0.19046	0.0457|0.0457	N|N	0.01640|0.01640	-0.785|-0.785	0.32587|0.32587	N|N	0.527718|0.527718	B|.	0.10296|.	0.003|.	B|.	0.10450|.	0.005|.	T|T	0.20438|0.20438	-1.0275|-1.0275	10|5	0.07325|.	T|.	0.83|.	-41.5792|-41.5792	12.6597|12.6597	0.56808|0.56808	0.0:0.9252:0.0:0.0748|0.0:0.9252:0.0:0.0748	.|.	289|.	Q13769|.	THOC5_HUMAN|.	S|V	289|159	ENSP00000420306:A289S;ENSP00000380970:A289S;ENSP00000380969:A289S;ENSP00000380971:A289S|.	ENSP00000380969:A289S|.	A|G	-|-	1|2	0|0	THOC5|THOC5	28255211|28255211	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	2.825000|2.825000	0.48096|0.48096	2.811000|2.811000	0.96726|0.96726	0.558000|0.558000	0.71614|0.71614	GCA|GGC		0.542	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1	NM_003678	
RBFOX2	23543	hgsc.bcm.edu	37	22	36156026	36156026	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:36156026C>T	ENST00000438146.2	-	10	1017	c.1018G>A	c.(1018-1020)Gct>Act	p.A340T	RBFOX2_ENST00000416721.2_Missense_Mutation_p.A265T|RBFOX2_ENST00000397303.2_Missense_Mutation_p.A246T|RBFOX2_ENST00000449924.2_Missense_Mutation_p.A269T|RBFOX2_ENST00000359369.4_Missense_Mutation_p.A245T|RBFOX2_ENST00000414461.2_Missense_Mutation_p.A269T|RBFOX2_ENST00000405409.2_Missense_Mutation_p.A266T|RBFOX2_ENST00000262829.7_Missense_Mutation_p.A247T	NM_001082578.1|NM_001082579.1	NP_001076047|NP_001076048.1	O43251	RFOX2_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 2	279	Ala-rich.				dendrite morphogenesis (GO:0048813)|intracellular estrogen receptor signaling pathway (GO:0030520)|mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of cell proliferation (GO:0042127)|regulation of definitive erythrocyte differentiation (GO:0010724)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.A266T(3)		endometrium(4)|large_intestine(7)|lung(7)	18						CCTCTGAAAGCGGCTGCCGTG	0.537																																					p.A339T												.	.	3	Substitution - Missense(3)	large_intestine(2)|endometrium(1)	c.G1015A	22						.						61.0	62.0	62.0					22																	36156026		2203	4300	6503	34485972	SO:0001583	missense	23543	exon10			AL009266	CCDS13921.1, CCDS43013.1, CCDS46699.1, CCDS46700.1, CCDS46701.1	22q12-q13	2013-02-12	2010-09-10	2010-09-10	ENSG00000100320	ENSG00000100320		"""RNA binding motif (RRM) containing"""	9906	protein-coding gene	gene with protein product	"""hexaribonucleotide binding protein 2"""	612149	"""RNA binding motif protein 9"""	RBM9			Standard	NM_014309		Approved	HNRBP2, FOX-2, HRNBP2	uc003aon.4	O43251	OTTHUMG00000150585	ENST00000438146.2:c.1018G>A	22.37:g.36156026C>T	ENSP00000413035:p.Ala340Thr	Somatic		Capture	SOLID	Phase_I	34485972	NM_001082579	A4F5G8|A8K5Z5|B0QYY8|B0QYY9|Q0PRL5|Q0VH35|Q5TF71|Q6IC09|Q8TD00|Q8WYB1|Q96DZ6|Q96NL7|Q9UGW4|Q9UH33	Missense_Mutation	SNP	ENST00000438146.2	37	CCDS43013.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695825	0.68386	.	.	ENSG00000100320	ENST00000405409;ENST00000338644;ENST00000414461;ENST00000449924;ENST00000262829;ENST00000397303;ENST00000359369;ENST00000416721;ENST00000438146	T;T;T;T;T;T;T	0.56776	1.23;0.94;0.52;0.74;1.24;0.73;0.44	5.48	5.48	0.80851	.	0.049338	0.85682	D	0.000000	T	0.69593	0.3128	L	0.49350	1.555	0.48901	D	0.999728	D;P;P;P;P;D;D;D;D	0.89917	0.961;0.939;0.939;0.858;0.939;0.994;0.983;1.0;0.961	B;B;B;B;B;P;P;D;P	0.91635	0.304;0.154;0.154;0.109;0.154;0.842;0.566;0.999;0.692	T	0.71457	-0.4587	10	0.87932	D	0	.	19.3581	0.94422	0.0:1.0:0.0:0.0	.	245;339;340;247;265;266;269;269;246	B0QYY4;O43251-6;O43251-8;O43251-3;O43251-5;O43251-9;O43251-10;O43251-4;B0QYV1	.;.;.;.;.;.;.;.;.	T	266;275;269;269;247;246;245;265;340	ENSP00000384944:A266T;ENSP00000407855:A269T;ENSP00000391670:A269T;ENSP00000380470:A246T;ENSP00000352328:A245T;ENSP00000405651:A265T;ENSP00000413035:A340T	ENSP00000262829:A247T	A	-	1	0	RBFOX2	34485972	0.997000	0.39634	0.999000	0.59377	0.990000	0.78478	3.400000	0.52594	2.581000	0.87130	0.563000	0.77884	GCT		0.537	RBFOX2-005	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319299.3		
DDX17	10521	hgsc.bcm.edu	37	22	38883897	38883897	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:38883897G>A	ENST00000396821.3	-	12	1770	c.1671C>T	c.(1669-1671)ggC>ggT	p.G557G	DDX17_ENST00000432525.1_5'Flank|DDX17_ENST00000381633.3_Silent_p.G480G|DDX17_ENST00000444597.1_Silent_p.G9G	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	555	Poly-Gly.|Transactivation domain.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)	p.G557G(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					CGCCTCCGCCGCCTCCTCTGT	0.498																																					p.G557G	Ovarian(55;1085 1454 6392 21425)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1671T	22						.						87.0	79.0	81.0					22																	38883897		2203	4300	6503	37213843	SO:0001819	synonymous_variant	10521	exon12			U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.1671C>T	22.37:g.38883897G>A		Somatic		Capture	SOLID	Phase_I	37213843	NM_001098504	B1AHM0|Q69YT1|Q6ICD6	Silent	SNP	ENST00000396821.3	37	CCDS46706.1																																																																																				0.498	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881	
PARVB	29780	hgsc.bcm.edu	37	22	44553944	44553944	+	Missense_Mutation	SNP	C	C	T	rs200342928		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:44553944C>T	ENST00000338758.7	+	11	989	c.926C>T	c.(925-927)cCg>cTg	p.P309L	PARVB_ENST00000404989.1_Missense_Mutation_p.P272L|PARVB_ENST00000406477.3_Missense_Mutation_p.P342L	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	309	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)		p.P342L(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				TACCTGACTCCGGAAAGCTTC	0.498																																					p.P342L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1025T	22						.						112.0	86.0	95.0					22																	44553944		2203	4300	6503	42885277	SO:0001583	missense	29780	exon12			AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.926C>T	22.37:g.44553944C>T	ENSP00000342492:p.Pro309Leu	Somatic		Capture	SOLID	Phase_I	42885277	NM_001003828	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Missense_Mutation	SNP	ENST00000338758.7	37	CCDS14056.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887866	0.72410	.	.	ENSG00000188677	ENST00000406477;ENST00000338758;ENST00000404989	T;T;T	0.60797	0.16;0.16;0.16	4.45	3.43	0.39272	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.78349	0.4269	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.992;0.995;0.997;0.994	T	0.80670	-0.1279	10	0.87932	D	0	-2.1534	9.9471	0.41616	0.0:0.898:0.0:0.102	.	309;272;309;342	A6NG58;B0QYM8;Q9HBI1;Q9HBI1-2	.;.;PARVB_HUMAN;.	L	342;309;272	ENSP00000384515:P342L;ENSP00000342492:P309L;ENSP00000384353:P272L	ENSP00000342492:P309L	P	+	2	0	PARVB	42885277	1.000000	0.71417	0.762000	0.31397	0.869000	0.49853	7.207000	0.77899	0.858000	0.35431	0.514000	0.50259	CCG		0.498	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828	
PARVB	29780	hgsc.bcm.edu	37	22	44559771	44559771	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:44559771C>T	ENST00000338758.7	+	12	1042	c.979C>T	c.(979-981)Ctg>Ttg	p.L327L	PARVB_ENST00000404989.1_Silent_p.L290L|PARVB_ENST00000406477.3_Silent_p.L360L	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	327	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)		p.L360L(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				TGAGCTGATGCTGGACGGAGG	0.612																																					p.L360L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1078T	22						.						131.0	96.0	108.0					22																	44559771		2203	4300	6503	42891104	SO:0001819	synonymous_variant	29780	exon13			AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.979C>T	22.37:g.44559771C>T		Somatic		Capture	SOLID	Phase_I	42891104	NM_001003828	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	ENST00000338758.7	37	CCDS14056.1																																																																																				0.612	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828	
PPP6R2	9701	hgsc.bcm.edu	37	22	50876286	50876286	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr22:50876286G>T	ENST00000216061.5	+	18	2166	c.1796G>T	c.(1795-1797)aGg>aTg	p.R599M	PPP6R2_ENST00000395744.3_Missense_Mutation_p.R572M|PPP6R2_ENST00000395741.3_Missense_Mutation_p.R573M|PPP6R2_ENST00000359139.3_Missense_Mutation_p.R572M			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	599						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.R572M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						CCGTTTGACAGGATCGCAGAG	0.627																																					p.R572M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1715T	22						.						61.0	43.0	49.0					22																	50876286		2167	4222	6389	49223152	SO:0001583	missense	9701	exon16			AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1796G>T	22.37:g.50876286G>T	ENSP00000216061:p.Arg599Met	Somatic		Capture	SOLID	Phase_I	49223152	NM_014678	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	37		.	.	.	.	.	.	.	.	.	.	G	19.64	3.865258	0.71949	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.39229	1.09;1.1;1.11;1.24	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.68357	0.2992	M	0.80847	2.515	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;1.0;0.999;0.993;1.0;0.993	T	0.72070	-0.4401	10	0.87932	D	0	-33.6815	18.3343	0.90282	0.0:0.0:1.0:0.0	.	131;599;599;573;572;572	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	M	572;573;572;599	ENSP00000352051:R572M;ENSP00000379090:R573M;ENSP00000379093:R572M;ENSP00000216061:R599M	ENSP00000216061:R599M	R	+	2	0	PPP6R2	49223152	1.000000	0.71417	1.000000	0.80357	0.231000	0.25187	7.038000	0.76537	2.636000	0.89361	0.313000	0.20887	AGG		0.627	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
FDX1L	112812	hgsc.bcm.edu	37	19	10421251	10421251	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:10421251G>A	ENST00000393708.3	-	5	481	c.463C>T	c.(463-465)Ctg>Ttg	p.L155L	FDX1L_ENST00000492239.1_5'UTR|ZGLP1_ENST00000403903.3_5'Flank|ZGLP1_ENST00000403352.1_5'Flank|CTD-2369P2.10_ENST00000452032.2_Silent_p.C142C|FDX1L_ENST00000494368.1_Silent_p.L20L|FDX1L_ENST00000541276.1_Silent_p.C145C	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like	155	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)	p.L155L(1)		NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			TCCGGTGTCAGCACAATCTGG	0.602																																					p.L155L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C463T	19						.						99.0	83.0	88.0					19																	10421251		2203	4300	6503	10282251	SO:0001819	synonymous_variant	112812	exon5			AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299	ENST00000393708.3:c.463C>T	19.37:g.10421251G>A		Somatic		Capture	SOLID	Phase_I	10282251	NM_001031734	Q8N8B8	Silent	SNP	ENST00000393708.3	37	CCDS32905.1																																																																																				0.602	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280567.2		
SMARCA4	6597	hgsc.bcm.edu	37	19	11123644	11123644	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:11123644T>G	ENST00000429416.3	+	17	2575	c.2294T>G	c.(2293-2295)cTg>cGg	p.L765R	SMARCA4_ENST00000413806.3_Missense_Mutation_p.L765R|CTC-215O4.4_ENST00000587831.1_RNA|SMARCA4_ENST00000344626.4_Missense_Mutation_p.L765R|SMARCA4_ENST00000450717.3_Missense_Mutation_p.L765R|RN7SL192P_ENST00000584303.1_RNA|SMARCA4_ENST00000590574.1_Missense_Mutation_p.L765R|SMARCA4_ENST00000358026.2_Missense_Mutation_p.L765R|SMARCA4_ENST00000589677.1_Missense_Mutation_p.L765R|SMARCA4_ENST00000541122.2_Missense_Mutation_p.L765R|SMARCA4_ENST00000444061.3_Missense_Mutation_p.L765R	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	765					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)|p.L765R(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TTGGAGTGGCTGGTGTCCCTG	0.592			"""F, N, Mis"""		NSCLC																																p.L765R			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|lung(1)	c.T2294G	19						.						115.0	93.0	100.0					19																	11123644		2203	4300	6503	10984644	SO:0001583	missense	6597	exon16			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2294T>G	19.37:g.11123644T>G	ENSP00000395654:p.Leu765Arg	Somatic		Capture	SOLID	Phase_I	10984644	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.052105	0.75960	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64;-3.64;-3.64;-3.64	4.73	3.72	0.42706	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.64402	D	0.000007	D	0.98248	0.9420	H	0.99074	4.42	0.49213	D	0.999764	D;D;D;D;D;D;D	0.71674	0.996;0.996;0.996;0.998;0.996;0.996;0.996	D;D;D;D;D;D;D	0.79108	0.985;0.985;0.985;0.992;0.959;0.985;0.985	D	0.97334	0.9952	10	0.87932	D	0	-29.9803	9.4512	0.38727	0.0:0.0859:0.0:0.9141	.	765;765;765;765;765;765;765	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	R	765;765;829;765;765;765;765;765	ENSP00000395654:L765R;ENSP00000350720:L765R;ENSP00000343896:L765R;ENSP00000445036:L765R;ENSP00000392837:L765R;ENSP00000397783:L765R;ENSP00000414727:L765R	ENSP00000343896:L765R	L	+	2	0	SMARCA4	10984644	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.868000	0.87116	0.845000	0.35118	0.533000	0.62120	CTG		0.592	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
KLF1	10661	hgsc.bcm.edu	37	19	12997903	12997903	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:12997903C>A	ENST00000264834.4	-	1	92	c.52G>T	c.(52-54)Ggc>Tgc	p.G18C		NM_006563.3	NP_006554.1	Q13351	KLF1_HUMAN	Kruppel-like factor 1 (erythroid)	18	Pro-rich.				cellular response to peptide (GO:1901653)|chromatin remodeling (GO:0006338)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G18C(1)		endometrium(3)|large_intestine(1)|skin(1)	5		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAAGGGGCCCAGGGCGGTC	0.652																																					p.G18C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G52T	19						.						109.0	95.0	100.0					19																	12997903		2203	4300	6503	12858903	SO:0001583	missense	10661	exon1			U37106	CCDS12285.1	19p13.2	2014-07-18			ENSG00000105610	ENSG00000105610		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6345	protein-coding gene	gene with protein product	"""erythroid Kruppel-like factor"""	600599				8924208, 9119377	Standard	NM_006563		Approved	EKLF	uc002mvo.3	Q13351	OTTHUMG00000180536	ENST00000264834.4:c.52G>T	19.37:g.12997903C>A	ENSP00000264834:p.Gly18Cys	Somatic		Capture	SOLID	Phase_I	12858903	NM_006563	Q6PIJ5|Q92899	Missense_Mutation	SNP	ENST00000264834.4	37	CCDS12285.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659325	0.67586	.	.	ENSG00000105610	ENST00000264834	T	0.16196	2.36	4.87	4.87	0.63330	.	0.000000	0.39985	N	0.001202	T	0.27278	0.0669	L	0.27053	0.805	0.34445	D	0.7	D	0.89917	1.0	D	0.71656	0.974	T	0.24119	-1.0169	10	0.51188	T	0.08	.	13.388	0.60807	0.0:1.0:0.0:0.0	.	18	Q13351	KLF1_HUMAN	C	18	ENSP00000264834:G18C	ENSP00000264834:G18C	G	-	1	0	KLF1	12858903	0.897000	0.30589	0.989000	0.46669	0.473000	0.32948	0.517000	0.22832	2.542000	0.85734	0.561000	0.74099	GGC		0.652	KLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451794.1	NM_006563	
IL27RA	9466	hgsc.bcm.edu	37	19	14161645	14161645	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:14161645C>T	ENST00000263379.2	+	11	1603	c.1478C>T	c.(1477-1479)aCc>aTc	p.T493I		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	493	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.T493I(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						ACAGCATCTACCATCGCTGGA	0.582																																					p.T493I	Colon(164;1849 1896 4443 37792 47834)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1478T	19						.						108.0	80.0	89.0					19																	14161645		2203	4300	6503	14022645	SO:0001583	missense	9466	exon11			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1478C>T	19.37:g.14161645C>T	ENSP00000263379:p.Thr493Ile	Somatic		Capture	SOLID	Phase_I	14022645	NM_004843	A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	37	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.042032	0.35989	.	.	ENSG00000104998	ENST00000263379	T	0.58940	0.3	4.69	3.64	0.41730	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.180319	0.26987	N	0.021490	T	0.62319	0.2418	L	0.32530	0.975	0.35349	D	0.787179	D	0.76494	0.999	D	0.67103	0.949	T	0.71279	-0.4640	10	0.87932	D	0	.	10.2821	0.43545	0.1969:0.8031:0.0:0.0	.	493	Q6UWB1	I27RA_HUMAN	I	493	ENSP00000263379:T493I	ENSP00000263379:T493I	T	+	2	0	IL27RA	14022645	0.985000	0.35326	0.763000	0.31416	0.068000	0.16541	2.152000	0.42272	0.936000	0.37367	0.461000	0.40582	ACC		0.582	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	
OR7C1	26664	hgsc.bcm.edu	37	19	14910860	14910860	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:14910860A>G	ENST00000248073.2	-	1	163	c.89T>C	c.(88-90)cTg>cCg	p.L30P	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	30					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L30P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						GGAGAGGAACAGCCCAAAGAG	0.478																																					p.L30P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T89C	19						.						91.0	81.0	85.0					19																	14910860		2203	4300	6503	14771860	SO:0001583	missense	26664	exon1			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.89T>C	19.37:g.14910860A>G	ENSP00000248073:p.Leu30Pro	Somatic		Capture	SOLID	Phase_I	14771860	NM_198944	Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	ENST00000248073.2	37	CCDS12317.1	.	.	.	.	.	.	.	.	.	.	a	14.26	2.481270	0.44147	.	.	ENSG00000127530	ENST00000248073	T	0.17691	2.26	3.52	3.52	0.40303	.	0.000000	0.29980	U	0.010716	T	0.42966	0.1226	M	0.86573	2.825	0.09310	N	0.999995	D	0.76494	0.999	D	0.69824	0.966	T	0.27331	-1.0077	10	0.72032	D	0.01	.	10.2983	0.43637	1.0:0.0:0.0:0.0	.	30	O76099	OR7C1_HUMAN	P	30	ENSP00000248073:L30P	ENSP00000248073:L30P	L	-	2	0	OR7C1	14771860	0.021000	0.18746	0.065000	0.19835	0.185000	0.23345	2.973000	0.49264	1.592000	0.50018	0.443000	0.29094	CTG		0.478	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1		
ZNF555	148254	hgsc.bcm.edu	37	19	2852634	2852634	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:2852634G>A	ENST00000334241.4	+	4	709	c.571G>A	c.(571-573)Gtg>Atg	p.V191M	ZNF555_ENST00000591539.1_Missense_Mutation_p.V190M|AC006130.3_ENST00000589365.1_RNA	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V191M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGAATGCATGTGAGAACCCA	0.478																																					p.V190M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G568A	19						.						152.0	130.0	138.0					19																	2852634		2203	4300	6503	2803634	SO:0001583	missense	148254	exon4			AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.571G>A	19.37:g.2852634G>A	ENSP00000334853:p.Val191Met	Somatic		Capture	SOLID	Phase_I	2803634	NM_001172775	A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	ENST00000334241.4	37	CCDS12096.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.236330	0.39498	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.04917	3.53	3.4	-5.05	0.02955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02727	0.0082	N	0.04787	-0.16	0.09310	N	1	B;B	0.29909	0.261;0.002	B;B	0.30251	0.113;0.007	T	0.45440	-0.9261	9	0.51188	T	0.08	.	5.8236	0.18540	0.5509:0.2248:0.2244:0.0	.	191;190	Q8NEP9;A8KA89	ZN555_HUMAN;.	M	191;190	ENSP00000334853:V191M	ENSP00000334853:V191M	V	+	1	0	ZNF555	2803634	0.000000	0.05858	0.000000	0.03702	0.919000	0.55068	-1.053000	0.03500	-0.651000	0.05415	-0.258000	0.10820	GTG		0.478	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451637.3	NM_152791	
TMEM161A	54929	hgsc.bcm.edu	37	19	19243228	19243228	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:19243228T>C	ENST00000162044.9	-	5	440	c.376A>G	c.(376-378)Atg>Gtg	p.M126V	TMEM161A_ENST00000450333.2_Intron|TMEM161A_ENST00000592147.1_5'Flank|TMEM161A_ENST00000587583.2_Missense_Mutation_p.M101V	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	126					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			GGTCCCAGCATGTAGTAGTAG	0.577																																					p.M126V												.	.	0			c.A376G	19						.						167.0	149.0	155.0					19																	19243228		2203	4300	6503	19104228	SO:0001583	missense	54929	exon5			BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.376A>G	19.37:g.19243228T>C	ENSP00000162044:p.Met126Val	Somatic		Capture	SOLID	Phase_I	19104228	NM_017814	B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	ENST00000162044.9	37	CCDS12393.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.339371	0.00017	.	.	ENSG00000064545	ENST00000162044	.	.	.	3.74	-7.48	0.01360	.	0.948828	0.08734	N	0.901642	T	0.05502	0.0145	N	0.00246	-1.78	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42649	-0.9439	9	0.14252	T	0.57	-20.0459	7.6241	0.28202	0.0:0.3566:0.3764:0.2669	.	126	Q9NX61	T161A_HUMAN	V	126	.	ENSP00000162044:M126V	M	-	1	0	TMEM161A	19104228	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.943000	0.03917	-1.546000	0.01717	-1.538000	0.00913	ATG		0.577	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460089.2	NM_017814	
CD22	933	hgsc.bcm.edu	37	19	35832692	35832692	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:35832692C>T	ENST00000085219.5	+	9	1925	c.1859C>T	c.(1858-1860)gCc>gTc	p.A620V	CD22_ENST00000270311.6_Missense_Mutation_p.A500V|CD22_ENST00000544992.2_Missense_Mutation_p.A620V|CD22_ENST00000594250.1_Missense_Mutation_p.A443V|CD22_ENST00000536635.2_Missense_Mutation_p.A532V|CD22_ENST00000341773.6_Missense_Mutation_p.A443V|CD22_ENST00000419549.2_Missense_Mutation_p.A448V	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	620	Ig-like C2-type 6.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.A620V(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GAGAGCGACGCCAACCCTCCC	0.612																																					p.A620V	Ovarian(42;1009 1133 23674 26041)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1859T	19						.						130.0	105.0	113.0					19																	35832692		2203	4300	6503	40524532	SO:0001583	missense	933	exon9			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1859C>T	19.37:g.35832692C>T	ENSP00000085219:p.Ala620Val	Somatic		Capture	SOLID	Phase_I	40524532	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	37	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473285	0.63737	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992;ENST00000270311;ENST00000419549	T;T;T;T;T;T	0.12672	2.66;2.66;2.66;2.66;2.66;2.66	5.39	5.39	0.77823	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000080	T	0.47248	0.1435	M	0.93106	3.38	0.40057	D	0.975846	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	T	0.59804	-0.7385	10	0.87932	D	0	.	14.648	0.68774	0.0:1.0:0.0:0.0	.	448;620;532;620;443	Q32M46;F5GYU4;F5H7U3;P20273;P20273-2	.;.;.;CD22_HUMAN;.	V	620;532;443;620;500;448	ENSP00000085219:A620V;ENSP00000442279:A532V;ENSP00000339349:A443V;ENSP00000441237:A620V;ENSP00000270311:A500V;ENSP00000403822:A448V	ENSP00000085219:A620V	A	+	2	0	CD22	40524532	1.000000	0.71417	0.999000	0.59377	0.194000	0.23727	3.933000	0.56545	2.548000	0.85928	0.561000	0.74099	GCC		0.612	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
YIF1B	90522	hgsc.bcm.edu	37	19	38799470	38799470	+	Silent	SNP	G	G	A	rs117905757	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:38799470G>A	ENST00000339413.6	-	5	546	c.501C>T	c.(499-501)taC>taT	p.Y167Y	YIF1B_ENST00000337679.8_Silent_p.Y164Y|YIF1B_ENST00000592694.1_Silent_p.Y136Y|YIF1B_ENST00000591784.1_Silent_p.Y136Y|YIF1B_ENST00000591755.1_Silent_p.Y164Y|YIF1B_ENST00000329420.8_Silent_p.Y152Y|YIF1B_ENST00000592246.1_Silent_p.Y101Y|YIF1B_ENST00000587361.1_5'UTR|YIF1B_ENST00000392124.3_Silent_p.Y136Y	NM_001039672.2|NM_001039673.2	NP_001034761.1|NP_001034762.1	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B (S. cerevisiae)	167						integral component of membrane (GO:0016021)		p.Y136Y(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)	10	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCACCAAAACGTAGGTGATGA	0.602													G|||	7	0.00139776	0.0	0.0	5008	,	,		17204	0.0069		0.0	False		,,,				2504	0.0				p.Y136Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C408T	19						.						182.0	180.0	180.0					19																	38799470		2203	4300	6503	43491310	SO:0001819	synonymous_variant	90522	exon5			AL833382	CCDS12512.1, CCDS33010.1, CCDS46066.1, CCDS46067.1	19q13.2	2008-02-05							30511	protein-coding gene	gene with protein product						12975309	Standard	NM_001039672		Approved	FinGER8	uc002ohz.2	Q5BJH7		ENST00000339413.6:c.501C>T	19.37:g.38799470G>A		Somatic		Capture	SOLID	Phase_I	43491310	NM_001145462	H7BXS8|Q5JPC2|Q8WY70|Q96C02|Q96IC4	Silent	SNP	ENST00000339413.6	37	CCDS33010.1																																																																																				0.602	YIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460511.1	NM_033557	
FCGBP	8857	hgsc.bcm.edu	37	19	40433201	40433201	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:40433201G>A	ENST00000221347.6	-	2	1075	c.1068C>T	c.(1066-1068)ggC>ggT	p.G356G		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	356	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)		p.G356G(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCAGGGCCACGCCCTCACAGC	0.597																																					p.G356G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1068T	19						.						86.0	66.0	73.0					19																	40433201		2203	4300	6503	45125041	SO:0001819	synonymous_variant	8857	exon2			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.1068C>T	19.37:g.40433201G>A		Somatic		Capture	SOLID	Phase_I	45125041	NM_003890	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
CEACAM6	4680	hgsc.bcm.edu	37	19	42260620	42260620	+	Silent	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:42260620C>A	ENST00000199764.6	+	2	395	c.177C>A	c.(175-177)ccC>ccA	p.P59P	AC011513.4_ENST00000601409.1_RNA|CEA_ENST00000598976.1_Intron	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	59	Ig-like V-type.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P59P(1)		breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		ACAACCTGCCCCAGAATCGTA	0.512																																					p.P59P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C177A	19						.						191.0	173.0	179.0					19																	42260620		2203	4300	6503	46952460	SO:0001819	synonymous_variant	4680	exon2			M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.177C>A	19.37:g.42260620C>A		Somatic		Capture	SOLID	Phase_I	46952460	NM_002483	Q13774|Q14920|Q53XP7	Silent	SNP	ENST00000199764.6	37	CCDS12585.1																																																																																				0.512	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321147.1		
LYPD4	147719	hgsc.bcm.edu	37	19	42342040	42342040	+	Silent	SNP	C	C	T	rs375253640		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:42342040C>T	ENST00000330743.3	-	4	1718	c.507G>A	c.(505-507)acG>acA	p.T169T	LYPD4_ENST00000343055.4_Silent_p.T134T|AC020956.3_ENST00000593354.1_lincRNA|LYPD4_ENST00000601246.1_Silent_p.T134T	NM_173506.4	NP_775777.3	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4	169	UPAR/Ly6.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.T169T(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)	12						AACTGTAACACGTAGAAGCAG	0.493																																					p.T169T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G507A	19						.			1,4405	2.1+/-5.4	0,1,2202	57.0	56.0	57.0		507	-6.3	0.0	19		57	0,8600		0,0,4300	no	coding-synonymous	LYPD4	NM_173506.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		169/247	42342040	1,13005	2203	4300	6503	47033880	SO:0001819	synonymous_variant	147719	exon4			AY358726	CCDS12587.1	19q13.2	2008-02-05				ENSG00000273111			28659	protein-coding gene	gene with protein product						12975309	Standard	XM_005278383		Approved	MGC42718	uc002orp.1	Q6UWN0		ENST00000330743.3:c.507G>A	19.37:g.42342040C>T		Somatic		Capture	SOLID	Phase_I	47033880	NM_173506	Q8IYW0	Silent	SNP	ENST00000330743.3	37	CCDS12587.1																																																																																				0.493	LYPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463039.1	NM_173506	
SMG9	56006	hgsc.bcm.edu	37	19	44249019	44249019	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:44249019A>G	ENST00000270066.6	-	6	948	c.606T>C	c.(604-606)acT>acC	p.T202T	SMG9_ENST00000601170.1_Silent_p.T202T	NM_019108.2	NP_061981.2	Q9H0W8	SMG9_HUMAN	SMG9 nonsense mediated mRNA decay factor	202					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|intracellular (GO:0005622)	identical protein binding (GO:0042802)	p.T202T(1)		kidney(1)|large_intestine(5)|liver(1)|lung(7)|pancreas(1)|prostate(2)|urinary_tract(2)	19						CCAACACATCAGTCTGATCCA	0.537											OREG0025533	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T202T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T606C	19						.						166.0	121.0	136.0					19																	44249019		2203	4300	6503	48940859	SO:0001819	synonymous_variant	56006	exon6			BC008869	CCDS33043.2	19q13.31	2013-07-02	2013-07-02	2011-06-21	ENSG00000105771	ENSG00000105771			25763	protein-coding gene	gene with protein product		613176	"""chromosome 19 open reading frame 61"", ""smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C19orf61		11230166, 19417104	Standard	NM_019108		Approved	FLJ12886	uc002oxj.2	Q9H0W8	OTTHUMG00000150337	ENST00000270066.6:c.606T>C	19.37:g.44249019A>G		Somatic	922	Capture	SOLID	Phase_I	48940859	NM_019108	O60429|Q9H9A9	Silent	SNP	ENST00000270066.6	37	CCDS33043.2																																																																																				0.537	SMG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317668.1	NM_019108	
KCNJ14	3770	hgsc.bcm.edu	37	19	48965194	48965194	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:48965194G>A	ENST00000391884.1	+	1	689	c.213G>A	c.(211-213)gcG>gcA	p.A71A	KCNJ14_ENST00000342291.2_Silent_p.A71A			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14	71					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.A71A(1)		cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	GCCAGGGCGCGCGCTACCTGA	0.667																																					p.A71A	NSCLC(148;170 3504 35216)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G213A	19						.						61.0	36.0	45.0					19																	48965194		2203	4300	6503	53657006	SO:0001819	synonymous_variant	3770	exon2			BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.213G>A	19.37:g.48965194G>A		Somatic		Capture	SOLID	Phase_I	53657006	NM_013348		Silent	SNP	ENST00000391884.1	37	CCDS12721.1																																																																																				0.667	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466127.1	NM_013348	
GYS1	2997	hgsc.bcm.edu	37	19	49488822	49488822	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:49488822T>C	ENST00000323798.3	-	5	915	c.719A>G	c.(718-720)cAc>cGc	p.H240R	GYS1_ENST00000544287.1_Intron|GYS1_ENST00000263276.6_Missense_Mutation_p.H176R|GYS1_ENST00000541188.1_Missense_Mutation_p.H160R|GYS1_ENST00000540532.1_Missense_Mutation_p.H160R|GYS1_ENST00000457974.1_5'Flank	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	240					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)	p.H240R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GCAGTATCGGTGGTAGATCTG	0.577																																					p.H240R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A719G	19						.						127.0	95.0	106.0					19																	49488822		2203	4300	6503	54180634	SO:0001583	missense	2997	exon5				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.719A>G	19.37:g.49488822T>C	ENSP00000317904:p.His240Arg	Somatic		Capture	SOLID	Phase_I	54180634	NM_002103	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.160285	0.78226	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000540532	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.998;0.983;0.999	D	0.89600	0.3834	10	0.87932	D	0	-37.7552	12.5246	0.56079	0.0:0.0:0.0:1.0	.	160;176;240	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	R	240;176;160;160	ENSP00000317904:H240R;ENSP00000263276:H176R;ENSP00000437922:H160R;ENSP00000445197:H160R	ENSP00000263276:H176R	H	-	2	0	GYS1	54180634	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.763000	0.85283	1.913000	0.55393	0.374000	0.22700	CAC		0.577	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
LILRA5	353514	hgsc.bcm.edu	37	19	54818815	54818815	+	Silent	SNP	G	G	A	rs201689439		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:54818815G>A	ENST00000301219.3	-	7	902	c.783C>T	c.(781-783)taC>taT	p.Y261Y	AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000346508.3_Silent_p.Y249Y	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	261					innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.Y261Y(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCTCTACTGCGTAATCCTGAA	0.567																																					p.Y261Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C783T	19						.						102.0	94.0	97.0					19																	54818815		2203	4300	6503	59510627	SO:0001819	synonymous_variant	353514	exon7			AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.783C>T	19.37:g.54818815G>A		Somatic		Capture	SOLID	Phase_I	59510627	NM_021250	A6NHI3	Silent	SNP	ENST00000301219.3	37	CCDS12888.1																																																																																				0.567	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985	
PPP1R12C	54776	hgsc.bcm.edu	37	19	55602865	55602865	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:55602865C>T	ENST00000263433.3	-	22	2339	c.2324G>A	c.(2323-2325)cGc>cAc	p.R775H	PPP1R12C_ENST00000376393.2_Missense_Mutation_p.R712H|PPP1R12C_ENST00000435544.2_Missense_Mutation_p.R700H	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C									p.R775H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GCTGATGACGCGGATCAACGC	0.627																																					p.R775H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2324A	19						.						72.0	67.0	68.0					19																	55602865		2203	4300	6503	60294677	SO:0001583	missense	54776	exon22			AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.2324G>A	19.37:g.55602865C>T	ENSP00000263433:p.Arg775His	Somatic		Capture	SOLID	Phase_I	60294677	NM_017607		Missense_Mutation	SNP	ENST00000263433.3	37	CCDS12916.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578229	0.65878	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.15952	2.38;2.38;2.38	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000006	T	0.45617	0.1351	M	0.86864	2.845	0.38704	D	0.953067	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.991;0.996;0.991	T	0.57676	-0.7770	10	0.87932	D	0	.	12.4262	0.55548	0.0:1.0:0.0:0.0	.	700;773;775	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	H	775;712;700	ENSP00000263433:R775H;ENSP00000365573:R712H;ENSP00000387833:R700H	ENSP00000263433:R775H	R	-	2	0	PPP1R12C	60294677	0.999000	0.42202	0.924000	0.36721	0.708000	0.40852	4.406000	0.59748	2.070000	0.61991	0.561000	0.74099	CGC		0.627	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
PTPRH	5794	hgsc.bcm.edu	37	19	55718195	55718195	+	Missense_Mutation	SNP	C	C	T	rs139926741	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:55718195C>T	ENST00000376350.3	-	3	236	c.214G>A	c.(214-216)Ggc>Agc	p.G72S	PTPRH_ENST00000263434.5_Missense_Mutation_p.G72S|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	72	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G72S(1)		breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TCTGTTGTGCCGCCGTCTCCA	0.572													C|||	2	0.000399361	0.0	0.0	5008	,	,		15136	0.0		0.002	False		,,,				2504	0.0				p.G72S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214A	19						.	C	SER/GLY,SER/GLY	0,4406		0,0,2203	150.0	125.0	133.0		214,214	-1.7	0.0	19	dbSNP_134	133	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	PTPRH	NM_001161440.1,NM_002842.3	56,56	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	possibly-damaging,possibly-damaging	72/938,72/1116	55718195	6,13000	2203	4300	6503	60410007	SO:0001583	missense	5794	exon3				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.214G>A	19.37:g.55718195C>T	ENSP00000365528:p.Gly72Ser	Somatic		Capture	SOLID	Phase_I	60410007	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	14.13	2.442432	0.43326	0.0	6.98E-4	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.56941	0.43;0.43	3.42	-1.68	0.08212	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.803958	0.10137	N	0.711311	T	0.31104	0.0786	L	0.55481	1.735	0.09310	N	1	P;P	0.38395	0.629;0.629	B;B	0.24701	0.055;0.055	T	0.23726	-1.0180	10	0.09338	T	0.73	.	2.7976	0.05405	0.2045:0.3865:0.0:0.409	.	72;72	C9JCH2;Q9HD43	.;PTPRH_HUMAN	S	72	ENSP00000365528:G72S;ENSP00000263434:G72S	ENSP00000263434:G72S	G	-	1	0	PTPRH	60410007	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.193000	0.03049	-0.192000	0.10432	-0.324000	0.08512	GGC		0.572	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
ZNF71	58491	hgsc.bcm.edu	37	19	57133933	57133933	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:57133933C>T	ENST00000328070.6	+	3	1512	c.1278C>T	c.(1276-1278)atC>atT	p.I426I		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I426I(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CCTACCTCATCGAGCACCAGC	0.647																																					p.I426I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1278T	19						.						78.0	66.0	70.0					19																	57133933		2203	4300	6503	61825745	SO:0001819	synonymous_variant	58491	exon3			X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1278C>T	19.37:g.57133933C>T		Somatic		Capture	SOLID	Phase_I	61825745	NM_021216	Q15919|Q9UC09|Q9UQD3	Silent	SNP	ENST00000328070.6	37	CCDS12947.1																																																																																				0.647	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
ZIM2	23619	hgsc.bcm.edu	37	19	57293402	57293402	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:57293402C>A	ENST00000391708.3	-	10	1107	c.565G>T	c.(565-567)Gaa>Taa	p.E189*	AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000593711.1_Nonsense_Mutation_p.E189*|AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000221722.5_Nonsense_Mutation_p.E189*|AC006115.3_ENST00000595954.1_RNA|ZIM2_ENST00000601070.1_Nonsense_Mutation_p.E189*|ZIM2_ENST00000599935.1_Nonsense_Mutation_p.E189*	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	189	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E189*(2)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GAACTAAGTTCCTCTGGGCTG	0.507																																					p.E189X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|NS(1)	c.G565T	19						.						164.0	147.0	153.0					19																	57293402		2203	4300	6503	61985214	SO:0001587	stop_gained	23619	exon10			AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.565G>T	19.37:g.57293402C>A	ENSP00000375589:p.Glu189*	Somatic		Capture	SOLID	Phase_I	61985214	NM_001146326	Q2M3K1	Nonsense_Mutation	SNP	ENST00000391708.3	37	CCDS33123.1	.	.	.	.	.	.	.	.	.	.	C	37	6.302839	0.97458	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.4806	0.67579	0.0:1.0:0.0:0.0	.	.	.	.	X	189	.	ENSP00000221722:E189X	E	-	1	0	ZIM2	61985214	0.936000	0.31750	0.949000	0.38748	0.010000	0.07245	0.737000	0.26144	2.884000	0.98904	0.655000	0.94253	GAA		0.507	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2		
HNRNPM	4670	hgsc.bcm.edu	37	19	8528546	8528546	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:8528546C>T	ENST00000325495.4	+	5	455	c.414C>T	c.(412-414)agC>agT	p.S138S	HNRNPM_ENST00000348943.3_Silent_p.S138S	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	138	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)	p.S138S(1)		endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						ATAGTCTGAGCGGAAGACCAC	0.418																																					p.S138S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C414T	19						.						114.0	93.0	100.0					19																	8528546		2203	4300	6503	8434546	SO:0001819	synonymous_variant	4670	exon5			L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.414C>T	19.37:g.8528546C>T		Somatic		Capture	SOLID	Phase_I	8434546	NM_005968	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Silent	SNP	ENST00000325495.4	37	CCDS12203.1																																																																																				0.418	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
ZNF551	90233	hgsc.bcm.edu	37	19	58198462	58198462	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:58198462C>G	ENST00000282296.5	+	3	1004	c.819C>G	c.(817-819)caC>caG	p.H273Q	AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.H257Q|AC003006.7_ENST00000599221.1_Intron|ZNF551_ENST00000596085.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	273					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGCAAATTCACACTGGACAAA	0.418																																					p.H257Q												.	.	0			c.C771G	19						.						104.0	97.0	99.0					19																	58198462		2203	4300	6503	62890274	SO:0001583	missense	90233	exon3			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.819C>G	19.37:g.58198462C>G	ENSP00000282296:p.His273Gln	Somatic		Capture	SOLID	Phase_I	62890274	NM_138347	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	37	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	C	9.328	1.059804	0.19987	.	.	ENSG00000204519	ENST00000356715;ENST00000282296	.	.	.	2.76	1.69	0.24217	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.68165	0.2971	H	0.94847	3.59	0.09310	N	1	D	0.55385	0.971	P	0.56278	0.795	T	0.58792	-0.7574	8	0.87932	D	0	.	6.6632	0.23027	0.0:0.747:0.0:0.253	.	273	Q7Z340	ZN551_HUMAN	Q	273;257	.	ENSP00000282296:H257Q	H	+	3	2	ZNF551	62890274	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	-0.084000	0.11268	0.491000	0.27793	0.561000	0.74099	CAC		0.418	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
DLC1	10395	hgsc.bcm.edu	37	8	12952294	12952294	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:12952294G>A	ENST00000276297.4	-	12	3909	c.3500C>T	c.(3499-3501)tCg>tTg	p.S1167L	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Missense_Mutation_p.S764L|DLC1_ENST00000358919.2_Missense_Mutation_p.S730L|DLC1_ENST00000520226.1_Missense_Mutation_p.S656L	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1167	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.S1167L(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AAAGGTTTCCGAGAGTTTGTT	0.443																																					p.S1167L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3500T	8						.						108.0	100.0	103.0					8																	12952294		2203	4300	6503	12996665	SO:0001583	missense	10395	exon12			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3500C>T	8.37:g.12952294G>A	ENSP00000276297:p.Ser1167Leu	Somatic		Capture	SOLID	Phase_I	12996665	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	32	5.179845	0.94846	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	4.97	4.97	0.65823	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.060649	0.64402	D	0.000002	T	0.36744	0.0978	L	0.45698	1.435	0.80722	D	1	D;D;D	0.89917	0.983;1.0;0.971	P;D;P	0.71656	0.61;0.974;0.832	T	0.05370	-1.0889	10	0.72032	D	0.01	.	18.8143	0.92071	0.0:0.0:1.0:0.0	.	1167;764;730	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	L	1167;730;106;764;656	ENSP00000276297:S1167L;ENSP00000351797:S730L;ENSP00000422595:S764L;ENSP00000428028:S656L	ENSP00000276297:S1167L	S	-	2	0	DLC1	12996665	1.000000	0.71417	0.967000	0.41034	0.860000	0.49131	7.673000	0.83973	2.761000	0.94854	0.650000	0.86243	TCG		0.443	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
DLC1	10395	hgsc.bcm.edu	37	8	12952432	12952432	+	Missense_Mutation	SNP	C	C	T	rs147918530		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:12952432C>T	ENST00000276297.4	-	12	3771	c.3362G>A	c.(3361-3363)cGg>cAg	p.R1121Q	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Missense_Mutation_p.R718Q|DLC1_ENST00000358919.2_Missense_Mutation_p.R684Q|DLC1_ENST00000520226.1_Missense_Mutation_p.R610Q	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1121	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R1121Q(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AGCCTGAATCCGGGACTTGAC	0.502																																					p.R1121Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3362A	8						.	C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	54.0	53.0	54.0		1829,2051,3362	5.0	1.0	8	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	DLC1	NM_001164271.1,NM_006094.4,NM_182643.2	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	610/1018,684/1092,1121/1529	12952432	1,13005	2203	4300	6503	12996803	SO:0001583	missense	10395	exon12			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3362G>A	8.37:g.12952432C>T	ENSP00000276297:p.Arg1121Gln	Somatic		Capture	SOLID	Phase_I	12996803	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	37	5.983079	0.97173	0.0	1.16E-4	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	4.97	4.97	0.65823	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.053277	0.64402	D	0.000001	T	0.51924	0.1703	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	0.985;1.0;1.0	P;D;D	0.76071	0.67;0.987;0.982	T	0.57602	-0.7783	10	0.87932	D	0	.	18.8143	0.92071	0.0:1.0:0.0:0.0	.	1121;718;684	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	Q	1121;684;60;718;610	ENSP00000276297:R1121Q;ENSP00000351797:R684Q;ENSP00000422595:R718Q;ENSP00000428028:R610Q	ENSP00000276297:R1121Q	R	-	2	0	DLC1	12996803	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.633000	0.83260	2.761000	0.94854	0.650000	0.86243	CGG		0.502	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
KIAA0196	9897	hgsc.bcm.edu	37	8	126052062	126052062	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:126052062C>T	ENST00000318410.7	-	24	3278	c.2929G>A	c.(2929-2931)Gca>Aca	p.A977T	KIAA0196_ENST00000517845.1_Missense_Mutation_p.A829T|KIAA0196-AS1_ENST00000519140.1_RNA	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	977					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.A977T(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			AGAGCAGCTGCCAGATGTTTA	0.428																																					p.A977T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2929A	8						.						67.0	65.0	66.0					8																	126052062		2203	4300	6503	126121244	SO:0001583	missense	9897	exon24				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.2929G>A	8.37:g.126052062C>T	ENSP00000318016:p.Ala977Thr	Somatic		Capture	SOLID	Phase_I	126121244	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	37	CCDS6355.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.85|12.85	2.062722|2.062722	0.36373|0.36373	.|.	.|.	ENSG00000164961|ENSG00000164961	ENST00000318410;ENST00000517845|ENST00000523273	D;D|.	0.85861|.	-2.04;-2.04|.	5.59|5.59	4.7|4.7	0.59300|0.59300	.|.	0.048746|.	0.85682|.	D|.	0.000000|.	T|.	0.69824|.	0.3154|.	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	B;B|.	0.27882|.	0.001;0.192|.	B;B|.	0.32211|.	0.002;0.142|.	T|.	0.68606|.	-0.5364|.	10|.	0.17832|.	T|.	0.49|.	-9.8738|-9.8738	15.6953|15.6953	0.77490|0.77490	0.1379:0.8621:0.0:0.0|0.1379:0.8621:0.0:0.0	.|.	829;977|.	E7EQI7;Q12768|.	.;STRUM_HUMAN|.	T|X	977;829|593	ENSP00000318016:A977T;ENSP00000429676:A829T|.	ENSP00000318016:A977T|.	A|W	-|-	1|3	0|0	KIAA0196|KIAA0196	126121244|126121244	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.887000|3.887000	0.56197|0.56197	1.311000|1.311000	0.45024|0.45024	0.561000|0.561000	0.74099|0.74099	GCA|TGG		0.428	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
ADCY8	114	hgsc.bcm.edu	37	8	132051793	132051793	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:132051793C>T	ENST00000286355.5	-	1	2879	c.787G>A	c.(787-789)Ggc>Agc	p.G263S	ADCY8_ENST00000377928.3_Missense_Mutation_p.G263S	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	263					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.G263S(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGCCCGTAGCCGAGGCCTGCT	0.662										HNSCC(32;0.087)																											p.G263S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G787A	8						.						44.0	40.0	41.0					8																	132051793		2203	4300	6503	132120975	SO:0001583	missense	114	exon1			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.787G>A	8.37:g.132051793C>T	ENSP00000286355:p.Gly263Ser	Somatic		Capture	SOLID	Phase_I	132120975	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848282	0.71603	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.44482	0.92;0.92	5.46	5.46	0.80206	.	0.065193	0.64402	D	0.000011	T	0.29093	0.0723	L	0.39245	1.2	0.50813	D	0.999899	P;P	0.47545	0.897;0.897	B;B	0.32149	0.103;0.141	T	0.18023	-1.0350	10	0.09590	T	0.72	.	18.2863	0.90115	0.0:1.0:0.0:0.0	.	263;263	E7EVL1;P40145	.;ADCY8_HUMAN	S	263	ENSP00000286355:G263S;ENSP00000367161:G263S	ENSP00000286355:G263S	G	-	1	0	ADCY8	132120975	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	7.463000	0.80869	2.580000	0.87095	0.455000	0.32223	GGC		0.662	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ERICH1	157697	hgsc.bcm.edu	37	8	623504	623504	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:623504G>A	ENST00000262109.7	-	4	925	c.848C>T	c.(847-849)aCa>aTa	p.T283I	ERICH1_ENST00000522706.1_Missense_Mutation_p.T189I|ERICH1_ENST00000518277.1_5'Flank	NM_207332.1	NP_997215.1	Q86X53	ERIC1_HUMAN	glutamate-rich 1	283	Glu-rich.							p.T283I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)	20		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		CCCGGCCCGTGTCAGGTCTTC	0.647																																					p.T283I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C848T	8						.						125.0	127.0	127.0					8																	623504		2203	4300	6503	613504	SO:0001583	missense	157697	exon4				CCDS5955.1	8p23.3	2005-09-01			ENSG00000104714	ENSG00000104714			27234	protein-coding gene	gene with protein product							Standard	NM_207332		Approved		uc003wph.3	Q86X53	OTTHUMG00000129163	ENST00000262109.7:c.848C>T	8.37:g.623504G>A	ENSP00000262109:p.Thr283Ile	Somatic		Capture	SOLID	Phase_I	613504	NM_207332	A8K2J9|Q9P063	Missense_Mutation	SNP	ENST00000262109.7	37	CCDS5955.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.257|2.257	-0.370190|-0.370190	0.05069|0.05069	.|.	.|.	ENSG00000104714|ENSG00000104714	ENST00000522893|ENST00000543819;ENST00000522706;ENST00000262109	.|T;T	.|0.32753	.|1.44;1.49	0.858|0.858	-0.192|-0.192	0.13248|0.13248	.|.	.|6.904030	.|0.00447	.|N	.|0.000089	T|T	0.41096|0.41096	0.1144|0.1144	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	1|1	.|P;D;P	.|0.62365	.|0.722;0.991;0.689	.|B;D;B	.|0.65323	.|0.156;0.934;0.096	T|T	0.15983|0.15983	-1.0418|-1.0418	5|10	.|0.39692	.|T	.|0.17	.|.	2.8738|2.8738	0.05625|0.05625	0.2943:0.3883:0.3173:0.0|0.2943:0.3883:0.3173:0.0	.|.	.|283;283;189	.|B4DMI5;Q86X53;E5RHA3	.|.;ERIC1_HUMAN;.	Y|I	52|283;189;283	.|ENSP00000428635:T189I;ENSP00000262109:T283I	.|ENSP00000262109:T283I	H|T	-|-	1|2	0|0	ERICH1|ERICH1	613504|613504	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.000000|0.000000	0.00434|0.00434	-0.570000|-0.570000	0.05895|0.05895	-0.090000|-0.090000	0.12462|0.12462	-0.688000|-0.688000	0.03733|0.03733	CAC|ACA		0.647	ERICH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251228.3	NM_207332	
ARHGEF10	9639	hgsc.bcm.edu	37	8	1857522	1857522	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:1857522C>A	ENST00000398564.1	+	18	2104	c.2104C>A	c.(2104-2106)Ctg>Atg	p.L702M	ARHGEF10_ENST00000520359.1_Missense_Mutation_p.L639M|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.L702M|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.L677M|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.L701M			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	702					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L454M(1)|p.L702M(1)		endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GAGCGTTCCACTGGGACATGT	0.582																																					p.L677M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2029A	8						.						163.0	147.0	152.0					8																	1857522		2203	4300	6503	1844929	SO:0001583	missense	9639	exon18			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.2104C>A	8.37:g.1857522C>A	ENSP00000381571:p.Leu702Met	Somatic		Capture	SOLID	Phase_I	1844929	NM_014629	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	37		.	.	.	.	.	.	.	.	.	.	C	13.33	2.204477	0.38905	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.66177	0.2763	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	T	0.72690	-0.4217	10	0.72032	D	0.01	-23.6567	17.0703	0.86571	0.0:1.0:0.0:0.0	.	702;639;677	O15013;O15013-7;O15013-5	ARHGA_HUMAN;.;.	M	677;639;701;702;702;350	ENSP00000340297:L677M;ENSP00000427909:L639M;ENSP00000431012:L701M;ENSP00000381571:L702M;ENSP00000262112:L702M;ENSP00000427768:L350M	ENSP00000262112:L702M	L	+	1	2	ARHGEF10	1844929	0.987000	0.35691	0.059000	0.19551	0.021000	0.10359	2.823000	0.48081	2.525000	0.85131	0.644000	0.83932	CTG		0.582	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding			
TUSC3	7991	hgsc.bcm.edu	37	8	15508207	15508207	+	Splice_Site	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:15508207C>T	ENST00000503731.1	+	3	458	c.310C>T	c.(310-312)Caa>Taa	p.Q104*	TUSC3_ENST00000506802.1_Splice_Site_p.Q104*|TUSC3_ENST00000382020.4_Splice_Site_p.Q104*|TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000509380.1_Splice_Site_p.Q104*	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	104	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.Q104*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		TCTTATCAGGCAAGCTAATGA	0.418																																					p.Q104X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C310T	8						.						185.0	179.0	181.0					8																	15508207		2203	4300	6503	15552578	SO:0001630	splice_region_variant	7991	exon3			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.309-1C>T	8.37:g.15508207C>T		Somatic		Capture	SOLID	Phase_I	15552578	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Nonsense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	C	37	6.397894	0.97533	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	.	.	.	5.6	5.6	0.85130	.	0.049628	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-6.2132	18.9923	0.92798	0.0:1.0:0.0:0.0	.	.	.	.	X	104	.	ENSP00000221167:Q104X	Q	+	1	0	TUSC3	15552578	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.487000	0.81328	2.805000	0.96524	0.655000	0.94253	CAA		0.418	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	Nonsense_Mutation
WRN	7486	hgsc.bcm.edu	37	8	30969188	30969188	+	Missense_Mutation	SNP	C	C	T	rs201990558		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:30969188C>T	ENST00000298139.5	+	19	2395	c.2146C>T	c.(2146-2148)Cgt>Tgt	p.R716C		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	716	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.R716C(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AGACATTGTACGTTGCTTAAA	0.388			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome				C|||	1	0.000199681	0.0008	0.0	5008	,	,		17629	0.0		0.0	False		,,,				2504	0.0				p.R716C	Ovarian(18;161 598 2706 14834 27543)	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2146T	8						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	109.0	101.0	104.0		2146	-0.4	0.0	8		104	1,8599	1.2+/-3.3	0,1,4299	yes	missense	WRN	NM_000553.4	180	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	716/1433	30969188	2,13004	2203	4300	6503	31088730	SO:0001583	missense	7486	exon19	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.2146C>T	8.37:g.30969188C>T	ENSP00000298139:p.Arg716Cys	Somatic		Capture	SOLID	Phase_I	31088730	NM_000553	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	C	4.686	0.127575	0.08981	2.27E-4	1.16E-4	ENSG00000165392	ENST00000298139	T	0.05081	3.5	5.15	-0.409	0.12378	DEAD-like helicase (2);	1.134720	0.06502	N	0.736528	T	0.06096	0.0158	L	0.46741	1.465	0.09310	N	1	B;B	0.12013	0.005;0.002	B;B	0.11329	0.006;0.001	T	0.44952	-0.9294	10	0.42905	T	0.14	0.2182	1.3559	0.02182	0.4055:0.2708:0.1019:0.2218	.	126;716	Q59F09;Q14191	.;WRN_HUMAN	C	716	ENSP00000298139:R716C	ENSP00000298139:R716C	R	+	1	0	WRN	31088730	0.000000	0.05858	0.000000	0.03702	0.253000	0.25986	-0.001000	0.12947	-0.432000	0.07297	-0.252000	0.11476	CGT		0.388	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1		
FUT10	84750	hgsc.bcm.edu	37	8	33246993	33246993	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:33246993G>A	ENST00000327671.5	-	4	1331	c.700C>T	c.(700-702)Ctg>Ttg	p.L234L	FUT10_ENST00000335589.3_Silent_p.L172L|FUT10_ENST00000518076.1_5'UTR|FUT10_ENST00000518672.1_Silent_p.L206L|FUT10_ENST00000524021.1_Silent_p.L206L	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	234					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)	p.L234L(1)		cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		TAAGTCATCAGCTCGCGAACA	0.473																																					p.L234L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C700T	8						.						110.0	101.0	104.0					8																	33246993		2203	4300	6503	33366535	SO:0001819	synonymous_variant	84750	exon4			AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.700C>T	8.37:g.33246993G>A		Somatic		Capture	SOLID	Phase_I	33366535	NM_032664	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Silent	SNP	ENST00000327671.5	37	CCDS6088.1																																																																																				0.473	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376540.1	NM_032664	
FUT10	84750	hgsc.bcm.edu	37	8	33318899	33318899	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:33318899G>A	ENST00000327671.5	-	2	703	c.72C>T	c.(70-72)gtC>gtT	p.V24V	FUT10_ENST00000518672.1_Intron|FUT10_ENST00000335589.3_5'UTR|FUT10_ENST00000524021.1_Intron	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	24					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)	p.V24V(1)		cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		CCTGGAGTGTGACAAGCAGAA	0.522																																					p.V24V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C72T	8						.						167.0	128.0	141.0					8																	33318899		2203	4300	6503	33438441	SO:0001819	synonymous_variant	84750	exon2			AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.72C>T	8.37:g.33318899G>A		Somatic		Capture	SOLID	Phase_I	33438441	NM_032664	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Silent	SNP	ENST00000327671.5	37	CCDS6088.1																																																																																				0.522	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376540.1	NM_032664	
DUSP26	78986	hgsc.bcm.edu	37	8	33451068	33451068	+	Missense_Mutation	SNP	G	G	A	rs147770891		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:33451068G>A	ENST00000256261.4	-	3	936	c.419C>T	c.(418-420)gCg>gTg	p.A140V	DUSP26_ENST00000523956.1_Missense_Mutation_p.A140V	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	140	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)	p.A140V(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		CTGGCTCAGCGCCCGGTGGAT	0.607																																					p.A140V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C419T	8						.	G	VAL/ALA	0,4406		0,0,2203	45.0	41.0	43.0		419	4.8	0.9	8	dbSNP_134	43	1,8599		0,1,4299	no	missense	DUSP26	NM_024025.1	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	140/212	33451068	1,13005	2203	4300	6503	33570610	SO:0001583	missense	78986	exon3			AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.419C>T	8.37:g.33451068G>A	ENSP00000256261:p.Ala140Val	Somatic		Capture	SOLID	Phase_I	33570610	NM_024025	D3DSV8|Q9BTW0	Missense_Mutation	SNP	ENST00000256261.4	37	CCDS6092.1	.	.	.	.	.	.	.	.	.	.	G	34	5.393853	0.96009	0.0	1.16E-4	ENSG00000133878	ENST00000256261;ENST00000523956;ENST00000522982	D;D;D	0.86497	-2.13;-2.13;-2.13	4.77	4.77	0.60923	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.054750	0.64402	D	0.000001	D	0.91556	0.7333	M	0.65320	2	0.80722	D	1	D	0.89917	1.0	P	0.61275	0.886	D	0.92353	0.5891	10	0.62326	D	0.03	-31.8782	17.7513	0.88435	0.0:0.0:1.0:0.0	.	140	Q9BV47	DUS26_HUMAN	V	140	ENSP00000256261:A140V;ENSP00000429176:A140V;ENSP00000430922:A140V	ENSP00000256261:A140V	A	-	2	0	DUSP26	33570610	1.000000	0.71417	0.942000	0.38095	0.945000	0.59286	9.672000	0.98629	2.363000	0.80096	0.563000	0.77884	GCG		0.607	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025	
ANK1	286	hgsc.bcm.edu	37	8	41550651	41550651	+	Missense_Mutation	SNP	C	C	T	rs139513895		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:41550651C>T	ENST00000347528.4	-	30	3684	c.3601G>A	c.(3601-3603)Gcc>Acc	p.A1201T	ANK1_ENST00000352337.4_Missense_Mutation_p.A1201T|ANK1_ENST00000379758.2_Missense_Mutation_p.A1201T|ANK1_ENST00000265709.8_Missense_Mutation_p.A1242T|ANK1_ENST00000396942.1_Missense_Mutation_p.A1201T|ANK1_ENST00000289734.7_Missense_Mutation_p.A1201T|ANK1_ENST00000396945.1_Missense_Mutation_p.A1201T	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1201	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A1201S(1)|p.A1201T(1)|p.A1242S(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GTGAAGTTGGCGCACTCGTTG	0.577																																					p.A1201T												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G3601A	8						.	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	355.0	275.0	302.0		3601,3724,3601,3601,3601	4.9	1.0	8	dbSNP_134	302	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	ANK1	NM_000037.3,NM_001142446.1,NM_020475.2,NM_020476.2,NM_020477.2	58,58,58,58,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1201/1881,1242/1898,1201/1857,1201/1882,1201/1720	41550651	1,13005	2203	4300	6503	41669808	SO:0001583	missense	286	exon30			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3601G>A	8.37:g.41550651C>T	ENSP00000339620:p.Ala1201Thr	Somatic		Capture	SOLID	Phase_I	41669808	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.219847|5.219847	0.95139|0.95139	2.27E-4|2.27E-4	0.0|0.0	ENSG00000029534|ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820|ENST00000520299	T;T;T;T;T;T;T|.	0.24151|.	1.87;1.87;1.87;1.87;1.87;1.87;1.87|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.113427|.	0.64402|.	D|.	0.000016|.	T|T	0.73171|0.73171	0.3553|0.3553	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.76494|.	0.999;0.995;0.995;0.994;0.998;0.992|.	D;P;P;P;D;P|.	0.66847|.	0.947;0.837;0.664;0.723;0.947;0.588|.	T|T	0.71998|0.71998	-0.4423|-0.4423	10|5	0.87932|.	D|.	0|.	.|.	18.5488|18.5488	0.91056|0.91056	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1242;1201;1201;1201;1201;517|.	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39|.	.;.;ANK1_HUMAN;.;.;.|.	T|H	1201;1201;1201;1201;1201;1201;1242;1201|522	ENSP00000339620:A1201T;ENSP00000289734:A1201T;ENSP00000369082:A1201T;ENSP00000380149:A1201T;ENSP00000380147:A1201T;ENSP00000309131:A1201T;ENSP00000265709:A1242T|.	ENSP00000265709:A1242T|.	A|R	-|-	1|2	0|0	ANK1|ANK1	41669808|41669808	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.838000|0.838000	0.47535|0.47535	7.818000|7.818000	0.86416|0.86416	2.453000|2.453000	0.82957|0.82957	0.467000|0.467000	0.42956|0.42956	GCC|CGC		0.577	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
PREX2	80243	hgsc.bcm.edu	37	8	69012054	69012054	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:69012054T>C	ENST00000288368.4	+	23	2968	c.2691T>C	c.(2689-2691)tgT>tgC	p.C897C	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	897					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.C897C(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AACACCTATGTCAGAGAATAT	0.294																																					p.C897C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2691C	8						.						82.0	82.0	82.0					8																	69012054		2203	4300	6503	69174608	SO:0001819	synonymous_variant	80243	exon23			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2691T>C	8.37:g.69012054T>C		Somatic		Capture	SOLID	Phase_I	69174608	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																				0.294	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PREX2	80243	hgsc.bcm.edu	37	8	69017411	69017411	+	Intron	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:69017411G>A	ENST00000288368.4	+	24	2992				PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2						adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.R918R(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TCACAGCACGGCATGCTGTCT	0.443																																					p.R918R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2754A	8						.						198.0	173.0	181.0					8																	69017411		2203	4300	6503	69179965	SO:0001627	intron_variant	80243	exon24			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2716-2933G>A	8.37:g.69017411G>A		Somatic		Capture	SOLID	Phase_I	69179965	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																				0.443	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
CA1	759	hgsc.bcm.edu	37	8	86242070	86242070	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:86242070T>C	ENST00000523953.1	-	8	1563	c.517A>G	c.(517-519)Aaa>Gaa	p.K173E	CA1_ENST00000432364.2_Missense_Mutation_p.K173E|CA1_ENST00000522389.1_Missense_Mutation_p.K39E|CA1_ENST00000256119.5_Missense_Mutation_p.K173E|CA1_ENST00000542576.1_Missense_Mutation_p.K173E|CA1_ENST00000523022.1_Missense_Mutation_p.K173E|CA1_ENST00000431316.1_Missense_Mutation_p.K173E			P00915	CAH1_HUMAN	carbonic anhydrase I	173					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.K173E(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	13		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methocarbamol(DB00423)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	GGGGCTCGTTTGCCCTGGAAG	0.363																																					p.K173E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A517G	8						.						55.0	53.0	53.0					8																	86242070		2201	4300	6501	86429322	SO:0001583	missense	759	exon8			M33987	CCDS6237.1	8q21.2	2006-03-10				ENSG00000133742	4.2.1.1	"""Carbonic anhydrases"""	1368	protein-coding gene	gene with protein product		114800				1916821	Standard	NM_001164830		Approved	Car1	uc003ydi.3	P00915		ENST00000523953.1:c.517A>G	8.37:g.86242070T>C	ENSP00000430656:p.Lys173Glu	Somatic		Capture	SOLID	Phase_I	86429322	NM_001128829		Missense_Mutation	SNP	ENST00000523953.1	37	CCDS6237.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.30|17.30	3.354221|3.354221	0.61293|0.61293	.|.	.|.	ENSG00000133742|ENSG00000133742	ENST00000523953;ENST00000256119;ENST00000431316;ENST00000542576;ENST00000432364;ENST00000523022;ENST00000522389;ENST00000524324;ENST00000517618;ENST00000519991;ENST00000520663;ENST00000517590|ENST00000521679	T;T;T;T;T;T;T;T;T;T;T;T|.	0.63580|.	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05|.	4.5|4.5	4.5|4.5	0.54988|0.54988	Carbonic anhydrase, alpha-class, catalytic domain (4);|.	0.184645|.	0.56097|.	D|.	0.000026|.	T|T	0.61751|0.61751	0.2372|0.2372	L|L	0.51853|0.51853	1.615|1.615	0.44042|0.44042	D|D	0.996778|0.996778	D|.	0.60575|.	0.988|.	D|.	0.65773|.	0.938|.	T|T	0.60052|0.60052	-0.7338|-0.7338	10|5	0.66056|.	D|.	0.02|.	-18.0587|-18.0587	13.0657|13.0657	0.59032|0.59032	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	173|.	P00915|.	CAH1_HUMAN|.	E|R	173;173;173;173;173;173;39;107;173;60;60;173|109	ENSP00000430656:K173E;ENSP00000256119:K173E;ENSP00000392338:K173E;ENSP00000443517:K173E;ENSP00000401551:K173E;ENSP00000429798:K173E;ENSP00000427773:K39E;ENSP00000428923:K107E;ENSP00000430861:K173E;ENSP00000430543:K60E;ENSP00000430571:K60E;ENSP00000429843:K173E|.	ENSP00000256119:K173E|.	K|Q	-|-	1|2	0|0	CA1|CA1	86429322|86429322	1.000000|1.000000	0.71417|0.71417	0.887000|0.887000	0.34795|0.34795	0.994000|0.994000	0.84299|0.84299	7.542000|7.542000	0.82095|0.82095	2.009000|2.009000	0.58944|0.58944	0.533000|0.533000	0.62120|0.62120	AAA|CAA		0.363	CA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381067.1	NM_001738	
SLC26A7	115111	hgsc.bcm.edu	37	8	92355655	92355655	+	Silent	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:92355655A>T	ENST00000276609.3	+	9	1340	c.1101A>T	c.(1099-1101)ggA>ggT	p.G367G	SLC26A7_ENST00000309536.2_Silent_p.G367G|SLC26A7_ENST00000520249.1_3'UTR|SLC26A7_ENST00000523719.1_Silent_p.G367G	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7									p.G367G(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CTGCCATGGGAAGGACGGCTG	0.478																																					p.G367G												.	.	1	Substitution - coding silent(1)	ovary(1)	c.A1101T	8						.						82.0	79.0	80.0					8																	92355655		2203	4300	6503	92424831	SO:0001819	synonymous_variant	115111	exon9			AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.1101A>T	8.37:g.92355655A>T		Somatic		Capture	SOLID	Phase_I	92424831	NM_134266		Silent	SNP	ENST00000276609.3	37	CCDS6254.1																																																																																				0.478	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
KCNK9	51305	hgsc.bcm.edu	37	8	140631048	140631048	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr8:140631048C>T	ENST00000520439.1	-	2	641	c.578G>A	c.(577-579)tGc>tAc	p.C193Y	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.C193Y	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	193					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.C193Y(1)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CGTGATGAAGCAGTAGTAGTA	0.587																																					p.C193Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G578A	8						.						87.0	85.0	86.0					8																	140631048		2203	4300	6503	140700230	SO:0001583	missense	51305	exon2			AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.578G>A	8.37:g.140631048C>T	ENSP00000430676:p.Cys193Tyr	Somatic		Capture	SOLID	Phase_I	140700230	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226551	0.79576	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.31247	1.5;1.5;1.5	5.85	5.85	0.93711	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.68723	0.3032	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.77389	-0.2606	10	0.87932	D	0	.	19.1531	0.93496	0.0:1.0:0.0:0.0	.	193	Q9NPC2	KCNK9_HUMAN	Y	193	ENSP00000429847:C193Y;ENSP00000302166:C193Y;ENSP00000430676:C193Y	ENSP00000302166:C193Y	C	-	2	0	KCNK9	140700230	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.635000	0.83286	2.753000	0.94483	0.655000	0.94253	TGC		0.587	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
UBE4B	10277	hgsc.bcm.edu	37	1	10239537	10239537	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:10239537G>A	ENST00000253251.8	+	26	4216	c.3377G>A	c.(3376-3378)cGc>cAc	p.R1126H	UBE4B_ENST00000343090.6_Missense_Mutation_p.R1255H|UBE4B_ENST00000377157.3_Missense_Mutation_p.R1014H					ubiquitination factor E4B									p.R1126H(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		ATCATGGACCGCTCCATCATC	0.597																																					p.R1255H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3764A	1						.						80.0	82.0	81.0					1																	10239537		2203	4300	6503	10162124	SO:0001583	missense	10277	exon27			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.3377G>A	1.37:g.10239537G>A	ENSP00000253251:p.Arg1126His	Somatic		Capture	SOLID	Phase_I	10162124	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	37	6.084238	0.97267	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.71222	-0.55;-0.45;-0.5	5.78	5.78	0.91487	Zinc finger, RING/FYVE/PHD-type (1);U box domain (2);	0.000000	0.85682	D	0.000000	D	0.91209	0.7230	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.989;0.998	D	0.94035	0.7304	10	0.87932	D	0	-18.2393	19.9987	0.97401	0.0:0.0:1.0:0.0	.	1255;1126	O95155;O95155-2	UBE4B_HUMAN;.	H	1126;1014;1255	ENSP00000253251:R1126H;ENSP00000366362:R1014H;ENSP00000343001:R1255H	ENSP00000253251:R1126H	R	+	2	0	UBE4B	10162124	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.819000	0.99357	2.738000	0.93877	0.591000	0.81541	CGC		0.597	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
TRMT13	54482	hgsc.bcm.edu	37	1	100606484	100606484	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:100606484A>C	ENST00000370141.2	+	7	584	c.578A>C	c.(577-579)aAg>aCg	p.K193T		NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	193					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.K193T(1)									GGAGCGGGAAAGGGAAAATTA	0.353																																					p.K193T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A578C	1						.						131.0	126.0	128.0					1																	100606484		2203	4300	6503	100379072	SO:0001583	missense	54482	exon7			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.578A>C	1.37:g.100606484A>C	ENSP00000359160:p.Lys193Thr	Somatic		Capture	SOLID	Phase_I	100379072	NM_019083	Q5VVL0|Q9NW65	Missense_Mutation	SNP	ENST00000370141.2	37	CCDS765.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.666726	0.47677	.	.	ENSG00000122435	ENST00000370141	T	0.52526	0.66	5.62	0.785	0.18584	Methyltransferase TRM13 (1);	0.410544	0.26404	N	0.024573	T	0.25195	0.0612	M	0.62088	1.915	0.80722	D	1	B;B	0.18741	0.03;0.016	B;B	0.22880	0.025;0.042	T	0.14727	-1.0462	10	0.51188	T	0.08	-6.7833	7.8371	0.29376	0.5032:0.0:0.4968:0.0	.	179;193	B4DQS9;Q9NUP7	.;TRM13_HUMAN	T	193	ENSP00000359160:K193T	ENSP00000359160:K193T	K	+	2	0	CCDC76	100379072	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.290000	0.43531	0.399000	0.25367	0.460000	0.39030	AAG		0.353	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029919.1	NM_019083	
OLFM3	118427	hgsc.bcm.edu	37	1	102462313	102462313	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:102462313A>G	ENST00000370103.4	-	1	273	c.60T>C	c.(58-60)gaT>gaC	p.D20D	OLFM3_ENST00000462354.1_5'UTR	NM_058170.2	NP_477518.2	Q96PB7	NOE3_HUMAN	olfactomedin 3	33					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.D20D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CCTTGGAAGGATCTAATCCGG	0.388																																					p.D20D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T60C	1						.						136.0	141.0	139.0					1																	102462313		2203	4300	6503	102234901	SO:0001819	synonymous_variant	118427	exon1			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000370103.4:c.60T>C	1.37:g.102462313A>G		Somatic		Capture	SOLID	Phase_I	102234901	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Silent	SNP	ENST00000370103.4	37	CCDS30781.1																																																																																				0.388	OLFM3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030144.1		
SORT1	6272	hgsc.bcm.edu	37	1	109893592	109893592	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:109893592T>C	ENST00000256637.6	-	6	799	c.741A>G	c.(739-741)ggA>ggG	p.G247G	SORT1_ENST00000538502.1_Silent_p.G111G	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	247					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)	p.G247G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		CTTCCCATTTTCCCCCAAAAT	0.418																																					p.G247G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A741G	1						.						184.0	177.0	179.0					1																	109893592		2203	4300	6503	109695115	SO:0001819	synonymous_variant	6272	exon6			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.741A>G	1.37:g.109893592T>C		Somatic		Capture	SOLID	Phase_I	109695115	NM_002959	B4DWI3|C0JYZ0|Q8IZ49	Silent	SNP	ENST00000256637.6	37	CCDS798.1																																																																																				0.418	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
EPS8L3	79574	hgsc.bcm.edu	37	1	110294674	110294674	+	Silent	SNP	G	G	A	rs546054799		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:110294674G>A	ENST00000361965.4	-	15	1483	c.1377C>T	c.(1375-1377)taC>taT	p.Y459Y	RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000361852.4_Silent_p.Y429Y|EPS8L3_ENST00000369805.3_Silent_p.Y460Y	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	459	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)		p.Y460Y(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		CTTCAAACTCGTACAAGACTT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		19064	0.0		0.0	False		,,,				2504	0.001				p.Y460Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1380T	1						.						115.0	120.0	118.0					1																	110294674		2203	4300	6503	110096197	SO:0001819	synonymous_variant	79574	exon15			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1377C>T	1.37:g.110294674G>A		Somatic		Capture	SOLID	Phase_I	110096197	NM_139053	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Silent	SNP	ENST00000361965.4	37	CCDS814.1																																																																																				0.577	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526	
SLC6A17	388662	hgsc.bcm.edu	37	1	110740769	110740769	+	Silent	SNP	G	G	A	rs139019064		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:110740769G>A	ENST00000331565.4	+	12	2372	c.1887G>A	c.(1885-1887)acG>acA	p.T629T		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	629					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.T629T(2)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TCGTGGCGACGCTGCCCATCC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		20895	0.001		0.0	False		,,,				2504	0.0				p.T629T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G1887A	1						.	G		0,4406		0,0,2203	106.0	86.0	93.0		1887	-3.7	0.4	1	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC6A17	NM_001010898.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		629/728	110740769	1,13005	2203	4300	6503	110542292	SO:0001819	synonymous_variant	388662	exon12				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1887G>A	1.37:g.110740769G>A		Somatic		Capture	SOLID	Phase_I	110542292	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Silent	SNP	ENST00000331565.4	37	CCDS30799.1																																																																																				0.622	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
KCNC4	3749	hgsc.bcm.edu	37	1	110765691	110765691	+	Missense_Mutation	SNP	C	C	T	rs200797895		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:110765691C>T	ENST00000369787.3	+	2	811	c.784C>T	c.(784-786)Cgc>Tgc	p.R262C	KCNC4_ENST00000438661.2_Missense_Mutation_p.R262C|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000413138.3_Missense_Mutation_p.R262C	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	262					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.R262C(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		AGAGATCCTCCGCGTAGGGAA	0.562													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22750	0.0		0.0	False		,,,				2504	0.0				p.R262C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C784T	1						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	233.0	188.0	203.0		784,784	3.8	1.0	1		203	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	KCNC4	NM_001039574.2,NM_004978.4	180,180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	262/627,262/636	110765691	2,13004	2203	4300	6503	110567214	SO:0001583	missense	3749	exon2			BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.784C>T	1.37:g.110765691C>T	ENSP00000358802:p.Arg262Cys	Somatic		Capture	SOLID	Phase_I	110567214	NM_004978	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	ENST00000369787.3	37	CCDS821.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	13.01	2.109080	0.37242	0.0	2.33E-4	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.97404	-4.37;-4.37;-4.37	4.75	3.83	0.44106	.	0.168904	0.24917	U	0.034580	D	0.93795	0.8016	L	0.36672	1.1	0.09310	N	0.999999	D;B;D	0.58620	0.983;0.132;0.973	B;B;P	0.55667	0.353;0.04;0.781	D	0.89086	0.3479	10	0.56958	D	0.05	.	8.1699	0.31249	0.2613:0.5445:0.1942:0.0	.	262;262;262	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	C	262	ENSP00000358802:R262C;ENSP00000388029:R262C;ENSP00000393655:R262C	ENSP00000358802:R262C	R	+	1	0	KCNC4	110567214	0.001000	0.12720	0.985000	0.45067	0.596000	0.36781	0.388000	0.20735	1.109000	0.41680	0.462000	0.41574	CGC		0.562	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
DRAM2	128338	hgsc.bcm.edu	37	1	111660810	111660810	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:111660810C>T	ENST00000286692.4	-	9	1390	c.773G>A	c.(772-774)cGa>cAa	p.R258Q	DRAM2_ENST00000484310.1_5'UTR|DRAM2_ENST00000539140.1_Missense_Mutation_p.R258Q			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	258					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)		p.R258Q(1)		endometrium(1)|large_intestine(5)|lung(3)	9						TAGCCGTGTTCGTTCATTGTT	0.363																																					p.R258Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773A	1						.						139.0	144.0	142.0					1																	111660810		2203	4300	6503	111462333	SO:0001583	missense	128338	exon9			AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.773G>A	1.37:g.111660810C>T	ENSP00000286692:p.Arg258Gln	Somatic		Capture	SOLID	Phase_I	111462333	NM_178454	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Missense_Mutation	SNP	ENST00000286692.4	37	CCDS30801.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317654	0.40996	.	.	ENSG00000156171	ENST00000286692;ENST00000539140	.	.	.	5.79	3.86	0.44501	.	0.293852	0.28772	N	0.014193	T	0.10766	0.0263	N	0.19112	0.55	0.27138	N	0.961722	B	0.13594	0.008	B	0.04013	0.001	T	0.13308	-1.0514	9	0.31617	T	0.26	-3.4577	8.298	0.31997	0.0:0.7607:0.1551:0.0842	.	258	Q6UX65	DRAM2_HUMAN	Q	258	.	ENSP00000286692:R258Q	R	-	2	0	DRAM2	111462333	0.978000	0.34361	1.000000	0.80357	0.985000	0.73830	0.897000	0.28390	1.452000	0.47756	0.585000	0.79938	CGA		0.363	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032930.3	NM_178454	
CTTNBP2NL	55917	hgsc.bcm.edu	37	1	112991593	112991593	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:112991593A>G	ENST00000271277.6	+	4	354	c.129A>G	c.(127-129)gaA>gaG	p.E43E		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	43					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)	p.E43E(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCATTGAAGAACGCTATGGAA	0.393																																					p.E43E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A129G	1						.						69.0	70.0	70.0					1																	112991593		2203	4300	6503	112793116	SO:0001819	synonymous_variant	55917	exon4			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.129A>G	1.37:g.112991593A>G		Somatic		Capture	SOLID	Phase_I	112793116	NM_018704	B3KMS5|Q96B40	Silent	SNP	ENST00000271277.6	37	CCDS845.1																																																																																				0.393	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704	
ST7L	54879	hgsc.bcm.edu	37	1	113140608	113140608	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:113140608G>A	ENST00000358039.4	-	5	911	c.607C>T	c.(607-609)Cgt>Tgt	p.R203C	ST7L_ENST00000343210.7_Missense_Mutation_p.R203C|ST7L_ENST00000369669.1_Missense_Mutation_p.R20C|ST7L_ENST00000369666.1_Missense_Mutation_p.R186C|ST7L_ENST00000490067.1_Missense_Mutation_p.R186C|ST7L_ENST00000538187.1_Missense_Mutation_p.R147C|ST7L_ENST00000360743.4_Missense_Mutation_p.R203C|ST7L_ENST00000369668.2_Missense_Mutation_p.R203C|ST7L_ENST00000544629.1_Intron|ST7L_ENST00000543570.1_Missense_Mutation_p.R186C|ST7L_ENST00000463235.1_5'UTR	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	203					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)		p.R203C(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTGAAGGACGTAAAAAATCT	0.353																																					p.R203C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C607T	1						.						159.0	151.0	154.0					1																	113140608		2203	4300	6503	112942131	SO:0001583	missense	54879	exon5			AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.607C>T	1.37:g.113140608G>A	ENSP00000350734:p.Arg203Cys	Somatic		Capture	SOLID	Phase_I	112942131	NM_138728	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Missense_Mutation	SNP	ENST00000358039.4	37	CCDS848.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344028	0.61073	.	.	ENSG00000007341	ENST00000358039;ENST00000360743;ENST00000369673;ENST00000369669;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187;ENST00000543570;ENST00000369665;ENST00000369664	T;T;T;T;T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.45074	0.1324	M	0.80847	2.515	0.80722	D	1	P;D;B;B;B;B;B	0.89917	0.786;1.0;0.187;0.187;0.187;0.325;0.224	B;D;B;B;B;B;B	0.91635	0.329;0.999;0.071;0.071;0.105;0.071;0.117	T	0.48445	-0.9035	10	0.87932	D	0	-9.5617	19.109	0.93309	0.0:0.0:1.0:0.0	.	186;147;203;186;186;203;203	B7Z8V6;B7Z7D4;Q8TDW4-5;Q8TDW4-6;Q8TDW4-3;Q8TDW4-2;Q8TDW4	.;.;.;.;.;.;ST7L_HUMAN	C	203;203;81;20;186;203;203;186;147;186;81;147	ENSP00000350734:R203C;ENSP00000353972:R203C;ENSP00000358683:R20C;ENSP00000417140:R186C;ENSP00000358682:R203C;ENSP00000345312:R203C;ENSP00000358680:R186C;ENSP00000444021:R147C;ENSP00000444088:R186C;ENSP00000358678:R147C	ENSP00000345312:R203C	R	-	1	0	ST7L	112942131	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.915000	0.63355	2.613000	0.88420	0.467000	0.42956	CGT		0.353	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3		
CSDE1	7812	hgsc.bcm.edu	37	1	115261289	115261289	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:115261289G>A	ENST00000358528.4	-	19	2720	c.2294C>T	c.(2293-2295)gCc>gTc	p.A765V	CSDE1_ENST00000530886.1_Missense_Mutation_p.A635V|CSDE1_ENST00000438362.2_Missense_Mutation_p.A811V|CSDE1_ENST00000369530.1_Missense_Mutation_p.A780V|CSDE1_ENST00000261443.5_Missense_Mutation_p.A734V|CSDE1_ENST00000483407.1_5'UTR|CSDE1_ENST00000339438.6_Missense_Mutation_p.A734V|CSDE1_ENST00000534699.1_Missense_Mutation_p.A765V|NRAS_ENST00000369535.4_5'Flank	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	765					male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A765V(1)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGAGCACTGGCATCATCCAG	0.507																																					p.A780V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2339T	1						.						100.0	84.0	89.0					1																	115261289		2203	4300	6503	115062812	SO:0001583	missense	7812	exon19				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.2294C>T	1.37:g.115261289G>A	ENSP00000351329:p.Ala765Val	Somatic		Capture	SOLID	Phase_I	115062812	NM_001130523	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551802	0.86127	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	5.95	5.95	0.96441	SUZ-C domain (1);	0.095172	0.64402	D	0.000001	T	0.58623	0.2135	L	0.36672	1.1	0.80722	D	1	D;P;P	0.56746	0.977;0.943;0.93	P;P;P	0.59703	0.862;0.672;0.619	T	0.51426	-0.8707	9	0.33940	T	0.23	-10.2275	20.3931	0.98965	0.0:0.0:1.0:0.0	.	780;765;811	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	V	734;811;765;734;635;780;765	.	ENSP00000261443:A734V	A	-	2	0	CSDE1	115062812	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.405000	0.97313	2.824000	0.97209	0.655000	0.94253	GCC		0.507	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
TRIM45	80263	hgsc.bcm.edu	37	1	117660662	117660662	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:117660662C>A	ENST00000256649.4	-	2	1742	c.1216G>T	c.(1216-1218)Gga>Tga	p.G406*	TRIM45_ENST00000369461.3_Nonsense_Mutation_p.G349*|TRIM45_ENST00000369464.3_Intron	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	406					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.G406*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		CTACCTTCTCCTTGTAGGACA	0.493																																					p.G406X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1216T	1						.						126.0	118.0	121.0					1																	117660662		2203	4300	6503	117462185	SO:0001587	stop_gained	80263	exon2				CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.1216G>T	1.37:g.117660662C>A	ENSP00000256649:p.Gly406*	Somatic		Capture	SOLID	Phase_I	117462185	NM_025188	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Nonsense_Mutation	SNP	ENST00000256649.4	37	CCDS893.1	.	.	.	.	.	.	.	.	.	.	C	37	6.261274	0.97421	.	.	ENSG00000134253	ENST00000256649;ENST00000369461	.	.	.	4.75	3.82	0.43975	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-14.9529	13.4061	0.60913	0.1582:0.8418:0.0:0.0	.	.	.	.	X	406;349	.	ENSP00000256649:G406X	G	-	1	0	TRIM45	117462185	1.000000	0.71417	0.923000	0.36655	0.205000	0.24178	7.046000	0.76592	1.206000	0.43276	0.655000	0.94253	GGA		0.493	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033503.1	NM_025188	
POLR3GL	84265	hgsc.bcm.edu	37	1	145459666	145459666	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:145459666G>A	ENST00000369314.1	-	3	348	c.242C>T	c.(241-243)gCt>gTt	p.A81V	POLR3GL_ENST00000369313.3_Missense_Mutation_p.A81V	NM_032305.1	NP_115681.1	Q9BT43	RPC7L_HUMAN	polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like	81					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)		p.A81V(1)		endometrium(2)|large_intestine(1)|lung(1)	4	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTTGGGGACAGCTGGCCGGAT	0.587																																					p.A81V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C242T	1						.						77.0	66.0	70.0					1																	145459666		2203	4300	6503	144171023	SO:0001583	missense	84265	exon3			BC004355	CCDS72875.1	1q21.1	2008-02-05	2006-12-14		ENSG00000121851	ENSG00000121851			28466	protein-coding gene	gene with protein product			"""polymerase (RNA) III (DNA directed) polypeptide G (32kD) like"""			12477932	Standard	NM_032305		Approved	flj32422, MGC3200	uc001enp.1	Q9BT43	OTTHUMG00000013739	ENST00000369314.1:c.242C>T	1.37:g.145459666G>A	ENSP00000358320:p.Ala81Val	Somatic		Capture	SOLID	Phase_I	144171023	NM_032305	B1MVG5	Missense_Mutation	SNP	ENST00000369314.1	37	CCDS914.1	.	.	.	.	.	.	.	.	.	.	G	32	5.165249	0.94768	.	.	ENSG00000121851	ENST00000369314;ENST00000369313	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.73071	0.3540	M	0.75777	2.31	0.80722	D	1	D	0.61697	0.99	P	0.62382	0.901	T	0.71705	-0.4512	9	0.45353	T	0.12	-15.9663	17.9326	0.89002	0.0:0.0:1.0:0.0	.	81	Q9BT43	RPC7L_HUMAN	V	81	.	ENSP00000358319:A81V	A	-	2	0	POLR3GL	144171023	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.978000	0.63799	2.836000	0.97738	0.655000	0.94253	GCT		0.587	POLR3GL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038510.1	NM_032305	
LIX1L	128077	hgsc.bcm.edu	37	1	145492281	145492281	+	Missense_Mutation	SNP	C	C	T	rs570209774		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:145492281C>T	ENST00000369308.3	+	3	577	c.503C>T	c.(502-504)gCg>gTg	p.A168V	RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000437207.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000366105.2_RNA	NM_153713.1	NP_714924.1	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (chicken) like	168								p.A168V(1)		large_intestine(4)|lung(6)|ovary(2)|skin(1)	13	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCAAAGATTGCGCTAATGAAT	0.453																																					p.A168V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C503T	1						.						100.0	101.0	101.0					1																	145492281		2203	4300	6503	144203638	SO:0001583	missense	128077	exon3			AK128733	CCDS72873.1	1q21.1	2014-07-15	2014-07-15		ENSG00000152022	ENSG00000271601			28715	protein-coding gene	gene with protein product			"""Lix1 homolog (mouse) like"", ""Lix1 homolog (chicken)-like"""			12477932	Standard	NM_153713		Approved	MGC46719	uc001enr.3	Q8IVB5	OTTHUMG00000013741	ENST00000369308.3:c.503C>T	1.37:g.145492281C>T	ENSP00000358314:p.Ala168Val	Somatic		Capture	SOLID	Phase_I	144203638	NM_153713	Q6AI36	Missense_Mutation	SNP	ENST00000369308.3	37	CCDS915.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207818	0.95033	.	.	ENSG00000152022	ENST00000369308;ENST00000449167	T	0.71341	-0.56	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.81730	0.4884	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83560	0.0106	10	0.87932	D	0	-11.9642	15.9833	0.80130	0.0:1.0:0.0:0.0	.	168	Q8IVB5	LIX1L_HUMAN	V	168;115	ENSP00000358314:A168V	ENSP00000358314:A168V	A	+	2	0	LIX1L	144203638	1.000000	0.71417	0.987000	0.45799	0.994000	0.84299	7.135000	0.77276	2.716000	0.92895	0.563000	0.77884	GCG		0.453	LIX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038513.1	NM_153713	
RFX5	5993	hgsc.bcm.edu	37	1	151316199	151316199	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:151316199G>A	ENST00000290524.4	-	9	893	c.715C>T	c.(715-717)Cga>Tga	p.R239*	RFX5_ENST00000478564.1_5'Flank|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000368870.2_Nonsense_Mutation_p.R239*|RFX5_ENST00000452513.2_Nonsense_Mutation_p.R199*|RFX5_ENST00000452671.2_Nonsense_Mutation_p.R239*	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	239					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R239*(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGTGCAGATCGGGCAGAGATG	0.577																																					p.R239X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C715T	1						.						81.0	71.0	74.0					1																	151316199		2203	4300	6503	149582823	SO:0001587	stop_gained	5993	exon9				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.715C>T	1.37:g.151316199G>A	ENSP00000290524:p.Arg239*	Somatic		Capture	SOLID	Phase_I	149582823	NM_001025603	B7Z848|D3DV19|E9PFU4|Q5VWC3	Nonsense_Mutation	SNP	ENST00000290524.4	37	CCDS994.1	.	.	.	.	.	.	.	.	.	.	G	37	6.572840	0.97676	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000436637;ENST00000452671;ENST00000452513;ENST00000392746	.	.	.	6.08	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0949	15.2809	0.73784	0.0:0.0:0.8587:0.1413	.	.	.	.	X	239;239;131;239;199;239	.	ENSP00000290524:R239X	R	-	1	2	RFX5	149582823	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.776000	0.55356	1.542000	0.49330	0.655000	0.94253	CGA		0.577	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
HRNR	388697	hgsc.bcm.edu	37	1	152193740	152193740	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:152193740C>T	ENST00000368801.2	-	3	440	c.365G>A	c.(364-366)cGg>cAg	p.R122Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	122			R -> W (in dbSNP:rs57277761).		establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R122Q(2)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGATTCTTGCCGTTTGTTCTC	0.428																																					p.R122Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G365A	1						.						249.0	193.0	212.0					1																	152193740		2203	4300	6503	150460364	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.365G>A	1.37:g.152193740C>T	ENSP00000357791:p.Arg122Gln	Somatic		Capture	SOLID	Phase_I	150460364	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.268993	0.23221	.	.	ENSG00000197915	ENST00000368801	T	0.01787	4.64	5.07	1.05	0.20165	.	.	.	.	.	T	0.00384	0.0012	N	0.24115	0.695	0.09310	N	1	B	0.27166	0.17	B	0.21151	0.033	T	0.41413	-0.9510	9	0.15066	T	0.55	.	3.5482	0.07836	0.1759:0.5385:0.0:0.2856	.	122	Q86YZ3	HORN_HUMAN	Q	122	ENSP00000357791:R122Q	ENSP00000357791:R122Q	R	-	2	0	HRNR	150460364	0.000000	0.05858	0.000000	0.03702	0.184000	0.23303	-0.303000	0.08210	0.111000	0.17947	0.632000	0.83419	CGG		0.428	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
LCE4A	199834	hgsc.bcm.edu	37	1	152681636	152681636	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:152681636T>C	ENST00000368777.1	+	2	341	c.85T>C	c.(85-87)Tgt>Cgt	p.C29R	LCE4A_ENST00000335535.3_Missense_Mutation_p.C29R			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	29	Cys-rich.				keratinization (GO:0031424)			p.C29R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			TCCCTCAAAGTGTGCATCCTC	0.582																																					p.C29R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T85C	1						.						127.0	140.0	135.0					1																	152681636		2203	4300	6503	150948260	SO:0001583	missense	199834	exon1			BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	ENST00000368777.1:c.85T>C	1.37:g.152681636T>C	ENSP00000357766:p.Cys29Arg	Somatic		Capture	SOLID	Phase_I	150948260	NM_178356	Q14D97	Missense_Mutation	SNP	ENST00000368777.1	37	CCDS1022.1	.	.	.	.	.	.	.	.	.	.	T	0.099	-1.154456	0.01700	.	.	ENSG00000187170	ENST00000368777;ENST00000335535	T;T	0.03920	3.76;3.76	4.1	1.64	0.23874	.	.	.	.	.	T	0.01254	0.0041	.	.	.	0.09310	N	1	B	0.18013	0.025	B	0.17433	0.018	T	0.47736	-0.9094	8	0.87932	D	0	.	3.2578	0.06837	0.211:0.1153:0.0:0.6737	.	29	Q5TA78	LCE4A_HUMAN	R	29	ENSP00000357766:C29R;ENSP00000335223:C29R	ENSP00000335223:C29R	C	+	1	0	LCE4A	150948260	0.448000	0.25681	0.001000	0.08648	0.070000	0.16714	1.053000	0.30442	0.117000	0.18138	0.254000	0.18369	TGT		0.582	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040048.1	NM_178356	
S100A14	57402	hgsc.bcm.edu	37	1	153587476	153587476	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:153587476T>G	ENST00000368702.1	-	5	472	c.200A>C	c.(199-201)aAa>aCa	p.K67T	S100A14_ENST00000368701.1_Missense_Mutation_p.K67T|S100A14_ENST00000476873.1_Missense_Mutation_p.K67T|S100A14_ENST00000344616.2_Missense_Mutation_p.K67T|S100A16_ENST00000474991.1_5'Flank|S100A14_ENST00000368700.3_5'UTR|S100A16_ENST00000368706.4_5'Flank			Q9HCY8	S10AE_HUMAN	S100 calcium binding protein A14	67					apoptotic process (GO:0006915)|calcium ion homeostasis (GO:0055074)|defense response to bacterium (GO:0042742)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)	extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|chemokine receptor binding (GO:0042379)	p.K67T(1)		kidney(2)|large_intestine(1)|lung(1)	4	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTTGGCAATTTTCTCTTCCAG	0.562																																					p.K67T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A200C	1						.						77.0	78.0	77.0					1																	153587476		2203	4300	6503	151854100	SO:0001583	missense	57402	exon4			AY007220	CCDS1046.1	1q21.1	2008-02-05			ENSG00000189334	ENSG00000189334		"""S100 calcium binding proteins"""	18901	protein-coding gene	gene with protein product		607986				11944983	Standard	NM_020672		Approved	S100A15, BCMP84	uc001fce.3	Q9HCY8	OTTHUMG00000035030	ENST00000368702.1:c.200A>C	1.37:g.153587476T>G	ENSP00000357691:p.Lys67Thr	Somatic		Capture	SOLID	Phase_I	151854100	NM_020672	Q5RHT0	Missense_Mutation	SNP	ENST00000368702.1	37	CCDS1046.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.571286	0.45798	.	.	ENSG00000189334	ENST00000476873;ENST00000368701;ENST00000368702;ENST00000344616	T;T;T;T	0.06068	3.35;3.35;3.35;3.35	4.93	3.74	0.42951	EF-hand-like domain (1);	0.207648	0.41605	D	0.000842	T	0.02047	0.0064	L	0.58101	1.795	0.29549	N	0.851505	P	0.36065	0.535	B	0.26770	0.073	T	0.42050	-0.9474	10	0.46703	T	0.11	-14.6057	6.4542	0.21920	0.0:0.1237:0.0:0.8763	.	67	Q9HCY8	S10AE_HUMAN	T	67	ENSP00000420296:K67T;ENSP00000357690:K67T;ENSP00000357691:K67T;ENSP00000340463:K67T	ENSP00000340463:K67T	K	-	2	0	S100A14	151854100	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	2.696000	0.47052	0.836000	0.34901	0.533000	0.62120	AAA		0.562	S100A14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084788.2	NM_020672	
SLC27A3	11000	hgsc.bcm.edu	37	1	153745688	153745688	+	5'Flank	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:153745688C>T	ENST00000368661.3	+	0	0				SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000435409.2_Missense_Mutation_p.P1024L|INTS3_ENST00000512605.1_Missense_Mutation_p.P884L|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000318967.2_Missense_Mutation_p.P1024L|INTS3_ENST00000456435.1_Missense_Mutation_p.P884L	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.P1024L(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GACACGAAACCGAAGCCTACC	0.607																																					p.P1024L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3071T	1						.						178.0	183.0	181.0					1																	153745688		2203	4300	6503	152012312	SO:0001631	upstream_gene_variant	65123	exon30			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		1.37:g.153745688C>T	Exception_encountered	Somatic		Capture	SOLID	Phase_I	152012312	NM_023015	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741003	0.69304	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.60301	0.2258	L	0.43152	1.355	0.41491	D	0.988226	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.982;0.992	T	0.60342	-0.7282	9	0.45353	T	0.12	.	13.5491	0.61721	0.0:1.0:0.0:0.0	.	884;1025;1024	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	L	1024;884;1024;884	.	ENSP00000318641:P1024L	P	+	2	0	INTS3	152012312	1.000000	0.71417	0.986000	0.45419	0.946000	0.59487	6.020000	0.70826	2.569000	0.86673	0.485000	0.47835	CCG		0.607	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
CREB3L4	148327	hgsc.bcm.edu	37	1	153941408	153941408	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:153941408C>T	ENST00000368607.3	+	3	443	c.177C>T	c.(175-177)ggC>ggT	p.G59G	RP11-422P24.10_ENST00000608147.1_RNA|CREB3L4_ENST00000368600.3_Silent_p.G39G|SLC39A1_ENST00000310483.6_5'Flank|CREB3L4_ENST00000271889.4_Silent_p.G59G|CREB3L4_ENST00000405694.3_Intron|CREB3L4_ENST00000368601.1_Silent_p.G59G|CREB3L4_ENST00000368603.1_Silent_p.G59G	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	59					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.G59G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TACTGTAGGGCCTTCAAGAGA	0.448																																					p.G59G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C177T	1						.						56.0	56.0	56.0					1																	153941408		2203	4300	6503	152208032	SO:0001819	synonymous_variant	148327	exon3			AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.177C>T	1.37:g.153941408C>T		Somatic		Capture	SOLID	Phase_I	152208032	NM_130898	D3DV62|Q5T4L0|Q86YW6	Silent	SNP	ENST00000368607.3	37	CCDS1056.1																																																																																				0.448	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090291.1	NM_130898	
IQGAP3	128239	hgsc.bcm.edu	37	1	156521552	156521552	+	Missense_Mutation	SNP	G	G	T	rs371790500		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:156521552G>T	ENST00000361170.2	-	15	1689	c.1679C>A	c.(1678-1680)cCt>cAt	p.P560H		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	560					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.P560H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGGGGCGACAGGGAGGCTGAC	0.572																																					p.P560H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1679A	1						.						74.0	65.0	68.0					1																	156521552		2203	4300	6503	154788176	SO:0001583	missense	128239	exon15			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.1679C>A	1.37:g.156521552G>T	ENSP00000354451:p.Pro560His	Somatic		Capture	SOLID	Phase_I	154788176	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824992	0.32237	.	.	ENSG00000183856	ENST00000361170	T	0.06218	3.33	4.76	2.71	0.32032	.	0.386809	0.26136	N	0.026134	T	0.02571	0.0078	L	0.51422	1.61	0.21147	N	0.999777	B	0.11235	0.004	B	0.09377	0.004	T	0.37549	-0.9701	10	0.42905	T	0.14	-1.2315	11.9977	0.53212	0.0:0.0:0.6889:0.3111	.	560	Q86VI3	IQGA3_HUMAN	H	560	ENSP00000354451:P560H	ENSP00000354451:P560H	P	-	2	0	IQGAP3	154788176	0.572000	0.26668	0.536000	0.28039	0.791000	0.44710	3.012000	0.49575	0.982000	0.38575	0.491000	0.48974	CCT		0.572	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
INSRR	3645	hgsc.bcm.edu	37	1	156811891	156811891	+	Intron	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:156811891G>A	ENST00000368195.3	-	19	3794				NTRK1_ENST00000392302.2_Missense_Mutation_p.A10T	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor						actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A10T(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CATCTGCCTGGCACCCTCTGT	0.582																																					p.A10T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G28A	1						.						96.0	83.0	88.0					1																	156811891		2203	4300	6503	155078515	SO:0001627	intron_variant	4914	exon2			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3397+12C>T	1.37:g.156811891G>A		Somatic		Capture	SOLID	Phase_I	155078515	NM_001007792	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	G	3.435	-0.115287	0.06881	.	.	ENSG00000198400	ENST00000392302	T	0.76186	-1.0	3.76	0.865	0.19074	.	.	.	.	.	T	0.26011	0.0634	N	0.08118	0	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.17623	-1.0363	9	0.27082	T	0.32	.	3.918	0.09231	0.3027:0.181:0.5162:0.0	.	10	A6NF12	.	T	10	ENSP00000376120:A10T	ENSP00000376120:A10T	A	+	1	0	NTRK1	155078515	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	0.029000	0.13666	0.209000	0.20645	0.561000	0.74099	GCA		0.582	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
INSRR	3645	hgsc.bcm.edu	37	1	156819191	156819191	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:156819191C>T	ENST00000368195.3	-	6	1687	c.1291G>A	c.(1291-1293)Gcg>Acg	p.A431T	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	431					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A431T(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GTGAGCCCCGCGGCCACCCAG	0.627																																					p.A431T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1291A	1						.						92.0	94.0	93.0					1																	156819191		2203	4300	6503	155085815	SO:0001583	missense	3645	exon6			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1291G>A	1.37:g.156819191C>T	ENSP00000357178:p.Ala431Thr	Somatic		Capture	SOLID	Phase_I	155085815	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786825	0.31593	.	.	ENSG00000027644	ENST00000368195	T	0.78126	-1.15	4.77	2.77	0.32553	EGF receptor, L domain (1);	0.153579	0.30365	N	0.009789	T	0.43523	0.1251	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.37957	-0.9683	9	0.46703	T	0.11	.	4.8819	0.13683	0.1703:0.6322:0.0:0.1975	.	431	P14616	INSRR_HUMAN	T	431	ENSP00000357178:A431T	ENSP00000357178:A431T	A	-	1	0	INSRR	155085815	1.000000	0.71417	0.078000	0.20375	0.981000	0.71138	3.188000	0.50958	0.533000	0.28675	0.561000	0.74099	GCG		0.627	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
NTRK1	4914	hgsc.bcm.edu	37	1	156849839	156849839	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:156849839A>G	ENST00000524377.1	+	16	2136	c.2095A>G	c.(2095-2097)Atc>Gtc	p.I699V	NTRK1_ENST00000358660.3_Missense_Mutation_p.I696V|NTRK1_ENST00000392302.2_Missense_Mutation_p.I663V|NTRK1_ENST00000368196.3_Missense_Mutation_p.I693V|NTRK1_ENST00000531606.1_3'UTR	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	699	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.I699V(1)|p.I663V(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GCCCGAGAGCATCCTGTACCG	0.647			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.I693V			Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2077G	1						.						77.0	72.0	74.0					1																	156849839		2203	4300	6503	155116463	SO:0001583	missense	4914	exon15			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2095A>G	1.37:g.156849839A>G	ENSP00000431418:p.Ile699Val	Somatic		Capture	SOLID	Phase_I	155116463	NM_001012331	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.224376	0.58668	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	4.23	4.23	0.50019	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000023	T	0.75443	0.3850	L	0.55743	1.74	0.80722	D	1	P;B;B;B	0.36465	0.554;0.009;0.015;0.145	B;B;B;B	0.41946	0.371;0.019;0.02;0.153	T	0.79429	-0.1807	10	0.54805	T	0.06	.	12.5906	0.56441	1.0:0.0:0.0:0.0	.	696;693;699;663	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	V	663;693;699;696	ENSP00000376120:I663V;ENSP00000357179:I693V;ENSP00000431418:I699V;ENSP00000351486:I696V	ENSP00000351486:I696V	I	+	1	0	NTRK1	155116463	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.824000	0.69279	1.915000	0.55452	0.459000	0.35465	ATC		0.647	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
PEAR1	375033	hgsc.bcm.edu	37	1	156879873	156879873	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:156879873C>T	ENST00000338302.3	+	14	1876	c.1651C>T	c.(1651-1653)Cgc>Tgc	p.R551C	PEAR1_ENST00000292357.7_Missense_Mutation_p.R551C			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	551					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.R551C(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGTTCATGGACGCTGTCAGTG	0.582											OREG0013890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R551C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1651T	1						.						142.0	124.0	130.0					1																	156879873		2203	4300	6503	155146497	SO:0001583	missense	375033	exon13			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1651C>T	1.37:g.156879873C>T	ENSP00000344465:p.Arg551Cys	Somatic	1781	Capture	SOLID	Phase_I	155146497	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.645023	0.67358	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.33438	1.41;1.41	4.71	4.71	0.59529	EGF-like, laminin (1);	0.254556	0.27631	N	0.018502	T	0.25717	0.0626	L	0.52573	1.65	0.36792	D	0.884887	D	0.57571	0.98	P	0.48400	0.576	T	0.03364	-1.1044	10	0.46703	T	0.11	.	15.1995	0.73122	0.0:1.0:0.0:0.0	.	551	Q5VY43	PEAR1_HUMAN	C	551	ENSP00000344465:R551C;ENSP00000292357:R551C	ENSP00000292357:R551C	R	+	1	0	PEAR1	155146497	0.000000	0.05858	0.996000	0.52242	0.983000	0.72400	0.329000	0.19698	2.447000	0.82792	0.561000	0.74099	CGC		0.582	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
FCRL2	79368	hgsc.bcm.edu	37	1	157740380	157740380	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:157740380G>A	ENST00000361516.3	-	3	177	c.129C>T	c.(127-129)aaC>aaT	p.N43N	FCRL2_ENST00000392274.3_Silent_p.N43N|FCRL2_ENST00000368181.4_Silent_p.N43N|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	43	Ig-like C2-type 1.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.N43N(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GAATTTTCCAGTTCTGTTCTC	0.433																																					p.N43N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C129T	1						.						65.0	66.0	66.0					1																	157740380		2203	4300	6503	156007004	SO:0001819	synonymous_variant	79368	exon3			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.129C>T	1.37:g.157740380G>A		Somatic		Capture	SOLID	Phase_I	156007004	NM_030764	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Silent	SNP	ENST00000361516.3	37	CCDS1168.1																																																																																				0.433	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764	
ACKR1	2532	hgsc.bcm.edu	37	1	159175912	159175912	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:159175912C>A	ENST00000368122.2	+	2	1362	c.683C>A	c.(682-684)gCc>gAc	p.A228D	DARC_ENST00000368121.2_Missense_Mutation_p.A230D|CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000537147.1_Missense_Mutation_p.A228D	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		228					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.A228D(1)		large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					TTGTTTGGAGCCAAGGGGCTG	0.537																																					p.A228D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C683A	1						.						89.0	80.0	83.0					1																	159175912		2203	4300	6503	157442536	SO:0001583	missense	2532	exon2																														ENST00000368122.2:c.683C>A	1.37:g.159175912C>A	ENSP00000357104:p.Ala228Asp	Somatic		Capture	SOLID	Phase_I	157442536	NM_002036	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	37	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.798480	0.50208	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.39056	1.1;1.1;1.1	5.07	3.2	0.36748	.	0.619363	0.12143	U	0.495617	T	0.36413	0.0966	L	0.43923	1.385	0.32617	N	0.523875	D;D	0.69078	0.997;0.997	D;D	0.67382	0.951;0.933	T	0.11991	-1.0565	10	0.37606	T	0.19	-4.4473	7.9762	0.30155	0.0:0.8088:0.0:0.1912	.	230;228	Q5Y7A1;Q16570	.;DUFFY_HUMAN	D	228;228;228;230	ENSP00000357104:A228D;ENSP00000441985:A228D;ENSP00000357103:A230D	ENSP00000352341:A228D	A	+	2	0	DARC	157442536	1.000000	0.71417	0.993000	0.49108	0.436000	0.31835	1.454000	0.35178	0.805000	0.34159	0.650000	0.86243	GCC		0.537	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
DCAF8	50717	hgsc.bcm.edu	37	1	160209671	160209671	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:160209671A>G	ENST00000368073.3	-	4	973	c.539T>C	c.(538-540)gTg>gCg	p.V180A	DCAF8_ENST00000556710.1_Missense_Mutation_p.V334A|DCAF8_ENST00000326837.2_Missense_Mutation_p.V180A|DCAF8_ENST00000610139.1_Missense_Mutation_p.V180A|DCAF8_ENST00000368074.1_Missense_Mutation_p.V180A|DCAF8_ENST00000608310.1_Missense_Mutation_p.V334A|DCAF8_ENST00000475733.1_Missense_Mutation_p.V180A			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	180					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V180A(1)		cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						GAAACGCTGCACAAAGACTCT	0.622																																					p.V180A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T539C	1						.						58.0	56.0	57.0					1																	160209671		2203	4300	6503	158476295	SO:0001583	missense	50717	exon4			AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.539T>C	1.37:g.160209671A>G	ENSP00000357052:p.Val180Ala	Somatic		Capture	SOLID	Phase_I	158476295	NM_015726	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	ENST00000368073.3	37	CCDS1200.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.247800	0.80024	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000447377;ENST00000556710	D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	5.04	5.04	0.67666	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	U	0.000006	D	0.84293	0.5440	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	0.99;1.0;0.994	D;D;P	0.80764	0.971;0.994;0.888	D	0.86495	0.1800	10	0.66056	D	0.02	-6.7435	13.7893	0.63131	1.0:0.0:0.0:0.0	.	334;180;180	G3V3G9;Q5TAQ9-2;Q5TAQ9	.;.;DCAF8_HUMAN	A	180;180;180;334;161;180;334	ENSP00000357052:V180A;ENSP00000318227:V180A;ENSP00000357053:V180A;ENSP00000451989:V334A;ENSP00000413688:V180A;ENSP00000451235:V334A	ENSP00000318227:V180A	V	-	2	0	RP11-574F21.3;DCAF8	158476295	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.114000	0.89570	1.892000	0.54788	0.533000	0.62120	GTG		0.622	DCAF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077402.2	NM_015726	
ZNF648	127665	hgsc.bcm.edu	37	1	182025564	182025564	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:182025564C>T	ENST00000339948.3	-	2	1789	c.1582G>A	c.(1582-1584)Gga>Aga	p.G528R		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G528R(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GGCCTCTCTCCGTTGTGCATT	0.617																																					p.G528R	NSCLC(71;908 1374 5429 20458 35642)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1582A	1						.						158.0	125.0	136.0					1																	182025564		2203	4300	6503	180292187	SO:0001583	missense	127665	exon2			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1582G>A	1.37:g.182025564C>T	ENSP00000344129:p.Gly528Arg	Somatic		Capture	SOLID	Phase_I	180292187	NM_001009992	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530846	0.64860	.	.	ENSG00000179930	ENST00000339948	T	0.26223	1.75	2.77	2.77	0.32553	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46171	0.1379	M	0.73962	2.25	0.37922	D	0.931729	D	0.62365	0.991	D	0.63957	0.92	T	0.57516	-0.7798	9	0.87932	D	0	.	11.7429	0.51803	0.0:1.0:0.0:0.0	.	528	Q5T619	ZN648_HUMAN	R	528	ENSP00000344129:G528R	ENSP00000344129:G528R	G	-	1	0	ZNF648	180292187	0.026000	0.19158	0.997000	0.53966	0.988000	0.76386	3.047000	0.49854	1.840000	0.53500	0.655000	0.94253	GGA		0.617	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
PAX7	5081	hgsc.bcm.edu	37	1	19062164	19062164	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:19062164G>A	ENST00000375375.3	+	8	1792	c.1194G>A	c.(1192-1194)ccG>ccA	p.P398P	PAX7_ENST00000400661.3_Silent_p.P396P|PAX7_ENST00000420770.2_Silent_p.P398P	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	398					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P398P(1)	PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CGGTGCCCCCGCAGCCACAGG	0.647			T	FOXO1A	alveolar rhabdomyosarcoma																																p.P396P			Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1188A	1						.						54.0	56.0	55.0					1																	19062164		2203	4300	6503	18934751	SO:0001819	synonymous_variant	5081	exon8			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.1194G>A	1.37:g.19062164G>A		Somatic		Capture	SOLID	Phase_I	18934751	NM_013945	E9PFV9|Q0VA99|Q2PJS5	Silent	SNP	ENST00000375375.3	37	CCDS186.1																																																																																				0.647	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584	
SWT1	54823	hgsc.bcm.edu	37	1	185153448	185153448	+	Silent	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:185153448T>A	ENST00000367500.4	+	8	1377	c.1212T>A	c.(1210-1212)gtT>gtA	p.V404V	SWT1_ENST00000367501.3_Silent_p.V404V	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	404	PINc.									breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						TCAAATTTGTTAGAATTTTGA	0.279																																					p.V404V												.	.	0			c.T1212A	1						.						44.0	48.0	47.0					1																	185153448		2190	4279	6469	183420071	SO:0001819	synonymous_variant	54823	exon8			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.1212T>A	1.37:g.185153448T>A		Somatic		Capture	SOLID	Phase_I	183420071	NM_001105518	Q8NEK9|Q9BZQ7|Q9NXQ0	Silent	SNP	ENST00000367500.4	37	CCDS1367.1																																																																																				0.279	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673	
LHX9	56956	hgsc.bcm.edu	37	1	197890640	197890640	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:197890640A>T	ENST00000367387.4	+	3	1009	c.584A>T	c.(583-585)tAt>tTt	p.Y195F	LHX9_ENST00000367390.3_Missense_Mutation_p.Y186F|LHX9_ENST00000561173.1_Missense_Mutation_p.Y201F|LHX9_ENST00000367391.1_Missense_Mutation_p.Y186F|LHX9_ENST00000337020.2_Missense_Mutation_p.Y195F	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	195					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						CAAGGAGAGTATCCACCGCAG	0.637																																					p.Y195F												.	.	0			c.A584T	1						.						47.0	47.0	47.0					1																	197890640		2203	4300	6503	196157263	SO:0001583	missense	56956	exon3			AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.584A>T	1.37:g.197890640A>T	ENSP00000356357:p.Tyr195Phe	Somatic		Capture	SOLID	Phase_I	196157263	NM_020204	Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	ENST00000367387.4	37	CCDS1393.1	.	.	.	.	.	.	.	.	.	.	A	4.007	-0.001320	0.07819	.	.	ENSG00000143355	ENST00000367391;ENST00000367390;ENST00000337020;ENST00000367387	T;D;T;D	0.88586	0.6;-2.4;0.51;-2.39	5.65	3.33	0.38152	.	0.058793	0.64402	D	0.000001	T	0.79215	0.4408	L	0.37850	1.14	0.46356	D	0.999003	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.10450	0.002;0.005;0.005	T	0.64884	-0.6302	10	0.16420	T	0.52	.	3.9839	0.09507	0.5978:0.0:0.1392:0.2629	.	195;186;186	Q9NQ69;Q9NQ69-3;Q9NQ69-2	LHX9_HUMAN;.;.	F	186;186;195;195	ENSP00000356361:Y186F;ENSP00000356360:Y186F;ENSP00000337969:Y195F;ENSP00000356357:Y195F	ENSP00000337969:Y195F	Y	+	2	0	LHX9	196157263	0.998000	0.40836	0.557000	0.28306	0.032000	0.12392	3.950000	0.56676	0.546000	0.28920	-0.250000	0.11733	TAT		0.637	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	NM_020204	
PTPN7	5778	hgsc.bcm.edu	37	1	202128610	202128610	+	Intron	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:202128610T>G	ENST00000308986.5	-	2	79				PTPN7_ENST00000544762.1_Intron|PTPN7_ENST00000492977.1_5'Flank|PTPN7_ENST00000367279.4_Missense_Mutation_p.E13A|PTPN7_ENST00000309017.3_Intron|PTPN7_ENST00000543735.1_Intron			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)	p.E13A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						CCGCTGCTGTTCTCTGGCCTG	0.632																																					p.E13A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A38C	1						.						36.0	38.0	37.0					1																	202128610		2203	4300	6503	200395233	SO:0001627	intron_variant	5778	exon1			BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931	ENST00000308986.5:c.52-28A>C	1.37:g.202128610T>G		Somatic		Capture	SOLID	Phase_I	200395233	NM_080588	B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	Missense_Mutation	SNP	ENST00000308986.5	37		.	.	.	.	.	.	.	.	.	.	T	9.679	1.148798	0.21288	.	.	ENSG00000143851	ENST00000367279	T	0.04317	3.65	4.15	-0.169	0.13339	.	.	.	.	.	T	0.03739	0.0106	.	.	.	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.40997	-0.9533	8	0.72032	D	0.01	.	4.387	0.11321	0.0:0.5068:0.1779:0.3154	.	13	P35236-2	.	A	13	ENSP00000356248:E13A	ENSP00000356248:E13A	E	-	2	0	PTPN7	200395233	0.000000	0.05858	0.001000	0.08648	0.077000	0.17291	0.465000	0.22004	-0.061000	0.13110	-0.451000	0.05528	GAA		0.632	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_002832	
PIK3C2B	5287	hgsc.bcm.edu	37	1	204401508	204401508	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:204401508G>A	ENST00000367187.3	-	28	4531	c.3975C>T	c.(3973-3975)ggC>ggT	p.G1325G	PIK3C2B_ENST00000424712.2_Silent_p.G1297G|RP11-739N20.2_ENST00000443515.1_RNA	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1325	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.G1325G(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TGGCTACACTGCCCAGGCTGG	0.498																																					p.G1325G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3975T	1						.						56.0	50.0	52.0					1																	204401508		2203	4300	6503	202668131	SO:0001819	synonymous_variant	5287	exon28			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3975C>T	1.37:g.204401508G>A		Somatic		Capture	SOLID	Phase_I	202668131	NM_002646	O95666|Q5SW99	Silent	SNP	ENST00000367187.3	37	CCDS1446.1																																																																																				0.498	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
SLC26A9	115019	hgsc.bcm.edu	37	1	205890895	205890895	+	Silent	SNP	G	G	A	rs35339136	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:205890895G>A	ENST00000367135.3	-	17	1967	c.1854C>T	c.(1852-1854)aaC>aaT	p.N618N	SLC26A9_ENST00000340781.4_Silent_p.N618N|SLC26A9_ENST00000367134.2_Silent_p.N618N	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	618	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.N618N(1)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			CGCTGGTGCCGTTAGCCGGGG	0.642													G|||	63	0.0125799	0.0008	0.0231	5008	,	,		16968	0.0		0.003	False		,,,				2504	0.044				p.N618N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1854T	1						.	G	,	6,4396	12.9+/-30.5	0,6,2195	108.0	85.0	93.0		1854,1854	-4.1	0.0	1	dbSNP_126	93	55,8545	32.8+/-85.7	0,55,4245	no	coding-synonymous,coding-synonymous	SLC26A9	NM_052934.3,NM_134325.2	,	0,61,6440	AA,AG,GG		0.6395,0.1363,0.4692	,	618/792,618/888	205890895	61,12941	2201	4300	6501	204157518	SO:0001819	synonymous_variant	115019	exon17			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1854C>T	1.37:g.205890895G>A		Somatic		Capture	SOLID	Phase_I	204157518	NM_134325	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Silent	SNP	ENST00000367135.3	37	CCDS30990.1																																																																																				0.642	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
PIGR	5284	hgsc.bcm.edu	37	1	207112739	207112739	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:207112739A>G	ENST00000356495.4	-	3	296	c.113T>C	c.(112-114)aTc>aCc	p.I38T		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	38	Ig-like V-type 1.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)	p.I38T(1)		central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTAGCACGTGATGGACACTGA	0.562																																					p.I38T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T113C	1						.						98.0	99.0	99.0					1																	207112739		2203	4300	6503	205179362	SO:0001583	missense	5284	exon3				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.113T>C	1.37:g.207112739A>G	ENSP00000348888:p.Ile38Thr	Somatic		Capture	SOLID	Phase_I	205179362	NM_002644	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.004152	0.74932	.	.	ENSG00000162896	ENST00000356495	T	0.70986	-0.53	5.45	5.45	0.79879	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.167849	0.42420	D	0.000707	D	0.86364	0.5915	M	0.91972	3.26	0.39352	D	0.965773	D	0.76494	0.999	D	0.71414	0.973	D	0.89978	0.4098	10	0.87932	D	0	-8.828	13.5454	0.61699	1.0:0.0:0.0:0.0	.	38	P01833	PIGR_HUMAN	T	38	ENSP00000348888:I38T	ENSP00000348888:I38T	I	-	2	0	PIGR	205179362	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.926000	0.56491	2.196000	0.70406	0.533000	0.62120	ATC		0.562	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
CD55	1604	hgsc.bcm.edu	37	1	207495887	207495887	+	Nonsense_Mutation	SNP	G	G	A	rs121909603		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:207495887G>A	ENST00000367064.3	+	2	519	c.261G>A	c.(259-261)tgG>tgA	p.W87*	CD55_ENST00000391920.4_Nonsense_Mutation_p.W87*|CD55_ENST00000314754.8_Nonsense_Mutation_p.W87*|CD55_ENST00000367062.4_Nonsense_Mutation_p.W87*|CD55_ENST00000391921.4_Nonsense_Mutation_p.W87*|CD55_ENST00000367063.2_Nonsense_Mutation_p.W87*|CD55_ENST00000367067.4_Nonsense_Mutation_p.W87*|CD55_ENST00000367065.5_Nonsense_Mutation_p.W87*	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	87	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)	p.W87*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	GCAGTCAATGGTCAGATATTG	0.363																																					p.W87X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G261A	1	GRCh37	CM940333	CD55	M	rs121909603	.						81.0	84.0	83.0					1																	207495887		2203	4300	6503	205562510	SO:0001587	stop_gained	1604	exon2			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.261G>A	1.37:g.207495887G>A	ENSP00000356031:p.Trp87*	Somatic		Capture	SOLID	Phase_I	205562510	NM_000574	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Nonsense_Mutation	SNP	ENST00000367064.3	37	CCDS31006.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.75|18.75	3.690611|3.690611	0.68271|0.68271	.|.	.|.	ENSG00000196352|ENSG00000196352	ENST00000343420|ENST00000367064;ENST00000367063;ENST00000391921;ENST00000367067;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.000000	.|0.52532	.|D	.|0.000067	T|.	0.36026|.	0.0952|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31503|.	-0.9941|.	3|.	.|0.02654	.|T	.|1	.|.	14.7745|14.7745	0.69713|0.69713	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	97|87	.|.	.|ENSP00000316333:W87X	G|W	+|+	2|3	0|0	CD55|CD55	205562510|205562510	1.000000|1.000000	0.71417|0.71417	0.917000|0.917000	0.36280|0.36280	0.042000|0.042000	0.13812|0.13812	4.530000|4.530000	0.60595|0.60595	2.553000|2.553000	0.86117|0.86117	0.650000|0.650000	0.86243|0.86243	GGT|TGG		0.363	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574	
C1orf74	148304	hgsc.bcm.edu	37	1	209956451	209956451	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:209956451G>T	ENST00000294811.1	-	2	785	c.529C>A	c.(529-531)Ctg>Atg	p.L177M		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	177								p.L177M(1)		endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GGATAGCCCAGGAGGATCCCA	0.507																																					p.L177M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C529A	1						.						101.0	107.0	105.0					1																	209956451		2203	4300	6503	208023074	SO:0001583	missense	148304	exon2			AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.529C>A	1.37:g.209956451G>T	ENSP00000294811:p.Leu177Met	Somatic		Capture	SOLID	Phase_I	208023074	NM_152485		Missense_Mutation	SNP	ENST00000294811.1	37	CCDS1491.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361469	0.61403	.	.	ENSG00000162757	ENST00000294811	T	0.78126	-1.15	5.27	3.4	0.38934	.	0.000000	0.64402	D	0.000003	D	0.86142	0.5862	M	0.75264	2.295	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	D	0.86096	0.1553	10	0.87932	D	0	-20.6804	11.3237	0.49436	0.1474:0.0:0.8526:0.0	.	177	Q96LT6	CA074_HUMAN	M	177	ENSP00000294811:L177M	ENSP00000294811:L177M	L	-	1	2	C1orf74	208023074	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	3.292000	0.51772	0.614000	0.30107	0.655000	0.94253	CTG		0.507	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088745.1	NM_152485	
DDOST	1650	hgsc.bcm.edu	37	1	20980800	20980800	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:20980800C>T	ENST00000375048.3	-	7	866	c.761G>A	c.(760-762)cGc>cAc	p.R254H	DDOST_ENST00000415136.2_Missense_Mutation_p.R217H|PINK1-AS_ENST00000451424.1_RNA|DDOST_ENST00000602624.2_Missense_Mutation_p.R237H	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	254					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.R254H(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAAGATGACGCGGGCATTGTT	0.607																																					p.R254H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G761A	1						.						50.0	42.0	45.0					1																	20980800		2197	4283	6480	20853387	SO:0001583	missense	1650	exon7			D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.761G>A	1.37:g.20980800C>T	ENSP00000364188:p.Arg254His	Somatic		Capture	SOLID	Phase_I	20853387	NM_005216	B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Missense_Mutation	SNP	ENST00000375048.3	37	CCDS212.1	.	.	.	.	.	.	.	.	.	.	C	35	5.595381	0.96602	.	.	ENSG00000244038	ENST00000375048;ENST00000415136	D;D	0.91464	-2.85;-2.85	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97074	0.9044	H	0.95151	3.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.97752	1.0215	10	0.87932	D	0	-23.7583	19.7977	0.96492	0.0:1.0:0.0:0.0	.	217;236;254	E7EWT1;B4DLI2;P39656	.;.;OST48_HUMAN	H	254;217	ENSP00000364188:R254H;ENSP00000399457:R217H	ENSP00000364188:R254H	R	-	2	0	DDOST	20853387	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.491000	0.81471	2.692000	0.91855	0.491000	0.48974	CGC		0.607	DDOST-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007961.2	NM_005216	
SYT14	255928	hgsc.bcm.edu	37	1	210273363	210273363	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:210273363T>C	ENST00000472886.1	+	6	735	c.721T>C	c.(721-723)Tca>Cca	p.S241P	SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000534859.1_Missense_Mutation_p.S241P|SYT14_ENST00000399639.2_Missense_Mutation_p.S241P|SYT14_ENST00000367015.1_Missense_Mutation_p.S203P|SYT14_ENST00000422431.1_Missense_Mutation_p.S286P|SYT14_ENST00000537238.1_Missense_Mutation_p.S203P|SYT14_ENST00000367019.1_Missense_Mutation_p.S241P			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	241					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)	p.S241P(1)		endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TTAGGATATGTCAGCTCAAGG	0.328																																					p.S241P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T721C	1						.						39.0	38.0	38.0					1																	210273363		2203	4300	6503	208339986	SO:0001583	missense	255928	exon6			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.721T>C	1.37:g.210273363T>C	ENSP00000418901:p.Ser241Pro	Somatic		Capture	SOLID	Phase_I	208339986	NM_153262	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	37	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.163860	0.78226	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.19938	3.29;3.14;2.11;3.41;3.16;3.41;3.41	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.39200	0.1069	L	0.47716	1.5	0.80722	D	1	D;B;D;B	0.71674	0.998;0.001;0.997;0.025	D;B;D;B	0.75484	0.986;0.002;0.943;0.023	T	0.04294	-1.0962	10	0.25751	T	0.34	-11.5839	16.2078	0.82141	0.0:0.0:0.0:1.0	.	269;241;241;286	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	P	286;241;241;203;241;241;203	ENSP00000389039:S286P;ENSP00000442891:S241P;ENSP00000445837:S241P;ENSP00000437423:S203P;ENSP00000355986:S241P;ENSP00000418901:S241P;ENSP00000355982:S203P	ENSP00000355982:S203P	S	+	1	0	SYT14	208339986	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.285000	0.78660	2.229000	0.72834	0.482000	0.46254	TCA		0.328	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
TRAF5	7188	hgsc.bcm.edu	37	1	211545629	211545629	+	Missense_Mutation	SNP	C	C	T	rs376419381		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:211545629C>T	ENST00000261464.5	+	11	1313	c.1259C>T	c.(1258-1260)gCg>gTg	p.A420V	TRAF5_ENST00000367004.3_Missense_Mutation_p.A420V|TRAF5_ENST00000336184.2_Missense_Mutation_p.A420V|TRAF5_ENST00000427925.2_Missense_Mutation_p.A314V	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	420	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A420V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		AAGAGAGAGGCGGTGGATGGG	0.493																																					p.A420V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1259T	1						.	C	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	105.0	112.0	110.0		1259,1259,1259	5.2	1.0	1		110	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TRAF5	NM_001033910.2,NM_004619.3,NM_145759.2	64,64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	420/558,420/558,420/558	211545629	1,13005	2203	4300	6503	209612252	SO:0001583	missense	7188	exon11			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.1259C>T	1.37:g.211545629C>T	ENSP00000261464:p.Ala420Val	Somatic		Capture	SOLID	Phase_I	209612252	NM_004619	B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	ENST00000261464.5	37	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.049386	0.93740	0.0	1.16E-4	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	T;T;T;T	0.49432	1.72;0.78;1.72;1.72	5.16	5.16	0.70880	TRAF-type (1);TRAF-like (1);MATH (2);	0.108256	0.64402	D	0.000011	T	0.77955	0.4208	M	0.93550	3.43	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.979;0.999	D	0.84215	0.0458	10	0.87932	D	0	-15.8094	19.0335	0.92967	0.0:1.0:0.0:0.0	.	314;431;420	F5H1P7;B4E0A2;O00463	.;.;TRAF5_HUMAN	V	420;314;420;420	ENSP00000336825:A420V;ENSP00000389891:A314V;ENSP00000261464:A420V;ENSP00000355971:A420V	ENSP00000261464:A420V	A	+	2	0	TRAF5	209612252	1.000000	0.71417	0.956000	0.39512	0.903000	0.53119	5.721000	0.68477	2.561000	0.86390	0.650000	0.86243	GCG		0.493	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
HSPG2	3339	hgsc.bcm.edu	37	1	22174194	22174194	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:22174194G>A	ENST00000374695.3	-	61	8092	c.8013C>T	c.(8011-8013)ccC>ccT	p.P2671P	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2671	Ig-like C2-type 12.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGTGTCGGGAGGGAAGGCTGC	0.647																																					p.P2671P												.	.	0			c.C8013T	1						.						40.0	36.0	38.0					1																	22174194		2202	4299	6501	22046781	SO:0001819	synonymous_variant	3339	exon61			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8013C>T	1.37:g.22174194G>A		Somatic		Capture	SOLID	Phase_I	22046781	NM_005529	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1																																																																																				0.647	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
DUSP10	11221	hgsc.bcm.edu	37	1	221879470	221879470	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:221879470G>A	ENST00000366899.3	-	3	1388	c.1150C>T	c.(1150-1152)Cgg>Tgg	p.R384W	DUSP10_ENST00000544095.1_Missense_Mutation_p.R42W|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_Missense_Mutation_p.R42W	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	384	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R384W(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		AAGTACTGCCGCAGGTTCTGC	0.488																																					p.R42W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C124T	1						.						107.0	110.0	109.0					1																	221879470		2203	4300	6503	219946093	SO:0001583	missense	11221	exon2			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.1150C>T	1.37:g.221879470G>A	ENSP00000355866:p.Arg384Trp	Somatic		Capture	SOLID	Phase_I	219946093	NM_144728	D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	ENST00000366899.3	37	CCDS1528.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842433	0.71488	.	.	ENSG00000143507	ENST00000366899;ENST00000418487;ENST00000323825;ENST00000544095	D;D;D	0.85955	-2.05;-2.05;-2.05	5.44	2.34	0.29019	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.059071	0.64402	D	0.000003	D	0.89427	0.6712	M	0.65320	2	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.88648	0.3180	10	0.72032	D	0.01	.	10.0482	0.42199	0.0:0.0996:0.4863:0.414	.	384	Q9Y6W6	DUS10_HUMAN	W	384;329;42;42	ENSP00000355866:R384W;ENSP00000322015:R42W;ENSP00000441302:R42W	ENSP00000322015:R42W	R	-	1	2	DUSP10	219946093	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.047000	0.30367	0.757000	0.33036	0.591000	0.81541	CGG		0.488	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207	
SUSD4	55061	hgsc.bcm.edu	37	1	223442011	223442011	+	Missense_Mutation	SNP	C	C	T	rs147477935	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:223442011C>T	ENST00000343846.3	-	3	1001	c.368G>A	c.(367-369)cGt>cAt	p.R123H	SUSD4_ENST00000484758.2_Missense_Mutation_p.R52H|SUSD4_ENST00000494793.2_Missense_Mutation_p.R123H|SUSD4_ENST00000344029.6_Missense_Mutation_p.R123H|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366878.4_Missense_Mutation_p.R123H			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	123	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R123H(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		TTGAGGGATACGGCAATCTGC	0.388																																					p.R123H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G368A	1						.	C	HIS/ARG,HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	164.0	142.0	149.0		368,368	4.9	1.0	1	dbSNP_134	149	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	SUSD4	NM_001037175.2,NM_017982.3	29,29	0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308	benign,benign	123/291,123/491	223442011	4,13002	2203	4300	6503	221508634	SO:0001583	missense	55061	exon4			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.368G>A	1.37:g.223442011C>T	ENSP00000344219:p.Arg123His	Somatic		Capture	SOLID	Phase_I	221508634	NM_001037175	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	ENST00000343846.3	37	CCDS41471.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290481	0.59976	4.54E-4	2.33E-4	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000271787;ENST00000344029	T;T;T	0.65364	-0.15;-0.15;-0.15	5.91	4.95	0.65309	Complement control module (3);Sushi/SCR/CCP (3);	0.000000	0.48767	D	0.000166	T	0.59487	0.2197	N	0.08118	0	0.80722	D	1	B;D;B	0.89917	0.026;1.0;0.009	B;D;B	0.79784	0.04;0.993;0.003	T	0.61603	-0.7029	10	0.40728	T	0.16	-20.1829	12.0348	0.53418	0.301:0.6989:0.0:0.0	.	52;123;123	B7Z369;Q5VX71-3;Q5VX71	.;.;SUSD4_HUMAN	H	123;123;52;123;123	ENSP00000344219:R123H;ENSP00000355843:R123H;ENSP00000339926:R123H	ENSP00000271787:R123H	R	-	2	0	SUSD4	221508634	0.987000	0.35691	0.970000	0.41538	0.601000	0.36947	2.797000	0.47877	2.802000	0.96397	0.650000	0.86243	CGT		0.388	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
PGBD5	79605	hgsc.bcm.edu	37	1	230492910	230492910	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:230492910C>T	ENST00000525115.1	-	2	305	c.282G>A	c.(280-282)acG>acA	p.T94T	PGBD5_ENST00000321327.2_Silent_p.T193T|PGBD5_ENST00000391860.1_Silent_p.T48T			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	94						integral component of membrane (GO:0016021)		p.T193T(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		TCTCCGTCAGCGTCACCTCCA	0.577																																					p.T94T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G282A	1						.						122.0	101.0	108.0					1																	230492910		2203	4300	6503	228559533	SO:0001819	synonymous_variant	79605	exon2			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.282G>A	1.37:g.230492910C>T		Somatic		Capture	SOLID	Phase_I	228559533	NM_024554	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	ENST00000525115.1	37																																																																																					0.577	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234743393	234743393	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:234743393G>A	ENST00000366609.3	-	2	1284	c.1254C>T	c.(1252-1254)gcC>gcT	p.A418A	IRF2BP2_ENST00000366610.3_Silent_p.A402A|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'UTR	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.A418A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GGCCATTCTGGGCCGCTTCAG	0.577																																					p.A418A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1254T	1						.						91.0	97.0	95.0					1																	234743393		2203	4300	6503	232810016	SO:0001819	synonymous_variant	359948	exon2			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1254C>T	1.37:g.234743393G>A		Somatic		Capture	SOLID	Phase_I	232810016	NM_182972	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																				0.577	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
NID1	4811	hgsc.bcm.edu	37	1	236212051	236212051	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:236212051A>T	ENST00000264187.6	-	2	546	c.464T>A	c.(463-465)gTc>gAc	p.V155D	NID1_ENST00000366595.3_Missense_Mutation_p.V155D	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	155	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.V155D(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	TTCCCAAGTGACAACCACCGC	0.577																																					p.V155D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T464A	1						.						72.0	65.0	68.0					1																	236212051		2203	4300	6503	234278674	SO:0001583	missense	4811	exon2			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.464T>A	1.37:g.236212051A>T	ENSP00000264187:p.Val155Asp	Somatic		Capture	SOLID	Phase_I	234278674	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	37	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	A	19.52	3.842456	0.71488	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.23552	1.9;1.9	4.81	4.81	0.61882	Nidogen, extracellular domain (2);	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	M	0.85197	2.74	0.80722	D	1	D;P	0.89917	1.0;0.822	D;P	0.74674	0.984;0.682	T	0.63319	-0.6664	10	0.87932	D	0	.	14.5333	0.67942	1.0:0.0:0.0:0.0	.	155;155	P14543-2;P14543	.;NID1_HUMAN	D	155	ENSP00000264187:V155D;ENSP00000355554:V155D	ENSP00000264187:V155D	V	-	2	0	NID1	234278674	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	4.319000	0.59197	2.019000	0.59389	0.533000	0.62120	GTC		0.577	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
HEATR1	55127	hgsc.bcm.edu	37	1	236736077	236736077	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:236736077C>T	ENST00000366582.3	-	25	3625	c.3511G>A	c.(3511-3513)Gct>Act	p.A1171T	HEATR1_ENST00000366581.2_Missense_Mutation_p.A1090T	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1171					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.A1171T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AAGGGTTTAGCTTTATCTGGT	0.403																																					p.A1171T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3511A	1						.						356.0	327.0	337.0					1																	236736077		2203	4300	6503	234802700	SO:0001583	missense	55127	exon25			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3511G>A	1.37:g.236736077C>T	ENSP00000355541:p.Ala1171Thr	Somatic		Capture	SOLID	Phase_I	234802700	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	9.980	1.227986	0.22542	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66995	-0.24;1.93	5.37	-0.102	0.13613	Armadillo-type fold (1);	0.814093	0.11736	N	0.534438	T	0.44307	0.1287	N	0.22421	0.69	0.50467	D	0.999879	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.20538	-1.0272	10	0.12430	T	0.62	.	6.0891	0.19985	0.1265:0.4424:0.0:0.4311	.	1090;1171	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	T	1171;1090	ENSP00000355541:A1171T;ENSP00000355540:A1090T	ENSP00000355540:A1090T	A	-	1	0	HEATR1	234802700	0.370000	0.25047	0.963000	0.40424	0.992000	0.81027	-0.403000	0.07214	0.173000	0.19788	-0.150000	0.13652	GCT		0.403	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
WDR64	128025	hgsc.bcm.edu	37	1	241907740	241907740	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:241907740C>T	ENST00000366552.2	+	12	1693	c.1486C>T	c.(1486-1488)Cct>Tct	p.P496S	WDR64_ENST00000437684.2_Missense_Mutation_p.P496S	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	496								p.P216S(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GATTTTAGAACCTCATGGTTT	0.413																																					p.P496S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1486T	1						.						115.0	114.0	114.0					1																	241907740		2203	4300	6503	239974363	SO:0001583	missense	128025	exon12			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1486C>T	1.37:g.241907740C>T	ENSP00000355510:p.Pro496Ser	Somatic		Capture	SOLID	Phase_I	239974363	NM_144625	B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37		.	.	.	.	.	.	.	.	.	.	C	11.03	1.520266	0.27211	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.39592	1.07;1.07;5.01	6.08	3.04	0.35103	.	0.191352	0.37669	N	0.002000	T	0.20333	0.0489	N	0.04959	-0.14	0.33812	D	0.627942	B	0.13145	0.007	B	0.17722	0.019	T	0.15665	-1.0429	10	0.28530	T	0.3	-11.7738	9.0231	0.36213	0.0:0.5005:0.4191:0.0804	.	216	D1MPS4	.	S	496;496;267	ENSP00000355510:P496S;ENSP00000402446:P496S;ENSP00000406656:P267S	ENSP00000355510:P496S	P	+	1	0	WDR64	239974363	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.191000	0.32138	0.886000	0.36113	-0.137000	0.14449	CCT		0.413	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
IL22RA1	58985	hgsc.bcm.edu	37	1	24447502	24447502	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:24447502G>A	ENST00000270800.1	-	7	1556	c.1518C>T	c.(1516-1518)ggC>ggT	p.G506G		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	506					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)	p.G506G(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		ACATGGGGTGGCCCTCGATCT	0.602																																					p.G506G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1518T	1						.						114.0	96.0	102.0					1																	24447502		2203	4300	6503	24320089	SO:0001819	synonymous_variant	58985	exon7			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.1518C>T	1.37:g.24447502G>A		Somatic		Capture	SOLID	Phase_I	24320089	NM_021258	A8K839|B2R9Y9|Q9HB22	Silent	SNP	ENST00000270800.1	37	CCDS247.1																																																																																				0.602	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1		
SDCCAG8	10806	hgsc.bcm.edu	37	1	243434338	243434338	+	Silent	SNP	G	G	A	rs145877279	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:243434338G>A	ENST00000366541.3	+	3	397	c.279G>A	c.(277-279)ccG>ccA	p.P93P	SDCCAG8_ENST00000343783.6_Intron|SDCCAG8_ENST00000391846.1_Silent_p.P93P|SDCCAG8_ENST00000355875.4_Silent_p.P93P	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	93					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)		p.P93P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		AAGTATCTCCGTCAAGAAGAA	0.358													G|||	7	0.00139776	0.0	0.0	5008	,	,		14697	0.0		0.0	False		,,,				2504	0.0072				p.P93P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G279A	1						.	G		1,4405	2.1+/-5.4	0,1,2202	126.0	116.0	119.0		279	-1.8	0.9	1	dbSNP_134	119	13,8587	10.5+/-38.8	0,13,4287	no	coding-synonymous	SDCCAG8	NM_006642.3		0,14,6489	AA,AG,GG		0.1512,0.0227,0.1076		93/714	243434338	14,12992	2203	4300	6503	241500961	SO:0001819	synonymous_variant	10806	exon3			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.279G>A	1.37:g.243434338G>A		Somatic		Capture	SOLID	Phase_I	241500961	NM_006642	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Silent	SNP	ENST00000366541.3	37	CCDS31075.1																																																																																				0.358	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642	
PIK3CD	5293	hgsc.bcm.edu	37	1	9780920	9780920	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:9780920C>T	ENST00000377346.4	+	13	1837	c.1642C>T	c.(1642-1644)Cgg>Tgg	p.R548W	PIK3CD_ENST00000543390.1_Missense_Mutation_p.R215W|PIK3CD_ENST00000536656.1_Missense_Mutation_p.R572W|PIK3CD_ENST00000361110.2_Missense_Mutation_p.R572W	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	548	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.R548W(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GGCGCTAGCCCGGCTGCTGCT	0.672																																					p.R548W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1642T	1						.						41.0	43.0	42.0					1																	9780920		2201	4298	6499	9703507	SO:0001583	missense	5293	exon13				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.1642C>T	1.37:g.9780920C>T	ENSP00000366563:p.Arg548Trp	Somatic		Capture	SOLID	Phase_I	9703507	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724759	0.48833	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563;ENST00000543390	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.43	2.37	0.29283	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.142496	0.47093	D	0.000243	T	0.68879	0.3049	L	0.46157	1.445	0.26770	N	0.969812	D;D;D	0.76494	0.999;0.999;0.999	D;P;D	0.72982	0.952;0.875;0.979	T	0.59941	-0.7359	10	0.87932	D	0	-30.2922	9.002	0.36088	0.5048:0.4206:0.0:0.0746	.	547;572;548	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	W	572;548;572;572;215	ENSP00000446444:R572W;ENSP00000366563:R548W;ENSP00000354410:R572W;ENSP00000443811:R215W	ENSP00000353766:R572W	R	+	1	2	PIK3CD	9703507	1.000000	0.71417	0.914000	0.36105	0.001000	0.01503	2.980000	0.49321	0.648000	0.30732	-0.362000	0.07510	CGG		0.672	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
AUNIP	79000	hgsc.bcm.edu	37	1	26161885	26161885	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:26161885G>A	ENST00000374298.3	-	3	727	c.673C>T	c.(673-675)Ccc>Tcc	p.P225S	AUNIP_ENST00000481602.1_Intron|AUNIP_ENST00000538789.1_Missense_Mutation_p.P225S	NM_024037.1	NP_076942.1	Q9H7T9	AUNIP_HUMAN	aurora kinase A and ninein interacting protein	225	Interaction with AURKA.				spindle organization (GO:0007051)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)		p.P225S(1)									TTGCCTAAGGGCTGACAGCAT	0.463																																					p.P225S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C673T	1						.						129.0	127.0	128.0					1																	26161885		2203	4300	6503	26034472	SO:0001583	missense	79000	exon3				CCDS266.1, CCDS72731.1	1p36.11	2012-08-07	2012-08-07	2012-08-07	ENSG00000127423	ENSG00000127423			28363	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 135"""	C1orf135		20596670	Standard	NM_001287490		Approved	MGC2603, AIBp	uc001bkw.1	Q9H7T9	OTTHUMG00000007372	ENST00000374298.3:c.673C>T	1.37:g.26161885G>A	ENSP00000363416:p.Pro225Ser	Somatic		Capture	SOLID	Phase_I	26034472	NM_024037	C9EI59|Q53F70	Missense_Mutation	SNP	ENST00000374298.3	37	CCDS266.1	.	.	.	.	.	.	.	.	.	.	G	1.979	-0.434599	0.04669	.	.	ENSG00000127423	ENST00000538789;ENST00000374298	T;T	0.44083	0.93;0.93	5.22	3.23	0.37069	.	0.845866	0.10327	N	0.688027	T	0.25568	0.0622	L	0.27053	0.805	0.09310	N	1	B	0.23377	0.084	B	0.26094	0.066	T	0.33650	-0.9860	10	0.07325	T	0.83	-25.4019	5.4305	0.16450	0.1073:0.0:0.6971:0.1956	.	225	Q9H7T9	CA135_HUMAN	S	225	ENSP00000443647:P225S;ENSP00000363416:P225S	ENSP00000363416:P225S	P	-	1	0	C1orf135	26034472	0.000000	0.05858	0.017000	0.16124	0.454000	0.32378	0.286000	0.18902	0.803000	0.34113	0.585000	0.79938	CCC		0.463	AUNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019309.2	NM_024037	
ARID1A	8289	hgsc.bcm.edu	37	1	27100203	27100203	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:27100203G>A	ENST00000324856.7	+	16	4370	c.3999G>A	c.(3997-3999)caG>caA	p.Q1333Q	ARID1A_ENST00000457599.2_Silent_p.Q1333Q|ARID1A_ENST00000374152.2_Silent_p.Q950Q|ARID1A_ENST00000540690.1_5'UTR	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1333	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q1333Q(1)|p.Q1334del(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		agcagcagcagcaACGGTGAG	0.577			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q1333Q			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	2	Substitution - coding silent(1)|Deletion - In frame(1)	large_intestine(1)|prostate(1)	c.G3999A	1						.						73.0	75.0	74.0					1																	27100203		2203	4300	6503	26972790	SO:0001819	synonymous_variant	8289	exon16			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3999G>A	1.37:g.27100203G>A		Somatic		Capture	SOLID	Phase_I	26972790	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	4.894	0.166205	0.09339	.	.	ENSG00000117713	ENST00000430799	.	.	.	5.67	3.73	0.42828	.	.	.	.	.	T	0.62405	0.2425	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60944	-0.7162	4	.	.	.	-1.5427	11.6172	0.51096	0.153:0.0:0.847:0.0	.	.	.	.	T	230	.	.	A	+	1	0	ARID1A	26972790	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.929000	0.40114	1.342000	0.45619	0.655000	0.94253	GCA		0.577	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
KDF1	126695	hgsc.bcm.edu	37	1	27278073	27278073	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:27278073C>T	ENST00000320567.5	-	2	887	c.799G>A	c.(799-801)Gtg>Atg	p.V267M		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		267					developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)		p.V267M(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TCCAGGAACACAGTGTCTGAT	0.542																																					p.V267M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	1						.						72.0	60.0	64.0					1																	27278073		2203	4300	6503	27150660	SO:0001583	missense	126695	exon2																														ENST00000320567.5:c.799G>A	1.37:g.27278073C>T	ENSP00000319179:p.Val267Met	Somatic		Capture	SOLID	Phase_I	27150660	NM_152365	Q5QP32|Q8N0S7	Missense_Mutation	SNP	ENST00000320567.5	37	CCDS293.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943956	0.53079	.	.	ENSG00000175707	ENST00000320567	T	0.34859	1.34	4.97	4.06	0.47325	.	0.155728	0.43919	D	0.000501	T	0.42245	0.1194	N	0.17082	0.46	0.45118	D	0.998133	D	0.76494	0.999	D	0.70016	0.967	T	0.46938	-0.9155	10	0.72032	D	0.01	.	13.3497	0.60595	0.0:0.9242:0.0:0.0758	.	267	Q8NAX2	CA172_HUMAN	M	267	ENSP00000319179:V267M	ENSP00000319179:V267M	V	-	1	0	C1orf172	27150660	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	4.564000	0.60830	1.325000	0.45301	0.555000	0.69702	GTG		0.542	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012340.1		
SRSF4	6429	hgsc.bcm.edu	37	1	29475269	29475269	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:29475269G>A	ENST00000373795.4	-	6	1372	c.1138C>T	c.(1138-1140)Cga>Tga	p.R380*	RP11-242O24.3_ENST00000413004.1_lincRNA|SRSF4_ENST00000546138.1_3'UTR|SRSF4_ENST00000466448.1_5'UTR	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	380	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R380*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						ttgctgcctcgctttctgctc	0.592																																					p.R380X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1138T	1						.						55.0	54.0	54.0					1																	29475269		2203	4300	6503	29347856	SO:0001587	stop_gained	6429	exon6			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.1138C>T	1.37:g.29475269G>A	ENSP00000362900:p.Arg380*	Somatic		Capture	SOLID	Phase_I	29347856	NM_005626	Q5VXP1|Q9BUA4|Q9UEB5	Nonsense_Mutation	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612847	0.87258	.	.	ENSG00000116350	ENST00000373795;ENST00000434636	.	.	.	5.72	5.72	0.89469	.	0.442863	0.22949	N	0.053682	.	.	.	.	.	.	0.26382	N	0.976728	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4435	0.61127	0.0:0.0:0.8433:0.1567	.	.	.	.	X	380	.	ENSP00000362900:R380X	R	-	1	2	SRSF4	29347856	0.617000	0.27043	0.011000	0.14972	0.946000	0.59487	2.315000	0.43752	2.691000	0.91804	0.655000	0.94253	CGA		0.592	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
ZCCHC17	51538	hgsc.bcm.edu	37	1	31810107	31810107	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:31810107G>T	ENST00000373714.1	+	4	471	c.210G>T	c.(208-210)aaG>aaT	p.K70N	ZCCHC17_ENST00000344147.5_Missense_Mutation_p.K70N|ZCCHC17_ENST00000479629.1_3'UTR|ZCCHC17_ENST00000422613.2_Missense_Mutation_p.K46N|ZCCHC17_ENST00000546109.1_Missense_Mutation_p.K62N|RP11-266K22.2_ENST00000430143.1_RNA	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	70	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.					cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.K70N(1)		breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		TGTGGGTGAAGCTTATTGGCC	0.448																																					p.K70N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G210T	1						.						179.0	169.0	173.0					1																	31810107		2203	4300	6503	31582694	SO:0001583	missense	51538	exon4			AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.210G>T	1.37:g.31810107G>T	ENSP00000362819:p.Lys70Asn	Somatic		Capture	SOLID	Phase_I	31582694	NM_016505	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Missense_Mutation	SNP	ENST00000373714.1	37	CCDS341.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067651	0.76301	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	6.17	5.27	0.74061	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.78792	0.4339	H	0.96365	3.81	0.35753	D	0.819546	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86505	0.1806	10	0.87932	D	0	.	8.404	0.32603	0.2242:0.0:0.7758:0.0	.	46;62;70	E7EPF0;B4DY38;Q9NP64	.;.;NO40_HUMAN	N	70;70;62;46	ENSP00000343557:K70N;ENSP00000362819:K70N;ENSP00000444742:K62N;ENSP00000391336:K46N	ENSP00000343557:K70N	K	+	3	2	ZCCHC17	31582694	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.031000	0.30165	1.635000	0.50512	0.655000	0.94253	AAG		0.448	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010665.1	NM_016505	
AGO4	192670	hgsc.bcm.edu	37	1	36306828	36306828	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:36306828G>T	ENST00000373210.3	+	14	2032	c.1787G>T	c.(1786-1788)gGg>gTg	p.G596V		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	596	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)	p.G596V(1)									CCCCCAGCAGGGGATGGGAAG	0.587																																					p.G596V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1787T	1						.						49.0	46.0	47.0					1																	36306828		2203	4300	6503	36079415	SO:0001583	missense	192670	exon14			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.1787G>T	1.37:g.36306828G>T	ENSP00000362306:p.Gly596Val	Somatic		Capture	SOLID	Phase_I	36079415	NM_017629	A7MD27	Missense_Mutation	SNP	ENST00000373210.3	37	CCDS397.1	.	.	.	.	.	.	.	.	.	.	G	33	5.206720	0.95033	.	.	ENSG00000134698	ENST00000373210	T	0.34072	1.38	6.01	6.01	0.97437	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.67970	0.2950	M	0.89840	3.065	0.80722	D	1	D	0.55605	0.972	D	0.62955	0.909	T	0.71777	-0.4490	10	0.59425	D	0.04	-14.5025	20.5211	0.99222	0.0:0.0:1.0:0.0	.	596	Q9HCK5	AGO4_HUMAN	V	596	ENSP00000362306:G596V	ENSP00000362306:G596V	G	+	2	0	EIF2C4	36079415	1.000000	0.71417	0.923000	0.36655	0.998000	0.95712	9.732000	0.98816	2.861000	0.98227	0.650000	0.86243	GGG		0.587	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629	
EXO5	64789	hgsc.bcm.edu	37	1	40981048	40981048	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:40981048T>A	ENST00000372703.1	+	2	1906	c.832T>A	c.(832-834)Tct>Act	p.S278T	RP11-656D10.6_ENST00000437060.1_RNA|EXO5_ENST00000358527.2_Missense_Mutation_p.S278T|EXO5_ENST00000296380.4_Missense_Mutation_p.S278T|RP11-656D10.5_ENST00000453437.1_RNA			Q9H790	EXO5_HUMAN	exonuclease 5	278					DNA catabolic process, exonucleolytic (GO:0000738)|interstrand cross-link repair (GO:0036297)	cytosol (GO:0005829)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)	p.S278T(1)									TGTCTTCTTGTCTCTAACACT	0.488																																					p.S278T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T832A	1						.						193.0	179.0	184.0					1																	40981048		2203	4300	6503	40753635	SO:0001583	missense	64789	exon3			AK024797	CCDS453.1	1p34.2	2012-11-02	2012-10-30	2012-10-30	ENSG00000164002	ENSG00000164002			26115	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 176"", ""defects in morphology 1 homolog (S. cerevisiae)"""	C1orf176, DEM1		23095756	Standard	NM_022774		Approved	FLJ21144	uc001cfp.3	Q9H790	OTTHUMG00000007305	ENST00000372703.1:c.832T>A	1.37:g.40981048T>A	ENSP00000361788:p.Ser278Thr	Somatic		Capture	SOLID	Phase_I	40753635	NM_022774	D3DPV4|Q5SWM7|Q5SWM8|Q5SWM9|Q5SWN0|Q5SWN1|Q8WTW9	Missense_Mutation	SNP	ENST00000372703.1	37	CCDS453.1	.	.	.	.	.	.	.	.	.	.	T	7.821	0.717708	0.15372	.	.	ENSG00000164002	ENST00000358527;ENST00000372703;ENST00000296380	T;T;T	0.31510	1.49;1.49;1.49	5.31	2.88	0.33553	.	0.120124	0.35291	N	0.003306	T	0.20047	0.0482	N	0.21373	0.66	0.27142	N	0.961624	P	0.37914	0.611	B	0.41036	0.346	T	0.14643	-1.0465	10	0.13108	T	0.6	-8.8372	9.5254	0.39160	0.0:0.0:0.3461:0.6539	.	278	Q9H790	EXO5_HUMAN	T	278	ENSP00000351328:S278T;ENSP00000361788:S278T;ENSP00000296380:S278T	ENSP00000296380:S278T	S	+	1	0	DEM1	40753635	0.993000	0.37304	0.814000	0.32528	0.995000	0.86356	0.346000	0.19997	0.507000	0.28148	0.528000	0.53228	TCT		0.488	EXO5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019087.1	NM_022774	
TIE1	7075	hgsc.bcm.edu	37	1	43783267	43783267	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:43783267G>A	ENST00000372476.3	+	16	2732	c.2653G>A	c.(2653-2655)Gcg>Acg	p.A885T	TIE1_ENST00000473014.1_3'UTR|TIE1_ENST00000433781.2_Missense_Mutation_p.A530T	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	885	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A885T(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TCGTGACTTTGCGGGAGAACT	0.502																																					p.A885T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2653A	1						.						165.0	180.0	175.0					1																	43783267		2203	4300	6503	43555854	SO:0001583	missense	7075	exon16			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2653G>A	1.37:g.43783267G>A	ENSP00000361554:p.Ala885Thr	Somatic		Capture	SOLID	Phase_I	43555854	NM_005424	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	CCDS482.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584270	0.86748	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	D;D	0.82619	-1.63;-1.63	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.39985	N	0.001216	T	0.81226	0.4778	L	0.38953	1.18	0.80722	D	1	P;P;P	0.51057	0.941;0.666;0.941	P;B;P	0.45577	0.486;0.216;0.486	T	0.81510	-0.0900	10	0.45353	T	0.12	.	19.7383	0.96217	0.0:0.0:1.0:0.0	.	840;530;885	B4DTW8;B4DKW0;P35590	.;.;TIE1_HUMAN	T	885;288;168;530	ENSP00000361554:A885T;ENSP00000411728:A530T	ENSP00000361553:A288T	A	+	1	0	TIE1	43555854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.675000	0.91044	0.655000	0.94253	GCG		0.502	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424	
RNF220	55182	hgsc.bcm.edu	37	1	45115566	45115566	+	Silent	SNP	G	G	A	rs201920718		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:45115566G>A	ENST00000355387.2	+	14	2016	c.1566G>A	c.(1564-1566)tcG>tcA	p.S522S	RNF220_ENST00000480686.1_3'UTR|TMEM53_ENST00000372242.3_Intron|TMEM53_ENST00000372244.3_Intron|RNF220_ENST00000361799.2_Silent_p.S522S|TMEM53_ENST00000372243.3_Intron|RNF220_ENST00000443020.2_Silent_p.S309S|RNF220_ENST00000372247.2_Silent_p.S522S			Q5VTB9	RN220_HUMAN	ring finger protein 220	522	Required for targeting to the cytoplasm. {ECO:0000250}.				protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S522S(2)		endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						ACTCGTACTCGATGCCCCTAA	0.657													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17360	0.0		0.0	False		,,,				2504	0.0				p.S522S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1566A	1						.						107.0	85.0	93.0					1																	45115566		2203	4300	6503	44888153	SO:0001819	synonymous_variant	55182	exon14			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.1566G>A	1.37:g.45115566G>A		Somatic		Capture	SOLID	Phase_I	44888153	NM_018150	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Silent	SNP	ENST00000355387.2	37	CCDS510.1																																																																																				0.657	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150	
TOE1	114034	hgsc.bcm.edu	37	1	45808849	45808849	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:45808849G>A	ENST00000372090.5	+	8	1591	c.1008G>A	c.(1006-1008)cgG>cgA	p.R336R	MUTYH_ENST00000529984.1_5'Flank|MUTYH_ENST00000528332.2_5'Flank|TOE1_ENST00000539779.1_Silent_p.R256R|MUTYH_ENST00000372110.3_5'Flank|MUTYH_ENST00000372098.3_5'Flank|TESK2_ENST00000486676.1_5'Flank|MUTYH_ENST00000372115.3_5'Flank|MUTYH_ENST00000450313.1_5'Flank|TOE1_ENST00000495703.1_3'UTR	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	336						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R336R(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					AGGACAAGCGGCGACGGCGAC	0.567																																					p.R336R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1008A	1						.						112.0	113.0	113.0					1																	45808849		2203	4300	6503	45581436	SO:0001819	synonymous_variant	114034	exon8				CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.1008G>A	1.37:g.45808849G>A		Somatic		Capture	SOLID	Phase_I	45581436	NM_025077	B4DEM6|Q6IA35|Q8IWN5|Q9H846	Silent	SNP	ENST00000372090.5	37	CCDS521.1																																																																																				0.567	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020517.1	NM_025077	
CYP4B1	1580	hgsc.bcm.edu	37	1	47284329	47284329	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:47284329T>C	ENST00000271153.4	+	12	1415	c.1379T>C	c.(1378-1380)aTg>aCg	p.M460T	CYP4B1_ENST00000452782.2_Missense_Mutation_p.M298T|CYP4B1_ENST00000371919.4_Missense_Mutation_p.M446T|CYP4B1_ENST00000371923.4_Missense_Mutation_p.M461T			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	460					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.M460T(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	CAGTTTGCCATGAGTGAGATG	0.547																																					p.M461T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1382C	1						.						162.0	137.0	145.0					1																	47284329		2203	4300	6503	47056916	SO:0001583	missense	1580	exon12			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1379T>C	1.37:g.47284329T>C	ENSP00000271153:p.Met460Thr	Somatic		Capture	SOLID	Phase_I	47056916	NM_001099772	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	37	CCDS542.1	.	.	.	.	.	.	.	.	.	.	T	19.79	3.892866	0.72524	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000452782	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.82806	0.5117	M	0.82056	2.57	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.99;0.996;0.998	D	0.85298	0.1071	10	0.87932	D	0	.	16.1502	0.81611	0.0:0.0:0.0:1.0	.	446;461;460	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	T	461;460;446;298	ENSP00000360991:M461T;ENSP00000271153:M460T;ENSP00000360987:M446T;ENSP00000400413:M298T	ENSP00000271153:M460T	M	+	2	0	CYP4B1	47056916	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.694000	0.84235	2.224000	0.72417	0.533000	0.62120	ATG		0.547	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
STIL	6491	hgsc.bcm.edu	37	1	47759209	47759209	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:47759209A>G	ENST00000360380.3	-	9	1156	c.793T>C	c.(793-795)Tct>Cct	p.S265P	STIL_ENST00000371877.3_Missense_Mutation_p.S265P|STIL_ENST00000396221.2_Missense_Mutation_p.S265P|STIL_ENST00000243182.6_Missense_Mutation_p.S265P|STIL_ENST00000337817.5_Missense_Mutation_p.S265P	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	265					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.S265P(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				GTAATTCCAGACAGCCAACTA	0.323																																					p.S265P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T793C	1						.						102.0	109.0	107.0					1																	47759209		2203	4300	6503	47531796	SO:0001583	missense	6491	exon8			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.793T>C	1.37:g.47759209A>G	ENSP00000353544:p.Ser265Pro	Somatic		Capture	SOLID	Phase_I	47531796	NM_001048166	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	A	16.90	3.251094	0.59212	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	5.75	1.94	0.25998	.	0.322570	0.39544	N	0.001334	T	0.54935	0.1889	M	0.67953	2.075	0.34941	D	0.750277	D;D;D;D;D	0.62365	0.991;0.991;0.991;0.991;0.991	D;D;D;D;D	0.64042	0.914;0.921;0.914;0.921;0.921	T	0.61950	-0.6957	10	0.66056	D	0.02	-13.3509	1.5688	0.02610	0.4401:0.2293:0.0789:0.2517	.	265;218;265;265;265	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	P	265;265;265;265;265;218	ENSP00000353544:S265P;ENSP00000337367:S265P;ENSP00000360944:S265P;ENSP00000379523:S265P;ENSP00000243182:S265P;ENSP00000411664:S218P	ENSP00000243182:S265P	S	-	1	0	STIL	47531796	0.973000	0.33851	0.675000	0.29917	0.844000	0.47949	2.145000	0.42207	0.422000	0.26005	0.528000	0.53228	TCT		0.323	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
DOCK7	85440	hgsc.bcm.edu	37	1	63021531	63021531	+	Missense_Mutation	SNP	C	C	T	rs370921127		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:63021531C>T	ENST00000340370.5	-	21	2578	c.2561G>A	c.(2560-2562)cGc>cAc	p.R854H	DOCK7_ENST00000251157.5_Missense_Mutation_p.R854H	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	854					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.R854H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						ATTTGGTAGGCGGAAAACATA	0.333																																					p.R854H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2561A	1						.						166.0	157.0	160.0					1																	63021531		2203	4300	6503	62794119	SO:0001583	missense	85440	exon21				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.2561G>A	1.37:g.63021531C>T	ENSP00000340742:p.Arg854His	Somatic		Capture	SOLID	Phase_I	62794119	NM_033407	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325675	0.60743	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370	T;T	0.32753	1.44;1.44	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.25195	0.0612	N	0.25332	0.735	0.80722	D	1	B;B;B;B;B	0.34241	0.046;0.046;0.094;0.444;0.091	B;B;B;B;B	0.33042	0.018;0.018;0.036;0.157;0.045	T	0.02574	-1.1139	10	0.24483	T	0.36	.	19.4782	0.94998	0.0:1.0:0.0:0.0	.	854;854;854;854;854	Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.;.;.;.;.	H	854	ENSP00000251157:R854H;ENSP00000340742:R854H	ENSP00000251157:R854H	R	-	2	0	DOCK7	62794119	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.932000	0.70121	2.838000	0.97847	0.655000	0.94253	CGC		0.333	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
PIGR	5284	hgsc.bcm.edu	37	1	207110647	207110648	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	CA	CA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:207110647_207110648delCA	ENST00000356495.4	-	4	1020_1021	c.837_838delTG	c.(835-840)tgtgacfs	p.CD279fs		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	279	Ig-like V-type 3.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)	p.C279fs*1(1)		central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACGACCACGTCACAGTTTTCCC	0.589																																					p.279_280del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.837_838del	1						.																																			205177271	SO:0001589	frameshift_variant	5284	exon4				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.837_838delTG	1.37:g.207110649_207110650delCA	ENSP00000348888:p.Cys279fs	Somatic		Capture	SOLID	Phase_I	205177270	NM_002644	Q68D81|Q8IZY7	Frame_Shift_Del	DEL	ENST00000356495.4	37	CCDS1474.1																																																																																				0.589	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
AHCTF1	25909	hgsc.bcm.edu	37	1	247006035	247006035	+	Missense_Mutation	SNP	G	G	A	rs143245095	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr1:247006035G>A	ENST00000391829.2	-	35	6692	c.6569C>T	c.(6568-6570)gCg>gTg	p.A2190V	AHCTF1_ENST00000366508.1_Missense_Mutation_p.A2225V|AHCTF1_ENST00000326225.3_Missense_Mutation_p.A2199V|AHCTF1_ENST00000470300.1_Intron			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	2190	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A2190V(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GATTCGTTTCGCTTTTGGCTT	0.363													G|||	9	0.00179712	0.0068	0.0	5008	,	,		15055	0.0		0.0	False		,,,				2504	0.0				p.A2199V	Colon(145;197 1800 4745 15099 26333)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6596T	1						.	G	VAL/ALA	21,4385	28.1+/-56.4	0,21,2182	218.0	200.0	206.0		6596	1.3	0.0	1	dbSNP_134	206	0,8600		0,0,4300	yes	missense	AHCTF1	NM_015446.4	64	0,21,6482	AA,AG,GG		0.0,0.4766,0.1615	benign	2199/2276	247006035	21,12985	2203	4300	6503	245072658	SO:0001583	missense	25909	exon35				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.6569C>T	1.37:g.247006035G>A	ENSP00000375705:p.Ala2190Val	Somatic		Capture	SOLID	Phase_I	245072658	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	0.004	-2.281406	0.00251	0.004766	0.0	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.27104	1.69;1.69;1.69	4.92	1.33	0.21861	.	0.647368	0.14116	N	0.340394	T	0.05410	0.0143	N	0.01352	-0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.38286	-0.9668	10	0.18276	T	0.48	-0.6522	8.656	0.34064	0.819:0.0:0.181:0.0	.	2225;2190	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	V	2225;2199;2190	ENSP00000355464:A2225V;ENSP00000355465:A2199V;ENSP00000375705:A2190V	ENSP00000355465:A2199V	A	-	2	0	AHCTF1	245072658	0.921000	0.31238	0.006000	0.13384	0.000000	0.00434	0.545000	0.23268	0.036000	0.15547	-1.320000	0.01293	GCG		0.363	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
CASP4	837	hgsc.bcm.edu	37	11	104819264	104819264	+	Silent	SNP	C	C	T	rs552187293		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:104819264C>T	ENST00000444739.2	-	6	1831	c.921G>A	c.(919-921)acG>acA	p.T307T	CASP4_ENST00000531333.1_5'Flank|CASP4_ENST00000393150.3_Silent_p.T251T	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	307					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)	p.T307T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		ACATACGTGGCGTTGAAGAGC	0.448													c|||	1	0.000199681	0.0	0.0	5008	,	,		20358	0.0		0.0	False		,,,				2504	0.001				p.T251T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G753A	11						.						133.0	97.0	109.0					11																	104819264		2202	4299	6501	104324474	SO:0001819	synonymous_variant	837	exon6			U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.921G>A	11.37:g.104819264C>T		Somatic		Capture	SOLID	Phase_I	104324474	NM_033306	A2NHL8|A2NHM0	Silent	SNP	ENST00000444739.2	37	CCDS8327.1																																																																																				0.448	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
ATM	472	hgsc.bcm.edu	37	11	108123582	108123582	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:108123582G>A	ENST00000452508.2	+	13	2030	c.1841G>A	c.(1840-1842)aGt>aAt	p.S614N	ATM_ENST00000278616.4_Missense_Mutation_p.S614N			Q13315	ATM_HUMAN	ATM serine/threonine kinase	614					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.S614N(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATTCTTGTGAGTCTCACTATG	0.313			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.S614N		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1841A	11						.						106.0	100.0	102.0					11																	108123582		2199	4294	6493	107628792	SO:0001583	missense	472	exon12	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1841G>A	11.37:g.108123582G>A	ENSP00000388058:p.Ser614Asn	Somatic		Capture	SOLID	Phase_I	107628792	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429180	0.83776	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.78364	-1.17;-1.17;-1.17	5.66	5.66	0.87406	Armadillo-type fold (1);	0.104211	0.64402	D	0.000002	D	0.85331	0.5672	M	0.69823	2.125	0.33210	D	0.553346	D	0.76494	0.999	D	0.63488	0.915	D	0.87138	0.2201	10	0.31617	T	0.26	.	14.8963	0.70646	0.0706:0.0:0.9294:0.0	.	614	Q13315	ATM_HUMAN	N	614	ENSP00000435747:S614N;ENSP00000278616:S614N;ENSP00000388058:S614N	ENSP00000278616:S614N	S	+	2	0	ATM	107628792	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.671000	0.68095	2.672000	0.90937	0.460000	0.39030	AGT		0.313	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
CEP164	22897	hgsc.bcm.edu	37	11	117214936	117214936	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:117214936T>C	ENST00000278935.3	+	4	284	c.137T>C	c.(136-138)cTg>cCg	p.L46P		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	46	Interaction with ATRIP.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.L46P(1)		breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GAACCAGAACTGATGTGGCTG	0.542																																					p.L46P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T137C	11						.						42.0	38.0	40.0					11																	117214936		2201	4296	6497	116720146	SO:0001583	missense	22897	exon4			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.137T>C	11.37:g.117214936T>C	ENSP00000278935:p.Leu46Pro	Somatic		Capture	SOLID	Phase_I	116720146	NM_014956	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.372113	0.82573	.	.	ENSG00000110274	ENST00000525734;ENST00000278935;ENST00000527609;ENST00000533570;ENST00000529538	T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45	4.62	4.62	0.57501	WW/Rsp5/WWP (1);	0.000000	0.35495	N	0.003177	D	0.84211	0.5422	M	0.90425	3.115	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.91635	0.995;0.999;0.999	D	0.87827	0.2642	10	0.87932	D	0	-8.584	14.007	0.64470	0.0:0.0:0.0:1.0	.	46;46;46	E9PI34;Q9UPV0;Q9UPV0-2	.;CE164_HUMAN;.	P	46	ENSP00000436609:L46P;ENSP00000278935:L46P;ENSP00000436351:L46P;ENSP00000431302:L46P	ENSP00000278935:L46P	L	+	2	0	CEP164	116720146	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.760000	0.68793	1.845000	0.53610	0.460000	0.39030	CTG		0.542	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
CBL	867	hgsc.bcm.edu	37	11	119156239	119156239	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:119156239C>A	ENST00000264033.4	+	11	2280	c.1904C>A	c.(1903-1905)cCt>cAt	p.P635H		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	635	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P635H(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CCAGATGTGCCTAGGCTCGGA	0.493			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																												p.P635H			"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1904A	11						.						44.0	44.0	44.0					11																	119156239		2199	4295	6494	118661449	SO:0001583	missense	867	exon11	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1904C>A	11.37:g.119156239C>A	ENSP00000264033:p.Pro635His	Somatic		Capture	SOLID	Phase_I	118661449	NM_005188	A3KMP8	Missense_Mutation	SNP	ENST00000264033.4	37	CCDS8418.1	.	.	.	.	.	.	.	.	.	.	C	6.211	0.407117	0.11754	.	.	ENSG00000110395	ENST00000264033	T	0.76839	-1.05	5.2	3.13	0.36017	.	0.795009	0.11991	N	0.509785	T	0.59335	0.2186	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51395	-0.8711	10	0.52906	T	0.07	-42.5375	7.1517	0.25614	0.3589:0.5535:0.0:0.0877	.	635	P22681	CBL_HUMAN	H	635	ENSP00000264033:P635H	ENSP00000264033:P635H	P	+	2	0	CBL	118661449	0.001000	0.12720	0.345000	0.25642	0.992000	0.81027	0.577000	0.23758	1.370000	0.46153	0.655000	0.94253	CCT		0.493	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	NM_005188	
OR6M1	390261	hgsc.bcm.edu	37	11	123676717	123676717	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:123676717G>A	ENST00000309154.2	-	1	378	c.341C>T	c.(340-342)gCg>gTg	p.A114V		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A114V(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GGACATCACCGCCAAGAGGAT	0.512																																					p.A114V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C341T	11						.						53.0	54.0	54.0					11																	123676717		2202	4299	6501	123181927	SO:0001583	missense	390261	exon1			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.341C>T	11.37:g.123676717G>A	ENSP00000311038:p.Ala114Val	Somatic		Capture	SOLID	Phase_I	123181927	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	37	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444096	0.43429	.	.	ENSG00000196099	ENST00000309154	T	0.02015	4.5	3.68	2.76	0.32466	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33110	U	0.005266	T	0.02012	0.0063	L	0.33753	1.03	0.23082	N	0.998329	P	0.35684	0.515	B	0.30572	0.117	T	0.46020	-0.9221	10	0.66056	D	0.02	.	8.8881	0.35416	0.1135:0.0:0.8865:0.0	.	114	Q8NGM8	OR6M1_HUMAN	V	114	ENSP00000311038:A114V	ENSP00000311038:A114V	A	-	2	0	OR6M1	123181927	0.016000	0.18221	0.633000	0.29310	0.954000	0.61252	1.904000	0.39868	0.735000	0.32537	0.655000	0.94253	GCG		0.512	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
PANX3	116337	hgsc.bcm.edu	37	11	124489804	124489804	+	Silent	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:124489804C>A	ENST00000284288.2	+	4	1219	c.1152C>A	c.(1150-1152)acC>acA	p.T384T	TBRG1_ENST00000375005.4_5'Flank|TBRG1_ENST00000441174.3_5'Flank	NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	384					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)	p.T384T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		AACACCTCACCAACTCGGCAT	0.423																																					p.T384T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1152A	11						.						87.0	83.0	84.0					11																	124489804		2201	4299	6500	123995014	SO:0001819	synonymous_variant	116337	exon4			AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.1152C>A	11.37:g.124489804C>A		Somatic		Capture	SOLID	Phase_I	123995014	NM_052959		Silent	SNP	ENST00000284288.2	37	CCDS8447.1																																																																																				0.423	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387064.1		
DCPS	28960	hgsc.bcm.edu	37	11	126208231	126208231	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:126208231C>T	ENST00000263579.4	+	4	902	c.573C>T	c.(571-573)ttC>ttT	p.F191F	DCPS_ENST00000530860.1_Intron	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger	191					cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)	p.F191F(1)		endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		GGATTGTTTTCGAGAACCCAG	0.507																																					p.F191F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C573T	11						.						163.0	138.0	147.0					11																	126208231		2201	4298	6499	125713441	SO:0001819	synonymous_variant	28960	exon4			AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.573C>T	11.37:g.126208231C>T		Somatic		Capture	SOLID	Phase_I	125713441	NM_014026	Q8NHL8|Q9Y2S5	Silent	SNP	ENST00000263579.4	37	CCDS8473.1																																																																																				0.507	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386455.1	NM_014026	
KRTAP5-2	440021	hgsc.bcm.edu	37	11	1618965	1618965	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:1618965G>T	ENST00000412090.1	-	1	559	c.516C>A	c.(514-516)tgC>tgA	p.C172*	KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	172						keratin filament (GO:0045095)		p.C172*(1)		large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TACACTGGCAGCACACAGGGA	0.562																																					p.C172X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C516A	11						.						100.0	96.0	98.0					11																	1618965		2202	4299	6501	1575541	SO:0001587	stop_gained	440021	exon1			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.516C>A	11.37:g.1618965G>T	ENSP00000400041:p.Cys172*	Somatic		Capture	SOLID	Phase_I	1575541	NM_001004325	A9JTZ1	Nonsense_Mutation	SNP	ENST00000412090.1	37	CCDS31331.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473722	0.63737	.	.	ENSG00000205867	ENST00000412090	.	.	.	3.53	3.53	0.40419	.	.	.	.	.	.	.	.	.	.	.	0.28693	N	0.904467	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0667	0.47979	0.0:0.0:1.0:0.0	.	.	.	.	X	172	.	ENSP00000400041:C172X	C	-	3	2	KRTAP5-2	1575541	1.000000	0.71417	0.996000	0.52242	0.570000	0.35934	3.411000	0.52672	1.739000	0.51704	0.271000	0.19318	TGC		0.562	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
OSBPL5	114879	hgsc.bcm.edu	37	11	3121472	3121472	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:3121472C>T	ENST00000263650.7	-	14	1696	c.1537G>A	c.(1537-1539)Gcg>Acg	p.A513T	OSBPL5_ENST00000348039.5_Missense_Mutation_p.A445T|OSBPL5_ENST00000389989.3_Missense_Mutation_p.A445T|OSBPL5_ENST00000525498.1_Missense_Mutation_p.A424T|OSBPL5_ENST00000542243.1_Missense_Mutation_p.A144T	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	513					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)	p.A513T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TCCAGCAGCGCCGACAGCGAG	0.602																																					p.A445T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1333A	11						.						112.0	88.0	96.0					11																	3121472		2202	4298	6500	3078048	SO:0001583	missense	114879	exon13			AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.1537G>A	11.37:g.3121472C>T	ENSP00000263650:p.Ala513Thr	Somatic		Capture	SOLID	Phase_I	3078048	NM_145638	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Missense_Mutation	SNP	ENST00000263650.7	37	CCDS31344.1	.	.	.	.	.	.	.	.	.	.	c	16.92	3.254655	0.59212	.	.	ENSG00000021762	ENST00000263650;ENST00000389989;ENST00000534454;ENST00000525498;ENST00000542243;ENST00000348039;ENST00000357352	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	3.59	3.59	0.41128	.	0.000000	0.64402	D	0.000002	T	0.56485	0.1988	M	0.79475	2.455	0.80722	D	1	D;D;D;B	0.89917	0.993;1.0;0.998;0.099	D;D;D;P	0.91635	0.956;0.999;0.987;0.525	T	0.65129	-0.6243	10	0.72032	D	0.01	-12.3468	15.7644	0.78114	0.0:1.0:0.0:0.0	.	424;474;445;513	B4DVB0;E7EP03;Q8N596;Q9H0X9	.;.;.;OSBL5_HUMAN	T	513;445;66;424;144;445;132	ENSP00000263650:A513T;ENSP00000374639:A445T;ENSP00000431412:A66T;ENSP00000433342:A424T;ENSP00000441551:A144T;ENSP00000302872:A445T	ENSP00000263650:A513T	A	-	1	0	OSBPL5	3078048	1.000000	0.71417	0.265000	0.24526	0.097000	0.18754	6.938000	0.75904	1.994000	0.58287	0.457000	0.33378	GCG		0.602	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2		
OR52R1	119695	hgsc.bcm.edu	37	11	4824983	4824983	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:4824983C>T	ENST00000356069.2	-	1	627	c.628G>A	c.(628-630)Gct>Act	p.A210T	MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.A289T|MMP26_ENST00000380390.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A209T(1)|p.A289T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCAAAGCCAGCCACAGAGAAG	0.488																																					p.A210T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G628A	11						.						115.0	91.0	99.0					11																	4824983		2201	4298	6499	4781559	SO:0001583	missense	119695	exon1			BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.628G>A	11.37:g.4824983C>T	ENSP00000348368:p.Ala210Thr	Somatic		Capture	SOLID	Phase_I	4781559	NM_001005177	Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	C	10.40	1.340764	0.24339	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.36878	1.23;1.23	5.57	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.482710	0.17098	N	0.187094	T	0.19765	0.0475	N	0.20328	0.56	0.09310	N	1	B	0.14805	0.011	B	0.14578	0.011	T	0.11941	-1.0567	10	0.44086	T	0.13	.	3.8416	0.08917	0.1368:0.5835:0.1324:0.1472	.	210	Q8NGF1	O52R1_HUMAN	T	210;289	ENSP00000348368:A210T;ENSP00000369742:A289T	ENSP00000348368:A210T	A	-	1	0	OR52R1	4781559	0.000000	0.05858	0.927000	0.36925	0.483000	0.33249	-0.184000	0.09698	0.905000	0.36596	0.650000	0.86243	GCT		0.488	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177	
CCKBR	887	hgsc.bcm.edu	37	11	6291387	6291387	+	Missense_Mutation	SNP	G	G	A	rs148250134		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:6291387G>A	ENST00000334619.2	+	3	666	c.473G>A	c.(472-474)cGa>cAa	p.R158Q	CCKBR_ENST00000532715.1_Missense_Mutation_p.R74Q|CCKBR_ENST00000525462.1_Missense_Mutation_p.R158Q|CCKBR_ENST00000525014.1_3'UTR	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	158					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.R158Q(1)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	GCCATCTGCCGACCACTGCAG	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18920	0.0		0.0	False		,,,				2504	0.0				p.R158Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G473A	11						.	G	GLN/ARG	8,4394	14.3+/-33.2	0,8,2193	51.0	44.0	47.0		473	4.8	1.0	11	dbSNP_134	47	0,8592		0,0,4296	yes	missense	CCKBR	NM_176875.2	43	0,8,6489	AA,AG,GG		0.0,0.1817,0.0616	probably-damaging	158/448	6291387	8,12986	2201	4296	6497	6247963	SO:0001583	missense	887	exon3			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.473G>A	11.37:g.6291387G>A	ENSP00000335544:p.Arg158Gln	Somatic		Capture	SOLID	Phase_I	6247963	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922946	0.92319	0.001817	0.0	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.38560	1.13;1.13;1.13	4.81	4.81	0.61882	GPCR, rhodopsin-like superfamily (1);	0.175302	0.39274	N	0.001418	T	0.50871	0.1641	L	0.49350	1.555	0.28488	N	0.91459	D;D;D	0.69078	0.997;0.993;0.997	P;P;D	0.66084	0.811;0.832;0.941	T	0.46470	-0.9189	10	0.39692	T	0.17	.	7.1529	0.25620	0.1809:0.0:0.8191:0.0	.	158;92;158	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	Q	158;74;158	ENSP00000335544:R158Q;ENSP00000432079:R74Q;ENSP00000435534:R158Q	ENSP00000335544:R158Q	R	+	2	0	CCKBR	6247963	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.086000	0.76885	2.505000	0.84491	0.655000	0.94253	CGA		0.622	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
CCKBR	887	hgsc.bcm.edu	37	11	6291895	6291895	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:6291895C>T	ENST00000334619.2	+	4	866	c.673C>T	c.(673-675)Ctc>Ttc	p.L225F	CCKBR_ENST00000532715.1_Missense_Mutation_p.L141F|CCKBR_ENST00000525462.1_Missense_Mutation_p.L225F	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	225					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.L225F(1)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	GCTGCTTCTGCTCTTGTTCTT	0.532																																					p.L225F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C673T	11						.						232.0	157.0	183.0					11																	6291895		2201	4296	6497	6248471	SO:0001583	missense	887	exon4			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.673C>T	11.37:g.6291895C>T	ENSP00000335544:p.Leu225Phe	Somatic		Capture	SOLID	Phase_I	6248471	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350092	0.41599	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.39056	1.1;1.1;1.1	5.55	4.44	0.53790	GPCR, rhodopsin-like superfamily (1);	0.297142	0.33916	N	0.004439	T	0.20941	0.0504	N	0.20401	0.57	0.27239	N	0.95919	B;B;B	0.15473	0.013;0.0;0.003	B;B;B	0.14578	0.011;0.001;0.008	T	0.20438	-1.0275	10	0.09084	T	0.74	.	4.785	0.13220	0.1529:0.6083:0.1484:0.0903	.	225;159;225	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	F	225;141;225	ENSP00000335544:L225F;ENSP00000432079:L141F;ENSP00000435534:L225F	ENSP00000335544:L225F	L	+	1	0	CCKBR	6248471	0.265000	0.24102	1.000000	0.80357	0.984000	0.73092	0.264000	0.18497	2.620000	0.88729	0.655000	0.94253	CTC		0.532	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
DCHS1	8642	hgsc.bcm.edu	37	11	6648127	6648127	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:6648127C>T	ENST00000299441.3	-	14	6554	c.6143G>A	c.(6142-6144)cGc>cAc	p.R2048H		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2048	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2048H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGTGGCAGAGCGAGCTGGACG	0.597																																					p.R2048H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6143A	11						.						32.0	32.0	32.0					11																	6648127		2201	4296	6497	6604703	SO:0001583	missense	8642	exon14			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6143G>A	11.37:g.6648127C>T	ENSP00000299441:p.Arg2048His	Somatic		Capture	SOLID	Phase_I	6604703	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352584	0.61293	.	.	ENSG00000166341	ENST00000299441	T	0.61980	0.06	4.94	4.94	0.65067	Cadherin (3);Cadherin-like (1);	0.000000	0.44688	D	0.000430	T	0.63896	0.2550	L	0.56199	1.76	0.46113	D	0.998873	D	0.76494	0.999	P	0.54270	0.747	T	0.58115	-0.7693	10	0.14252	T	0.57	.	10.9062	0.47081	0.2921:0.7079:0.0:0.0	.	2048	Q96JQ0	PCD16_HUMAN	H	2048	ENSP00000299441:R2048H	ENSP00000299441:R2048H	R	-	2	0	DCHS1	6604703	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.254000	0.43214	2.584000	0.87258	0.462000	0.41574	CGC		0.597	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
IPO7	10527	hgsc.bcm.edu	37	11	9457898	9457898	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:9457898G>A	ENST00000379719.3	+	20	2395	c.2253G>A	c.(2251-2253)ggG>ggA	p.G751G	CTD-2371O3.2_ENST00000531111.1_RNA	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	751					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)	p.G751G(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		AGTGCAAAGGGCGTGGCATTG	0.403																																					p.G751G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2253A	11						.						118.0	97.0	104.0					11																	9457898		2201	4294	6495	9414474	SO:0001819	synonymous_variant	10527	exon20			AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.2253G>A	11.37:g.9457898G>A		Somatic		Capture	SOLID	Phase_I	9414474	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Silent	SNP	ENST00000379719.3	37	CCDS31425.1																																																																																				0.403	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
MYOD1	4654	hgsc.bcm.edu	37	11	17743019	17743019	+	Silent	SNP	G	G	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:17743019G>C	ENST00000250003.3	+	3	1142	c.927G>C	c.(925-927)gcG>gcC	p.A309A		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	309			A -> V (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)	p.A309A(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						AGTGCCCTGCGGGTGCGAACC	0.716																																					p.A309A												MYOD1,breast,NS,Substitution - Missense,+1	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G927C	11						.						12.0	15.0	14.0					11																	17743019		2052	4027	6079	17699595	SO:0001819	synonymous_variant	4654	exon3			AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.927G>C	11.37:g.17743019G>C		Somatic		Capture	SOLID	Phase_I	17699595	NM_002478	O75321	Silent	SNP	ENST00000250003.3	37	CCDS7826.1																																																																																				0.716	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389387.1	NM_002478	
SERGEF	26297	hgsc.bcm.edu	37	11	18028188	18028188	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:18028188C>T	ENST00000265965.5	-	3	453	c.302G>A	c.(301-303)tGt>tAt	p.C101Y	SERGEF_ENST00000532265.1_5'UTR|SERGEF_ENST00000532212.1_5'UTR|SERGEF_ENST00000528200.1_Missense_Mutation_p.C101Y|RP1-59M18.2_ENST00000525523.1_RNA	NM_012139.2	NP_036271.1	Q9UGK8	SRGEF_HUMAN	secretion regulating guanine nucleotide exchange factor	101					negative regulation of protein secretion (GO:0050709)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.C101Y(1)		autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(5)|lung(5)	12						TTGGATGGGACAGCCAAAGAG	0.498																																					p.C101Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G302A	11						.						125.0	126.0	126.0					11																	18028188		2200	4293	6493	17984764	SO:0001583	missense	26297	exon3			AJ243950	CCDS7828.1	11p14.3	2006-03-09			ENSG00000129158	ENSG00000129158			17499	protein-coding gene	gene with protein product		606051				10571079, 12459492	Standard	NM_012139		Approved	DelGEF, Gnefr	uc001mnm.3	Q9UGK8	OTTHUMG00000166420	ENST00000265965.5:c.302G>A	11.37:g.18028188C>T	ENSP00000265965:p.Cys101Tyr	Somatic		Capture	SOLID	Phase_I	17984764	NM_012139	Q9UGK9	Missense_Mutation	SNP	ENST00000265965.5	37	CCDS7828.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168118	0.57476	.	.	ENSG00000129158	ENST00000265965;ENST00000528200	T;T	0.79749	-1.3;-1.3	6.17	5.25	0.73442	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.346988	0.34531	N	0.003881	T	0.74779	0.3761	L	0.57536	1.79	0.80722	D	1	B;D	0.56035	0.013;0.974	B;B	0.43082	0.011;0.407	T	0.75246	-0.3385	10	0.02654	T	1	-7.2119	14.1747	0.65534	0.1501:0.8499:0.0:0.0	.	101;101	Q9UGK8-2;Q9UGK8	.;SRGEF_HUMAN	Y	101	ENSP00000265965:C101Y;ENSP00000434188:C101Y	ENSP00000265965:C101Y	C	-	2	0	SERGEF	17984764	0.936000	0.31750	1.000000	0.80357	0.979000	0.70002	1.983000	0.40648	1.602000	0.50124	0.655000	0.94253	TGT		0.498	SERGEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389538.1	NM_012139	
PRR5L	79899	hgsc.bcm.edu	37	11	36422701	36422701	+	Silent	SNP	C	C	T	rs78731804	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:36422701C>T	ENST00000378867.3	+	3	385	c.30C>T	c.(28-30)ccC>ccT	p.P10P	PRR5L_ENST00000530639.1_Silent_p.P10P|PRR5L_ENST00000389693.3_Intron|PRR5L_ENST00000311599.5_5'UTR|PRR5L_ENST00000527487.1_Silent_p.P10P	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	10					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)	p.P10P(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						CCATTCTGCCCGTCGAGTTCC	0.612													C|||	463	0.0924521	0.0908	0.1066	5008	,	,		17325	0.1171		0.0596	False		,,,				2504	0.093				p.P10P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C30T	11						.	C	,,,	400,4004	195.7+/-220.2	23,354,1825	53.0	46.0	49.0		30,,30,30	-0.0	0.0	11	dbSNP_131	49	482,8114	140.8+/-197.2	13,456,3829	no	coding-synonymous,intron,coding-synonymous,coding-synonymous	PRR5L	NM_001160167.1,NM_001160168.1,NM_001160169.1,NM_024841.4	,,,	36,810,5654	TT,TC,CC		5.6073,9.0827,6.7846	,,,	10/369,,10/206,10/369	36422701	882,12118	2202	4298	6500	36379277	SO:0001819	synonymous_variant	79899	exon1				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.30C>T	11.37:g.36422701C>T		Somatic		Capture	SOLID	Phase_I	36379277	NM_001160169	A4QN22|E9PKY1|Q96H46|Q9H7V4	Silent	SNP	ENST00000378867.3	37	CCDS31463.1																																																																																				0.612	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389209.1	NM_024841	
TTC17	55761	hgsc.bcm.edu	37	11	43472815	43472815	+	Splice_Site	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:43472815G>T	ENST00000039989.4	+	21	3044	c.3030G>T	c.(3028-3030)aaG>aaT	p.K1010N		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	1010					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.K1010N(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						TTTTGGAAAAGGTAAGTCACC	0.413																																					p.K1010N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3030T	11						.						94.0	88.0	90.0					11																	43472815		2203	4300	6503	43429391	SO:0001630	splice_region_variant	55761	exon21			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.3030+1G>T	11.37:g.43472815G>T		Somatic		Capture	SOLID	Phase_I	43429391	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.64|15.64	2.892969|2.892969	0.52121|0.52121	.|.	.|.	ENSG00000052841|ENSG00000052841	ENST00000039989|ENST00000418561	T|.	0.36157|.	1.27|.	5.84|5.84	3.34|3.34	0.38264|0.38264	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.57110|0.57110	0.2031|0.2031	L|L	0.49640|0.49640	1.575|1.575	0.58432|0.58432	D|D	0.999993|0.999993	D|.	0.76494|.	0.999|.	D|.	0.78314|.	0.991|.	T|T	0.49437|0.49437	-0.8940|-0.8940	10|5	0.17369|.	T|.	0.5|.	-19.3829|-19.3829	9.0601|9.0601	0.36429|0.36429	0.2095:0.0:0.7905:0.0|0.2095:0.0:0.7905:0.0	.|.	1010|.	Q96AE7|.	TTC17_HUMAN|.	N|M	1010|29	ENSP00000039989:K1010N|.	ENSP00000039989:K1010N|.	K|R	+|+	3|2	2|0	TTC17|TTC17	43429391|43429391	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.514000|4.514000	0.60482|0.60482	0.475000|0.475000	0.27415|0.27415	-0.142000|-0.142000	0.14014|0.14014	AAG|AGG		0.413	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	Missense_Mutation
AMBRA1	55626	hgsc.bcm.edu	37	11	46568833	46568833	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:46568833A>G	ENST00000458649.2	-	4	626	c.208T>C	c.(208-210)Tcc>Ccc	p.S70P	AMBRA1_ENST00000298834.3_Missense_Mutation_p.S70P|AMBRA1_ENST00000534300.1_Missense_Mutation_p.S70P|AMBRA1_ENST00000314845.3_Missense_Mutation_p.S70P|AMBRA1_ENST00000528950.1_Missense_Mutation_p.S70P|AMBRA1_ENST00000426438.1_Missense_Mutation_p.S70P|AMBRA1_ENST00000533727.1_Missense_Mutation_p.S70P			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	70					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)		p.S70P(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		ACATGGGTGGAGGCTAAGAGA	0.423																																					p.S70P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T208C	11						.						101.0	93.0	96.0					11																	46568833		2201	4299	6500	46525409	SO:0001583	missense	55626	exon4			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.208T>C	11.37:g.46568833A>G	ENSP00000415327:p.Ser70Pro	Somatic		Capture	SOLID	Phase_I	46525409	NM_017749	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37		.	.	.	.	.	.	.	.	.	.	A	18.24	3.579500	0.65878	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33;1.33	5.69	5.69	0.88448	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048006	0.85682	N	0.000000	T	0.60353	0.2262	M	0.69523	2.12	0.58432	D	0.999999	D;D;D;D;D;D	0.76494	0.995;0.997;0.997;0.997;0.999;0.997	D;D;D;D;D;D	0.80764	0.979;0.991;0.991;0.991;0.994;0.991	T	0.64317	-0.6436	10	0.87932	D	0	.	15.9414	0.79756	1.0:0.0:0.0:0.0	.	70;70;70;70;70;70	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	P	70	ENSP00000318313:S70P;ENSP00000433372:S70P;ENSP00000431926:S70P;ENSP00000410899:S70P;ENSP00000298834:S70P;ENSP00000415327:S70P;ENSP00000433945:S70P	ENSP00000298834:S70P	S	-	1	0	AMBRA1	46525409	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	8.938000	0.92943	2.157000	0.67596	0.533000	0.62120	TCC		0.423	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
OR10Q1	219960	hgsc.bcm.edu	37	11	57996073	57996073	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:57996073G>A	ENST00000316770.2	-	1	317	c.275C>T	c.(274-276)gCc>gTc	p.A92V		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A92V(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GGGCTTCTGGGCCCCCAAAAT	0.537																																					p.A92V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C275T	11						.						73.0	66.0	69.0					11																	57996073		2201	4295	6496	57752649	SO:0001583	missense	219960	exon1			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.275C>T	11.37:g.57996073G>A	ENSP00000314324:p.Ala92Val	Somatic		Capture	SOLID	Phase_I	57752649	NM_001004471	Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	37	CCDS31547.1	.	.	.	.	.	.	.	.	.	.	G	0.193	-1.051274	0.01981	.	.	ENSG00000180475	ENST00000316770	T	0.03065	4.06	4.54	4.54	0.55810	GPCR, rhodopsin-like superfamily (1);	0.171732	0.27720	N	0.018125	T	0.03053	0.0090	N	0.25144	0.715	0.09310	N	1	B	0.26935	0.164	B	0.24155	0.051	T	0.45071	-0.9286	10	0.26408	T	0.33	.	11.4208	0.49980	0.0:0.0:0.7006:0.2994	.	92	Q8NGQ4	O10Q1_HUMAN	V	92	ENSP00000314324:A92V	ENSP00000314324:A92V	A	-	2	0	OR10Q1	57752649	0.000000	0.05858	0.996000	0.52242	0.074000	0.17049	-0.293000	0.08320	2.334000	0.79466	0.557000	0.71058	GCC		0.537	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471	
MS4A14	84689	hgsc.bcm.edu	37	11	60170482	60170482	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:60170482G>A	ENST00000300187.6	+	4	693	c.416G>A	c.(415-417)tGc>tAc	p.C139Y	MS4A14_ENST00000395005.2_Missense_Mutation_p.C122Y|MS4A14_ENST00000531783.1_Missense_Mutation_p.C139Y|MS4A14_ENST00000395001.1_Missense_Mutation_p.C27Y|MS4A14_ENST00000531787.1_Missense_Mutation_p.C27Y	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	139						integral component of membrane (GO:0016021)		p.C139Y(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						GACAAGTACTGCCAGATGCCA	0.408																																					p.C139Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G416A	11						.						260.0	232.0	241.0					11																	60170482		2203	4300	6503	59927058	SO:0001583	missense	84689	exon4			AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.416G>A	11.37:g.60170482G>A	ENSP00000300187:p.Cys139Tyr	Somatic		Capture	SOLID	Phase_I	59927058	NM_032597	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000300187.6	37	CCDS31569.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.63|13.63	2.295326|2.295326	0.40594|0.40594	.|.	.|.	ENSG00000166928|ENSG00000166928	ENST00000534688|ENST00000531787;ENST00000300187;ENST00000395005;ENST00000526375;ENST00000531783;ENST00000395001	.|T;T;T;T;T;T	.|0.71579	.|4.37;4.37;4.37;-0.58;4.37;4.37	4.77|4.77	4.77|4.77	0.60923|0.60923	.|.	.|.	.|.	.|.	.|.	D|D	0.83440|0.83440	0.5255|0.5255	M|M	0.78285|0.78285	2.405|2.405	0.31730|0.31730	N|N	0.637115|0.637115	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.84330|0.84330	0.0521|0.0521	5|9	.|0.62326	.|D	.|0.03	-6.7596|-6.7596	13.4723|13.4723	0.61288|0.61288	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|122;139	.|Q96JA4-2;Q96JA4	.|.;M4A14_HUMAN	T|Y	98|27;139;122;122;139;27	.|ENSP00000437222:C27Y;ENSP00000300187:C139Y;ENSP00000378453:C122Y;ENSP00000435764:C122Y;ENSP00000433761:C139Y;ENSP00000378449:C27Y	.|ENSP00000300187:C139Y	A|C	+|+	1|2	0|0	MS4A14|MS4A14	59927058|59927058	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.043000|0.043000	0.13939|0.13939	3.950000|3.950000	0.56676|0.56676	2.610000|2.610000	0.88304|0.88304	0.650000|0.650000	0.86243|0.86243	GCC|TGC		0.408	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		
MS4A12	54860	hgsc.bcm.edu	37	11	60264913	60264913	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:60264913A>C	ENST00000016913.4	+	2	179	c.122A>C	c.(121-123)aAc>aCc	p.N41T	MS4A12_ENST00000537076.1_Missense_Mutation_p.N41T|MS4A12_ENST00000525951.1_3'UTR	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	41						integral component of membrane (GO:0016021)		p.N41T(1)		breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						AACTTAGAAAACCAAGCTCAG	0.473																																					p.N41T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A122C	11						.						93.0	91.0	92.0					11																	60264913		2203	4300	6503	60021489	SO:0001583	missense	54860	exon2			AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.122A>C	11.37:g.60264913A>C	ENSP00000016913:p.Asn41Thr	Somatic		Capture	SOLID	Phase_I	60021489	NM_001164470	F5GX98|Q8N6L4	Missense_Mutation	SNP	ENST00000016913.4	37	CCDS7988.1	.	.	.	.	.	.	.	.	.	.	A	15.32	2.798087	0.50208	.	.	ENSG00000071203	ENST00000537076;ENST00000526784;ENST00000016913;ENST00000530007	T;T;T;T	0.48201	1.83;0.85;3.49;0.82	4.71	-0.451	0.12214	.	62.788600	0.00166	N	0.000000	T	0.46054	0.1373	L	0.29908	0.895	0.09310	N	1	D;P	0.61697	0.99;0.9	P;B	0.59424	0.857;0.373	T	0.44726	-0.9309	10	0.09084	T	0.74	.	3.2878	0.06937	0.5372:0.0:0.2917:0.1711	.	41;41	E9PNI3;Q9NXJ0	.;M4A12_HUMAN	T	41	ENSP00000440424:N41T;ENSP00000431959:N41T;ENSP00000016913:N41T;ENSP00000434783:N41T	ENSP00000016913:N41T	N	+	2	0	MS4A12	60021489	0.006000	0.16342	0.004000	0.12327	0.027000	0.11550	0.702000	0.25631	-0.174000	0.10743	0.460000	0.39030	AAC		0.473	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383627.1		
PRPF19	27339	hgsc.bcm.edu	37	11	60658671	60658671	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:60658671G>A	ENST00000227524.4	-	16	1687	c.1482C>T	c.(1480-1482)ggC>ggT	p.G494G		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19									p.G494G(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						TTCTGTCCATGCCTGTTGAAG	0.562																																					p.G494G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1482T	11						.						77.0	65.0	69.0					11																	60658671		2203	4299	6502	60415247	SO:0001819	synonymous_variant	27339	exon16			BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.1482C>T	11.37:g.60658671G>A		Somatic		Capture	SOLID	Phase_I	60415247	NM_014502		Silent	SNP	ENST00000227524.4	37	CCDS7995.1																																																																																				0.562	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502	
TUT1	64852	hgsc.bcm.edu	37	11	62342600	62342600	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:62342600A>C	ENST00000476907.1	-	9	3282	c.2591T>G	c.(2590-2592)gTt>gGt	p.V864G	EEF1G_ENST00000378019.3_5'Flank|EEF1G_ENST00000532986.1_5'Flank|TUT1_ENST00000308436.7_Missense_Mutation_p.V902G|EEF1G_ENST00000329251.4_5'Flank|MIR3654_ENST00000496634.2_Intron			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	864					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)	p.V864G(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AGGGAGGAAAACCTGTAAGAA	0.502																																					p.V902G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2705G	11						.						56.0	59.0	58.0					11																	62342600		2202	4299	6501	62099176	SO:0001583	missense	64852	exon9			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.2591T>G	11.37:g.62342600A>C	ENSP00000419607:p.Val864Gly	Somatic		Capture	SOLID	Phase_I	62099176	NM_022830	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	ENST00000476907.1	37		.	.	.	.	.	.	.	.	.	.	A	8.453	0.853540	0.17106	.	.	ENSG00000149016	ENST00000308436;ENST00000476907	T;T	0.35973	1.28;1.3	5.56	1.85	0.25348	.	0.673120	0.14772	N	0.299351	T	0.17365	0.0417	N	0.04880	-0.145	0.38224	D	0.94083	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10941	-1.0608	10	0.13470	T	0.59	-13.506	12.7134	0.57102	0.3673:0.6327:0.0:0.0	.	864;902	Q9H6E5;F5H0R1	STPAP_HUMAN;.	G	902;864	ENSP00000308000:V902G;ENSP00000419607:V864G	ENSP00000308000:V902G	V	-	2	0	TUT1	62099176	0.002000	0.14202	0.936000	0.37596	0.887000	0.51463	0.495000	0.22483	0.350000	0.24002	0.533000	0.62120	GTT		0.502	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	
TAF6L	10629	hgsc.bcm.edu	37	11	62545581	62545581	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:62545581T>C	ENST00000294168.3	+	4	567	c.366T>C	c.(364-366)tgT>tgC	p.C122C	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	122					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.C122C(1)		endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						CCAAAGGCTGTGCTGAGACAG	0.622																																					p.C122C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T366C	11						.						62.0	56.0	58.0					11																	62545581		2201	4299	6500	62302157	SO:0001819	synonymous_variant	10629	exon4			BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.366T>C	11.37:g.62545581T>C		Somatic		Capture	SOLID	Phase_I	62302157	NM_006473	B2RAT0|Q96HA6	Silent	SNP	ENST00000294168.3	37	CCDS8035.1																																																																																				0.622	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395352.1	NM_006473	
HRASLS5	117245	hgsc.bcm.edu	37	11	63257788	63257788	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:63257788C>T	ENST00000301790.4	-	2	355	c.196G>A	c.(196-198)Gca>Aca	p.A66T	HRASLS5_ENST00000540857.1_Missense_Mutation_p.A56T|HRASLS5_ENST00000539221.1_Missense_Mutation_p.A66T			Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	66							transferase activity, transferring acyl groups (GO:0016746)	p.A66T(1)		endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	14						ACCAACGCTGCGAATCCCACG	0.537																																					p.A66T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G196A	11						.						167.0	184.0	178.0					11																	63257788		2201	4298	6499	63014364	SO:0001583	missense	117245	exon2			AJ416558	CCDS8044.1, CCDS53646.1, CCDS53647.1	11q13.2	2006-08-16			ENSG00000168004	ENSG00000168004			24978	protein-coding gene	gene with protein product		611474					Standard	NM_001146729		Approved	HRLP5	uc001nwy.2	Q96KN8	OTTHUMG00000167806	ENST00000301790.4:c.196G>A	11.37:g.63257788C>T	ENSP00000301790:p.Ala66Thr	Somatic		Capture	SOLID	Phase_I	63014364	NM_001146728	B7X6T1|F5GZ87|F5H4Y9	Missense_Mutation	SNP	ENST00000301790.4	37	CCDS8044.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827867	0.32329	.	.	ENSG00000168004	ENST00000540857;ENST00000539221;ENST00000301790	T;T;T	0.28454	1.61;2.11;1.62	3.89	1.98	0.26296	.	3.704160	0.00868	N	0.001990	T	0.23727	0.0574	N	0.24115	0.695	0.09310	N	1	B;B;B	0.33904	0.431;0.431;0.305	B;B;B	0.26770	0.073;0.037;0.033	T	0.34254	-0.9836	10	0.56958	D	0.05	-9.0494	10.3308	0.43820	0.0:0.4139:0.5861:0.0	.	66;56;66	F5GZ87;F5H4Y9;Q96KN8	.;.;HRSL5_HUMAN	T	56;66;66	ENSP00000444809:A56T;ENSP00000443873:A66T;ENSP00000301790:A66T	ENSP00000301790:A66T	A	-	1	0	HRASLS5	63014364	0.002000	0.14202	0.004000	0.12327	0.023000	0.10783	0.629000	0.24538	0.598000	0.29829	-0.165000	0.13383	GCA		0.537	HRASLS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396375.1	NM_054108	
MARK2	2011	hgsc.bcm.edu	37	11	63667431	63667431	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:63667431T>C	ENST00000509502.2	+	8	981	c.518T>C	c.(517-519)cTg>cCg	p.L173P	MARK2_ENST00000377810.3_Missense_Mutation_p.L173P|MARK2_ENST00000402010.2_Missense_Mutation_p.L206P|MARK2_ENST00000350490.7_Missense_Mutation_p.L206P|MARK2_ENST00000502399.3_Missense_Mutation_p.L206P|MARK2_ENST00000361128.5_Missense_Mutation_p.L206P|MARK2_ENST00000315032.8_Missense_Mutation_p.L206P|MARK2_ENST00000425897.2_Missense_Mutation_p.L173P|MARK2_ENST00000377809.4_Missense_Mutation_p.L206P|MARK2_ENST00000408948.3_Missense_Mutation_p.L173P|MARK2_ENST00000513765.2_Missense_Mutation_p.L173P|MARK2_ENST00000413835.2_Missense_Mutation_p.L206P|MARK2_ENST00000508192.1_Missense_Mutation_p.L206P	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2									p.L173P(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						GGGAACAAGCTGGACACCTTC	0.493																																					p.L173P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T518C	11						.						150.0	147.0	148.0					11																	63667431		2201	4297	6498	63424007	SO:0001583	missense	2011	exon8			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.518T>C	11.37:g.63667431T>C	ENSP00000423974:p.Leu173Pro	Somatic		Capture	SOLID	Phase_I	63424007	NM_017490		Missense_Mutation	SNP	ENST00000509502.2	37	CCDS41665.1	.	.	.	.	.	.	.	.	.	.	t	25.0	4.595871	0.86953	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000502399;ENST00000509502;ENST00000513765;ENST00000408948;ENST00000425897	T;T;T;T;T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.76212	0.3956	L	0.42744	1.35	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;1.0;1.0	T	0.78502	-0.2179	10	0.87932	D	0	.	14.7168	0.69275	0.0:0.0:0.0:1.0	.	173;173;206;206;206;206	E7ETY4;Q7KZI7-14;Q7KZI7-15;Q7KZI7-5;Q7KZI7;Q7KZI7-16	.;.;.;.;MARK2_HUMAN;.	P	206;206;206;206;173;206;206;206;206;173;173;173;173	ENSP00000385751:L206P;ENSP00000326632:L206P;ENSP00000367040:L206P;ENSP00000389184:L206P;ENSP00000367041:L173P;ENSP00000425765:L206P;ENSP00000355091:L206P;ENSP00000294247:L206P;ENSP00000423974:L173P;ENSP00000421075:L173P;ENSP00000386128:L173P;ENSP00000415494:L173P	ENSP00000326632:L206P	L	+	2	0	MARK2	63424007	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.865000	0.87049	2.305000	0.77605	0.529000	0.55759	CTG		0.493	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490	
MACROD1	28992	hgsc.bcm.edu	37	11	63767721	63767721	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:63767721G>A	ENST00000255681.6	-	5	708	c.642C>T	c.(640-642)ggC>ggT	p.G214G	OTUB1_ENST00000535715.1_Intron	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	214	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.G214G(1)		breast(1)|large_intestine(3)|lung(6)|skin(1)	11						GCCGATAGCCGCCGGTGATCT	0.701																																					p.G214G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C642T	11						.						23.0	25.0	25.0					11																	63767721		2197	4294	6491	63524297	SO:0001819	synonymous_variant	28992	exon5			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.642C>T	11.37:g.63767721G>A		Somatic		Capture	SOLID	Phase_I	63524297	NM_014067	Q9UH96	Silent	SNP	ENST00000255681.6	37	CCDS8056.1																																																																																				0.701	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
PYGM	5837	hgsc.bcm.edu	37	11	64519124	64519124	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:64519124A>G	ENST00000164139.3	-	15	2170	c.1772T>C	c.(1771-1773)aTc>aCc	p.I591T	PYGM_ENST00000377432.3_Missense_Mutation_p.I503T|PYGM_ENST00000462303.1_5'UTR	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	591					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)	p.I591T(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTCCCTCTTGATGCCTGTGGA	0.562																																					p.I503T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1508C	11						.						69.0	68.0	69.0					11																	64519124		2201	4297	6498	64275700	SO:0001583	missense	5837	exon13				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1772T>C	11.37:g.64519124A>G	ENSP00000164139:p.Ile591Thr	Somatic		Capture	SOLID	Phase_I	64275700	NM_001164716	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839345	0.71488	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.94613	-3.47;-3.47	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000002	D	0.98264	0.9425	H	0.97940	4.11	0.80722	D	1	D;P	0.58620	0.983;0.946	D;D	0.78314	0.976;0.991	D	0.99232	1.0882	10	0.87932	D	0	-31.5113	13.1569	0.59522	1.0:0.0:0.0:0.0	.	503;591	A6NDY6;P11217	.;PYGM_HUMAN	T	503;591;572	ENSP00000366650:I503T;ENSP00000164139:I591T	ENSP00000164139:I591T	I	-	2	0	PYGM	64275700	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	5.087000	0.64480	2.211000	0.71520	0.459000	0.35465	ATC		0.562	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
SPDYC	387778	hgsc.bcm.edu	37	11	64937728	64937728	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:64937728C>T	ENST00000377185.2	+	1	104	c.22C>T	c.(22-24)Ctc>Ttc	p.L8F		NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C									p.L8F(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						CATTCCTGAGCTCGGGTAAGG	0.662																																					p.L8F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C22T	11						.						40.0	38.0	39.0					11																	64937728		2201	4297	6498	64694304	SO:0001583	missense	387778	exon1			AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611	ENST00000377185.2:c.22C>T	11.37:g.64937728C>T	ENSP00000366390:p.Leu8Phe	Somatic		Capture	SOLID	Phase_I	64694304	NM_001008778		Missense_Mutation	SNP	ENST00000377185.2	37	CCDS31606.1	.	.	.	.	.	.	.	.	.	.	C	7.915	0.737392	0.15574	.	.	ENSG00000204710	ENST00000377185	.	.	.	2.82	0.912	0.19349	.	2.437120	0.02173	N	0.059853	T	0.20129	0.0484	N	0.08118	0	0.09310	N	1	P	0.39326	0.668	B	0.42319	0.383	T	0.14144	-1.0483	9	0.49607	T	0.09	.	4.352	0.11160	0.0:0.632:0.233:0.135	.	8	Q5MJ68	SPDYC_HUMAN	F	8	.	ENSP00000366390:L8F	L	+	1	0	SPDYC	64694304	0.000000	0.05858	0.012000	0.15200	0.001000	0.01503	-0.780000	0.04654	0.271000	0.22005	-1.106000	0.02097	CTC		0.662	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385299.1	NM_001008778	
PACS1	55690	hgsc.bcm.edu	37	11	65988707	65988707	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:65988707A>G	ENST00000320580.4	+	10	1315	c.1282A>G	c.(1282-1284)Acc>Gcc	p.T428A		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	428					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.T428A(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						CGGAAAAGACACCACCAGCCC	0.627																																					p.T428A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1282G	11						.						92.0	74.0	80.0					11																	65988707		2200	4295	6495	65745283	SO:0001583	missense	55690	exon10			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1282A>G	11.37:g.65988707A>G	ENSP00000316454:p.Thr428Ala	Somatic		Capture	SOLID	Phase_I	65745283	NM_018026	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	CCDS8129.1	.	.	.	.	.	.	.	.	.	.	A	5.283	0.237653	0.10023	.	.	ENSG00000175115	ENST00000320580	T	0.16597	2.33	5.3	1.19	0.21007	.	0.466033	0.24587	N	0.037256	T	0.07143	0.0181	N	0.24115	0.695	0.39193	D	0.962996	B	0.02656	0.0	B	0.01281	0.0	T	0.27054	-1.0085	10	0.09590	T	0.72	-18.3732	0.999	0.01473	0.4624:0.1559:0.23:0.1516	.	428	Q6VY07	PACS1_HUMAN	A	428	ENSP00000316454:T428A	ENSP00000316454:T428A	T	+	1	0	PACS1	65745283	0.020000	0.18652	0.911000	0.35937	0.990000	0.78478	0.369000	0.20416	0.315000	0.23110	0.459000	0.35465	ACC		0.627	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026	
UCP2	7351	hgsc.bcm.edu	37	11	73689345	73689345	+	Missense_Mutation	SNP	C	C	T	rs201315561		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:73689345C>T	ENST00000310473.3	-	3	921	c.79G>A	c.(79-81)Gca>Aca	p.A27T	UCP2_ENST00000536983.1_Missense_Mutation_p.A27T|UCP2_ENST00000542615.1_5'Flank	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	27					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.A27T(1)		large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					ATGAGATCTGCGATGCAGGCA	0.542																																					p.A27T	Colon(191;388 2040 43557 45622 48925)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G79A	11						.						88.0	87.0	87.0					11																	73689345		2200	4293	6493	73366993	SO:0001583	missense	7351	exon3			U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.79G>A	11.37:g.73689345C>T	ENSP00000312029:p.Ala27Thr	Somatic		Capture	SOLID	Phase_I	73366993	NM_003355	Q4PJH8|Q53HM3	Missense_Mutation	SNP	ENST00000310473.3	37	CCDS8228.1	.	.	.	.	.	.	.	.	.	.	C	34	5.370332	0.95900	.	.	ENSG00000175567	ENST00000310473;ENST00000536983;ENST00000539764	T;T;T	0.80909	-1.43;-1.43;-1.25	6.07	5.15	0.70609	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.89839	0.6831	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90611	0.4552	10	0.87932	D	0	-9.0084	14.564	0.68162	0.0:0.9282:0.0:0.0718	.	27;27	F5GX45;P55851	.;UCP2_HUMAN	T	27	ENSP00000312029:A27T;ENSP00000441147:A27T;ENSP00000438230:A27T	ENSP00000312029:A27T	A	-	1	0	UCP2	73366993	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	6.021000	0.70832	2.884000	0.98904	0.655000	0.94253	GCA		0.542	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398108.1	NM_003355	
POLD3	10714	hgsc.bcm.edu	37	11	74347269	74347269	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:74347269C>T	ENST00000263681.2	+	11	1276	c.1147C>T	c.(1147-1149)Cga>Tga	p.R383*	POLD3_ENST00000532497.1_Nonsense_Mutation_p.R277*|POLD3_ENST00000527458.1_Nonsense_Mutation_p.R344*	NM_006591.2	NP_006582.1	Q15054	DPOD3_HUMAN	polymerase (DNA-directed), delta 3, accessory subunit	383					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)	p.R383*(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|stomach(1)	18	Breast(11;3.21e-06)					CAAAAGAAAACGAAAACGCGT	0.343																																					p.R383X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1147T	11						.						82.0	79.0	80.0					11																	74347269		2200	4293	6493	74024917	SO:0001587	stop_gained	10714	exon11			D26018	CCDS8233.1	11q14	2014-06-13			ENSG00000077514	ENSG00000077514		"""DNA polymerases"""	20932	protein-coding gene	gene with protein product	"""DNA polymerase delta subunit p66"", ""Pol delta C subunit (p66)"", ""protein phosphatase 1, regulatory subunit 128"""	611415				10219083	Standard	NM_006591		Approved	P66, KIAA0039, P68, PPP1R128	uc001ovf.2	Q15054	OTTHUMG00000165621	ENST00000263681.2:c.1147C>T	11.37:g.74347269C>T	ENSP00000263681:p.Arg383*	Somatic		Capture	SOLID	Phase_I	74024917	NM_006591	B7ZAI6|Q32MZ9|Q32N00	Nonsense_Mutation	SNP	ENST00000263681.2	37	CCDS8233.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424040	0.83667	.	.	ENSG00000077514	ENST00000263681;ENST00000527458;ENST00000532497	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.4019	12.2984	0.54860	0.1692:0.8308:0.0:0.0	.	.	.	.	X	383;344;277	.	ENSP00000263681:R383X	R	+	1	2	POLD3	74024917	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.002000	0.40835	2.696000	0.92011	0.561000	0.74099	CGA		0.343	POLD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385376.1	NM_006591	
NCAPD3	23310	hgsc.bcm.edu	37	11	134048744	134048744	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr11:134048744G>T	ENST00000534548.2	-	21	2711	c.2647C>A	c.(2647-2649)Ctg>Atg	p.L883M	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	883					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.L883M(2)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GACGAAGCCAGGACGGACTGA	0.478																																					p.L883M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C2647A	11						.						108.0	94.0	99.0					11																	134048744		2201	4297	6498	133553954	SO:0001583	missense	23310	exon21			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2647C>A	11.37:g.134048744G>T	ENSP00000433681:p.Leu883Met	Somatic		Capture	SOLID	Phase_I	133553954	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024056	0.54683	.	.	ENSG00000151503	ENST00000534548	T	0.33438	1.41	5.78	4.86	0.63082	Armadillo-like helical (1);Armadillo-type fold (1);	0.069340	0.64402	D	0.000013	T	0.47078	0.1426	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.63283	0.913	T	0.43718	-0.9374	10	0.51188	T	0.08	-8.8488	10.0611	0.42275	0.0715:0.1534:0.7751:0.0	.	883	P42695	CNDD3_HUMAN	M	883	ENSP00000433681:L883M	ENSP00000434168:L883M	L	-	1	2	NCAPD3	133553954	1.000000	0.71417	0.520000	0.27837	0.307000	0.27823	2.954000	0.49113	1.410000	0.46936	0.563000	0.77884	CTG		0.478	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
NEDD9	4739	hgsc.bcm.edu	37	6	11185508	11185508	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:11185508C>T	ENST00000379446.5	-	7	2558	c.2392G>A	c.(2392-2394)Gcc>Acc	p.A798T	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Missense_Mutation_p.A798T	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	798					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.A798T(4)		endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			TAATGGAGGGCGGCCATCTTG	0.552																																					p.A798T												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G2392A	6						.						162.0	144.0	150.0					6																	11185508		2203	4300	6503	11293494	SO:0001583	missense	4739	exon7			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.2392G>A	6.37:g.11185508C>T	ENSP00000368759:p.Ala798Thr	Somatic		Capture	SOLID	Phase_I	11293494	NM_006403	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	ENST00000379446.5	37	CCDS4520.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.736342	0.89482	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.35973	1.28;1.28	6.17	6.17	0.99709	CAS family, DUF3513 (1);	0.044236	0.85682	D	0.000000	T	0.61173	0.2326	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.62487	-0.6844	10	0.87932	D	0	-35.1735	20.8794	0.99867	0.0:1.0:0.0:0.0	.	798;798;798	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	T	798	ENSP00000368759:A798T;ENSP00000422871:A798T	ENSP00000368759:A798T	A	-	1	0	NEDD9	11293494	1.000000	0.71417	0.998000	0.56505	0.543000	0.35085	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GCC		0.552	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403	
ASCC3	10973	hgsc.bcm.edu	37	6	101053552	101053552	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:101053552G>A	ENST00000369162.2	-	33	5413	c.5069C>T	c.(5068-5070)gCt>gTt	p.A1690V		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1690	Helicase C-terminal 2. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.A1690V(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CGGCCTCCCAGCACGCCCCAT	0.383																																					p.A1690V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5069T	6						.						31.0	33.0	33.0					6																	101053552		2203	4298	6501	101160273	SO:0001583	missense	10973	exon33			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.5069C>T	6.37:g.101053552G>A	ENSP00000358159:p.Ala1690Val	Somatic		Capture	SOLID	Phase_I	101160273	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	G	35	5.589026	0.96590	.	.	ENSG00000112249	ENST00000369162	D	0.95272	-3.66	5.53	5.53	0.82687	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99568	1.0970	10	0.72032	D	0.01	.	19.4455	0.94844	0.0:0.0:1.0:0.0	.	1690	Q8N3C0	HELC1_HUMAN	V	1690	ENSP00000358159:A1690V	ENSP00000358159:A1690V	A	-	2	0	ASCC3	101160273	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.807000	0.99171	2.607000	0.88179	0.563000	0.77884	GCT		0.383	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
SERINC1	57515	hgsc.bcm.edu	37	6	122773115	122773115	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:122773115C>T	ENST00000339697.4	-	6	761	c.677G>A	c.(676-678)tGt>tAt	p.C226Y		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	226					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)	p.C226Y(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		GTTTTCTGAACAACTGGCTGG	0.418																																					p.C226Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G677A	6						.						96.0	87.0	90.0					6																	122773115		2203	4300	6503	122814814	SO:0001583	missense	57515	exon6			AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.677G>A	6.37:g.122773115C>T	ENSP00000342962:p.Cys226Tyr	Somatic		Capture	SOLID	Phase_I	122814814	NM_020755	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Missense_Mutation	SNP	ENST00000339697.4	37	CCDS5125.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.921859	0.92319	.	.	ENSG00000111897	ENST00000339697;ENST00000368454	T;T	0.58358	0.34;0.34	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.78691	0.4323	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83768	0.0218	10	0.87932	D	0	-20.2519	19.8431	0.96699	0.0:1.0:0.0:0.0	.	226	Q9NRX5	SERC1_HUMAN	Y	226	ENSP00000342962:C226Y;ENSP00000357439:C226Y	ENSP00000342962:C226Y	C	-	2	0	SERINC1	122814814	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.683000	0.91414	0.650000	0.86243	TGT		0.418	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	NM_020755	
CLVS2	134829	hgsc.bcm.edu	37	6	123369832	123369832	+	Silent	SNP	G	G	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:123369832G>C	ENST00000275162.5	+	4	1965	c.630G>C	c.(628-630)ctG>ctC	p.L210L	CLVS2_ENST00000368438.1_Silent_p.L64L	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	210	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.L210L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						TCCATGCCCTGTACACCGTGA	0.383																																					p.L210L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G630C	6						.						158.0	164.0	162.0					6																	123369832		2203	4300	6503	123411531	SO:0001819	synonymous_variant	134829	exon4			AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.630G>C	6.37:g.123369832G>C		Somatic		Capture	SOLID	Phase_I	123411531	NM_001010852	B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Silent	SNP	ENST00000275162.5	37	CCDS34525.1																																																																																				0.383	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852	
NCOA7	135112	hgsc.bcm.edu	37	6	126210663	126210663	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:126210663A>G	ENST00000368357.3	+	10	1815	c.1463A>G	c.(1462-1464)gAg>gGg	p.E488G	NCOA7_ENST00000229634.9_Missense_Mutation_p.E373G|NCOA7_ENST00000392477.2_Missense_Mutation_p.E488G	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	488					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)	p.E488G(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		GAAACCTGTGAGAAGCAAGAT	0.433																																					p.E488G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1463G	6						.						53.0	56.0	55.0					6																	126210663		2202	4298	6500	126252356	SO:0001583	missense	135112	exon11			AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.1463A>G	6.37:g.126210663A>G	ENSP00000357341:p.Glu488Gly	Somatic		Capture	SOLID	Phase_I	126252356	NM_001199620	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	37	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	A	18.84	3.709993	0.68730	.	.	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000229634;ENST00000413085	T;T;T;T	0.42900	2.39;2.39;2.44;0.96	5.8	5.8	0.92144	.	0.297628	0.36303	N	0.002673	T	0.40956	0.1138	L	0.34521	1.04	0.43499	D	0.995745	D;D;D	0.76494	0.966;0.995;0.999	P;P;D	0.80764	0.469;0.791;0.994	T	0.34204	-0.9838	10	0.37606	T	0.19	-1.3623	12.0646	0.53580	0.8564:0.1436:0.0:0.0	.	477;477;488	B3KXK4;Q8NI08-2;Q8NI08	.;.;NCOA7_HUMAN	G	488;488;373;286	ENSP00000357341:E488G;ENSP00000376269:E488G;ENSP00000229634:E373G;ENSP00000389186:E286G	ENSP00000229634:E373G	E	+	2	0	NCOA7	126252356	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.294000	0.59043	2.216000	0.71823	0.533000	0.62120	GAG		0.433	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
L3MBTL3	84456	hgsc.bcm.edu	37	6	130454766	130454766	+	Splice_Site	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:130454766G>T	ENST00000529410.1	+	23	2615	c.2136G>T	c.(2134-2136)gaG>gaT	p.E712D	RP11-73O6.3_ENST00000415964.1_RNA|L3MBTL3_ENST00000368136.2_Splice_Site_p.E712D|L3MBTL3_ENST00000368139.2_Splice_Site_p.E687D|RP11-73O6.3_ENST00000609978.1_RNA|L3MBTL3_ENST00000361794.2_Splice_Site_p.E712D|L3MBTL3_ENST00000526019.1_Splice_Site_p.E687D|L3MBTL3_ENST00000533560.1_Splice_Site_p.E687D|RP11-73O6.3_ENST00000591297.1_RNA			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	712	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.E712D(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GCACAGACGAGGTATATTTTA	0.453																																					p.E712D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2136T	6						.						39.0	36.0	38.0					6																	130454766		2203	4300	6503	130496459	SO:0001630	splice_region_variant	84456	exon21			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.2136+1G>T	6.37:g.130454766G>T		Somatic		Capture	SOLID	Phase_I	130496459	NM_032438	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	37	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.288074	0.59976	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.19	4.32	0.51571	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.158990	0.56097	D	0.000036	T	0.34978	0.0916	L	0.36672	1.1	0.58432	D	0.99999	P;D	0.60575	0.663;0.988	B;D	0.63877	0.261;0.919	T	0.10543	-1.0625	10	0.14656	T	0.56	.	13.8932	0.63753	0.0742:0.0:0.9258:0.0	.	687;712	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	D	712;687;712;687;687;712	ENSP00000431962:E712D;ENSP00000437185:E687D;ENSP00000354526:E712D;ENSP00000357121:E687D;ENSP00000436706:E687D;ENSP00000357118:E712D	ENSP00000354526:E712D	E	+	3	2	L3MBTL3	130496459	1.000000	0.71417	0.996000	0.52242	0.152000	0.21847	7.492000	0.81482	1.301000	0.44836	0.561000	0.74099	GAG		0.453	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074	Missense_Mutation
SYNE1	23345	hgsc.bcm.edu	37	6	152527404	152527404	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:152527404C>A	ENST00000367255.5	-	126	23519	c.22918G>T	c.(22918-22920)Gag>Tag	p.E7640*	SYNE1_ENST00000341594.5_Nonsense_Mutation_p.E7252*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.E7640*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.E7569*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.E7569*|SYNE1_ENST00000356820.4_Nonsense_Mutation_p.E2164*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7640					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAGGCGGCCTCAGCGCCACTG	0.512										HNSCC(10;0.0054)																											p.E2164X												.	.	0			c.G6490T	6						.						73.0	68.0	70.0					6																	152527404		2203	4300	6503	152569097	SO:0001587	stop_gained	23345	exon41			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.22918G>T	6.37:g.152527404C>A	ENSP00000356224:p.Glu7640*	Somatic		Capture	SOLID	Phase_I	152569097	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	47	13.321911	0.99734	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	.	.	.	5.51	4.64	0.57946	.	0.105190	0.41605	D	0.000859	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	16.6557	0.85227	0.0:0.87:0.13:0.0	.	.	.	.	X	7640;286;7569;7640;7569;7252;2164;562	.	ENSP00000265368:E7640X	E	-	1	0	SYNE1	152569097	1.000000	0.71417	0.892000	0.35008	0.032000	0.12392	4.906000	0.63293	1.430000	0.47334	0.591000	0.81541	GAG		0.512	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu	37	6	152551714	152551714	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:152551714C>T	ENST00000367255.5	-	115	21764	c.21163G>A	c.(21163-21165)Gct>Act	p.A7055T	SYNE1_ENST00000341594.5_Missense_Mutation_p.A6667T|SYNE1_ENST00000265368.4_Missense_Mutation_p.A7055T|SYNE1_ENST00000423061.1_Missense_Mutation_p.A6984T|SYNE1_ENST00000448038.1_Missense_Mutation_p.A6984T|SYNE1_ENST00000356820.4_Missense_Mutation_p.A1579T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7055					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A7055T(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGAACAGAAGCCTGATCTCCA	0.383										HNSCC(10;0.0054)																											p.A1579T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4735A	6						.						261.0	219.0	233.0					6																	152551714		2203	4300	6503	152593407	SO:0001583	missense	23345	exon30			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21163G>A	6.37:g.152551714C>T	ENSP00000356224:p.Ala7055Thr	Somatic		Capture	SOLID	Phase_I	152593407	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	9.789	1.177314	0.21787	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.75	3.96	0.45880	.	0.317981	0.26792	N	0.022469	T	0.14527	0.0351	L	0.38838	1.175	0.38212	D	0.940519	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.13407	0.009;0.009;0.008	T	0.15378	-1.0439	10	0.02654	T	1	.	11.6448	0.51255	0.0:0.8552:0.0:0.1448	.	7055;7055;6984	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	T	7055;6984;7055;6984;6667;1579	ENSP00000356224:A7055T;ENSP00000396024:A6984T;ENSP00000265368:A7055T;ENSP00000390975:A6984T;ENSP00000341887:A6667T;ENSP00000349276:A1579T	ENSP00000265368:A7055T	A	-	1	0	SYNE1	152593407	0.982000	0.34865	1.000000	0.80357	0.899000	0.52679	0.956000	0.29202	0.765000	0.33221	0.563000	0.77884	GCT		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu	37	6	152786509	152786509	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:152786509T>G	ENST00000367255.5	-	18	2417	c.1816A>C	c.(1816-1818)Agc>Cgc	p.S606R	SYNE1_ENST00000367248.3_Missense_Mutation_p.S596R|SYNE1_ENST00000413186.2_Missense_Mutation_p.S606R|SYNE1_ENST00000341594.5_Missense_Mutation_p.S613R|SYNE1_ENST00000495090.2_Missense_Mutation_p.S173R|SYNE1_ENST00000265368.4_Missense_Mutation_p.S606R|SYNE1_ENST00000423061.1_Missense_Mutation_p.S613R|SYNE1_ENST00000448038.1_Missense_Mutation_p.S613R|SYNE1_ENST00000466159.2_Missense_Mutation_p.S606R|SYNE1_ENST00000367253.4_Missense_Mutation_p.S606R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	606					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S606R(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCAGCATGCTCCTCACACTC	0.448										HNSCC(10;0.0054)																											p.S613R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1837C	6						.						172.0	147.0	156.0					6																	152786509		2203	4300	6503	152828202	SO:0001583	missense	23345	exon18			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1816A>C	6.37:g.152786509T>G	ENSP00000356224:p.Ser606Arg	Somatic		Capture	SOLID	Phase_I	152828202	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	23.6	4.437126	0.83885	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000495090;ENST00000466159;ENST00000537750	T;T;T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000001	T	0.54935	0.1889	M	0.77103	2.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.992;0.999;0.998;0.999	T	0.60622	-0.7227	10	0.62326	D	0.03	.	16.1303	0.81428	0.0:0.0:0.0:1.0	.	589;606;606;173;596;606;613	B3W695;Q8NF91;F5H4Q0;F5H422;F5GXQ8;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.;.	R	606;613;606;613;613;606;596;606;173;606;589	ENSP00000356224:S606R;ENSP00000396024:S613R;ENSP00000265368:S606R;ENSP00000390975:S613R;ENSP00000341887:S613R;ENSP00000356222:S606R;ENSP00000356217:S596R;ENSP00000414510:S606R;ENSP00000438508:S173R;ENSP00000446021:S606R;ENSP00000441264:S589R	ENSP00000265368:S606R	S	-	1	0	SYNE1	152828202	1.000000	0.71417	0.973000	0.42090	0.617000	0.37484	8.040000	0.89188	2.218000	0.71995	0.533000	0.62120	AGC		0.448	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
PARK2	5071	hgsc.bcm.edu	37	6	161807881	161807881	+	Missense_Mutation	SNP	G	G	A	rs375036403		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:161807881G>A	ENST00000366898.1	-	10	1214	c.1112C>T	c.(1111-1113)gCg>gTg	p.A371V	PARK2_ENST00000366896.1_Missense_Mutation_p.A222V|PARK2_ENST00000366897.1_Missense_Mutation_p.A343V|PARK2_ENST00000338468.3_Missense_Mutation_p.A180V|PARK2_ENST00000366894.1_Missense_Mutation_p.A180V	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	371			A -> T (in a patient with Parkinson disease; unknown pathological significance). {ECO:0000269|PubMed:19501131}.		adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)	p.A371V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TTCATGGTACGCTTCTTTACA	0.458																																					p.A371V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1112T	6						.	G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	153.0	125.0	134.0		1112,1028,665	-3.9	0.0	6		134	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PARK2	NM_004562.2,NM_013987.2,NM_013988.2	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	371/466,343/438,222/317	161807881	1,13005	2203	4300	6503	161727871	SO:0001583	missense	5071	exon10				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.1112C>T	6.37:g.161807881G>A	ENSP00000355865:p.Ala371Val	Somatic		Capture	SOLID	Phase_I	161727871	NM_004562	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	ENST00000366898.1	37	CCDS5281.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891726	0.33442	0.0	1.16E-4	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366894;ENST00000338468;ENST00000392134	D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51	4.71	-3.87	0.04218	Zinc finger, C6HC-type (2);	0.876086	0.09935	N	0.736657	T	0.47266	0.1436	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.15930	0.001;0.015;0.015;0.005	B;B;B;B	0.14578	0.001;0.011;0.007;0.004	T	0.44682	-0.9312	10	0.38643	T	0.18	.	8.9291	0.35659	0.0851:0.0:0.2173:0.6976	.	222;343;371;180	Q5VVX3;Q5VVX4;O60260;Q8NI42	.;.;PRKN2_HUMAN;.	V	371;343;222;180;180;180	ENSP00000355865:A371V;ENSP00000355863:A343V;ENSP00000355862:A222V;ENSP00000355860:A180V;ENSP00000343589:A180V	ENSP00000343589:A180V	A	-	2	0	PARK2	161727871	0.000000	0.05858	0.001000	0.08648	0.095000	0.18619	0.024000	0.13555	-0.414000	0.07495	0.637000	0.83480	GCG		0.458	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1		
FAM50B	26240	hgsc.bcm.edu	37	6	3850836	3850836	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:3850836C>T	ENST00000380274.1	+	1	1217	c.791C>T	c.(790-792)cCg>cTg	p.P264L	FAM50B_ENST00000380272.3_Missense_Mutation_p.P264L			Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	264						nucleus (GO:0005634)		p.P264L(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(3)|urinary_tract(3)	17	Ovarian(93;0.0925)	all_hematologic(90;0.108)				AAGAGCGGGCCGCTCTTCAGC	0.632																																					p.P264L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C791T	6						.						71.0	57.0	62.0					6																	3850836		2203	4300	6503	3795835	SO:0001583	missense	26240	exon2			Y18504	CCDS4487.1	6p25.2	2008-05-15			ENSG00000145945	ENSG00000145945			18789	protein-coding gene	gene with protein product		614686				10534398	Standard	NM_012135		Approved	D6S2654E, X5L	uc003mvu.3	Q9Y247	OTTHUMG00000014147	ENST00000380274.1:c.791C>T	6.37:g.3850836C>T	ENSP00000369627:p.Pro264Leu	Somatic		Capture	SOLID	Phase_I	3795835	NM_012135	Q5T2L6	Missense_Mutation	SNP	ENST00000380274.1	37	CCDS4487.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758849	0.89843	.	.	ENSG00000145945	ENST00000380274;ENST00000380272	.	.	.	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.62600	0.2441	L	0.52823	1.66	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.58956	-0.7544	9	0.31617	T	0.26	-51.7397	14.8117	0.70000	0.0:1.0:0.0:0.0	.	264	Q9Y247	FA50B_HUMAN	L	264	.	ENSP00000369625:P264L	P	+	2	0	FAM50B	3795835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.812000	0.62613	2.430000	0.82344	0.555000	0.69702	CCG		0.632	FAM50B-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039693.1	NM_012135	
ECI2	10455	hgsc.bcm.edu	37	6	4116219	4116219	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:4116219T>C	ENST00000380118.3	-	10	1110	c.1074A>G	c.(1072-1074)gaA>gaG	p.E358E	ECI2_ENST00000465828.1_Silent_p.E328E|ECI2_ENST00000361538.2_Silent_p.E328E|ECI2_ENST00000413766.2_Silent_p.E191E|C6orf201_ENST00000380175.4_Intron|ECI2_ENST00000380125.2_Silent_p.E328E|C6orf201_ENST00000430835.2_Intron|C6orf201_ENST00000333388.5_Intron			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	358					fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)	p.E328E(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						CGTGTAGTTTTTCTCTCTCTC	0.403																																					p.E358E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1074G	6						.						177.0	150.0	159.0					6																	4116219		2203	4300	6503	4061218	SO:0001819	synonymous_variant	10455	exon10			AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.1074A>G	6.37:g.4116219T>C		Somatic		Capture	SOLID	Phase_I	4061218	NM_206836	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Silent	SNP	ENST00000380118.3	37	CCDS43420.2																																																																																				0.403	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	
GPLD1	2822	hgsc.bcm.edu	37	6	24429262	24429262	+	Nonstop_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:24429262A>C	ENST00000230036.1	-	25	2631	c.2521T>G	c.(2521-2523)Tga>Gga	p.*841G		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	0					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)	p.*841G(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						TGAAATCTTCAATCTGAGCCA	0.517																																					p.X841G												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T2521G	6						.						96.0	87.0	90.0					6																	24429262		2203	4300	6503	24537241	SO:0001578	stop_lost	2822	exon25			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.2521T>G	6.37:g.24429262A>C	ENSP00000230036:p.*841Argext*15	Somatic		Capture	SOLID	Phase_I	24537241	NM_001503	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	ENST00000230036.1	37	CCDS4553.1	.	.	.	.	.	.	.	.	.	.	A	7.742	0.701499	0.15172	.	.	ENSG00000112293	ENST00000230036	.	.	.	5.06	3.87	0.44632	.	.	.	.	.	.	.	.	.	.	.	0.19775	N	0.999959	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6483	0.34018	0.8067:0.1933:0.0:0.0	.	.	.	.	G	841	.	.	X	-	1	0	GPLD1	24537241	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	1.391000	0.34475	0.902000	0.36520	0.533000	0.62120	TGA		0.517	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503	
BTN1A1	696	hgsc.bcm.edu	37	6	26508812	26508812	+	Missense_Mutation	SNP	C	C	T	rs536850553		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:26508812C>T	ENST00000244513.6	+	7	1057	c.991C>T	c.(991-993)Cgt>Tgt	p.R331C		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	331	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.R331C(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						GGAAGATTCACGTCAGAAACT	0.493													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19420	0.0		0.0	False		,,,				2504	0.0				p.R331C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C991T	6						.						154.0	151.0	152.0					6																	26508812		2203	4300	6503	26616791	SO:0001583	missense	696	exon7			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.991C>T	6.37:g.26508812C>T	ENSP00000244513:p.Arg331Cys	Somatic		Capture	SOLID	Phase_I	26616791	NM_001732	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	ENST00000244513.6	37	CCDS4614.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332268	0.24167	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.12147	2.71	5.33	3.42	0.39159	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.112392	0.38326	N	0.001729	T	0.08403	0.0209	M	0.83118	2.625	0.20307	N	0.999919	P	0.39903	0.694	B	0.36567	0.228	T	0.08269	-1.0730	10	0.66056	D	0.02	.	8.1121	0.30920	0.1573:0.7573:0.0:0.0854	.	331	Q13410	BT1A1_HUMAN	C	331	ENSP00000244513:R331C	ENSP00000244513:R331C	R	+	1	0	BTN1A1	26616791	0.000000	0.05858	0.937000	0.37676	0.264000	0.26372	-0.674000	0.05233	1.382000	0.46385	-0.140000	0.14226	CGT		0.493	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043776.1	NM_001732	
VARS2	57176	hgsc.bcm.edu	37	6	30882949	30882949	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:30882949T>A	ENST00000321897.5	+	2	850	c.218T>A	c.(217-219)aTt>aAt	p.I73N	VARS2_ENST00000541562.1_Missense_Mutation_p.I103N|VARS2_ENST00000542001.1_5'UTR|VARS2_ENST00000416670.2_Missense_Mutation_p.I73N			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	73					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						GCAGAATCCATTAAGGCCTGG	0.473																																					p.I73N												.	.	0			c.T218A	6						.						89.0	94.0	93.0					6																	30882949		2203	4300	6503	30990928	SO:0001583	missense	57176	exon3			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.218T>A	6.37:g.30882949T>A	ENSP00000316092:p.Ile73Asn	Somatic		Capture	SOLID	Phase_I	30990928	NM_020442	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	T	1.908	-0.451477	0.04572	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000428017;ENST00000413959;ENST00000541562;ENST00000421263	T;T;T;T;T	0.28255	3.6;3.6;1.62;3.59;1.62	4.43	0.348	0.16026	.	0.773985	0.11926	N	0.516210	T	0.04679	0.0127	N	0.08118	0	0.52501	D	0.999953	B;B;B	0.11235	0.002;0.004;0.0	B;B;B	0.15870	0.006;0.014;0.0	T	0.30880	-0.9963	10	0.36615	T	0.2	0.4342	3.0877	0.06283	0.098:0.3204:0.4126:0.169	.	73;103;73	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	N	73;73;73;73;103;73	ENSP00000316092:I73N;ENSP00000394802:I73N;ENSP00000403749:I73N;ENSP00000441000:I103N;ENSP00000416390:I73N	ENSP00000316092:I73N	I	+	2	0	VARS2	30990928	0.043000	0.20138	0.897000	0.35233	0.101000	0.19017	0.545000	0.23268	-0.050000	0.13356	-1.241000	0.01538	ATT		0.473	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
NCR3	259197	hgsc.bcm.edu	37	6	31555085	31555085	+	IGR	SNP	G	G	A	rs149481602		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:31555085G>A	ENST00000340027.5	-	0	1042				LST1_ENST00000376096.1_Silent_p.S3S|LST1_ENST00000376111.4_5'UTR|LST1_ENST00000376102.3_5'UTR|LST1_ENST00000376092.3_Silent_p.S3S|LST1_ENST00000418507.2_Silent_p.S3S|LST1_ENST00000211921.7_Silent_p.S3S|LST1_ENST00000339530.4_Silent_p.S3S|LST1_ENST00000303757.8_Silent_p.S3S|LST1_ENST00000376099.1_Silent_p.S3S|LST1_ENST00000376093.2_Silent_p.S3S|LST1_ENST00000376110.3_Silent_p.S3S|LST1_ENST00000376086.3_Silent_p.S3S|LST1_ENST00000376089.2_Silent_p.S3S|LST1_ENST00000438075.2_Silent_p.S3S|NCR3_ENST00000491161.1_5'Flank|LST1_ENST00000419073.1_3'UTR|LST1_ENST00000376090.2_Silent_p.S3S|LST1_ENST00000376100.3_Silent_p.S3S|LST1_ENST00000396101.3_Silent_p.S3S	NM_147130.2	NP_667341.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3						cell recognition (GO:0008037)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	integral component of plasma membrane (GO:0005887)		p.S3S(1)		cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9						TAATGTTATCGCGGAATGATG	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		21113	0.001		0.0	False		,,,				2504	0.0				p.S3S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G9A	6						.	G	,,,,,	1,4405	2.1+/-5.4	0,1,2202	119.0	90.0	100.0		9,9,9,9,9,9	-6.9	0.0	6	dbSNP_134	100	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LST1	NM_001166538.1,NM_007161.3,NM_205837.2,NM_205838.2,NM_205839.2,NM_205840.2	,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,	3/74,3/105,3/67,3/67,3/98,3/60	31555085	1,13005	2203	4300	6503	31663064	SO:0001628	intergenic_variant	7940	exon1			AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117		8824804, 11782277	Standard	NM_001145466		Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123		6.37:g.31555085G>A		Somatic		Capture	SOLID	Phase_I	31663064	NM_205840	B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	Silent	SNP	ENST00000340027.5	37	CCDS34397.1																																																																																				0.498	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076210.2		
DDAH2	23564	hgsc.bcm.edu	37	6	31696455	31696455	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:31696455G>A	ENST00000375789.2	-	2	995	c.365C>T	c.(364-366)gCg>gTg	p.A122V	DDAH2_ENST00000480913.1_5'UTR|DDAH2_ENST00000375792.3_Missense_Mutation_p.A122V|DDAH2_ENST00000375787.2_Missense_Mutation_p.A122V			O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	122					arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|negative regulation of apoptotic process (GO:0043066)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of nitric oxide biosynthetic process (GO:0045429)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)	p.A122V(1)		endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	11					L-Citrulline(DB00155)	ATCCAGCGTCGCGTTCTCGTC	0.587																																					p.A122V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C365T	6						.						80.0	65.0	70.0					6																	31696455		1511	2709	4220	31804434	SO:0001583	missense	23564	exon3			AF070667	CCDS4718.1	6p21	2010-02-17			ENSG00000213722	ENSG00000213722	3.5.3.18		2716	protein-coding gene	gene with protein product		604744				10493931	Standard	XM_005248974		Approved		uc003nwq.3	O95865	OTTHUMG00000031212	ENST00000375789.2:c.365C>T	6.37:g.31696455G>A	ENSP00000364945:p.Ala122Val	Somatic		Capture	SOLID	Phase_I	31804434	NM_013974	A2BEZ7	Missense_Mutation	SNP	ENST00000375789.2	37	CCDS4718.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.556060	0.86231	.	.	ENSG00000213722	ENST00000375789;ENST00000375787;ENST00000375792;ENST00000416410;ENST00000436437	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.71879	0.3392	M	0.68952	2.095	0.58432	D	0.999998	D	0.89917	1.0	D	0.71870	0.975	T	0.73636	-0.3920	9	0.56958	D	0.05	-18.0923	15.8166	0.78608	0.0:0.0:1.0:0.0	.	122	O95865	DDAH2_HUMAN	V	122	.	ENSP00000364943:A122V	A	-	2	0	DDAH2	31804434	1.000000	0.71417	0.990000	0.47175	0.941000	0.58515	7.465000	0.80898	2.585000	0.87301	0.655000	0.94253	GCG		0.587	DDAH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076432.2		
ITPR3	3710	hgsc.bcm.edu	37	6	33655027	33655027	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:33655027C>A	ENST00000374316.5	+	46	7160	c.6100C>A	c.(6100-6102)Ctg>Atg	p.L2034M	ITPR3_ENST00000605930.1_Missense_Mutation_p.L2034M			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2034					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.L2034M(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GAAGGCCTACCTGCAGGAGGA	0.607																																					p.L2034M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6100A	6						.						75.0	65.0	68.0					6																	33655027		2203	4300	6503	33763005	SO:0001583	missense	3710	exon45			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6100C>A	6.37:g.33655027C>A	ENSP00000363435:p.Leu2034Met	Somatic		Capture	SOLID	Phase_I	33763005	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.730507	0.30684	.	.	ENSG00000096433	ENST00000374316	D	0.91996	-2.95	4.98	4.09	0.47781	.	0.654185	0.14814	N	0.296863	T	0.70430	0.3223	N	0.08118	0	0.34685	D	0.725108	B;B	0.23316	0.012;0.083	B;B	0.19946	0.027;0.014	T	0.60010	-0.7346	10	0.30854	T	0.27	-9.4636	8.782	0.34798	0.0:0.7684:0.1523:0.0793	.	2034;1704	Q14573;Q59ES2	ITPR3_HUMAN;.	M	2034	ENSP00000363435:L2034M	ENSP00000363435:L2034M	L	+	1	2	ITPR3	33763005	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.634000	0.37123	1.049000	0.40321	0.561000	0.74099	CTG		0.607	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
PIM1	5292	hgsc.bcm.edu	37	6	37141786	37141786	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:37141786T>C	ENST00000373509.5	+	6	1234	c.861T>C	c.(859-861)caT>caC	p.H287H	PIM1_ENST00000468243.1_3'UTR	NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	378	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.H287H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TCCAGAACCATCCATGGATGC	0.542			T	BCL6	NHL																																p.H287H			Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T861C	6						.						96.0	80.0	85.0					6																	37141786		2203	4300	6503	37249764	SO:0001819	synonymous_variant	5292	exon6				CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.861T>C	6.37:g.37141786T>C		Somatic		Capture	SOLID	Phase_I	37249764	NM_002648	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																				0.542	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
DNAH8	1769	hgsc.bcm.edu	37	6	38818164	38818164	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:38818164G>A	ENST00000359357.3	+	36	4940	c.4686G>A	c.(4684-4686)ttG>ttA	p.L1562L	DNAH8_ENST00000441566.1_Silent_p.L1562L|DNAH8_ENST00000449981.2_Silent_p.L1779L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1562					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L1562L(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ATGAGCAGTTGGAAGTATGTC	0.353																																					p.L1562L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G4686A	6						.						122.0	116.0	118.0					6																	38818164		2203	4300	6503	38926142	SO:0001819	synonymous_variant	1769	exon36			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4686G>A	6.37:g.38818164G>A		Somatic		Capture	SOLID	Phase_I	38926142	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					0.353	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
KCNK5	8645	hgsc.bcm.edu	37	6	39158947	39158947	+	Missense_Mutation	SNP	C	C	T	rs147451811	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:39158947C>T	ENST00000359534.3	-	5	1557	c.1219G>A	c.(1219-1221)Gcc>Acc	p.A407T		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	407					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.A407T(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						TAGTCCTGGGCGTCCCATGGC	0.627													C|||	8	0.00159744	0.0	0.0029	5008	,	,		18652	0.0		0.006	False		,,,				2504	0.0				p.A407T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1219A	6						.	C	THR/ALA	2,4404	6.2+/-15.9	0,2,2201	81.0	73.0	76.0		1219	2.2	0.2	6	dbSNP_134	76	30,8570	21.0+/-64.5	0,30,4270	yes	missense	KCNK5	NM_003740.3	58	0,32,6471	TT,TC,CC		0.3488,0.0454,0.246	benign	407/500	39158947	32,12974	2203	4300	6503	39266925	SO:0001583	missense	8645	exon5			AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.1219G>A	6.37:g.39158947C>T	ENSP00000352527:p.Ala407Thr	Somatic		Capture	SOLID	Phase_I	39266925	NM_003740	B2RAQ6|B5TJL2|Q5VV76	Missense_Mutation	SNP	ENST00000359534.3	37	CCDS4841.1	6	0.0027472527472527475	0	0.0	1	0.0027624309392265192	0	0.0	5	0.006596306068601583	C	11.50	1.657237	0.29425	4.54E-4	0.003488	ENSG00000164626	ENST00000359534	T	0.22336	1.96	5.97	2.22	0.28083	.	4.417720	0.00166	N	0.000003	T	0.05364	0.0142	L	0.27053	0.805	0.29358	N	0.864865	B	0.11235	0.004	B	0.06405	0.002	T	0.13845	-1.0494	10	0.39692	T	0.17	.	5.0888	0.14696	0.3706:0.4179:0.0:0.2114	.	407	O95279	KCNK5_HUMAN	T	407	ENSP00000352527:A407T	ENSP00000352527:A407T	A	-	1	0	KCNK5	39266925	1.000000	0.71417	0.183000	0.23137	0.415000	0.31203	2.447000	0.44917	0.127000	0.18452	-0.181000	0.13052	GCC		0.627	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	
LRFN2	57497	hgsc.bcm.edu	37	6	40400510	40400510	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:40400510G>T	ENST00000338305.6	-	2	885	c.343C>A	c.(343-345)Ctt>Att	p.L115I		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	115						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCCTCCCCAAGGCTTGGCAGC	0.592																																					p.L115I												.	.	0			c.C343A	6						.						51.0	42.0	45.0					6																	40400510		2203	4300	6503	40508488	SO:0001583	missense	57497	exon2			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.343C>A	6.37:g.40400510G>T	ENSP00000345985:p.Leu115Ile	Somatic		Capture	SOLID	Phase_I	40508488	NM_020737	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	0.881	-0.728585	0.03135	.	.	ENSG00000156564	ENST00000338305	T	0.02837	4.14	5.76	4.81	0.61882	.	0.127146	0.53938	D	0.000059	T	0.00666	0.0022	N	0.10809	0.05	0.47308	D	0.999383	B	0.10296	0.003	B	0.19666	0.026	T	0.43426	-0.9392	10	0.02654	T	1	.	13.1572	0.59524	0.0:0.0:0.7882:0.2118	.	115	Q9ULH4	LRFN2_HUMAN	I	115	ENSP00000345985:L115I	ENSP00000345985:L115I	L	-	1	0	LRFN2	40508488	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	4.090000	0.57693	2.736000	0.93811	0.655000	0.94253	CTT		0.592	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
TREM2	54209	hgsc.bcm.edu	37	6	41129120	41129120	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:41129120C>T	ENST00000373113.3	-	2	365	c.272G>A	c.(271-273)gGc>gAc	p.G91D	TREM2_ENST00000338469.3_Missense_Mutation_p.G91D|TREM2_ENST00000373122.4_Missense_Mutation_p.G91D	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2	91	Ig-like V-type.				axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.G91D(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGTGAGAGTGCCACCCAGGGT	0.597																																					p.G91D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	6						.						145.0	129.0	134.0					6																	41129120		2203	4300	6503	41237098	SO:0001583	missense	54209	exon2			AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.272G>A	6.37:g.41129120C>T	ENSP00000362205:p.Gly91Asp	Somatic		Capture	SOLID	Phase_I	41237098	NM_018965	Q8N5H8|Q8WYN6	Missense_Mutation	SNP	ENST00000373113.3	37	CCDS4852.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141776	0.57044	.	.	ENSG00000095970	ENST00000373113;ENST00000338469;ENST00000373122	T;T;T	0.23348	1.91;1.91;1.91	5.51	5.51	0.81932	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.47488	0.1448	M	0.86178	2.8	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.996	T	0.43393	-0.9394	10	0.33940	T	0.23	-36.5445	16.5756	0.84635	0.0:1.0:0.0:0.0	.	91;91;91	Q9NZC2-2;Q9NZC2-3;Q9NZC2	.;.;TREM2_HUMAN	D	91	ENSP00000362205:G91D;ENSP00000342651:G91D;ENSP00000362214:G91D	ENSP00000342651:G91D	G	-	2	0	TREM2	41237098	0.997000	0.39634	0.944000	0.38274	0.185000	0.23345	4.054000	0.57434	2.599000	0.87857	0.561000	0.74099	GGC		0.597	TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040499.1	NM_018965	
GLTSCR1L	23506	hgsc.bcm.edu	37	6	42796430	42796430	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:42796430T>C	ENST00000314073.5	+	6	535	c.359T>C	c.(358-360)tTg>tCg	p.L120S	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.L120S			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	120								p.L120S(1)									GAACAGACATTGGCAGAAGAG	0.453																																					p.L120S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T359C	6						.						148.0	128.0	135.0					6																	42796430		2203	4300	6503	42904408	SO:0001583	missense	23506	exon5			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.359T>C	6.37:g.42796430T>C	ENSP00000313933:p.Leu120Ser	Somatic		Capture	SOLID	Phase_I	42904408	NM_015349	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	37	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	T	17.60	3.429111	0.62844	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.38722	1.12;1.12	5.81	5.81	0.92471	.	0.000000	0.52532	D	0.000065	T	0.56514	0.1990	M	0.68593	2.085	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.59273	-0.7485	10	0.56958	D	0.05	-11.0464	16.4563	0.84015	0.0:0.0:0.0:1.0	.	120;120;120	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	S	120	ENSP00000313933:L120S;ENSP00000377723:L120S	ENSP00000313933:L120S	L	+	2	0	KIAA0240	42904408	1.000000	0.71417	0.940000	0.37924	0.979000	0.70002	7.353000	0.79414	2.343000	0.79666	0.533000	0.62120	TTG		0.453	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
CUL7	9820	hgsc.bcm.edu	37	6	43013021	43013021	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:43013021C>A	ENST00000265348.3	-	15	3067	c.2982G>T	c.(2980-2982)caG>caT	p.Q994H	CUL7_ENST00000535468.1_Missense_Mutation_p.Q1078H|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	994					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.Q994H(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGCTCCAGGCCTGTGCCCGAA	0.592																																					p.Q994H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2982T	6						.						110.0	99.0	103.0					6																	43013021		2203	4300	6503	43120999	SO:0001583	missense	9820	exon15			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.2982G>T	6.37:g.43013021C>A	ENSP00000265348:p.Gln994His	Somatic		Capture	SOLID	Phase_I	43120999	NM_014780	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605092	0.46423	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.79352	-1.25;-1.26	4.98	1.61	0.23674	.	0.112667	0.64402	D	0.000017	T	0.49389	0.1554	L	0.41236	1.265	0.80722	D	1	B;P;P	0.41597	0.095;0.623;0.756	B;B;B	0.42882	0.061;0.401;0.401	T	0.46289	-0.9202	10	0.27082	T	0.32	-18.3694	2.5749	0.04804	0.1057:0.423:0.2293:0.2419	.	1078;1078;994	F5H0L1;B4DYZ0;Q14999	.;.;CUL7_HUMAN	H	994;1078	ENSP00000265348:Q994H;ENSP00000438788:Q1078H	ENSP00000265348:Q994H	Q	-	3	2	CUL7	43120999	1.000000	0.71417	0.992000	0.48379	0.948000	0.59901	1.164000	0.31810	0.476000	0.27440	0.563000	0.77884	CAG		0.592	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
KLC4	89953	hgsc.bcm.edu	37	6	43039980	43039980	+	Missense_Mutation	SNP	G	G	A	rs201715041		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:43039980G>A	ENST00000394056.2	+	13	1970	c.1475G>A	c.(1474-1476)cGg>cAg	p.R492Q	KLC4_ENST00000259708.3_Missense_Mutation_p.R510Q|KLC4_ENST00000453940.2_Missense_Mutation_p.R415Q|KLC4_ENST00000479388.1_Missense_Mutation_p.R492Q|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000347162.5_Missense_Mutation_p.R492Q|KLC4_ENST00000394058.1_Missense_Mutation_p.R492Q			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	492						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.R492Q(1)		endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			TGTGCCCTGCGGTCCCGGAGA	0.597													G|||	0	0.0	0.0	0.0	5008	,	,		17009	0.0		0.0	False		,,,				2504	0.0				p.R492Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1475A	6						.	G	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	51.0	56.0	54.0		1475,1475,1529	6.0	1.0	6		54	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense	KLC4	NM_201521.1,NM_201522.1,NM_201523.1	43,43,43	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging	492/620,492/620,510/638	43039980	3,13003	2203	4300	6503	43147958	SO:0001583	missense	89953	exon12			AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1475G>A	6.37:g.43039980G>A	ENSP00000377620:p.Arg492Gln	Somatic		Capture	SOLID	Phase_I	43147958	NM_201521	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	37	CCDS4883.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	G	36	5.599401	0.96614	0.0	3.49E-4	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T	0.80738	-1.37;1.22;-1.41;-1.37;-1.37;-1.37	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000006	D	0.89598	0.6761	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.983;0.99	D	0.87864	0.2666	10	0.48119	T	0.1	-15.7566	20.5792	0.99380	0.0:0.0:1.0:0.0	.	415;510;492	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	Q	492;415;510;492;492;492	ENSP00000340221:R492Q;ENSP00000395806:R415Q;ENSP00000259708:R510Q;ENSP00000418031:R492Q;ENSP00000377620:R492Q;ENSP00000377622:R492Q	ENSP00000259708:R510Q	R	+	2	0	KLC4	43147958	1.000000	0.71417	0.997000	0.53966	0.672000	0.39443	7.810000	0.86072	2.873000	0.98535	0.561000	0.74099	CGG		0.597	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
ZNF318	24149	hgsc.bcm.edu	37	6	43306246	43306246	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:43306246C>T	ENST00000361428.2	-	10	5567	c.5490G>A	c.(5488-5490)atG>atA	p.M1830I	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1830					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.M1830I(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTTTGTCAATCATTAGCAAGT	0.408																																					p.M1830I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5490A	6						.						150.0	138.0	143.0					6																	43306246		2203	4300	6503	43414224	SO:0001583	missense	24149	exon10			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.5490G>A	6.37:g.43306246C>T	ENSP00000354964:p.Met1830Ile	Somatic		Capture	SOLID	Phase_I	43414224	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	5.915	0.352818	0.11182	.	.	ENSG00000171467	ENST00000361428	T	0.11604	2.76	5.51	-0.256	0.12984	.	0.595915	0.16372	N	0.217300	T	0.02119	0.0066	N	0.24115	0.695	0.09310	N	0.99999	B	0.06786	0.001	B	0.01281	0.0	T	0.43909	-0.9362	10	0.44086	T	0.13	0.3088	9.0037	0.36097	0.0:0.3901:0.0:0.6099	.	1830	Q5VUA4	ZN318_HUMAN	I	1830	ENSP00000354964:M1830I	ENSP00000354964:M1830I	M	-	3	0	ZNF318	43414224	0.000000	0.05858	0.075000	0.20258	0.449000	0.32228	-0.804000	0.04535	-0.040000	0.13580	-1.028000	0.02416	ATG		0.408	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
KCNQ5	56479	hgsc.bcm.edu	37	6	73904837	73904837	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:73904837A>C	ENST00000370398.1	+	14	2608	c.2499A>C	c.(2497-2499)caA>caC	p.Q833H	KCNQ5_ENST00000402622.2_Missense_Mutation_p.Q843H|KCNQ5_ENST00000414165.2_Missense_Mutation_p.Q723H|KCNQ5_ENST00000355194.4_Missense_Mutation_p.Q833H|KCNQ5_ENST00000342056.2_Missense_Mutation_p.Q852H|KCNQ5_ENST00000355635.3_Missense_Mutation_p.Q834H|KCNQ5_ENST00000403813.2_Missense_Mutation_p.Q824H	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	833					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	TGTCTGTGCAAAACCTGATCA	0.483																																					p.Q852H	GBM(142;1375 1859 14391 23261 44706)											.	.	0			c.A2556C	6						.						98.0	81.0	87.0					6																	73904837		2203	4300	6503	73961558	SO:0001583	missense	56479	exon15			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2499A>C	6.37:g.73904837A>C	ENSP00000359425:p.Gln833His	Somatic		Capture	SOLID	Phase_I	73961558	NM_001160133	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.230982	0.58777	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99567	-5.96;-5.96;-5.96;-5.96;-5.97;-5.99;-6.18	5.97	3.45	0.39498	.	0.067610	0.64402	D	0.000011	D	0.99115	0.9695	M	0.61703	1.905	0.27435	N	0.953885	B;B;D;D;D	0.67145	0.234;0.055;0.99;0.994;0.996	B;B;P;D;P	0.78314	0.14;0.051;0.73;0.991;0.862	D	0.97884	1.0293	10	0.44086	T	0.13	.	10.3902	0.44164	0.859:0.0:0.141:0.0	.	723;843;852;824;833	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	H	852;852;833;833;843;834;824;723	ENSP00000345055:Q852H;ENSP00000347326:Q833H;ENSP00000359425:Q833H;ENSP00000385501:Q843H;ENSP00000347853:Q834H;ENSP00000384453:Q824H;ENSP00000409861:Q723H	ENSP00000345055:Q852H	Q	+	3	2	KCNQ5	73961558	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.594000	0.54008	1.006000	0.39211	0.528000	0.53228	CAA		0.483	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
LCA5	167691	hgsc.bcm.edu	37	6	80223102	80223102	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:80223102G>A	ENST00000392959.1	-	4	1158	c.547C>T	c.(547-549)Cgg>Tgg	p.R183W	LCA5_ENST00000467898.3_Missense_Mutation_p.R183W|LCA5_ENST00000369846.4_Missense_Mutation_p.R183W	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	183					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)	p.R183W(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TCAGTTGCCCGTTCTTTCTCT	0.358																																					p.R183W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C547T	6						.						169.0	161.0	164.0					6																	80223102		2203	4299	6502	80279821	SO:0001583	missense	167691	exon4				CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.547C>T	6.37:g.80223102G>A	ENSP00000376686:p.Arg183Trp	Somatic		Capture	SOLID	Phase_I	80279821	NM_181714	E1P542|Q9BWX7	Missense_Mutation	SNP	ENST00000392959.1	37	CCDS4990.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890948	0.72524	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	T;T	0.81415	-1.49;-1.49	6.07	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.87394	0.6166	M	0.76838	2.35	0.49389	D	0.999781	D;D	0.89917	1.0;1.0	P;D	0.87578	0.899;0.998	D	0.88012	0.2763	10	0.87932	D	0	-9.4907	13.2653	0.60131	0.0:0.0:0.7286:0.2714	.	183;183	B4DRL2;Q86VQ0	.;LCA5_HUMAN	W	183	ENSP00000358861:R183W;ENSP00000376686:R183W	ENSP00000358861:R183W	R	-	1	2	LCA5	80279821	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.967000	0.70403	2.885000	0.99019	0.655000	0.94253	CGG		0.358	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
RPS6KA2	6196	hgsc.bcm.edu	37	6	166845916	166845916	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr6:166845916C>A	ENST00000265678.4	-	15	1618	c.1395G>T	c.(1393-1395)caG>caT	p.Q465H	RPS6KA2_ENST00000481261.2_Missense_Mutation_p.Q376H|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.Q490H|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.Q376H|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.Q473H	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	465	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)	p.Q465H(1)|p.Q473H(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		TGTTCGGGTGCTGGCCGTACC	0.512																																					p.Q465H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1395T	6						.						148.0	118.0	128.0					6																	166845916		2203	4300	6503	166765906	SO:0001583	missense	6196	exon15			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.1395G>T	6.37:g.166845916C>A	ENSP00000265678:p.Gln465His	Somatic		Capture	SOLID	Phase_I	166765906	NM_021135	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	CCDS5294.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339983	0.41398	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	4.79	0.925	0.19424	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.064498	0.64402	D	0.000006	T	0.30603	0.0770	N	0.26042	0.785	0.80722	D	1	B;B;D	0.55800	0.005;0.001;0.973	B;B;D	0.74348	0.034;0.01;0.983	T	0.05500	-1.0881	10	0.30078	T	0.28	.	9.7376	0.40397	0.0:0.7159:0.0:0.2841	.	490;473;465	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	H	465;490;473;376;376	ENSP00000265678:Q465H;ENSP00000422435:Q490H;ENSP00000427015:Q473H;ENSP00000422484:Q376H;ENSP00000386050:Q376H	ENSP00000265678:Q465H	Q	-	3	2	RPS6KA2	166765906	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.447000	0.52936	-0.026000	0.13895	0.650000	0.86243	CAG		0.512	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
SMG6	23293	hgsc.bcm.edu	37	17	2186924	2186924	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:2186924G>A	ENST00000263073.6	-	7	2493	c.2443C>T	c.(2443-2445)Cgg>Tgg	p.R815W	SMG6_ENST00000544865.1_Missense_Mutation_p.R784W	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	815					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)	p.R815W(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CTCACCTTCCGCTTGGTCTCT	0.532																																					p.R784W	Melanoma(59;28 1088 11621 25887 46638 50814)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2350T	17						.						175.0	134.0	148.0					17																	2186924		2203	4300	6503	2133674	SO:0001583	missense	23293	exon7			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.2443C>T	17.37:g.2186924G>A	ENSP00000263073:p.Arg815Trp	Somatic		Capture	SOLID	Phase_I	2133674	NM_001170957	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	ENST00000263073.6	37	CCDS11016.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941103	0.73557	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.19250	2.16;2.16	5.17	4.16	0.48862	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.38607	-0.9653	10	0.87932	D	0	-3.5593	12.9123	0.58187	0.0:0.0:0.7088:0.2912	.	815	Q86US8	EST1A_HUMAN	W	815;784	ENSP00000263073:R815W;ENSP00000443920:R784W	ENSP00000263073:R815W	R	-	1	2	SMG6	2133674	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	5.096000	0.64535	2.393000	0.81446	0.484000	0.47621	CGG		0.532	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
MYH4	4622	hgsc.bcm.edu	37	17	10354747	10354747	+	Missense_Mutation	SNP	C	C	T	rs200121484		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:10354747C>T	ENST00000255381.2	-	28	3871	c.3761G>A	c.(3760-3762)cGc>cAc	p.R1254H	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1254					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.R1254H(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTCTAGGGTGCGGCACATTTT	0.418													C|||	1	0.000199681	0.0008	0.0	5008	,	,		11762	0.0		0.0	False		,,,				2504	0.0				p.R1254H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3761A	17						.	C	HIS/ARG	5,4401	9.9+/-24.2	0,5,2198	159.0	139.0	146.0		3761	3.6	1.0	17		146	0,8600		0,0,4300	yes	missense	MYH4	NM_017533.2	29	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	probably-damaging	1254/1940	10354747	5,13001	2203	4300	6503	10295472	SO:0001583	missense	4622	exon28				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3761G>A	17.37:g.10354747C>T	ENSP00000255381:p.Arg1254His	Somatic		Capture	SOLID	Phase_I	10295472	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511257	0.64522	0.001135	0.0	ENSG00000141048	ENST00000255381	T	0.78924	-1.22	5.62	3.64	0.41730	Myosin tail (1);	0.000000	0.37219	U	0.002181	T	0.76300	0.3968	M	0.65975	2.015	0.44359	D	0.997257	B	0.18863	0.031	B	0.26770	0.073	T	0.73688	-0.3904	10	0.59425	D	0.04	.	12.8771	0.57996	0.0:0.8666:0.0:0.1334	.	1254	Q9Y623	MYH4_HUMAN	H	1254	ENSP00000255381:R1254H	ENSP00000255381:R1254H	R	-	2	0	MYH4	10295472	0.952000	0.32445	0.963000	0.40424	0.878000	0.50629	2.224000	0.42945	0.845000	0.35118	0.655000	0.94253	CGC		0.418	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
SLFN13	146857	hgsc.bcm.edu	37	17	33769242	33769242	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:33769242T>C	ENST00000285013.6	-	5	1537	c.1262A>G	c.(1261-1263)gAa>gGa	p.E421G	SLFN13_ENST00000534689.1_Missense_Mutation_p.E103G|SLFN13_ENST00000542635.1_Missense_Mutation_p.E421G|SLFN13_ENST00000360502.2_Missense_Mutation_p.E103G|SLFN13_ENST00000526861.1_Missense_Mutation_p.E421G|SLFN13_ENST00000533791.1_Missense_Mutation_p.E421G	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	421						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CTTTAGTCCTTCATGCTGTAA	0.458																																					p.E421G												.	.	0			c.A1262G	17						.						73.0	68.0	70.0					17																	33769242		2203	4300	6503	30793355	SO:0001583	missense	146857	exon5			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1262A>G	17.37:g.33769242T>C	ENSP00000285013:p.Glu421Gly	Somatic		Capture	SOLID	Phase_I	30793355	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	ENST00000285013.6	37	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	t	9.558	1.117778	0.20877	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689;ENST00000532210	T;T;T;T;T;T	0.21031	4.32;3.73;4.32;4.32;3.73;2.03	3.09	1.99	0.26369	.	0.142704	0.31976	N	0.006763	T	0.19927	0.0479	M	0.78637	2.42	0.09310	N	1	B;B	0.34103	0.008;0.437	B;B	0.27500	0.023;0.08	T	0.22695	-1.0209	10	0.72032	D	0.01	.	4.8564	0.13561	0.0:0.153:0.0:0.847	.	103;421	Q68D06-2;Q68D06	.;SLN13_HUMAN	G	421;103;421;421;103;90	ENSP00000285013:E421G;ENSP00000353692:E103G;ENSP00000434439:E421G;ENSP00000444016:E421G;ENSP00000435442:E103G;ENSP00000435328:E90G	ENSP00000285013:E421G	E	-	2	0	SLFN13	30793355	0.000000	0.05858	0.012000	0.15200	0.063000	0.16089	0.397000	0.20883	0.393000	0.25203	0.172000	0.16884	GAA		0.458	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
FBXL20	84961	hgsc.bcm.edu	37	17	37431306	37431306	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:37431306C>T	ENST00000264658.6	-	10	1004	c.744G>A	c.(742-744)aaG>aaA	p.K248K	FBXL20_ENST00000583610.1_Silent_p.K248K|FBXL20_ENST00000394294.3_Silent_p.K216K|FBXL20_ENST00000577399.1_Silent_p.K250K	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	248					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)		p.K248K(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			GGGATTGTAACTTATGGCACC	0.398																																					p.K248K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G744A	17						.						125.0	113.0	117.0					17																	37431306		2203	4300	6503	34684832	SO:0001819	synonymous_variant	84961	exon10			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.744G>A	17.37:g.37431306C>T		Somatic		Capture	SOLID	Phase_I	34684832	NM_032875	A8K729|Q38J52	Silent	SNP	ENST00000264658.6	37	CCDS32640.1																																																																																				0.398	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444315.2	NM_032875	
MED1	5469	hgsc.bcm.edu	37	17	37571513	37571513	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:37571513A>G	ENST00000394287.3	-	15	1582	c.1377T>C	c.(1375-1377)aaT>aaC	p.N459N	MED1_ENST00000300651.6_Silent_p.N459N			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.N459N(1)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CCAGGGAGTCATTCACAGGGT	0.453										HNSCC(31;0.082)																											p.N459N	Pancreas(21;279 768 2492 4877 24026)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1377C	17						.						79.0	60.0	67.0					17																	37571513		2203	4300	6503	34825039	SO:0001819	synonymous_variant	5469	exon15			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.1377T>C	17.37:g.37571513A>G		Somatic		Capture	SOLID	Phase_I	34825039	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Silent	SNP	ENST00000394287.3	37																																																																																					0.453	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000256944.1	NM_004774	
ZZEF1	23140	hgsc.bcm.edu	37	17	3977627	3977627	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:3977627C>T	ENST00000381638.2	-	24	3626	c.3502G>A	c.(3502-3504)Ggt>Agt	p.G1168S	ZZEF1_ENST00000574474.1_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1168							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.G1168S(1)		central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						AACCGAGGACCGGCCTTGAAG	0.498											OREG0024096	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G1168S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3502A	17						.						149.0	142.0	145.0					17																	3977627		2203	4300	6503	3924376	SO:0001583	missense	23140	exon24			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.3502G>A	17.37:g.3977627C>T	ENSP00000371051:p.Gly1168Ser	Somatic	615	Capture	SOLID	Phase_I	3924376	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.028833	0.93518	.	.	ENSG00000074755	ENST00000381638	T	0.58797	0.31	5.87	5.87	0.94306	CUB (1);	0.000000	0.85682	D	0.000000	T	0.74038	0.3664	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	P	0.60173	0.87	T	0.72969	-0.4130	10	0.48119	T	0.1	-18.7964	20.2192	0.98319	0.0:1.0:0.0:0.0	.	1168	O43149	ZZEF1_HUMAN	S	1168	ENSP00000371051:G1168S	ENSP00000371051:G1168S	G	-	1	0	ZZEF1	3924376	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	7.443000	0.80521	2.780000	0.95670	0.655000	0.94253	GGT		0.498	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
MED24	9862	hgsc.bcm.edu	37	17	38176535	38176535	+	Silent	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:38176535G>T	ENST00000394128.2	-	24	2776	c.2695C>A	c.(2695-2697)Cga>Aga	p.R899R	MED24_ENST00000394127.2_Silent_p.R886R|MED24_ENST00000394126.1_Silent_p.R924R|MED24_ENST00000501516.3_Silent_p.R918R|MED24_ENST00000356271.3_Silent_p.R886R	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	899					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R899R(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CCCAGGACTCGGTTCAGAGGG	0.627																																					p.R886R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2656A	17						.						59.0	52.0	54.0					17																	38176535		2200	4296	6496	35430061	SO:0001819	synonymous_variant	9862	exon23			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2695C>A	17.37:g.38176535G>T		Somatic		Capture	SOLID	Phase_I	35430061	NM_001079518	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	ENST00000394128.2	37	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	G	9.595	1.127197	0.20959	.	.	ENSG00000008838	ENST00000422942	.	.	.	4.58	2.58	0.30949	.	.	.	.	.	T	0.57858	0.2082	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52087	-0.8622	4	.	.	.	-1.8376	8.6621	0.34099	0.0736:0.0:0.5871:0.3393	.	.	.	.	Q	196	.	.	P	-	2	0	MED24	35430061	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.815000	0.38981	0.660000	0.30964	-0.142000	0.14014	CCG		0.627	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
CALCOCO2	10241	hgsc.bcm.edu	37	17	46930338	46930338	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:46930338T>C	ENST00000258947.3	+	9	977	c.876T>C	c.(874-876)aaT>aaC	p.N292N	CALCOCO2_ENST00000416445.2_Silent_p.N250N|CALCOCO2_ENST00000508679.1_Silent_p.N220N|CALCOCO2_ENST00000448105.2_Silent_p.N316N|CALCOCO2_ENST00000509507.1_Silent_p.N313N	NM_001261390.1|NM_001261391.1|NM_001261393.1|NM_001261395.1|NM_005831.4	NP_001248319.1|NP_001248320.1|NP_001248322.1|NP_001248324.1|NP_005822.1	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	292					response to interferon-gamma (GO:0034341)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)	p.N292N(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	15						TGAAGCAGAATGAAACTACTG	0.433																																					p.N292N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T876C	17						.						146.0	125.0	132.0					17																	46930338		2203	4300	6503	44285337	SO:0001819	synonymous_variant	10241	exon9			BC004130	CCDS11538.1, CCDS58558.1, CCDS58559.1, CCDS58560.1, CCDS58561.1	17q21.32	2006-02-09				ENSG00000136436			29912	protein-coding gene	gene with protein product		604587				7540613	Standard	NM_001261390		Approved	MGC17318, NDP52	uc010wlr.3	Q13137		ENST00000258947.3:c.876T>C	17.37:g.46930338T>C		Somatic		Capture	SOLID	Phase_I	44285337	NM_005831	B2RBT0|B4DDC4|B4DDT4|B4DP36|B4E0C0|E7ENK0|E7ETP5|E9PBE5|Q53FQ5|Q53HB5|Q6IBN9|Q9BTF7	Silent	SNP	ENST00000258947.3	37	CCDS11538.1	.	.	.	.	.	.	.	.	.	.	T	0.084	-1.178733	0.01633	.	.	ENSG00000136436	ENST00000507306	.	.	.	5.24	0.394	0.16299	.	.	.	.	.	.	.	.	.	.	.	0.31936	N	0.611491	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.1334	2.9752	0.05935	0.4702:0.0:0.1459:0.3839	.	.	.	.	R	6	.	.	X	+	1	0	CALCOCO2	44285337	0.004000	0.15560	0.026000	0.17262	0.026000	0.11368	-0.161000	0.10026	-0.140000	0.11394	-0.347000	0.07816	TGA		0.433	CALCOCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360866.1	NM_005831	
FAM117A	81558	hgsc.bcm.edu	37	17	47809955	47809955	+	Silent	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:47809955A>C	ENST00000240364.2	-	2	403	c.324T>G	c.(322-324)gcT>gcG	p.A108A	FAM117A_ENST00000513602.1_5'UTR|FAM117A_ENST00000514018.1_5'UTR	NM_030802.3	NP_110429.1	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	108								p.A108A(1)		haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	17						AGGCCCCATCAGCATCTCGTG	0.577																																					p.A108A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T324G	17						.						104.0	84.0	91.0					17																	47809955		2203	4300	6503	45164954	SO:0001819	synonymous_variant	81558	exon2			BC037572	CCDS11553.1	17q21.33	2006-04-26				ENSG00000121104			24179	protein-coding gene	gene with protein product	"""C/EBP induced protein"""					12477932	Standard	NM_030802		Approved		uc002ipk.3	Q9C073		ENST00000240364.2:c.324T>G	17.37:g.47809955A>C		Somatic		Capture	SOLID	Phase_I	45164954	NM_030802	B7Z7Q3	Silent	SNP	ENST00000240364.2	37	CCDS11553.1																																																																																				0.577	FAM117A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365736.1	NM_030802	
WSCD1	23302	hgsc.bcm.edu	37	17	6013081	6013081	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:6013081T>C	ENST00000574946.1	+	6	1394	c.1004T>C	c.(1003-1005)gTg>gCg	p.V335A	WSCD1_ENST00000317744.5_Missense_Mutation_p.V335A|WSCD1_ENST00000574232.1_Missense_Mutation_p.V335A|WSCD1_ENST00000573634.1_Missense_Mutation_p.V219A|WSCD1_ENST00000539421.1_Missense_Mutation_p.V335A			Q658N2	WSCD1_HUMAN	WSC domain containing 1	335	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.V335A(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CAGACACCTGTGCAAGGTGGG	0.597																																					p.V335A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1004C	17						.						89.0	81.0	84.0					17																	6013081		2203	4300	6503	5953805	SO:0001583	missense	23302	exon6				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1004T>C	17.37:g.6013081T>C	ENSP00000460825:p.Val335Ala	Somatic		Capture	SOLID	Phase_I	5953805	NM_015253	A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	ENST00000574946.1	37	CCDS32538.1	.	.	.	.	.	.	.	.	.	.	T	18.35	3.604422	0.66445	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.37584	1.19;1.19	5.54	5.54	0.83059	Carbohydrate-binding WSC (1);Carbohydrate-binding WSC, subgroup (1);	0.116195	0.64402	D	0.000019	T	0.41971	0.1182	L	0.58810	1.83	0.46631	D	0.999138	P	0.52463	0.953	P	0.47603	0.551	T	0.27365	-1.0076	10	0.36615	T	0.2	-29.2087	13.6286	0.62181	0.0:0.0:0.0:1.0	.	335	Q658N2	WSCD1_HUMAN	A	335	ENSP00000323087:V335A;ENSP00000446032:V335A	ENSP00000323087:V335A	V	+	2	0	WSCD1	5953805	1.000000	0.71417	0.982000	0.44146	0.341000	0.28922	7.398000	0.79919	2.091000	0.63221	0.455000	0.32223	GTG		0.597	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253	
RNF43	54894	hgsc.bcm.edu	37	17	56435179	56435179	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:56435179T>C	ENST00000584437.1	-	8	3913	c.1958A>G	c.(1957-1959)cAg>cGg	p.Q653R	RNF43_ENST00000577716.1_Missense_Mutation_p.Q653R|RNF43_ENST00000500597.2_Missense_Mutation_p.Q612R|RNF43_ENST00000581868.1_Missense_Mutation_p.Q526R|RNF43_ENST00000407977.2_Missense_Mutation_p.Q653R|RNF43_ENST00000577625.1_Missense_Mutation_p.Q526R|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000583753.1_Missense_Mutation_p.Q612R			Q68DV7	RNF43_HUMAN	ring finger protein 43	653	Pro-rich.				negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q653R(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCTTTTCCTCTGTGGGTGTCG	0.627																																					p.Q653R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1958G	17						.						65.0	78.0	74.0					17																	56435179		2201	4293	6494	53790178	SO:0001583	missense	54894	exon9				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1958A>G	17.37:g.56435179T>C	ENSP00000463069:p.Gln653Arg	Somatic		Capture	SOLID	Phase_I	53790178	NM_017763	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.305481	0.23736	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.08720	3.19;3.06	5.18	5.18	0.71444	.	0.375137	0.22913	N	0.054112	T	0.07279	0.0184	L	0.32530	0.975	0.25959	N	0.982645	B;B;B	0.33238	0.403;0.017;0.005	B;B;B	0.28305	0.088;0.007;0.002	T	0.23119	-1.0197	10	0.51188	T	0.08	-18.8168	11.4111	0.49925	0.0:0.0:0.0:1.0	.	612;653;653	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	R	653;612	ENSP00000385328:Q653R;ENSP00000441969:Q612R	ENSP00000385328:Q653R	Q	-	2	0	RNF43	53790178	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	3.070000	0.50033	1.955000	0.56771	0.172000	0.16884	CAG		0.627	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
CDC27	996	hgsc.bcm.edu	37	17	45216162	45216162	+	Missense_Mutation	SNP	A	A	C	rs111227623		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:45216162A>C	ENST00000066544.3	-	13	1740	c.1647T>G	c.(1645-1647)gaT>gaG	p.D549E	CDC27_ENST00000531206.1_Missense_Mutation_p.D555E|CDC27_ENST00000527547.1_Missense_Mutation_p.D548E|CDC27_ENST00000446365.2_Missense_Mutation_p.D488E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	549					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.D549E(4)|p.D555E(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AAAGAGCAACATCTTTTTGAA	0.348																																					p.D555E												CDC27,lung,NS,Substitution - Missense,0	.	6	Substitution - Missense(6)	large_intestine(4)|ovary(1)|lung(1)	c.T1665G	17						.						46.0	51.0	49.0					17																	45216162		2202	4299	6501	42571161	SO:0001583	missense	996	exon13			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1647T>G	17.37:g.45216162A>C	ENSP00000066544:p.Asp549Glu	Somatic		Capture	SOLID	Phase_I	42571161	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	6.981	0.550975	0.13374	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.65364	-0.14;-0.15;0.15;-0.12	5.57	-0.476	0.12100	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	N	0.01473	-0.845	0.48040	D	0.999577	B;B;B;B	0.27192	0.052;0.171;0.171;0.052	B;B;B;B	0.27715	0.021;0.082;0.082;0.021	T	0.36261	-0.9755	10	0.02654	T	1	-6.7614	9.4643	0.38802	0.6029:0.0:0.3971:0.0	.	488;548;555;549	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	E	549;555;488;548	ENSP00000066544:D549E;ENSP00000434614:D555E;ENSP00000392802:D488E;ENSP00000437339:D548E	ENSP00000066544:D549E	D	-	3	2	CDC27	42571161	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.462000	0.35266	-0.146000	0.11274	-0.256000	0.11100	GAT		0.348	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
PRR11	55771	hgsc.bcm.edu	37	17	57247171	57247171	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:57247171delA	ENST00000262293.4	+	2	370	c.58delA	c.(58-60)aaafs	p.K22fs		NM_018304.3	NP_060774.2	Q96HE9	PRR11_HUMAN	proline rich 11	22						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.E23fs*9(3)|p.E23fs*46(1)		breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|pancreas(1)	16	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					AAGATTATTCAAAAAAAAAGA	0.363																																					p.K20fs												.	.	4	Deletion - Frameshift(3)|Insertion - Frameshift(1)	large_intestine(2)|ovary(1)|lung(1)	c.58delA	17						.						79.0	79.0	79.0					17																	57247171		2203	4300	6503	54601953	SO:0001589	frameshift_variant	55771	exon2				CCDS11614.1	17q23.2	2005-12-13				ENSG00000068489			25619	protein-coding gene	gene with protein product		615920				11799066	Standard	NM_018304		Approved	FLJ11029	uc002ixf.2	Q96HE9		ENST00000262293.4:c.58delA	17.37:g.57247171delA	ENSP00000262293:p.Lys22fs	Somatic		Capture	SOLID	Phase_I	54601953	NM_018304	Q9NUZ7|Q9NXE9	Frame_Shift_Del	DEL	ENST00000262293.4	37	CCDS11614.1																																																																																				0.363	PRR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445949.1	NM_018304	
SECTM1	6398	hgsc.bcm.edu	37	17	80280231	80280231	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr17:80280231G>T	ENST00000269389.3	-	5	903	c.553C>A	c.(553-555)Cta>Ata	p.L185I	SECTM1_ENST00000580437.1_Silent_p.S149S	NM_003004.2	NP_002995.1	Q8WVN6	SCTM1_HUMAN	secreted and transmembrane 1	185					immune response (GO:0006955)|mesoderm development (GO:0007498)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine activity (GO:0005125)|signal transducer activity (GO:0004871)	p.L185I(1)		endometrium(1)|large_intestine(2)|lung(1)	4	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			TGGGGTTCTAGGAGGAAGAAC	0.672																																					p.L185I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C553A	17						.						50.0	57.0	55.0					17																	80280231		2203	4300	6503	77873520	SO:0001583	missense	6398	exon5			U77643	CCDS11808.1	17q25	2008-07-18				ENSG00000141574			10707	protein-coding gene	gene with protein product	"""K12 protein"", ""type 1a transmembrane protein"""	602602				9480746	Standard	NM_003004		Approved	K12	uc002keo.3	Q8WVN6		ENST00000269389.3:c.553C>A	17.37:g.80280231G>T	ENSP00000269389:p.Leu185Ile	Somatic		Capture	SOLID	Phase_I	77873520	NM_003004	B2R7H0|O00466	Missense_Mutation	SNP	ENST00000269389.3	37	CCDS11808.1	.	.	.	.	.	.	.	.	.	.	G	3.709	-0.059974	0.07317	.	.	ENSG00000141574	ENST00000269389	.	.	.	0.965	-1.3	0.09259	.	.	.	.	.	T	0.08846	0.0219	N	0.14661	0.345	0.09310	N	1	P;P	0.44344	0.833;0.833	B;B	0.26614	0.071;0.071	T	0.19679	-1.0298	8	0.46703	T	0.11	.	3.9897	0.09532	0.4968:0.0:0.5032:0.0	.	185;185	Q8WVN6;A8K3U3	SCTM1_HUMAN;.	I	185	.	ENSP00000269389:L185I	L	-	1	2	SECTM1	77873520	0.008000	0.16893	0.000000	0.03702	0.013000	0.08279	0.132000	0.15891	-0.491000	0.06697	0.467000	0.42956	CTA		0.672	SECTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442856.1	NM_003004	
TMPRSS15	5651	hgsc.bcm.edu	37	21	19687475	19687475	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr21:19687475C>A	ENST00000284885.3	-	17	2053	c.2020G>T	c.(2020-2022)Gaa>Taa	p.E674*		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	674	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.E674*(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CAATCTGCTTCATCTGAGCCA	0.403																																					p.E674X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2020T	21						.						147.0	122.0	131.0					21																	19687475		2203	4300	6503	18609346	SO:0001587	stop_gained	5651	exon17				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2020G>T	21.37:g.19687475C>A	ENSP00000284885:p.Glu674*	Somatic		Capture	SOLID	Phase_I	18609346	NM_002772	Q2NKL7	Nonsense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	38	6.872491	0.97901	.	.	ENSG00000154646	ENST00000284885	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4399	0.83896	0.0:1.0:0.0:0.0	.	.	.	.	X	674	.	.	E	-	1	0	TMPRSS15	18609346	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	4.488000	0.60300	2.752000	0.94435	0.650000	0.86243	GAA		0.403	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709763	31709763	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr21:31709763C>T	ENST00000382835.2	-	1	249	c.224G>A	c.(223-225)tGt>tAt	p.C75Y		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	75						intermediate filament (GO:0005882)		p.C75Y(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						ACTTTGCACACAGCTATCGTC	0.478																																					p.C75Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G224A	21						.						163.0	155.0	158.0					21																	31709763		2203	4300	6503	30631634	SO:0001583	missense	643812	exon1			AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.224G>A	21.37:g.31709763C>T	ENSP00000372286:p.Cys75Tyr	Somatic		Capture	SOLID	Phase_I	30631634	NM_001077711		Missense_Mutation	SNP	ENST00000382835.2	37	CCDS33532.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004365	0.35320	.	.	ENSG00000206107	ENST00000382835	T	0.47869	0.83	4.34	1.45	0.22620	.	0.859314	0.09735	N	0.762599	T	0.45256	0.1333	M	0.82716	2.605	0.09310	N	1	B	0.29341	0.242	B	0.27796	0.083	T	0.41734	-0.9492	10	0.32370	T	0.25	-0.4584	2.9411	0.05830	0.1858:0.5351:0.1797:0.0995	.	75	Q3LI81	KR271_HUMAN	Y	75	ENSP00000372286:C75Y	ENSP00000372286:C75Y	C	-	2	0	KRTAP27-1	30631634	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	0.484000	0.22308	0.323000	0.23307	-0.282000	0.10007	TGT		0.478	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
BRWD1	54014	hgsc.bcm.edu	37	21	40600468	40600468	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr21:40600468G>A	ENST00000333229.2	-	27	3493	c.3166C>T	c.(3166-3168)Cgt>Tgt	p.R1056C	BRWD1_ENST00000342449.3_Missense_Mutation_p.R1056C|BRWD1_ENST00000380800.3_Missense_Mutation_p.R1056C	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1056					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R1056C(2)		cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TAAAATTGACGCAATACAAGA	0.294																																					p.R1056C	Melanoma(170;988 1986 4794 16843 39731)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3166T	21						.						47.0	45.0	45.0					21																	40600468		2203	4294	6497	39522338	SO:0001583	missense	54014	exon27			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3166C>T	21.37:g.40600468G>A	ENSP00000330753:p.Arg1056Cys	Somatic		Capture	SOLID	Phase_I	39522338	NM_033656	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.54|19.54	3.847624|3.847624	0.71603|0.71603	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000424441|ENST00000333229;ENST00000342449;ENST00000380800;ENST00000380783	.|T;T;T	.|0.46819	.|0.86;0.86;0.86	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.091827	.|0.45606	.|D	.|0.000355	T|T	0.69842|0.69842	0.3156|0.3156	M|M	0.82323|0.82323	2.585|2.585	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.79108	.|0.992;0.982;0.988	T|T	0.74529|0.74529	-0.3635|-0.3635	5|10	.|0.87932	.|D	.|0	-8.6257|-8.6257	13.4839|13.4839	0.61353|0.61353	0.0:0.0:0.8433:0.1566|0.0:0.0:0.8433:0.1566	.|.	.|1056;1056;1056	.|Q9NSI6-3;Q9NSI6-2;Q9NSI6	.|.;.;BRWD1_HUMAN	V|C	41|1056;1056;1056;60	.|ENSP00000330753:R1056C;ENSP00000344333:R1056C;ENSP00000370178:R1056C	.|ENSP00000330753:R1056C	A|R	-|-	2|1	0|0	BRWD1|BRWD1	39522338|39522338	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.430000|2.430000	0.44766|0.44766	2.524000|2.524000	0.85096|0.85096	0.585000|0.585000	0.79938|0.79938	GCG|CGT		0.294	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
HSF2BP	11077	hgsc.bcm.edu	37	21	45053173	45053173	+	Missense_Mutation	SNP	C	C	T	rs371675179		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr21:45053173C>T	ENST00000291560.2	-	5	752	c.421G>A	c.(421-423)Gtc>Atc	p.V141I	HSF2BP_ENST00000542962.1_Missense_Mutation_p.V66I	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	141					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)		p.V141I(1)		kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		ATGGCCTTGACGACTTCCTCA	0.473																																					p.V141I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G421A	21						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	144.0	126.0	132.0		421	4.9	1.0	21		132	0,8600		0,0,4300	no	missense	HSF2BP	NM_007031.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	141/335	45053173	1,13005	2203	4300	6503	43877601	SO:0001583	missense	11077	exon5			AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.421G>A	21.37:g.45053173C>T	ENSP00000291560:p.Val141Ile	Somatic		Capture	SOLID	Phase_I	43877601	NM_007031	B4DX36	Missense_Mutation	SNP	ENST00000291560.2	37	CCDS13697.1	.	.	.	.	.	.	.	.	.	.	C	14.37	2.515604	0.44763	2.27E-4	0.0	ENSG00000160207	ENST00000291560;ENST00000542962;ENST00000443485	T;T;T	0.64618	-0.11;0.81;-0.11	4.95	4.95	0.65309	Armadillo-type fold (1);	0.128679	0.52532	D	0.000075	T	0.49474	0.1559	L	0.35414	1.06	0.43000	D	0.994518	P	0.40794	0.729	B	0.31016	0.123	T	0.56353	-0.7993	10	0.45353	T	0.12	-23.2801	18.1784	0.89769	0.0:1.0:0.0:0.0	.	141	O75031	HSF2B_HUMAN	I	141;66;141	ENSP00000291560:V141I;ENSP00000443367:V66I;ENSP00000409585:V141I	ENSP00000291560:V141I	V	-	1	0	HSF2BP	43877601	0.995000	0.38212	0.969000	0.41365	0.885000	0.51271	3.204000	0.51082	2.282000	0.76494	0.585000	0.79938	GTC		0.473	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195620.1	NM_007031	
TRPM2	7226	hgsc.bcm.edu	37	21	45810874	45810874	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr21:45810874G>A	ENST00000397928.1	+	10	1851	c.1406G>A	c.(1405-1407)cGc>cAc	p.R469H	TRPM2_ENST00000397932.2_Missense_Mutation_p.R469H|TRPM2_ENST00000300481.9_Missense_Mutation_p.R469H|TRPM2_ENST00000300482.5_Missense_Mutation_p.R469H|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	469					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.R469H(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GACATTGCCCGCAGTGAGATC	0.572																																					p.R469H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1406A	21						.						146.0	134.0	138.0					21																	45810874		2203	4300	6503	44635302	SO:0001583	missense	7226	exon10			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1406G>A	21.37:g.45810874G>A	ENSP00000381023:p.Arg469His	Somatic		Capture	SOLID	Phase_I	44635302	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105135	0.77096	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	4.6	3.72	0.42706	.	0.267853	0.37219	N	0.002187	T	0.49338	0.1551	M	0.87456	2.885	0.42105	D	0.991354	D;D	0.65815	0.995;0.995	P;P	0.48627	0.584;0.561	T	0.59118	-0.7514	10	0.66056	D	0.02	-33.7015	10.3262	0.43793	0.1611:0.0:0.8389:0.0	.	469;469	E9PGK7;O94759	.;TRPM2_HUMAN	H	469	ENSP00000300482:R469H;ENSP00000381023:R469H;ENSP00000300481:R469H;ENSP00000381026:R469H	ENSP00000300481:R469H	R	+	2	0	TRPM2	44635302	0.953000	0.32496	1.000000	0.80357	0.978000	0.69477	2.187000	0.42602	1.074000	0.40909	0.655000	0.94253	CGC		0.572	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
SPATC1L	84221	hgsc.bcm.edu	37	21	47588256	47588256	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr21:47588256G>A	ENST00000291672.5	-	3	1571	c.510C>T	c.(508-510)acC>acT	p.T170T	SPATC1L_ENST00000330205.6_Silent_p.T16T	NM_001142854.1	NP_001136326.1	Q9H0A9	SPC1L_HUMAN	spermatogenesis and centriole associated 1-like	170																	TCCTGTCCCCGGTGGGCAGGC	0.657																																					p.T170T												.	.	0			c.C510T	21						.						42.0	36.0	38.0					21																	47588256		2203	4300	6503	46412684	SO:0001819	synonymous_variant	84221	exon3			BC009497	CCDS13732.1, CCDS46653.1	21q22.3	2013-01-21	2012-11-12	2012-11-12	ENSG00000160284	ENSG00000160284			1298	protein-coding gene	gene with protein product	"""speriolin-like protein"""	612412	"""chromosome 21 open reading frame 56"""	C21orf56			Standard	NM_032261		Approved		uc011afu.2	Q9H0A9	OTTHUMG00000090487	ENST00000291672.5:c.510C>T	21.37:g.47588256G>A		Somatic		Capture	SOLID	Phase_I	46412684	NM_001142854	B4E323|Q52LS9|Q6FIH5|Q6P0L3|Q9NSE5	Silent	SNP	ENST00000291672.5	37	CCDS46653.1																																																																																				0.657	SPATC1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376654.1	NM_032261	
PCNT	5116	hgsc.bcm.edu	37	21	47776924	47776924	+	Missense_Mutation	SNP	G	G	A	rs202197939		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr21:47776924G>A	ENST00000359568.5	+	13	2079	c.1972G>A	c.(1972-1974)Ggg>Agg	p.G658R	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	658	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.G658R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TGTGCAGGACGGGGACTTGGA	0.597																																					p.G658R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1972A	21						.	G	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	61.0	61.0	61.0		1972	-6.8	0.0	21		61	0,8600		0,0,4300	no	missense	PCNT	NM_006031.5	125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	658/3337	47776924	1,13005	2203	4300	6503	46601352	SO:0001583	missense	5116	exon13			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1972G>A	21.37:g.47776924G>A	ENSP00000352572:p.Gly658Arg	Somatic		Capture	SOLID	Phase_I	46601352	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	4.598	0.111060	0.08831	2.27E-4	0.0	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.01379	4.96	4.76	-6.79	0.01715	.	.	.	.	.	T	0.00906	0.0030	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46569	-0.9182	9	0.19147	T	0.46	.	4.0474	0.09779	0.4109:0.0954:0.3975:0.0962	.	540;658	O95613-2;O95613	.;PCNT_HUMAN	R	658;645	ENSP00000352572:G658R	ENSP00000338675:G645R	G	+	1	0	PCNT	46601352	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.393000	0.07305	-2.304000	0.00655	-1.203000	0.01651	GGG		0.597	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
TEKT5	146279	hgsc.bcm.edu	37	16	10729660	10729660	+	Missense_Mutation	SNP	C	C	T	rs549750185		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:10729660C>T	ENST00000283025.2	-	6	1273	c.1202G>A	c.(1201-1203)cGc>cAc	p.R401H	TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	401						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.R401H(2)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						CATGTTGGGGCGCCGGGTCCG	0.627																																					p.R401H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1202A	16						.						96.0	101.0	100.0					16																	10729660		2197	4300	6497	10637161	SO:0001583	missense	146279	exon6				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1202G>A	16.37:g.10729660C>T	ENSP00000283025:p.Arg401His	Somatic		Capture	SOLID	Phase_I	10637161	NM_144674	A1L3Z3	Missense_Mutation	SNP	ENST00000283025.2	37	CCDS10542.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758177	0.89843	.	.	ENSG00000153060	ENST00000283025	T	0.26660	1.72	4.56	4.56	0.56223	.	0.000000	0.53938	D	0.000041	T	0.58892	0.2154	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70004	-0.4991	10	0.87932	D	0	-23.7408	15.9141	0.79496	0.0:1.0:0.0:0.0	.	401	Q96M29	TEKT5_HUMAN	H	401	ENSP00000283025:R401H	ENSP00000283025:R401H	R	-	2	0	TEKT5	10637161	0.996000	0.38824	0.983000	0.44433	0.760000	0.43138	7.225000	0.78051	2.090000	0.63153	0.555000	0.69702	CGC		0.627	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674	
MKL2	57496	hgsc.bcm.edu	37	16	14351989	14351989	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:14351989A>G	ENST00000341243.5	+	14	2702	c.2702A>G	c.(2701-2703)gAc>gGc	p.D901G	MKL2_ENST00000318282.5_Missense_Mutation_p.D862G|MKL2_ENST00000574045.1_Missense_Mutation_p.D862G|MKL2_ENST00000571589.1_Missense_Mutation_p.D912G			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	901					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.D862G(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CAGATGGATGACCTCTTTGAT	0.383																																					p.D862G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2585G	16						.						110.0	94.0	100.0					16																	14351989		2197	4300	6497	14259490	SO:0001583	missense	57496	exon16			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.2702A>G	16.37:g.14351989A>G	ENSP00000345841:p.Asp901Gly	Somatic		Capture	SOLID	Phase_I	14259490	NM_014048	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	37		.	.	.	.	.	.	.	.	.	.	A	25.9	4.683569	0.88639	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.79375	0.4435	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.995	T	0.82307	-0.0522	9	0.87932	D	0	-24.3344	14.7871	0.69810	1.0:0.0:0.0:0.0	.	912;862	B4DGT8;Q9ULH7-4	.;.	G	862;901	.	ENSP00000339086:D862G	D	+	2	0	MKL2	14259490	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.817000	0.91985	2.098000	0.63641	0.460000	0.39030	GAC		0.383	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048	
MVP	9961	hgsc.bcm.edu	37	16	29845139	29845139	+	Missense_Mutation	SNP	A	A	C	rs556282001		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:29845139A>C	ENST00000357402.5	+	4	545	c.407A>C	c.(406-408)aAg>aCg	p.K136T	MVP_ENST00000395353.1_Missense_Mutation_p.K136T|MVP_ENST00000452209.2_Intron	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	136					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)	p.K136T(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						GATGGAGACAAGGTGGTGGCA	0.532													A|||	1	0.000199681	0.0	0.0014	5008	,	,		19157	0.0		0.0	False		,,,				2504	0.0				p.K136T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A407C	16						.						204.0	192.0	196.0					16																	29845139		2197	4300	6497	29752640	SO:0001583	missense	9961	exon4			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.407A>C	16.37:g.29845139A>C	ENSP00000349977:p.Lys136Thr	Somatic		Capture	SOLID	Phase_I	29752640	NM_017458	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.423229	0.43020	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.34472	1.36;1.36	5.8	3.22	0.36961	.	0.044969	0.85682	D	0.000000	T	0.31513	0.0799	L	0.55743	1.74	0.80722	D	1	B	0.14805	0.011	B	0.20955	0.032	T	0.09357	-1.0678	10	0.33141	T	0.24	-0.9561	9.2109	0.37318	0.8278:0.0:0.1722:0.0	.	136	Q14764	MVP_HUMAN	T	136	ENSP00000349977:K136T;ENSP00000378760:K136T	ENSP00000349977:K136T	K	+	2	0	MVP	29752640	1.000000	0.71417	0.988000	0.46212	0.895000	0.52256	4.603000	0.61105	1.011000	0.39340	0.402000	0.26972	AAG		0.532	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115	
SRCAP	10847	hgsc.bcm.edu	37	16	30723190	30723190	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:30723190T>C	ENST00000262518.4	+	12	1912	c.1527T>C	c.(1525-1527)gaT>gaC	p.D509D	SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000344771.4_Silent_p.D509D|SRCAP_ENST00000395059.2_Silent_p.D509D	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	509	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.D509D(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ATGAGGAAGATGAACATTCAG	0.502																																					p.D509D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1527C	16						.						68.0	64.0	65.0					16																	30723190		2197	4300	6497	30630691	SO:0001819	synonymous_variant	10847	exon12			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1527T>C	16.37:g.30723190T>C		Somatic		Capture	SOLID	Phase_I	30630691	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																				0.502	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SRCAP	10847	hgsc.bcm.edu	37	16	30727450	30727450	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:30727450T>C	ENST00000262518.4	+	17	2942	c.2557T>C	c.(2557-2559)Tac>Cac	p.Y853H	SRCAP_ENST00000344771.4_Missense_Mutation_p.Y853H|SRCAP_ENST00000395059.2_Missense_Mutation_p.Y853H	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	853					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.Y853H(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GCCCAAAAAGTACGAGCATGT	0.502																																					p.Y853H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2557C	16						.						152.0	129.0	137.0					16																	30727450		2197	4300	6497	30634951	SO:0001583	missense	10847	exon17			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2557T>C	16.37:g.30727450T>C	ENSP00000262518:p.Tyr853His	Somatic		Capture	SOLID	Phase_I	30634951	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	T	17.18	3.322928	0.60634	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	T;T;T	0.75050	-0.9;-0.9;-0.9	5.25	5.25	0.73442	SNF2-related (1);	0.000000	0.49305	D	0.000142	T	0.76499	0.3996	N	0.17345	0.48	0.54753	D	0.999983	B;D;D	0.89917	0.302;1.0;1.0	P;D;D	0.91635	0.541;0.999;0.999	T	0.80246	-0.1462	10	0.66056	D	0.02	-7.9383	14.2776	0.66191	0.0:0.0:0.0:1.0	.	853;853;853	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	H	853	ENSP00000262518:Y853H;ENSP00000378499:Y853H;ENSP00000343042:Y853H	ENSP00000262518:Y853H	Y	+	1	0	SRCAP	30634951	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.712000	0.84684	2.201000	0.70794	0.459000	0.35465	TAC		0.502	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
CREBBP	1387	hgsc.bcm.edu	37	16	3781845	3781845	+	Missense_Mutation	SNP	G	G	A	rs73491901	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:3781845G>A	ENST00000262367.5	-	29	5631	c.4822C>T	c.(4822-4824)Ccc>Tcc	p.P1608S	CREBBP_ENST00000382070.3_Missense_Mutation_p.P1570S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1608	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P1608S(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGCATGCTGGGCttcttcttg	0.557			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.P1608S			Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4822T	16						.						510.0	406.0	441.0					16																	3781845		2197	4300	6497	3721846	SO:0001583	missense	1387	exon29			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4822C>T	16.37:g.3781845G>A	ENSP00000262367:p.Pro1608Ser	Somatic		Capture	SOLID	Phase_I	3721846	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	g	15.45	2.838500	0.51057	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.92299	-3.01;-3.01	5.51	5.51	0.81932	.	0.075811	0.56097	D	0.000027	D	0.84561	0.5499	N	0.04297	-0.235	0.80722	D	1	P;P	0.41420	0.749;0.749	P;P	0.45753	0.492;0.492	D	0.83400	0.0022	10	0.15066	T	0.55	-17.5877	14.9637	0.71174	0.0:0.1424:0.8576:0.0	.	1638;1608	Q4LE28;Q92793	.;CBP_HUMAN	S	1608;1638;1570	ENSP00000262367:P1608S;ENSP00000371502:P1570S	ENSP00000262367:P1608S	P	-	1	0	CREBBP	3721846	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.884000	0.87274	2.587000	0.87381	0.561000	0.74099	CCC		0.557	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
STX1B	112755	hgsc.bcm.edu	37	16	31004521	31004521	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:31004521G>T	ENST00000215095.5	-	9	947	c.716C>A	c.(715-717)tCt>tAt	p.S239Y	STX1B_ENST00000565419.1_Missense_Mutation_p.S239Y	NM_052874.3	NP_443106.1	P61266	STX1B_HUMAN	syntaxin 1B	239	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intracellular protein transport (GO:0006886)|neurotransmitter transport (GO:0006836)|regulation of exocytosis (GO:0017157)|regulation of gene expression (GO:0010468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)	p.S239Y(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)	13						GTAGTCCACAGAATGTTCCAC	0.602																																					p.S239Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C716A	16						.						157.0	142.0	147.0					16																	31004521		2197	4300	6497	30912022	SO:0001583	missense	112755	exon9			AY028792	CCDS10699.1	16p12-p11	2008-02-05	2007-06-20	2007-06-20	ENSG00000099365	ENSG00000099365			18539	protein-coding gene	gene with protein product		601485	"""syntaxin 1B1"", ""syntaxin 1B2"""	STX1B1, STX1B2			Standard	NM_052874		Approved		uc010cad.2	P61266	OTTHUMG00000132391	ENST00000215095.5:c.716C>A	16.37:g.31004521G>T	ENSP00000215095:p.Ser239Tyr	Somatic		Capture	SOLID	Phase_I	30912022	NM_052874	Q15531|Q2VPS2	Missense_Mutation	SNP	ENST00000215095.5	37	CCDS10699.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952477	0.92660	.	.	ENSG00000099365	ENST00000215095	T	0.23348	1.91	5.0	5.0	0.66597	t-SNARE (1);Target SNARE coiled-coil domain (3);	0.130700	0.52532	D	0.000065	T	0.49847	0.1581	M	0.73319	2.225	0.80722	D	1	D;P	0.60160	0.987;0.953	P;D	0.64877	0.905;0.93	T	0.54275	-0.8318	10	0.87932	D	0	.	17.0941	0.86630	0.0:0.0:1.0:0.0	.	239;239	Q2VPS2;P61266	.;STX1B_HUMAN	Y	239	ENSP00000215095:S239Y	ENSP00000215095:S239Y	S	-	2	0	STX1B	30912022	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.476000	0.97823	2.309000	0.77851	0.561000	0.74099	TCT		0.602	STX1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255521.2		
ZNF423	23090	hgsc.bcm.edu	37	16	49764733	49764733	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:49764733A>C	ENST00000561648.1	-	3	279	c.226T>G	c.(226-228)Ttc>Gtc	p.F76V	ZNF423_ENST00000563137.2_Missense_Mutation_p.F16V|ZNF423_ENST00000262383.2_Missense_Mutation_p.F76V|ZNF423_ENST00000562871.1_Missense_Mutation_p.F16V|ZNF423_ENST00000562520.1_Missense_Mutation_p.F16V	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	76					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F76V(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				AGAGACTCGAAGTCCTGCTGA	0.527																																					p.F76V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T226G	16						.						291.0	234.0	253.0					16																	49764733		2198	4300	6498	48322234	SO:0001583	missense	23090	exon4			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.226T>G	16.37:g.49764733A>C	ENSP00000455426:p.Phe76Val	Somatic		Capture	SOLID	Phase_I	48322234	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727711	0.89390	.	.	ENSG00000102935	ENST00000262383	T	0.80304	-1.36	5.15	5.15	0.70609	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000001	D	0.83524	0.5273	L	0.29908	0.895	0.46874	D	0.999239	D	0.76494	0.999	D	0.83275	0.996	T	0.82772	-0.0292	9	.	.	.	.	15.2745	0.73732	1.0:0.0:0.0:0.0	.	76	Q2M1K9	ZN423_HUMAN	V	76	ENSP00000262383:F76V	.	F	-	1	0	ZNF423	48322234	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.892000	0.87324	2.069000	0.61940	0.260000	0.18958	TTC		0.527	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
PPL	5493	hgsc.bcm.edu	37	16	4935679	4935679	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:4935679C>T	ENST00000345988.2	-	22	3066	c.2977G>A	c.(2977-2979)Gtg>Atg	p.V993M	PPL_ENST00000590782.2_Missense_Mutation_p.V991M	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	993					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.V993M(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCCTTGACCACGTACTCCTGC	0.672																																					p.V993M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2977A	16						.						89.0	90.0	90.0					16																	4935679		2197	4300	6497	4875680	SO:0001583	missense	5493	exon22			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2977G>A	16.37:g.4935679C>T	ENSP00000340510:p.Val993Met	Somatic		Capture	SOLID	Phase_I	4875680	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744013	0.30865	.	.	ENSG00000118898	ENST00000345988	T	0.54866	0.55	4.89	2.94	0.34122	.	0.328596	0.28895	N	0.013793	T	0.47192	0.1432	L	0.51422	1.61	0.22719	N	0.998815	D	0.53462	0.96	P	0.45506	0.483	T	0.40327	-0.9569	10	0.59425	D	0.04	.	8.032	0.30470	0.0:0.6602:0.0:0.3398	.	993	O60437	PEPL_HUMAN	M	993	ENSP00000340510:V993M	ENSP00000340510:V993M	V	-	1	0	PPL	4875680	0.050000	0.20438	0.905000	0.35620	0.060000	0.15804	0.855000	0.27805	0.492000	0.27815	0.484000	0.47621	GTG		0.672	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
NAGPA	51172	hgsc.bcm.edu	37	16	5080405	5080405	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:5080405C>T	ENST00000312251.3	-	4	791	c.772G>A	c.(772-774)Ggc>Agc	p.G258S	NAGPA_ENST00000381955.3_Missense_Mutation_p.G258S|NAGPA_ENST00000564922.1_5'Flank|RP11-165E7.1_ENST00000588778.1_RNA	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	258					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)	p.G258S(1)		endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	TCCGTTTGGCCGTCTGCATGA	0.587																																					p.G258S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G772A	16						.						35.0	28.0	30.0					16																	5080405		2173	4234	6407	5020406	SO:0001583	missense	51172	exon4			AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.772G>A	16.37:g.5080405C>T	ENSP00000310998:p.Gly258Ser	Somatic		Capture	SOLID	Phase_I	5020406	NM_016256	B2RAS1|Q96EJ8	Missense_Mutation	SNP	ENST00000312251.3	37	CCDS10527.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565075	0.86439	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.61742	0.08;0.28	5.09	5.09	0.68999	.	0.113791	0.64402	D	0.000013	D	0.82765	0.5108	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87766	0.2602	10	0.87932	D	0	-28.8716	18.4939	0.90856	0.0:1.0:0.0:0.0	.	258;258	Q9UK23;Q9UK23-2	NAGPA_HUMAN;.	S	258	ENSP00000310998:G258S;ENSP00000371381:G258S	ENSP00000310998:G258S	G	-	1	0	NAGPA	5020406	1.000000	0.71417	0.943000	0.38184	0.397000	0.30659	7.604000	0.82830	2.380000	0.81148	0.561000	0.74099	GGC		0.587	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256	
HEATR3	55027	hgsc.bcm.edu	37	16	50134200	50134200	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:50134200C>T	ENST00000299192.7	+	13	1850	c.1659C>T	c.(1657-1659)gtC>gtT	p.V553V	HEATR3_ENST00000285767.4_Silent_p.V467V|RP11-429P3.5_ENST00000566770.1_RNA|RNY4P3_ENST00000365254.1_RNA	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	553								p.V553V(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						GTAGTAATGTCGGGGTTAGAG	0.388																																					p.V553V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1659T	16						.						128.0	114.0	119.0					16																	50134200		2198	4300	6498	48691701	SO:0001819	synonymous_variant	55027	exon13			BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1659C>T	16.37:g.50134200C>T		Somatic		Capture	SOLID	Phase_I	48691701	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Silent	SNP	ENST00000299192.7	37	CCDS10739.1																																																																																				0.388	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
KATNB1	10300	hgsc.bcm.edu	37	16	57778419	57778419	+	Silent	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:57778419C>A	ENST00000379661.3	+	4	677	c.285C>A	c.(283-285)gcC>gcA	p.A95A		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1									p.A95A(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				TGGAAGCTGCCAAAAGTAGGC	0.617																																					p.A95A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C285A	16						.						90.0	87.0	88.0					16																	57778419		2198	4300	6498	56335920	SO:0001819	synonymous_variant	10300	exon4			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.285C>A	16.37:g.57778419C>A		Somatic		Capture	SOLID	Phase_I	56335920	NM_005886		Silent	SNP	ENST00000379661.3	37	CCDS10788.1																																																																																				0.617	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257343.3		
RRAD	6236	hgsc.bcm.edu	37	16	66956063	66956063	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:66956063G>T	ENST00000299759.6	-	5	1093	c.843C>A	c.(841-843)ttC>ttA	p.F281L	RRAD_ENST00000420652.1_Missense_Mutation_p.F281L			P55042	RAD_HUMAN	Ras-related associated with diabetes	281	Calmodulin-binding.				small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		TGCGGCCCAAGAAGCGCTTCG	0.622																																					p.F281L												.	.	0			c.C843A	16						.						89.0	72.0	78.0					16																	66956063		2200	4300	6500	65513564	SO:0001583	missense	6236	exon5			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.843C>A	16.37:g.66956063G>T	ENSP00000299759:p.Phe281Leu	Somatic		Capture	SOLID	Phase_I	65513564	NM_004165	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735199	0.69189	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.66638	-0.22;-0.22	5.93	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.75057	0.3798	L	0.46885	1.475	0.58432	D	0.999997	D	0.71674	0.998	D	0.73380	0.98	T	0.76110	-0.3079	10	0.54805	T	0.06	.	12.2611	0.54651	0.1422:0.0:0.8578:0.0	.	281	P55042	RAD_HUMAN	L	281	ENSP00000388744:F281L;ENSP00000299759:F281L	ENSP00000299759:F281L	F	-	3	2	RRAD	65513564	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.961000	0.49168	1.478000	0.48253	0.561000	0.74099	TTC		0.622	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268830.1	NM_004165	
CTCF	10664	hgsc.bcm.edu	37	16	67662412	67662412	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:67662412C>T	ENST00000264010.4	+	9	2102	c.1658C>T	c.(1657-1659)gCg>gTg	p.A553V	CTCF_ENST00000401394.1_Missense_Mutation_p.A225V	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	553					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A553V(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TTCGTCCCTGCGGCTTTTGTC	0.488																																					p.A225V	Colon(175;1200 1966 6945 23069 27405)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C674T	16						.						220.0	196.0	204.0					16																	67662412		2198	4300	6498	66219913	SO:0001583	missense	10664	exon7			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1658C>T	16.37:g.67662412C>T	ENSP00000264010:p.Ala553Val	Somatic		Capture	SOLID	Phase_I	66219913	NM_001191022	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	37	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201580	0.79015	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	T;T	0.08896	3.04;3.12	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000002	T	0.06462	0.0166	N	0.17674	0.51	0.80722	D	1	P;P	0.38711	0.602;0.643	B;B	0.24974	0.053;0.057	T	0.32079	-0.9920	10	0.56958	D	0.05	-2.9111	19.488	0.95037	0.0:1.0:0.0:0.0	.	225;553	B5MC38;P49711	.;CTCF_HUMAN	V	553;225	ENSP00000264010:A553V;ENSP00000384707:A225V	ENSP00000264010:A553V	A	+	2	0	CTCF	66219913	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	7.794000	0.85869	2.702000	0.92279	0.462000	0.41574	GCG		0.488	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
SF3B3	23450	hgsc.bcm.edu	37	16	70595628	70595628	+	Silent	SNP	G	G	A	rs531078470		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:70595628G>A	ENST00000302516.5	+	17	2440	c.2229G>A	c.(2227-2229)tcG>tcA	p.S743S		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	743					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.S743S(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				AATTTGCATCGGGTTTTGCCT	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20755	0.0		0.0	False		,,,				2504	0.0				p.S743S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2229A	16						.						153.0	126.0	135.0					16																	70595628		2198	4300	6498	69153129	SO:0001819	synonymous_variant	23450	exon17			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2229G>A	16.37:g.70595628G>A		Somatic		Capture	SOLID	Phase_I	69153129	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	ENST00000302516.5	37	CCDS10894.1																																																																																				0.522	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
HYDIN	54768	hgsc.bcm.edu	37	16	71149659	71149659	+	Missense_Mutation	SNP	C	C	T	rs552008331		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:71149659C>T	ENST00000393567.2	-	10	1417	c.1267G>A	c.(1267-1269)Gtg>Atg	p.V423M	HYDIN_ENST00000448691.1_Missense_Mutation_p.V423M|RP11-23E19.2_ENST00000567556.1_RNA|HYDIN_ENST00000321489.5_Missense_Mutation_p.V423M|HYDIN_ENST00000448089.2_Missense_Mutation_p.V423M|HYDIN_ENST00000393550.2_Missense_Mutation_p.V423M|HYDIN_ENST00000541601.1_Missense_Mutation_p.V440M|HYDIN_ENST00000538248.1_Missense_Mutation_p.V450M|HYDIN_ENST00000288168.10_Missense_Mutation_p.V440M	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	423					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.V423M(3)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TTAAAGTACACGGTGATTTCA	0.413																																					p.V423M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G1267A	16						.						39.0	36.0	37.0					16																	71149659		2196	4277	6473	69707160	SO:0001583	missense	54768	exon10			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.1267G>A	16.37:g.71149659C>T	ENSP00000377197:p.Val423Met	Somatic		Capture	SOLID	Phase_I	69707160	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620109	0.66787	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601;ENST00000288168;ENST00000393550	T;T;T;T;T;T;T;T	0.22134	4.86;3.19;3.22;3.22;3.24;3.22;2.81;1.97	4.76	4.76	0.60689	.	0.000000	0.28641	U	0.014625	T	0.52533	0.1740	M	0.84585	2.705	0.39232	D	0.9637	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.80764	0.994;0.994;0.992;0.994;0.992	T	0.63659	-0.6587	10	0.72032	D	0.01	.	18.2065	0.89857	0.0:1.0:0.0:0.0	.	450;440;440;423;423	B4DRN4;F5H6V3;F8WD03;Q4G0P3-5;F8WD23	.;.;.;.;.	M	423;423;423;423;423;450;440;440;423	ENSP00000377197:V423M;ENSP00000398544:V423M;ENSP00000394826:V423M;ENSP00000314736:V423M;ENSP00000444970:V450M;ENSP00000437341:V440M;ENSP00000288168:V440M;ENSP00000377181:V423M	ENSP00000288168:V440M	V	-	1	0	HYDIN	69707160	1.000000	0.71417	0.997000	0.53966	0.860000	0.49131	4.114000	0.57858	2.372000	0.80975	0.505000	0.49811	GTG		0.413	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
MARVELD3	91862	hgsc.bcm.edu	37	16	71674493	71674493	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:71674493C>A	ENST00000299952.4	+	3	839	c.796C>A	c.(796-798)Ctg>Atg	p.L266M	MARVELD3_ENST00000561682.1_Intron|PHLPP2_ENST00000540628.1_3'UTR|MARVELD3_ENST00000565261.1_3'UTR	NM_001017967.3|NM_001271329.1	NP_001017967.2|NP_001258258.1	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	269	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)		p.L266M(1)		NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				CCGCTCGCCCCTGATATACGG	0.577																																					p.L266M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C796A	16						.						67.0	55.0	59.0					16																	71674493		2198	4300	6498	70231994	SO:0001583	missense	91862	exon3			BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000299952.4:c.796C>A	16.37:g.71674493C>A	ENSP00000299952:p.Leu266Met	Somatic		Capture	SOLID	Phase_I	70231994	NM_001017967	A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	ENST00000299952.4	37	CCDS32478.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109635	0.37242	.	.	ENSG00000140832	ENST00000299952	D	0.87029	-2.2	5.79	5.79	0.91817	.	0.479470	0.22922	N	0.054004	D	0.92925	0.7749	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.91341	0.5097	9	0.34782	T	0.22	-9.4506	17.535	0.87827	0.0:1.0:0.0:0.0	.	266	Q96A59-2	.	M	266	ENSP00000299952:L266M	ENSP00000299952:L266M	L	+	1	2	MARVELD3	70231994	0.988000	0.35896	0.990000	0.47175	0.074000	0.17049	2.514000	0.45503	2.739000	0.93911	0.655000	0.94253	CTG		0.577	MARVELD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268990.1	NM_052858	
PHLPP2	23035	hgsc.bcm.edu	37	16	71683801	71683801	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:71683801C>A	ENST00000568954.1	-	19	3342	c.2964G>T	c.(2962-2964)tgG>tgT	p.W988C	PHLPP2_ENST00000567016.1_Missense_Mutation_p.W1023C|PHLPP2_ENST00000540628.1_Intron|PHLPP2_ENST00000393524.2_Missense_Mutation_p.W921C|PHLPP2_ENST00000360429.3_Intron|PHLPP2_ENST00000356272.3_Missense_Mutation_p.W988C			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	988	PP2C-like.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.W988C(1)		central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						ACAAGTGTTCCCACAATGCTT	0.493																																					p.W988C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2964T	16						.						199.0	167.0	178.0					16																	71683801		2198	4300	6498	70241302	SO:0001583	missense	23035	exon18			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.2964G>T	16.37:g.71683801C>A	ENSP00000457991:p.Trp988Cys	Somatic		Capture	SOLID	Phase_I	70241302	NM_015020	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	ENST00000568954.1	37	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717568	0.48622	.	.	ENSG00000040199	ENST00000356272;ENST00000393524	T;T	0.32988	1.43;1.43	5.62	5.62	0.85841	Protein phosphatase 2C-like (4);	0.111967	0.64402	D	0.000004	T	0.67878	0.2940	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71656	0.969;0.974	T	0.77523	-0.2556	10	0.87932	D	0	-9.1673	18.6782	0.91537	0.0:1.0:0.0:0.0	.	921;988	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	C	988;921	ENSP00000348611:W988C;ENSP00000377159:W921C	ENSP00000348611:W988C	W	-	3	0	PHLPP2	70241302	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.385000	0.44371	2.648000	0.89879	0.650000	0.86243	TGG		0.493	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020	
ZNF821	55565	hgsc.bcm.edu	37	16	71894501	71894501	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:71894501C>G	ENST00000565601.1	-	7	1066	c.659G>C	c.(658-660)gGg>gCg	p.G220A	ZNF821_ENST00000564134.1_3'UTR|ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000313565.6_Missense_Mutation_p.G178A|ZNF821_ENST00000425432.1_Missense_Mutation_p.G220A|ZNF821_ENST00000446827.2_Missense_Mutation_p.G178A	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G178A(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						AATATCCTTCCCCTCAGCACT	0.493																																					p.G178A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G533C	16						.						103.0	95.0	97.0					16																	71894501		2198	4300	6498	70452002	SO:0001583	missense	55565	exon6			AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.659G>C	16.37:g.71894501C>G	ENSP00000455648:p.Gly220Ala	Somatic		Capture	SOLID	Phase_I	70452002	NM_017530	A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	ENST00000565601.1	37	CCDS56006.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.294900	0.23564	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.01388	6.55;4.95;4.95	5.77	5.77	0.91146	.	0.255390	0.39475	N	0.001345	T	0.01489	0.0048	N	0.22421	0.69	0.46823	D	0.999218	B;B;B	0.29378	0.243;0.143;0.243	B;B;B	0.29176	0.097;0.099;0.097	T	0.68284	-0.5449	10	0.35671	T	0.21	-19.1214	12.7004	0.57029	0.0:0.8826:0.0:0.1174	.	220;178;220	B4DKK4;O75541-2;O75541	.;.;ZN821_HUMAN	A	220;178;178	ENSP00000398089:G220A;ENSP00000313822:G178A;ENSP00000405908:G178A	ENSP00000313822:G178A	G	-	2	0	ZNF821	70452002	0.958000	0.32768	0.997000	0.53966	0.352000	0.29268	2.100000	0.41777	2.723000	0.93209	0.655000	0.94253	GGG		0.493	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434180.1	NM_017530	
TXNL4B	54957	hgsc.bcm.edu	37	16	72124602	72124602	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:72124602T>G	ENST00000268483.3	-	2	368	c.47A>C	c.(46-48)cAg>cCg	p.Q16P	TXNL4B_ENST00000426362.2_Missense_Mutation_p.Q16P|TXNL4B_ENST00000423037.1_Missense_Mutation_p.Q16P|DHX38_ENST00000268482.3_5'Flank	NM_001142318.1|NM_017853.2	NP_001135790.1|NP_060323.1	Q9NX01	TXN4B_HUMAN	thioredoxin-like 4B	16					mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)		p.Q16P(1)		cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)	8						TTTTATCGCCTGGTCTACTTC	0.428																																					p.Q16P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A47C	16						.						201.0	171.0	181.0					16																	72124602		2198	4300	6498	70682103	SO:0001583	missense	54957	exon2			BC009646	CCDS10906.1	16q22.2	2012-11-19			ENSG00000140830	ENSG00000140830			26041	protein-coding gene	gene with protein product						15161931	Standard	NM_017853		Approved	FLJ20511, DLP, Dim2	uc010vmn.2	Q9NX01	OTTHUMG00000173453	ENST00000268483.3:c.47A>C	16.37:g.72124602T>G	ENSP00000268483:p.Gln16Pro	Somatic		Capture	SOLID	Phase_I	70682103	NM_001142317	D3DWS6	Missense_Mutation	SNP	ENST00000268483.3	37	CCDS10906.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.358759	0.61403	.	.	ENSG00000140830	ENST00000268483;ENST00000426362;ENST00000423037	.	.	.	5.66	5.66	0.87406	Thioredoxin-like fold (2);	0.167973	0.52532	D	0.000067	T	0.63236	0.2494	M	0.69358	2.11	0.58432	D	0.999993	B	0.31174	0.311	B	0.33620	0.167	T	0.66168	-0.5991	9	0.72032	D	0.01	.	13.8503	0.63492	0.0:0.0:0.0:1.0	.	16	Q9NX01	TXN4B_HUMAN	P	16	.	ENSP00000268483:Q16P	Q	-	2	0	TXNL4B	70682103	1.000000	0.71417	0.966000	0.40874	0.992000	0.81027	4.850000	0.62889	2.140000	0.66376	0.533000	0.62120	CAG		0.428	TXNL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269007.2	NM_017853	
ZFHX3	463	hgsc.bcm.edu	37	16	72821255	72821255	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:72821255C>T	ENST00000268489.5	-	10	11592	c.10920G>A	c.(10918-10920)acG>acA	p.T3640T	RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Silent_p.T2726T|AC004943.1_ENST00000584072.1_RNA|RP5-991G20.1_ENST00000563328.2_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3640					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.T3640T(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TTGAGGTAACCGTTGAAGATG	0.592																																					p.T3640T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G10920A	16						.						55.0	53.0	54.0					16																	72821255		2198	4300	6498	71378756	SO:0001819	synonymous_variant	463	exon10			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10920G>A	16.37:g.72821255C>T		Somatic		Capture	SOLID	Phase_I	71378756	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																				0.592	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
USP7	7874	hgsc.bcm.edu	37	16	8998407	8998407	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:8998407G>A	ENST00000344836.4	-	15	1787	c.1589C>T	c.(1588-1590)gCg>gTg	p.A530V	USP7_ENST00000381886.4_Missense_Mutation_p.A514V|USP7_ENST00000535863.1_Missense_Mutation_p.A431V	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	530					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.A530V(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						GTCGGTGACCGCCTGTAAAAC	0.502																																					p.A530V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1589T	16						.						94.0	82.0	86.0					16																	8998407		2197	4300	6497	8905908	SO:0001583	missense	7874	exon15			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.1589C>T	16.37:g.8998407G>A	ENSP00000343535:p.Ala530Val	Somatic		Capture	SOLID	Phase_I	8905908	NM_003470	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698401	0.68386	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549	T;T	0.05786	3.39;3.39	5.2	5.2	0.72013	.	0.100266	0.64402	D	0.000002	T	0.05686	0.0149	N	0.14661	0.345	0.48830	D	0.999716	B;B	0.18310	0.015;0.027	B;B	0.09377	0.004;0.003	T	0.44574	-0.9319	10	0.39692	T	0.17	.	18.7258	0.91713	0.0:0.0:1.0:0.0	.	530;514	Q93009;B7Z815	UBP7_HUMAN;.	V	530;538;431;431	ENSP00000343535:A530V;ENSP00000443646:A431V	ENSP00000343535:A530V	A	-	2	0	USP7	8905908	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.949000	0.87791	2.423000	0.82170	0.455000	0.32223	GCG		0.502	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
MYH11	4629	hgsc.bcm.edu	37	16	15820795	15820797	+	In_Frame_Del	DEL	CTT	CTT	-	rs149241435		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	CTT	CTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:15820795_15820797delCTT	ENST00000300036.5	-	28	3875_3877	c.3766_3768delAAG	c.(3766-3768)aagdel	p.K1256del	MYH11_ENST00000396324.3_In_Frame_Del_p.K1263del|MYH11_ENST00000452625.2_In_Frame_Del_p.K1263del|AF001548.5_ENST00000574212.1_RNA|MYH11_ENST00000576790.2_In_Frame_Del_p.K1256del	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1256			Missing (in AAT4). {ECO:0000269|PubMed:16444274}.		axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.K1256delK(1)|p.K1263delK(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GCGCCTCCAGCTTCTTCTTCTTA	0.611			T	CBFB	AML																																p.1263_1263del			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	2	Deletion - In frame(2)	large_intestine(2)	c.3787_3789del	16						.																																			15728298	SO:0001651	inframe_deletion	4629	exon29			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.3766_3768delAAG	16.37:g.15820804_15820806delCTT	ENSP00000300036:p.Lys1256del	Somatic		Capture	SOLID	Phase_I	15728296	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	In_Frame_Del	DEL	ENST00000300036.5	37	CCDS10565.1																																																																																				0.611	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
ADAMTS18	170692	hgsc.bcm.edu	37	16	77465438	77465438	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr16:77465438G>A	ENST00000282849.5	-	3	667	c.249C>T	c.(247-249)aaC>aaT	p.N83N	RP11-449J10.1_ENST00000564358.1_RNA|ADAMTS18_ENST00000567121.1_5'UTR	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	83					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N83N(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TTTTCCTGCCGTTGTGCAAAA	0.493																																					p.N83N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C249T	16						.						202.0	209.0	207.0					16																	77465438		2198	4300	6498	76022939	SO:0001819	synonymous_variant	170692	exon3			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.249C>T	16.37:g.77465438G>A		Somatic		Capture	SOLID	Phase_I	76022939	NM_199355	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																				0.493	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
LAMA1	284217	hgsc.bcm.edu	37	18	7026007	7026007	+	Silent	SNP	G	G	A	rs536633386	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr18:7026007G>A	ENST00000389658.3	-	17	2466	c.2373C>T	c.(2371-2373)tgC>tgT	p.C791C		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	791	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.C791C(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GAGGGCAGGCGCAGGGCTGGC	0.632													G|||	2	0.000399361	0.0	0.0	5008	,	,		16421	0.0		0.0	False		,,,				2504	0.002				p.C791C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2373T	18						.						49.0	39.0	42.0					18																	7026007		2203	4300	6503	7016007	SO:0001819	synonymous_variant	284217	exon17			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2373C>T	18.37:g.7026007G>A		Somatic		Capture	SOLID	Phase_I	7016007	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.632	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ROCK1	6093	hgsc.bcm.edu	37	18	18547809	18547809	+	Missense_Mutation	SNP	C	C	A	rs568092015		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr18:18547809C>A	ENST00000399799.2	-	26	4036	c.3096G>T	c.(3094-3096)aaG>aaT	p.K1032N		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	1032					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K1032N(2)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TTCGATTTTCCTTTTCTTTCT	0.333																																					p.K1032N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3096T	18						.						181.0	180.0	180.0					18																	18547809		2203	4300	6503	16801807	SO:0001583	missense	6093	exon26				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.3096G>T	18.37:g.18547809C>A	ENSP00000382697:p.Lys1032Asn	Somatic		Capture	SOLID	Phase_I	16801807	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967062	0.74131	.	.	ENSG00000067900	ENST00000399799	T	0.14022	2.54	5.29	3.52	0.40303	.	0.000000	0.85682	D	0.000000	T	0.36386	0.0965	M	0.83384	2.64	0.58432	D	0.999995	D	0.89917	1.0	D	0.79108	0.992	T	0.08513	-1.0718	10	0.66056	D	0.02	.	8.9358	0.35700	0.0:0.7747:0.0:0.2253	.	1032	Q13464	ROCK1_HUMAN	N	1032	ENSP00000382697:K1032N	ENSP00000382697:K1032N	K	-	3	2	ROCK1	16801807	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.593000	0.36686	0.625000	0.30304	0.585000	0.79938	AAG		0.333	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
ATP9B	374868	hgsc.bcm.edu	37	18	77119425	77119425	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr18:77119425C>T	ENST00000426216.2	+	26	2992	c.2975C>T	c.(2974-2976)gCg>gTg	p.A992V	ATP9B_ENST00000543761.1_Missense_Mutation_p.A313V|ATP9B_ENST00000307671.7_Missense_Mutation_p.A992V	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	992					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.A992V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CCAGAGATGGCGATGCTCTAC	0.552																																					p.A992V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2975T	18						.						158.0	113.0	128.0					18																	77119425		2203	4300	6503	75220413	SO:0001583	missense	374868	exon26			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.2975C>T	18.37:g.77119425C>T	ENSP00000398076:p.Ala992Val	Somatic		Capture	SOLID	Phase_I	75220413	NM_198531	O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	ENST00000426216.2	37	CCDS12014.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405070	0.83230	.	.	ENSG00000166377	ENST00000426216;ENST00000359184;ENST00000307671;ENST00000543761	D;D;T	0.88354	-2.37;-2.37;-0.26	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.89525	0.6740	L	0.28504	0.86	0.80722	D	1	B;D;D	0.63046	0.255;0.986;0.992	B;P;P	0.58331	0.064;0.691;0.837	D	0.89947	0.4077	10	0.46703	T	0.11	.	17.1085	0.86669	0.0:1.0:0.0:0.0	.	313;992;992	F5H8J1;O43861;O43861-2	.;ATP9B_HUMAN;.	V	992;48;992;313	ENSP00000398076:A992V;ENSP00000304500:A992V;ENSP00000442015:A313V	ENSP00000304500:A992V	A	+	2	0	ATP9B	75220413	1.000000	0.71417	0.783000	0.31826	0.530000	0.34684	7.116000	0.77119	2.367000	0.80283	0.591000	0.81541	GCG		0.552	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
PTPRM	5797	hgsc.bcm.edu	37	18	8244097	8244097	+	Missense_Mutation	SNP	G	G	T	rs371291461		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr18:8244097G>T	ENST00000332175.8	+	15	3379	c.2342G>T	c.(2341-2343)cGa>cTa	p.R781L	PTPRM_ENST00000400053.4_Missense_Mutation_p.R719L|PTPRM_ENST00000444013.1_Missense_Mutation_p.R568L|PTPRM_ENST00000580170.1_Missense_Mutation_p.R781L|PTPRM_ENST00000400060.4_Missense_Mutation_p.R781L	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	781					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R781L(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AGCAGCACCCGACAGGAGATG	0.483																																					p.R781L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2342T	18						.						130.0	127.0	128.0					18																	8244097		2203	4300	6503	8234097	SO:0001583	missense	5797	exon15			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2342G>T	18.37:g.8244097G>T	ENSP00000331418:p.Arg781Leu	Somatic		Capture	SOLID	Phase_I	8234097	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	G	35	5.434672	0.96150	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.50001	1.09;1.1;0.9;0.76	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.70727	0.3257	M	0.76574	2.34	0.80722	D	1	P;D;D	0.63880	0.912;0.993;0.993	P;D;D	0.74023	0.621;0.982;0.982	T	0.70718	-0.4795	10	0.56958	D	0.05	.	20.1178	0.97943	0.0:0.0:1.0:0.0	.	568;781;781	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	L	781;781;719;568	ENSP00000331418:R781L;ENSP00000382933:R781L;ENSP00000382927:R719L;ENSP00000387608:R568L	ENSP00000331418:R781L	R	+	2	0	PTPRM	8234097	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.759000	0.94783	0.557000	0.71058	CGA		0.483	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PTPRM	5797	hgsc.bcm.edu	37	18	8253338	8253338	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr18:8253338C>T	ENST00000332175.8	+	17	3678	c.2641C>T	c.(2641-2643)Cgg>Tgg	p.R881W	PTPRM_ENST00000400053.4_Missense_Mutation_p.R819W|PTPRM_ENST00000444013.1_Missense_Mutation_p.R668W|PTPRM_ENST00000580170.1_Missense_Mutation_p.R894W|PTPRM_ENST00000400060.4_Missense_Mutation_p.R895W	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	881					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R881W(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CCCCGCCATCCGGGTGGCAGA	0.602																																					p.R881W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2641T	18						.						41.0	32.0	35.0					18																	8253338		2203	4300	6503	8243338	SO:0001583	missense	5797	exon17			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2641C>T	18.37:g.8253338C>T	ENSP00000331418:p.Arg881Trp	Somatic		Capture	SOLID	Phase_I	8243338	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.714460	0.68730	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.52295	0.99;1.02;0.82;0.67	6.04	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.70107	0.3186	M	0.81802	2.56	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.982;0.982	T	0.75036	-0.3459	10	0.72032	D	0.01	.	15.7607	0.78076	0.2493:0.7507:0.0:0.0	.	668;894;881	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	W	881;895;819;668	ENSP00000331418:R881W;ENSP00000382933:R895W;ENSP00000382927:R819W;ENSP00000387608:R668W	ENSP00000331418:R881W	R	+	1	2	PTPRM	8243338	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.856000	0.55964	0.869000	0.35703	-0.310000	0.09108	CGG		0.602	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PQLC1	80148	hgsc.bcm.edu	37	18	77703384	77703384	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr18:77703384C>T	ENST00000397778.2	-	3	464	c.282G>A	c.(280-282)ctG>ctA	p.L94L	PQLC1_ENST00000357575.4_Silent_p.L94L|PQLC1_ENST00000409073.1_Silent_p.L11L|PQLC1_ENST00000590381.1_Silent_p.L94L	NM_025078.4	NP_079354.2	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	94						integral component of membrane (GO:0016021)		p.L94L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	9		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		CCTCGGTGCACAGCTTCAGCA	0.612																																					p.L94L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G282A	18						.						127.0	114.0	119.0					18																	77703384		2203	4300	6503	75804372	SO:0001819	synonymous_variant	80148	exon3			AK123870	CCDS12020.1, CCDS54192.1, CCDS54193.1	18q23	2004-01-14			ENSG00000122490	ENSG00000122490			26188	protein-coding gene	gene with protein product						12477932	Standard	NM_025078		Approved	FLJ22378	uc002lnl.2	Q8N2U9	OTTHUMG00000132921	ENST00000397778.2:c.282G>A	18.37:g.77703384C>T		Somatic		Capture	SOLID	Phase_I	75804372	NM_001146345	B7Z7D9|G5E989|Q9H6D0	Silent	SNP	ENST00000397778.2	37	CCDS12020.1																																																																																				0.612	PQLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256434.1	NM_025078	
SLC6A11	6538	hgsc.bcm.edu	37	3	10886015	10886015	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:10886015C>T	ENST00000254488.2	+	5	806	c.740C>T	c.(739-741)aCc>aTc	p.T247I		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	247					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)	p.T247I(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	TGGAAGGGGACCAAGTCTACA	0.537																																					p.T247I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C740T	3						.						123.0	107.0	113.0					3																	10886015		2203	4300	6503	10861015	SO:0001583	missense	6538	exon5			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.740C>T	3.37:g.10886015C>T	ENSP00000254488:p.Thr247Ile	Somatic		Capture	SOLID	Phase_I	10861015	NM_014229	B2R6U6|Q8IYC9	Missense_Mutation	SNP	ENST00000254488.2	37	CCDS2602.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.406898	0.42715	.	.	ENSG00000132164	ENST00000254488	T	0.69685	-0.42	5.83	5.83	0.93111	.	0.050740	0.85682	D	0.000000	T	0.33847	0.0877	N	0.00453	-1.485	0.80722	D	1	B	0.10296	0.003	B	0.14023	0.01	T	0.37820	-0.9689	10	0.39692	T	0.17	.	13.0134	0.58743	0.0:0.9258:0.0:0.0742	.	247	P48066	S6A11_HUMAN	I	247	ENSP00000254488:T247I	ENSP00000254488:T247I	T	+	2	0	SLC6A11	10861015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.811000	0.55620	2.749000	0.94314	0.650000	0.86243	ACC		0.537	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
CBLB	868	hgsc.bcm.edu	37	3	105412384	105412384	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:105412384G>A	ENST00000264122.4	-	13	2329	c.2008C>T	c.(2008-2010)Cgg>Tgg	p.R670W	CBLB_ENST00000403724.1_Missense_Mutation_p.R670W|CBLB_ENST00000405772.1_Missense_Mutation_p.R670W|CBLB_ENST00000394027.3_Missense_Mutation_p.R692W	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	670	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R670W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GGAGAAAGCCGGGGAGGAACA	0.413			Mis S		AML																																p.R670W	GBM(93;588 1337 9788 29341 43499)		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2008T	3						.						133.0	128.0	130.0					3																	105412384		2203	4299	6502	106895074	SO:0001583	missense	868	exon13			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.2008C>T	3.37:g.105412384G>A	ENSP00000264122:p.Arg670Trp	Somatic		Capture	SOLID	Phase_I	106895074	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903530	0.92035	.	.	ENSG00000114423	ENST00000394030;ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	T;D;D;D;D	0.84800	-1.25;-1.86;-1.88;-1.9;-1.89	5.45	5.45	0.79879	.	0.382757	0.26387	N	0.024680	D	0.90473	0.7016	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	0.999;0.998;1.0	P;P;P	0.59546	0.853;0.859;0.828	D	0.91226	0.5010	10	0.87932	D	0	-11.9049	19.2751	0.94029	0.0:0.0:1.0:0.0	.	692;670;670	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	W	53;670;692;670;670	ENSP00000377598:R53W;ENSP00000264122:R670W;ENSP00000377595:R692W;ENSP00000384816:R670W;ENSP00000384938:R670W	ENSP00000264122:R670W	R	-	1	2	CBLB	106895074	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.454000	0.66651	2.563000	0.86464	0.591000	0.81541	CGG		0.413	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
DZIP3	9666	hgsc.bcm.edu	37	3	108363342	108363342	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:108363342G>A	ENST00000361582.3	+	14	1703	c.1473G>A	c.(1471-1473)ccG>ccA	p.P491P	DZIP3_ENST00000463306.1_Silent_p.P491P	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	491					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P491P(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ATATGGAACCGCCATCTTCTG	0.413																																					p.P491P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1473A	3						.						123.0	121.0	122.0					3																	108363342		2203	4300	6503	109846032	SO:0001819	synonymous_variant	9666	exon14			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1473G>A	3.37:g.108363342G>A		Somatic		Capture	SOLID	Phase_I	109846032	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Silent	SNP	ENST00000361582.3	37	CCDS2952.1																																																																																				0.413	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
TAMM41	132001	hgsc.bcm.edu	37	3	11888097	11888097	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:11888097G>A	ENST00000444133.2	-	1	156	c.14C>T	c.(13-15)aCg>aTg	p.T5M	TAMM41_ENST00000273037.5_Missense_Mutation_p.T5M|TAMM41_ENST00000455809.1_Missense_Mutation_p.T5M			Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)	5					cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)	p.T5M(1)									GCTCTGCAGCGTCTGCAGCGC	0.652											OREG0015397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T5M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C14T	3						.						73.0	68.0	69.0					3																	11888097		2203	4300	6503	11863097	SO:0001583	missense	132001	exon1				CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000444133.2:c.14C>T	3.37:g.11888097G>A	ENSP00000388598:p.Thr5Met	Somatic	675	Capture	SOLID	Phase_I	11863097	NM_138807	B4DIY7|C9J2U4	Missense_Mutation	SNP	ENST00000444133.2	37		.	.	.	.	.	.	.	.	.	.	G	16.49	3.137984	0.56936	.	.	ENSG00000144559	ENST00000455809;ENST00000273037;ENST00000444133	T;T;T	0.34072	1.51;1.51;1.38	4.71	3.81	0.43845	.	0.544964	0.19260	N	0.118701	T	0.24470	0.0593	N	0.14661	0.345	0.09310	N	0.999992	D;P;P	0.61697	0.99;0.581;0.521	P;B;B	0.45099	0.469;0.169;0.128	T	0.05733	-1.0867	10	0.59425	D	0.04	-8.8366	9.7941	0.40724	0.0:0.0:0.7946:0.2054	.	5;5;5	B4DIY7;C9J2U4;Q96BW9	.;.;TAM41_HUMAN	M	5	ENSP00000398596:T5M;ENSP00000273037:T5M;ENSP00000388598:T5M	ENSP00000273037:T5M	T	-	2	0	TAMM41	11863097	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	2.421000	0.44688	1.149000	0.42402	0.467000	0.42956	ACG		0.652	TAMM41-008	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000339258.2	NM_138807	
ZDHHC23	254887	hgsc.bcm.edu	37	3	113677268	113677268	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:113677268T>C	ENST00000330212.3	+	5	1398	c.1099T>C	c.(1099-1101)Tac>Cac	p.Y367H	ZDHHC23_ENST00000498275.1_Missense_Mutation_p.Y361H|ZDHHC23_ENST00000488129.1_3'UTR	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	367					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.Y367H(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						AGGCATGGCCTACATCTTCCT	0.572																																					p.Y367H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1099C	3						.						96.0	89.0	91.0					3																	113677268		2203	4300	6503	115159958	SO:0001583	missense	254887	exon5			AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.1099T>C	3.37:g.113677268T>C	ENSP00000330485:p.Tyr367His	Somatic		Capture	SOLID	Phase_I	115159958	NM_173570	D3DN76	Missense_Mutation	SNP	ENST00000330212.3	37	CCDS33827.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.239553	0.39598	.	.	ENSG00000184307	ENST00000330212;ENST00000498275	T;T	0.25250	1.81;1.81	5.82	5.82	0.92795	.	0.053164	0.85682	D	0.000000	T	0.22551	0.0544	L	0.38649	1.16	0.52099	D	0.999948	P;B	0.34615	0.459;0.285	B;B	0.34418	0.182;0.123	T	0.03576	-1.1023	10	0.21014	T	0.42	-20.7679	16.1776	0.81862	0.0:0.0:0.0:1.0	.	367;367	B3KXB3;Q8IYP9	.;ZDH23_HUMAN	H	367;361	ENSP00000330485:Y367H;ENSP00000417840:Y361H	ENSP00000330485:Y367H	Y	+	1	0	ZDHHC23	115159958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.401000	0.59716	2.222000	0.72286	0.477000	0.44152	TAC		0.572	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354702.1	NM_173570	
IGSF11	152404	hgsc.bcm.edu	37	3	118621638	118621638	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:118621638C>T	ENST00000393775.2	-	7	1330	c.1025G>A	c.(1024-1026)gGc>gAc	p.G342D	IGSF11_ENST00000489689.1_Missense_Mutation_p.G318D|IGSF11_ENST00000441144.2_Missense_Mutation_p.G317D|IGSF11_ENST00000491903.1_Missense_Mutation_p.G314D|IGSF11_ENST00000354673.2_Missense_Mutation_p.G341D|IGSF11_ENST00000425327.2_Missense_Mutation_p.G341D	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	342					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G341D(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GAAAGATTGGCCCAAGTCACT	0.458																																					p.G341D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1022A	3						.						158.0	161.0	160.0					3																	118621638		2203	4300	6503	120104328	SO:0001583	missense	152404	exon9			AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.1025G>A	3.37:g.118621638C>T	ENSP00000377370:p.Gly342Asp	Somatic		Capture	SOLID	Phase_I	120104328	NM_152538	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Missense_Mutation	SNP	ENST00000393775.2	37	CCDS46891.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.020773	0.35606	.	.	ENSG00000144847	ENST00000425327;ENST00000393775;ENST00000489689;ENST00000354673;ENST00000441144;ENST00000491903	T;T;D;T;D;D	0.83335	-0.87;-1.09;-1.71;-0.87;-1.65;-1.52	5.18	0.864	0.19068	.	0.997884	0.08123	N	0.994399	T	0.67116	0.2859	N	0.14661	0.345	0.23515	N	0.997517	B;B;B;B;B	0.28128	0.201;0.145;0.145;0.09;0.09	B;B;B;B;B	0.20767	0.023;0.031;0.031;0.031;0.023	T	0.48456	-0.9034	10	0.17832	T	0.49	.	10.1875	0.43006	0.0:0.5873:0.0:0.4126	.	314;317;341;318;342	C9JBA5;Q5DX21-3;Q5DX21-2;C9JMW0;Q5DX21	.;.;.;.;IGS11_HUMAN	D	341;342;318;341;317;314	ENSP00000406092:G341D;ENSP00000377370:G342D;ENSP00000420486:G318D;ENSP00000346700:G341D;ENSP00000401240:G317D;ENSP00000417413:G314D	ENSP00000346700:G341D	G	-	2	0	IGSF11	120104328	0.998000	0.40836	1.000000	0.80357	0.905000	0.53344	0.541000	0.23207	0.267000	0.21916	-0.140000	0.14226	GGC		0.458	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2		
POLQ	10721	hgsc.bcm.edu	37	3	121155115	121155115	+	Missense_Mutation	SNP	C	C	T	rs367989768		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:121155115C>T	ENST00000264233.5	-	28	7525	c.7397G>A	c.(7396-7398)cGt>cAt	p.R2466H		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2466					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.R2601H(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GATAGCTTGACGCTCAGCCTA	0.423								DNA polymerases (catalytic subunits)																													p.R2466H	Pancreas(152;907 1925 26081 31236 36904)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7397A	3						.	C	HIS/ARG	0,4406		0,0,2203	173.0	152.0	159.0		7397	5.8	1.0	3		159	1,8599	1.2+/-3.3	0,1,4299	no	missense	POLQ	NM_199420.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	2466/2591	121155115	1,13005	2203	4300	6503	122637805	SO:0001583	missense	10721	exon28			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7397G>A	3.37:g.121155115C>T	ENSP00000264233:p.Arg2466His	Somatic		Capture	SOLID	Phase_I	122637805	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971292	0.92919	0.0	1.16E-4	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.97906	-4.6	5.81	5.81	0.92471	DNA-directed DNA polymerase, family A, palm domain (2);	0.000000	0.85682	D	0.000000	D	0.99242	0.9736	H	0.96111	3.77	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98965	1.0799	10	0.87932	D	0	.	19.6863	0.95981	0.0:1.0:0.0:0.0	.	2466;1638	O75417;O75417-2	DPOLQ_HUMAN;.	H	2089;2466;2602	ENSP00000264233:R2466H	ENSP00000264233:R2466H	R	-	2	0	POLQ	122637805	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	6.788000	0.75105	2.746000	0.94184	0.591000	0.81541	CGT		0.423	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
HCLS1	3059	hgsc.bcm.edu	37	3	121353146	121353146	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:121353146C>T	ENST00000314583.3	-	10	902	c.811G>A	c.(811-813)Gtg>Atg	p.V271M	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Missense_Mutation_p.V234M	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	271					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)	p.V271M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		CTCTTTGTCACAGCCTTTCGC	0.577																																					p.V271M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G811A	3						.						86.0	80.0	82.0					3																	121353146		2203	4300	6503	122835836	SO:0001583	missense	3059	exon10				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.811G>A	3.37:g.121353146C>T	ENSP00000320176:p.Val271Met	Somatic		Capture	SOLID	Phase_I	122835836	NM_005335	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	37	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	C	5.564	0.288936	0.10513	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.20069	2.11;2.1	5.38	-1.09	0.09904	.	0.509003	0.21764	N	0.069461	T	0.09247	0.0228	N	0.22421	0.69	0.09310	N	1	B;B	0.22480	0.007;0.07	B;B	0.14023	0.006;0.01	T	0.16217	-1.0410	10	0.34782	T	0.22	-1.5283	1.2278	0.01937	0.248:0.2644:0.3177:0.1698	.	234;271	E7EVW7;P14317	.;HCLS1_HUMAN	M	271;234	ENSP00000320176:V271M;ENSP00000387645:V234M	ENSP00000320176:V271M	V	-	1	0	HCLS1	122835836	0.001000	0.12720	0.014000	0.15608	0.020000	0.10135	0.036000	0.13819	-0.427000	0.07350	-0.145000	0.13849	GTG		0.577	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335	
GOLGB1	2804	hgsc.bcm.edu	37	3	121438545	121438545	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:121438545T>G	ENST00000340645.5	-	7	829	c.704A>C	c.(703-705)gAt>gCt	p.D235A	GOLGB1_ENST00000393667.3_Missense_Mutation_p.D240A	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	235					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AAGAAGCTCATCTTCATGAAG	0.428																																					p.D235A												.	.	0			c.A704C	3						.						153.0	133.0	140.0					3																	121438545		2203	4300	6503	122921235	SO:0001583	missense	2804	exon7			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.704A>C	3.37:g.121438545T>G	ENSP00000341848:p.Asp235Ala	Somatic		Capture	SOLID	Phase_I	122921235	NM_004487	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.124347	0.56613	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.14144	2.53;2.55	5.86	5.86	0.93980	.	0.101533	0.43579	D	0.000555	T	0.28896	0.0717	L	0.55481	1.735	0.36040	D	0.840044	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.99;0.998;0.998	T	0.21314	-1.0249	10	0.13108	T	0.6	.	12.6477	0.56744	0.0:0.0:0.0:1.0	.	240;240;235	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	A	235;240	ENSP00000341848:D235A;ENSP00000377275:D240A	ENSP00000341848:D235A	D	-	2	0	GOLGB1	122921235	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.338000	0.52128	2.239000	0.73571	0.528000	0.53228	GAT		0.428	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
SLC41A3	54946	hgsc.bcm.edu	37	3	125735691	125735691	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:125735691C>T	ENST00000315891.6	-	7	1011	c.773G>A	c.(772-774)tGc>tAc	p.C258Y	SLC41A3_ENST00000360370.4_Missense_Mutation_p.C258Y|SLC41A3_ENST00000383598.2_Missense_Mutation_p.C232Y|SLC41A3_ENST00000508835.1_Missense_Mutation_p.C141Y|SLC41A3_ENST00000346785.5_Missense_Mutation_p.C222Y	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.C232Y(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		AAAGCTGAGGCAGACCAGCGG	0.582																																					p.C258Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773A	3						.						76.0	65.0	69.0					3																	125735691		2203	4300	6503	127218381	SO:0001583	missense	54946	exon7				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.773G>A	3.37:g.125735691C>T	ENSP00000326070:p.Cys258Tyr	Somatic		Capture	SOLID	Phase_I	127218381	NM_001008485	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	ENST00000315891.6	37	CCDS33843.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.903648	0.52333	.	.	ENSG00000114544	ENST00000360370;ENST00000346785;ENST00000383598;ENST00000458524;ENST00000315891;ENST00000508835;ENST00000514677	T;T;T;T;T	0.33438	1.44;1.42;1.45;1.41;1.44	5.52	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.57066	0.2028	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.989;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.77004	0.935;0.768;0.959;0.989;0.976;0.982	T	0.62618	-0.6816	10	0.59425	D	0.04	-24.9707	14.163	0.65459	0.0:0.8487:0.1513:0.0	.	141;258;258;222;258;232	B7Z4Y2;A8MQ22;E7ENY4;Q96GZ6-3;Q96GZ6;Q96GZ6-7	.;.;.;.;S41A3_HUMAN;.	Y	258;222;232;249;258;141;273	ENSP00000353533:C258Y;ENSP00000264471:C222Y;ENSP00000373092:C232Y;ENSP00000326070:C258Y;ENSP00000422828:C273Y	ENSP00000326070:C258Y	C	-	2	0	SLC41A3	127218381	0.993000	0.37304	0.854000	0.33618	0.324000	0.28378	3.105000	0.50314	1.308000	0.44962	0.591000	0.81541	TGC		0.582	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
TF	7018	hgsc.bcm.edu	37	3	133496062	133496062	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:133496062T>C	ENST00000402696.3	+	16	2527	c.2042T>C	c.(2041-2043)cTg>cCg	p.L681P	TF_ENST00000264998.3_Missense_Mutation_p.L554P	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	681	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.L681P(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	GTTGGTAACCTGAGAAAATGC	0.468																																					p.L681P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2042C	3						.						67.0	66.0	66.0					3																	133496062		2203	4300	6503	134978752	SO:0001583	missense	7018	exon16				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.2042T>C	3.37:g.133496062T>C	ENSP00000385834:p.Leu681Pro	Somatic		Capture	SOLID	Phase_I	134978752	NM_001063	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	ENST00000402696.3	37	CCDS3080.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241939	0.58995	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.52295	0.67;0.67	5.46	5.46	0.80206	.	0.435288	0.25511	N	0.030177	T	0.77089	0.4079	H	0.95712	3.71	0.26194	N	0.979548	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.75227	-0.3392	10	0.87932	D	0	-1.4047	13.1457	0.59461	0.0:0.0:0.0:1.0	.	407;681	B4DHZ6;P02787	.;TRFE_HUMAN	P	681;554	ENSP00000385834:L681P;ENSP00000264998:L554P	ENSP00000264998:L554P	L	+	2	0	TF	134978752	0.920000	0.31207	0.008000	0.14137	0.126000	0.20510	4.592000	0.61027	2.296000	0.77279	0.482000	0.46254	CTG		0.468	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
PPP2R3A	5523	hgsc.bcm.edu	37	3	135722307	135722307	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:135722307T>C	ENST00000264977.3	+	2	2584	c.1967T>C	c.(1966-1968)tTg>tCg	p.L656S	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	656					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)	p.L656S(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TCAGCAGTTTTGATTCAGCAG	0.368																																					p.L656S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1967C	3						.						67.0	64.0	65.0					3																	135722307		2201	4299	6500	137204997	SO:0001583	missense	5523	exon2			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1967T>C	3.37:g.135722307T>C	ENSP00000264977:p.Leu656Ser	Somatic		Capture	SOLID	Phase_I	137204997	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.680322	0.29872	.	.	ENSG00000073711	ENST00000264977	T	0.08008	3.14	5.83	4.69	0.59074	.	0.088135	0.48286	D	0.000196	T	0.05868	0.0153	N	0.26042	0.785	0.80722	D	1	B	0.23540	0.087	B	0.17433	0.018	T	0.36866	-0.9730	10	0.30078	T	0.28	.	8.0793	0.30735	0.0:0.1472:0.0:0.8528	.	656	Q06190	P2R3A_HUMAN	S	656	ENSP00000264977:L656S	ENSP00000264977:L656S	L	+	2	0	PPP2R3A	137204997	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.078000	0.57606	2.231000	0.72958	0.460000	0.39030	TTG		0.368	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
MSL2	55167	hgsc.bcm.edu	37	3	135870639	135870639	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:135870639G>A	ENST00000309993.2	-	2	1816	c.1084C>T	c.(1084-1086)Cga>Tga	p.R362*	MSL2_ENST00000434835.2_Nonsense_Mutation_p.R288*	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	362					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R362*(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						GTTGGGCCTCGGATAATGGTA	0.463																																					p.R362X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1084T	3						.						115.0	107.0	110.0					3																	135870639		2203	4300	6503	137353329	SO:0001587	stop_gained	55167	exon2			AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.1084C>T	3.37:g.135870639G>A	ENSP00000311827:p.Arg362*	Somatic		Capture	SOLID	Phase_I	137353329	NM_018133	B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Nonsense_Mutation	SNP	ENST00000309993.2	37	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	G	40	8.512771	0.98843	.	.	ENSG00000174579	ENST00000309993;ENST00000434835	.	.	.	5.84	4.97	0.65823	.	0.267880	0.36703	N	0.002444	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-0.0284	10.2628	0.43436	0.1656:0.0:0.8344:0.0	.	.	.	.	X	362;288	.	ENSP00000311827:R362X	R	-	1	2	MSL2	137353329	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	6.005000	0.70716	1.463000	0.47967	0.551000	0.68910	CGA		0.463	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133	
TMEM43	79188	hgsc.bcm.edu	37	3	14175246	14175246	+	Missense_Mutation	SNP	G	G	A	rs397517385		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:14175246G>A	ENST00000306077.4	+	7	774	c.520G>A	c.(520-522)Gca>Aca	p.A174T	RP11-434D12.1_ENST00000608606.1_5'Flank	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	174					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.A174T(1)		breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						CAGTGCCATGGCAGTGGAGTC	0.597																																					p.A174T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G520A	3						.						178.0	170.0	173.0					3																	14175246		2203	4300	6503	14150247	SO:0001583	missense	79188	exon7			BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.520G>A	3.37:g.14175246G>A	ENSP00000303992:p.Ala174Thr	Somatic		Capture	SOLID	Phase_I	14150247	NM_024334	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	ENST00000306077.4	37	CCDS2618.1	.	.	.	.	.	.	.	.	.	.	G	33	5.202515	0.94997	.	.	ENSG00000170876	ENST00000306077	T	0.36699	1.24	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.51160	0.1658	L	0.33245	0.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.989	T	0.46345	-0.9198	10	0.40728	T	0.16	-16.3873	19.0044	0.92844	0.0:0.0:1.0:0.0	.	104;174	Q8TEP9;Q9BTV4	.;TMM43_HUMAN	T	174	ENSP00000303992:A174T	ENSP00000303992:A174T	A	+	1	0	TMEM43	14150247	1.000000	0.71417	0.996000	0.52242	0.858000	0.48976	8.261000	0.89860	2.473000	0.83533	0.591000	0.81541	GCA		0.597	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
STAG1	10274	hgsc.bcm.edu	37	3	136287655	136287655	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:136287655C>T	ENST00000383202.2	-	5	602	c.346G>A	c.(346-348)Gca>Aca	p.A116T	STAG1_ENST00000480733.1_Missense_Mutation_p.A116T|STAG1_ENST00000434713.2_5'UTR|STAG1_ENST00000236698.5_Missense_Mutation_p.A116T	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	116					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.A116T(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TCCAGAAGTGCGATGTCCCTG	0.348																																					p.A116T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G346A	3						.						72.0	66.0	68.0					3																	136287655		2203	4300	6503	137770345	SO:0001583	missense	10274	exon5			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.346G>A	3.37:g.136287655C>T	ENSP00000372689:p.Ala116Thr	Somatic		Capture	SOLID	Phase_I	137770345	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	35	5.570955	0.96553	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000480733	T;T	0.36157	1.28;1.27	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.57710	0.2072	M	0.82823	2.61	0.80722	D	1	D;P;P	0.56746	0.977;0.665;0.936	P;B;B	0.52957	0.714;0.086;0.271	T	0.65240	-0.6216	10	0.87932	D	0	.	18.9937	0.92804	0.0:1.0:0.0:0.0	.	116;116;116	C9JJQ0;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	T	116	ENSP00000372689:A116T;ENSP00000236698:A116T	ENSP00000236698:A116T	A	-	1	0	STAG1	137770345	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.570000	0.86706	0.650000	0.86243	GCA		0.348	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
GRK7	131890	hgsc.bcm.edu	37	3	141499299	141499299	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:141499299C>T	ENST00000264952.2	+	2	833	c.696C>T	c.(694-696)ggC>ggT	p.G232G		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	232	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)	p.G232G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						AGAAAGGTGGCGAGAAGATGG	0.478																																					p.G232G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C696T	3						.						97.0	95.0	96.0					3																	141499299		2203	4300	6503	142981989	SO:0001819	synonymous_variant	131890	exon2				CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.696C>T	3.37:g.141499299C>T		Somatic		Capture	SOLID	Phase_I	142981989	NM_139209		Silent	SNP	ENST00000264952.2	37	CCDS3120.1																																																																																				0.478	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353168.1	NM_139209	
HLTF	6596	hgsc.bcm.edu	37	3	148792015	148792015	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:148792015A>G	ENST00000310053.5	-	4	709	c.516T>C	c.(514-516)ggT>ggC	p.G172G	HLTF_ENST00000465259.1_Silent_p.G172G|HLTF_ENST00000392912.2_Silent_p.G172G|HLTF_ENST00000494055.1_Silent_p.G172G	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	172					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G172G(1)		breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TTGGTGCAGGACCCAATTTAA	0.348																																					p.G172G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T516C	3						.						89.0	87.0	88.0					3																	148792015		2203	4300	6503	150274705	SO:0001819	synonymous_variant	6596	exon4			L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.516T>C	3.37:g.148792015A>G		Somatic		Capture	SOLID	Phase_I	150274705	NM_139048	D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Silent	SNP	ENST00000310053.5	37	CCDS33875.1																																																																																				0.348	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1		
IGSF10	285313	hgsc.bcm.edu	37	3	151155137	151155137	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:151155137C>A	ENST00000282466.3	-	6	7211	c.7212G>T	c.(7210-7212)gaG>gaT	p.E2404D	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2404	Ig-like C2-type 10.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTCCTGCATCCTCCCGAGTTG	0.373																																					p.E431D												.	.	0			c.G1293T	3						.						105.0	108.0	107.0					3																	151155137		2203	4300	6503	152637827	SO:0001583	missense	285313	exon2			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7212G>T	3.37:g.151155137C>A	ENSP00000282466:p.Glu2404Asp	Somatic		Capture	SOLID	Phase_I	152637827	NM_001178145	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.990747	0.00439	.	.	ENSG00000152580	ENST00000282466	D	0.96554	-4.05	5.55	-11.1	0.00147	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.563545	0.15159	N	0.277242	D	0.86748	0.6007	N	0.21282	0.65	0.09310	N	0.999995	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.002	T	0.70160	-0.4948	10	0.09084	T	0.74	.	7.6278	0.28222	0.1324:0.2368:0.495:0.1359	.	2404;431	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	D	2404	ENSP00000282466:E2404D	ENSP00000282466:E2404D	E	-	3	2	IGSF10	152637827	0.000000	0.05858	0.000000	0.03702	0.565000	0.35776	-2.683000	0.00835	-4.040000	0.00079	-1.107000	0.02091	GAG		0.373	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
PLCH1	23007	hgsc.bcm.edu	37	3	155314145	155314145	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:155314145C>T	ENST00000340059.7	-	2	65	c.66G>A	c.(64-66)atG>atA	p.M22I	PLCH1_ENST00000494598.1_Missense_Mutation_p.M22I|PLCH1_ENST00000414191.1_Missense_Mutation_p.M4I|PLCH1_ENST00000447496.2_Missense_Mutation_p.M22I|PLCH1_ENST00000460012.1_Missense_Mutation_p.M4I|PLCH1_ENST00000334686.6_Missense_Mutation_p.M4I	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	22	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.M4I(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCCCGGACTGCATCACACTCA	0.488																																					p.M22I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G66A	3						.						142.0	128.0	133.0					3																	155314145		2203	4300	6503	156796839	SO:0001583	missense	23007	exon2			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.66G>A	3.37:g.155314145C>T	ENSP00000345988:p.Met22Ile	Somatic		Capture	SOLID	Phase_I	156796839	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	C	35	5.414327	0.96092	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01	5.42	5.42	0.78866	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.78792	0.4339	M	0.79011	2.435	0.80722	D	1	D;D;D	0.62365	0.991;0.985;0.983	P;P;P	0.61201	0.885;0.826;0.885	T	0.80630	-0.1297	10	0.59425	D	0.04	.	19.2309	0.93839	0.0:1.0:0.0:0.0	.	4;22;22	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	I	22;4;22;22;4;4	ENSP00000419100:M22I;ENSP00000417502:M4I;ENSP00000402759:M22I;ENSP00000345988:M22I;ENSP00000335469:M4I;ENSP00000412977:M4I	ENSP00000335469:M4I	M	-	3	0	PLCH1	156796839	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.711000	0.84669	2.536000	0.85505	0.655000	0.94253	ATG		0.488	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
SLC7A14	57709	hgsc.bcm.edu	37	3	170185099	170185099	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:170185099G>A	ENST00000231706.5	-	8	2375	c.2060C>T	c.(2059-2061)gCc>gTc	p.A687V	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	687					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.A687V(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TTGGTGCAGGGCCTCTTCTCG	0.562																																					p.A687V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2060T	3						.						59.0	62.0	61.0					3																	170185099		2203	4300	6503	171667793	SO:0001583	missense	57709	exon8			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.2060C>T	3.37:g.170185099G>A	ENSP00000231706:p.Ala687Val	Somatic		Capture	SOLID	Phase_I	171667793	NM_020949	B3KV33|Q9HCF9	Missense_Mutation	SNP	ENST00000231706.5	37	CCDS33892.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854398	0.51270	.	.	ENSG00000013293	ENST00000231706	D	0.87809	-2.3	5.69	5.69	0.88448	.	0.107161	0.64402	D	0.000004	T	0.74688	0.3749	N	0.08118	0	0.42717	D	0.993667	B	0.06786	0.001	B	0.04013	0.001	T	0.69684	-0.5079	10	0.32370	T	0.25	.	13.0713	0.59064	0.0734:0.0:0.9266:0.0	.	687	Q8TBB6	S7A14_HUMAN	V	687	ENSP00000231706:A687V	ENSP00000231706:A687V	A	-	2	0	SLC7A14	171667793	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.327000	0.52045	2.701000	0.92244	0.655000	0.94253	GCC		0.562	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
PLD1	5337	hgsc.bcm.edu	37	3	171431788	171431788	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:171431788C>T	ENST00000351298.4	-	9	932	c.806G>A	c.(805-807)aGc>aAc	p.S269N	PLD1_ENST00000340989.4_Missense_Mutation_p.S269N|PLD1_ENST00000342215.6_Missense_Mutation_p.S269N|PLD1_ENST00000356327.5_Missense_Mutation_p.S269N	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	269	PH.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.S269N(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	AATGGCACCGCTGTCTGGTTT	0.353																																					p.S269N	NSCLC(149;2174 3517 34058)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G806A	3						.						112.0	115.0	114.0					3																	171431788		2203	4300	6503	172914482	SO:0001583	missense	5337	exon9			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.806G>A	3.37:g.171431788C>T	ENSP00000342793:p.Ser269Asn	Somatic		Capture	SOLID	Phase_I	172914482	NM_001130081		Missense_Mutation	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159744	0.38119	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.36	1.39	0.22231	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.344816	0.32459	N	0.006069	T	0.64627	0.2615	L	0.48362	1.52	0.34240	D	0.677531	B;B	0.06786	0.001;0.001	B;B	0.15052	0.012;0.005	T	0.55945	-0.8060	10	0.21540	T	0.41	-9.4869	5.6029	0.17363	0.0:0.4806:0.2792:0.2403	.	292;269	Q59EA4;Q13393	.;PLD1_HUMAN	N	269	ENSP00000348681:S269N;ENSP00000342793:S269N;ENSP00000339936:S269N;ENSP00000340326:S269N	ENSP00000340326:S269N	S	-	2	0	PLD1	172914482	0.833000	0.29383	0.848000	0.33437	0.998000	0.95712	1.261000	0.32980	0.045000	0.15804	0.563000	0.77884	AGC		0.353	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
NCEH1	57552	hgsc.bcm.edu	37	3	172351414	172351414	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:172351414G>A	ENST00000475381.1	-	5	1311	c.1078C>T	c.(1078-1080)Cgt>Tgt	p.R360C	NCEH1_ENST00000538775.1_Missense_Mutation_p.R400C|NCEH1_ENST00000543711.1_Missense_Mutation_p.R227C|NCEH1_ENST00000273512.3_Missense_Mutation_p.R392C			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	360					lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)	p.R392C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						CTCTCCAAACGCTTGGCATAC	0.527																																					p.R400C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1198T	3						.						122.0	104.0	110.0					3																	172351414		2203	4300	6503	173834108	SO:0001583	missense	57552	exon5			AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.1078C>T	3.37:g.172351414G>A	ENSP00000418571:p.Arg360Cys	Somatic		Capture	SOLID	Phase_I	173834108	NM_001146276	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	ENST00000475381.1	37		.	.	.	.	.	.	.	.	.	.	G	31	5.075647	0.94000	.	.	ENSG00000144959	ENST00000475381;ENST00000538775;ENST00000273512;ENST00000543711	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	5.57	5.57	0.84162	Alpha/beta hydrolase fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.46425	0.1392	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.52449	-0.8574	10	0.87932	D	0	-22.2459	19.5349	0.95247	0.0:0.0:1.0:0.0	.	400;360	F5H7K4;Q6PIU2	.;NCEH1_HUMAN	C	360;400;392;227	ENSP00000418571:R360C;ENSP00000442464:R400C;ENSP00000273512:R392C;ENSP00000443227:R227C	ENSP00000273512:R392C	R	-	1	0	NCEH1	173834108	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.471000	0.97696	2.614000	0.88457	0.491000	0.48974	CGT		0.527	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000346367.3	NM_020792	
SPATA16	83893	hgsc.bcm.edu	37	3	172634182	172634182	+	Missense_Mutation	SNP	C	C	A	rs200392899		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:172634182C>A	ENST00000351008.3	-	9	1611	c.1428G>T	c.(1426-1428)caG>caT	p.Q476H		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	476					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)		p.Q476H(1)		breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			GATTAATCACCTGGGACTGCT	0.473																																					p.Q476H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1428T	3						.						230.0	214.0	219.0					3																	172634182		2203	4300	6503	174116876	SO:0001583	missense	83893	exon9			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1428G>T	3.37:g.172634182C>A	ENSP00000341765:p.Gln476His	Somatic		Capture	SOLID	Phase_I	174116876	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715142	0.48622	.	.	ENSG00000144962	ENST00000351008	T	0.22134	1.97	6.17	1.91	0.25777	.	0.000000	0.64402	D	0.000003	T	0.30324	0.0761	L	0.32530	0.975	0.30747	N	0.745574	D	0.89917	1.0	D	0.87578	0.998	T	0.13019	-1.0525	10	0.87932	D	0	-12.4048	8.528	0.33317	0.0:0.5009:0.0:0.4991	.	476	Q9BXB7	SPT16_HUMAN	H	476	ENSP00000341765:Q476H	ENSP00000341765:Q476H	Q	-	3	2	SPATA16	174116876	0.998000	0.40836	1.000000	0.80357	0.859000	0.49053	0.338000	0.19858	0.479000	0.27511	0.655000	0.94253	CAG		0.473	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
ETV5	2119	hgsc.bcm.edu	37	3	185823434	185823434	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:185823434T>C	ENST00000306376.5	-	3	359	c.113A>G	c.(112-114)gAt>gGt	p.D38G	ETV5_ENST00000537818.1_Missense_Mutation_p.D80G|ETV5_ENST00000434744.1_Missense_Mutation_p.D38G|DGKG_ENST00000447054.1_5'Flank	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	38					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.D38G(1)		breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GTGAGCCAGATCTGTGTCCAA	0.483			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.D38G			Dom	yes		3	3q28	2119	ets variant gene 5		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A113G	3						.						136.0	128.0	131.0					3																	185823434		2203	4300	6503	187306128	SO:0001583	missense	2119	exon3			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.113A>G	3.37:g.185823434T>C	ENSP00000306894:p.Asp38Gly	Somatic		Capture	SOLID	Phase_I	187306128	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	37	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.337101	0.60963	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818;ENST00000440773;ENST00000421809;ENST00000413301;ENST00000422039	T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88	5.71	5.71	0.89125	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.272209	0.37761	N	0.001943	T	0.31231	0.0790	L	0.33189	0.99	0.54753	D	0.999986	P;D	0.57571	0.951;0.98	P;P	0.55713	0.637;0.782	T	0.02546	-1.1143	10	0.21014	T	0.42	.	13.5044	0.61476	0.0:0.0:0.0:1.0	.	38;80	P41161;B7Z7D7	ETV5_HUMAN;.	G	38;38;80;38;38;38;38	ENSP00000306894:D38G;ENSP00000413755:D38G;ENSP00000441737:D80G;ENSP00000389707:D38G;ENSP00000412171:D38G;ENSP00000405157:D38G;ENSP00000388737:D38G	ENSP00000306894:D38G	D	-	2	0	ETV5	187306128	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.076000	0.76806	2.179000	0.69175	0.379000	0.24179	GAT		0.483	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
ADIPOQ	9370	hgsc.bcm.edu	37	3	186570888	186570888	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:186570888C>T	ENST00000412955.2	+	2	182	c.41C>T	c.(40-42)cCc>cTc	p.P14L	ADIPOQ_ENST00000320741.2_Missense_Mutation_p.P14L|ADIPOQ_ENST00000444204.2_Missense_Mutation_p.P14L|ADIPOQ-AS1_ENST00000422718.1_RNA			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	14					adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		TTAGCTCTGCCCGGTCATGAC	0.612																																					p.P14L												.	.	0			c.C41T	3						.						88.0	81.0	84.0					3																	186570888		2203	4300	6503	188053582	SO:0001583	missense	9370	exon2			D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.41C>T	3.37:g.186570888C>T	ENSP00000405611:p.Pro14Leu	Somatic		Capture	SOLID	Phase_I	188053582	NM_004797	Q58EX9	Missense_Mutation	SNP	ENST00000412955.2	37	CCDS3284.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229123	0.39399	.	.	ENSG00000181092	ENST00000412955;ENST00000320741;ENST00000444204	D;D;D	0.90261	-2.64;-2.64;-2.64	5.31	3.15	0.36227	.	0.327649	0.28778	N	0.014166	D	0.82770	0.5109	L	0.32530	0.975	0.24650	N	0.993525	B	0.06786	0.001	B	0.06405	0.002	T	0.73335	-0.4015	10	0.56958	D	0.05	.	5.8627	0.18757	0.0:0.7378:0.0:0.2622	.	14	Q15848	ADIPO_HUMAN	L	14	ENSP00000405611:P14L;ENSP00000320709:P14L;ENSP00000389814:P14L	ENSP00000320709:P14L	P	+	2	0	ADIPOQ	188053582	0.000000	0.05858	0.517000	0.27799	0.167000	0.22549	0.153000	0.16323	1.406000	0.46857	0.655000	0.94253	CCC		0.612	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797	
BCL6	604	hgsc.bcm.edu	37	3	187447463	187447463	+	Silent	SNP	G	G	T	rs529677174		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:187447463G>T	ENST00000406870.2	-	5	1096	c.730C>A	c.(730-732)Cgg>Agg	p.R244R	RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Silent_p.R244R|BCL6_ENST00000450123.2_Silent_p.R244R|RP11-211G3.3_ENST00000449623.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	244					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R244R(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		AAAGTCGGCCGGCTGTACTCA	0.562			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.R244R			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C730A	3						.						49.0	50.0	49.0					3																	187447463		2203	4300	6503	188930157	SO:0001819	synonymous_variant	604	exon5				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.730C>A	3.37:g.187447463G>T		Somatic		Capture	SOLID	Phase_I	188930157	NM_001130845	A7E241|B8PSA7|D3DNV5	Silent	SNP	ENST00000406870.2	37	CCDS3289.1																																																																																				0.562	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
ATP13A5	344905	hgsc.bcm.edu	37	3	193007736	193007736	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:193007736C>T	ENST00000342358.4	-	26	3078	c.2961G>A	c.(2959-2961)gtG>gtA	p.V987V	ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	987						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.V987V(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CACTGATCTGCACAATGCAGG	0.433																																					p.V987V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2961A	3						.						82.0	80.0	80.0					3																	193007736		2203	4300	6503	194490430	SO:0001819	synonymous_variant	344905	exon26			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2961G>A	3.37:g.193007736C>T		Somatic		Capture	SOLID	Phase_I	194490430	NM_198505	Q6UWS4|Q6ZWL0	Silent	SNP	ENST00000342358.4	37	CCDS33914.1																																																																																				0.433	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
OSBPL10	114884	hgsc.bcm.edu	37	3	31743923	31743923	+	Silent	SNP	G	G	A	rs138576814		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:31743923G>A	ENST00000396556.2	-	7	1295	c.1173C>T	c.(1171-1173)ggC>ggT	p.G391G	OSBPL10_ENST00000438237.2_Silent_p.G327G|OSBPL10-AS1_ENST00000455961.1_RNA|OSBPL10-AS1_ENST00000458127.1_RNA|OSBPL10-AS1_ENST00000428872.2_RNA|OSBPL10-AS1_ENST00000418728.2_RNA	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	391					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.G391G(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CCTCCATGACGCCCAATTCCG	0.388																																					p.G391G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1173T	3						.	G	,	1,4405	2.1+/-5.4	0,1,2202	151.0	133.0	139.0		981,1173	-6.0	0.7	3	dbSNP_134	139	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	OSBPL10	NM_001174060.1,NM_017784.4	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	327/701,391/765	31743923	2,13004	2203	4300	6503	31718927	SO:0001819	synonymous_variant	114884	exon7			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1173C>T	3.37:g.31743923G>A		Somatic		Capture	SOLID	Phase_I	31718927	NM_017784	B4E212|Q9BTU5	Silent	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	9.867	1.197976	0.22037	2.27E-4	1.16E-4	ENSG00000144645	ENST00000429492	.	.	.	5.47	-5.97	0.02227	.	.	.	.	.	T	0.47801	0.1465	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.49283	-0.8956	4	.	.	.	-18.6393	7.1259	0.25471	0.5405:0.0:0.2064:0.2531	.	.	.	.	V	160	.	.	A	-	2	0	OSBPL10	31718927	0.006000	0.16342	0.674000	0.29902	0.989000	0.77384	-1.630000	0.02028	-1.120000	0.02953	-0.282000	0.10007	GCG		0.388	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
CNOT10	25904	hgsc.bcm.edu	37	3	32769328	32769328	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:32769328G>C	ENST00000328834.5	+	10	1497	c.1181G>C	c.(1180-1182)cGg>cCg	p.R394P	CNOT10_ENST00000454516.2_Missense_Mutation_p.R454P|CNOT10-AS1_ENST00000475395.2_RNA|CNOT10_ENST00000331889.6_Missense_Mutation_p.R394P|CNOT10_ENST00000538368.1_Missense_Mutation_p.R166P	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	394					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						CTCTGGCTACGGCTGGCTGAA	0.468																																					p.R394P												.	.	0			c.G1181C	3						.						76.0	74.0	75.0					3																	32769328		2203	4300	6503	32744332	SO:0001583	missense	25904	exon10			BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.1181G>C	3.37:g.32769328G>C	ENSP00000330060:p.Arg394Pro	Somatic		Capture	SOLID	Phase_I	32744332	NM_015442	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	ENST00000328834.5	37	CCDS2655.1	.	.	.	.	.	.	.	.	.	.	.	31	5.070384	0.93950	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000540405;ENST00000538368;ENST00000454516	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	5.36	5.36	0.76844	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.93380	0.7889	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.94156	0.7410	10	0.87932	D	0	-16.998	19.0763	0.93163	0.0:0.0:1.0:0.0	.	454;394;393;394	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	P	394;394;294;166;454	ENSP00000329376:R394P;ENSP00000330060:R394P;ENSP00000442552:R166P;ENSP00000399862:R454P	ENSP00000330060:R394P	R	+	2	0	CNOT10	32744332	1.000000	0.71417	0.957000	0.39632	0.989000	0.77384	9.414000	0.97362	2.496000	0.84212	0.491000	0.48974	CGG		0.468	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442	
FYCO1	79443	hgsc.bcm.edu	37	3	46023078	46023078	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:46023078A>G	ENST00000296137.2	-	3	351	c.146T>C	c.(145-147)cTt>cCt	p.L49P	FYCO1_ENST00000535325.1_Missense_Mutation_p.L49P	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	49	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)	p.L49P(1)		NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GAGATACTCAAGTTTATAAGA	0.413																																					p.L49P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T146C	3						.						118.0	118.0	118.0					3																	46023078		2203	4300	6503	45998082	SO:0001583	missense	79443	exon3			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.146T>C	3.37:g.46023078A>G	ENSP00000296137:p.Leu49Pro	Somatic		Capture	SOLID	Phase_I	45998082	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.375190	0.82682	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.25250	1.81;1.81	5.66	5.66	0.87406	RUN (1);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.51593	-0.8686	10	0.87932	D	0	-10.8356	14.7731	0.69693	1.0:0.0:0.0:0.0	.	49;49	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	P	49	ENSP00000296137:L49P;ENSP00000441178:L49P	ENSP00000296137:L49P	L	-	2	0	FYCO1	45998082	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	8.907000	0.92634	2.285000	0.76669	0.533000	0.62120	CTT		0.413	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
DHX30	22907	hgsc.bcm.edu	37	3	47882454	47882454	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:47882454A>G	ENST00000445061.1	+	7	861	c.454A>G	c.(454-456)Agc>Ggc	p.S152G	DHX30_ENST00000348968.4_Missense_Mutation_p.S124G|DHX30_ENST00000457607.1_Missense_Mutation_p.S180G|DHX30_ENST00000446256.2_Missense_Mutation_p.S113G	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	152						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CCCTGCCGACAGCTGGTGGCG	0.607																																					p.S152G												.	.	0			c.A454G	3						.						48.0	45.0	46.0					3																	47882454		2203	4300	6503	47857458	SO:0001583	missense	22907	exon7			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.454A>G	3.37:g.47882454A>G	ENSP00000405620:p.Ser152Gly	Somatic		Capture	SOLID	Phase_I	47857458	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.720161	0.48728	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03358	3.99;3.97;3.98;3.96	4.89	4.89	0.63831	.	0.163302	0.53938	D	0.000055	T	0.04003	0.0112	L	0.36672	1.1	0.36436	D	0.865215	B;B;B	0.26147	0.143;0.089;0.042	B;B;B	0.25614	0.028;0.062;0.042	T	0.40646	-0.9552	10	0.41790	T	0.15	.	9.855	0.41079	0.8288:0.1712:0.0:0.0	.	152;113;180	Q7L2E3;Q7L2E3-3;Q7L2E3-2	DHX30_HUMAN;.;.	G	113;152;124;180	ENSP00000392601:S113G;ENSP00000405620:S152G;ENSP00000343442:S124G;ENSP00000394682:S180G	ENSP00000343442:S124G	S	+	1	0	DHX30	47857458	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.174000	0.42482	1.821000	0.53095	0.533000	0.62120	AGC		0.607	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
COL7A1	1294	hgsc.bcm.edu	37	3	48618082	48618082	+	Missense_Mutation	SNP	C	C	T	rs139905484		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:48618082C>T	ENST00000328333.8	-	54	5091	c.4984G>A	c.(4984-4986)Gca>Aca	p.A1662T	MIR711_ENST00000390201.1_RNA|COL7A1_ENST00000454817.1_Missense_Mutation_p.A1662T	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1662	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A1662T(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACTCCAGGTGCCCCCTAAGAA	0.572																																					p.A1662T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4984A	3						.						74.0	68.0	70.0					3																	48618082		2202	4300	6502	48593086	SO:0001583	missense	1294	exon54			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.4984G>A	3.37:g.48618082C>T	ENSP00000332371:p.Ala1662Thr	Somatic		Capture	SOLID	Phase_I	48593086	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707875	0.68615	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.93604	-3.25;-3.25	5.24	-4.59	0.03400	.	0.824139	0.10204	N	0.702957	T	0.80793	0.4691	N	0.16790	0.44	0.09310	N	1	B	0.32526	0.374	B	0.27076	0.076	T	0.72276	-0.4341	10	0.14252	T	0.57	.	5.3613	0.16089	0.0972:0.3923:0.3842:0.1264	.	1662	Q02388	CO7A1_HUMAN	T	1662	ENSP00000332371:A1662T;ENSP00000412569:A1662T	ENSP00000332371:A1662T	A	-	1	0	COL7A1	48593086	0.000000	0.05858	0.014000	0.15608	0.907000	0.53573	-0.320000	0.08028	-0.532000	0.06332	-0.176000	0.13171	GCA		0.572	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
NDUFAF3	25915	hgsc.bcm.edu	37	3	49061987	49061987	+	IGR	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:49061987A>G	ENST00000326925.6	+	0	2012				IMPDH2_ENST00000326739.4_Silent_p.L488L|DALRD3_ENST00000496568.1_5'Flank	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3						mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)		p.L488L(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						TCTCAAACTTAAGCTCCCCAG	0.577																																					p.L488L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1464C	3						.						110.0	105.0	107.0					3																	49061987		2203	4300	6503	49036991	SO:0001628	intergenic_variant	3615	exon13				CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773		3.37:g.49061987A>G		Somatic		Capture	SOLID	Phase_I	49036991	NM_000884		Silent	SNP	ENST00000326925.6	37	CCDS2784.1	.	.	.	.	.	.	.	.	.	.	A	8.578	0.881624	0.17467	.	.	ENSG00000178035	ENST00000429182	.	.	.	5.68	0.776	0.18532	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.2916	10.066	0.42303	0.1187:0.337:0.5443:0.0	.	.	.	.	Q	444	.	.	X	-	1	0	IMPDH2	49036991	0.794000	0.28838	1.000000	0.80357	0.997000	0.91878	-0.128000	0.10531	0.166000	0.19597	0.533000	0.62120	TAA		0.577	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345683.2	NM_199069	
ABHD14B	84836	hgsc.bcm.edu	37	3	52003518	52003518	+	Missense_Mutation	SNP	G	G	A	rs201010064		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:52003518G>A	ENST00000483233.1	-	5	1063	c.557C>T	c.(556-558)gCg>gTg	p.A186V	ABHD14B_ENST00000487005.1_5'UTR|PCBP4_ENST00000355852.2_5'Flank|ABHD14B_ENST00000361143.5_Missense_Mutation_p.A186V|RP11-155D18.14_ENST00000489595.2_Intron|PCBP4_ENST00000484633.1_5'Flank|ABHD14B_ENST00000525795.1_Missense_Mutation_p.A186V|PCBP4_ENST00000461554.1_5'Flank|ABHD14B_ENST00000315877.10_Missense_Mutation_p.A184V|ABHD14B_ENST00000461108.1_3'UTR|ABHD14B_ENST00000395008.2_Missense_Mutation_p.A186V|PCBP4_ENST00000395013.3_5'Flank|PCBP4_ENST00000428823.2_5'Flank|RP11-155D18.12_ENST00000488257.1_RNA			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	186					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.A186V(1)		large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GGGGTGCCCCGCCCCCTTCAT	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17162	0.0		0.0	False		,,,				2504	0.0				p.A186V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C557T	3						.	G	VAL/ALA,VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	83.0	88.0	86.0		557,557	5.3	1.0	3		86	0,8600		0,0,4300	no	missense,missense	ABHD14B	NM_001146314.1,NM_032750.2	64,64	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging	186/211,186/211	52003518	2,13004	2203	4300	6503	51978558	SO:0001583	missense	84836	exon4			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.557C>T	3.37:g.52003518G>A	ENSP00000420065:p.Ala186Val	Somatic		Capture	SOLID	Phase_I	51978558	NM_001146314	Q86VK8|Q8N8W5	Missense_Mutation	SNP	ENST00000483233.1	37	CCDS2842.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	36	5.778911	0.96929	4.54E-4	0.0	ENSG00000114779	ENST00000483233;ENST00000315877;ENST00000395008;ENST00000361143;ENST00000439982;ENST00000525795	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.54271	0.1848	L	0.58969	1.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.55848	-0.8076	10	0.72032	D	0.01	-12.921	18.5376	0.91015	0.0:0.0:1.0:0.0	.	106;186	B4DKK0;Q96IU4	.;ABHEB_HUMAN	V	186;184;186;186;161;186	ENSP00000420065:A186V;ENSP00000318248:A184V;ENSP00000378455:A186V;ENSP00000354841:A186V;ENSP00000433388:A186V	ENSP00000318248:A184V	A	-	2	0	ABHD14B	51978558	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	9.531000	0.98054	2.490000	0.84030	0.484000	0.47621	GCG		0.612	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349673.1	NM_032750	
TLR9	54106	hgsc.bcm.edu	37	3	52256411	52256411	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:52256411G>A	ENST00000360658.2	-	2	2554	c.1921C>T	c.(1921-1923)Cac>Tac	p.H641Y	TLR9_ENST00000494383.1_Missense_Mutation_p.A794V|TLR9_ENST00000597542.1_Missense_Mutation_p.H665Y	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	641					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.H641Y(1)		endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	AGGAGGGTGTGCAGGCGGTTC	0.587																																					p.H641Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1921T	3						.						59.0	58.0	58.0					3																	52256411		2203	4300	6503	52231451	SO:0001583	missense	54106	exon2			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.1921C>T	3.37:g.52256411G>A	ENSP00000353874:p.His641Tyr	Somatic		Capture	SOLID	Phase_I	52231451	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.45|12.45	1.941447|1.941447	0.34283|0.34283	.|.	.|.	ENSG00000173366|ENSG00000239732	ENST00000494383|ENST00000360658	.|T	.|0.79554	.|-1.28	5.16|5.16	4.23|4.23	0.50019|0.50019	.|.	.|0.000000	.|0.40554	.|N	.|0.001069	T|T	0.78266|0.78266	0.4256|0.4256	N|N	0.26092|0.26092	0.79|0.79	0.09310|0.09310	N|N	0.999991|0.999991	.|D;D	.|0.69078	.|0.981;0.997	.|B;P	.|0.54706	.|0.369;0.759	T|T	0.71155|0.71155	-0.4675|-0.4675	5|10	.|0.54805	.|T	.|0.06	.|.	12.8259|12.8259	0.57718|0.57718	0.0:0.1657:0.8342:0.0|0.0:0.1657:0.8342:0.0	.|.	.|738;641	.|B4E0A1;Q9NR96	.|.;TLR9_HUMAN	V|Y	794|641	.|ENSP00000353874:H641Y	.|ENSP00000353874:H641Y	A|H	-|-	2|1	0|0	RP11-330H6.5|TLR9	52231451|52231451	0.000000|0.000000	0.05858|0.05858	0.924000|0.924000	0.36721|0.36721	0.185000|0.185000	0.23345|0.23345	-0.155000|-0.155000	0.10115|0.10115	2.399000|2.399000	0.81585|0.81585	0.561000|0.561000	0.74099|0.74099	GCA|CAC		0.587	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
BAP1	8314	hgsc.bcm.edu	37	3	52437627	52437627	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:52437627G>A	ENST00000460680.1	-	13	2005	c.1534C>T	c.(1534-1536)Cgc>Tgc	p.R512C	BAP1_ENST00000296288.5_Missense_Mutation_p.R494C	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R512C(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TTGGCTGAGCGGATAGGCGAG	0.617			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.R512C	GBM(101;493 1458 7992 21037 25532)		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1534T	3						.						55.0	56.0	56.0					3																	52437627		2203	4300	6503	52412667	SO:0001583	missense	8314	exon13			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1534C>T	3.37:g.52437627G>A	ENSP00000417132:p.Arg512Cys	Somatic		Capture	SOLID	Phase_I	52412667	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211021	0.58343	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000478368	T;T;T	0.64991	0.24;0.22;-0.13	6.05	6.05	0.98169	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.000000	0.85682	D	0.000000	T	0.70518	0.3233	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.70684	-0.4804	10	0.56958	D	0.05	.	15.3393	0.74284	0.0:0.0:0.8604:0.1396	.	512	Q92560	BAP1_HUMAN	C	512;494;13	ENSP00000417132:R512C;ENSP00000296288:R494C;ENSP00000420647:R13C	ENSP00000296288:R494C	R	-	1	0	BAP1	52412667	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	6.056000	0.71111	2.880000	0.98712	0.655000	0.94253	CGC		0.617	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
APPL1	26060	hgsc.bcm.edu	37	3	57282289	57282289	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:57282289G>A	ENST00000288266.3	+	10	920	c.773G>A	c.(772-774)aGt>aAt	p.S258N		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	258	Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)	p.S258N(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		GAAGTAGCCAGTGATCCCTTA	0.418																																					p.S258N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773A	3						.						118.0	110.0	113.0					3																	57282289		2203	4300	6503	57257329	SO:0001583	missense	26060	exon10			AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.773G>A	3.37:g.57282289G>A	ENSP00000288266:p.Ser258Asn	Somatic		Capture	SOLID	Phase_I	57257329	NM_012096	Q9P2B9	Missense_Mutation	SNP	ENST00000288266.3	37	CCDS2882.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.785162	0.49997	.	.	ENSG00000157500	ENST00000288266	T	0.11063	2.81	5.94	5.94	0.96194	.	0.040146	0.85682	D	0.000000	T	0.12774	0.0310	L	0.43152	1.355	0.44000	D	0.996702	B;B	0.13145	0.007;0.003	B;B	0.08055	0.003;0.002	T	0.15292	-1.0442	10	0.19147	T	0.46	-10.1956	20.3552	0.98837	0.0:0.0:1.0:0.0	.	241;258	B4DQX8;Q9UKG1	.;DP13A_HUMAN	N	258	ENSP00000288266:S258N	ENSP00000288266:S258N	S	+	2	0	APPL1	57257329	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.035000	0.93752	2.812000	0.96745	0.557000	0.71058	AGT		0.418	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	NM_012096	
FLNB	2317	hgsc.bcm.edu	37	3	58124154	58124154	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:58124154T>C	ENST00000295956.4	+	29	5172	c.5007T>C	c.(5005-5007)gaT>gaC	p.D1669D	FLNB_ENST00000429972.2_Silent_p.D1669D|FLNB_ENST00000493452.1_Silent_p.D1500D|FLNB_ENST00000358537.3_Silent_p.D1669D|FLNB_ENST00000357272.4_Silent_p.D1669D|FLNB_ENST00000348383.5_Silent_p.D1669D|FLNB_ENST00000419752.2_Silent_p.D1500D|FLNB_ENST00000490882.1_Silent_p.D1700D	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1669					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.D1669D(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		AGAATGAAGATGGAACCTATG	0.522																																					p.D1700D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5100C	3						.						168.0	159.0	162.0					3																	58124154		2203	4300	6503	58099194	SO:0001819	synonymous_variant	2317	exon30			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.5007T>C	3.37:g.58124154T>C		Somatic		Capture	SOLID	Phase_I	58099194	NM_001164317	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	CCDS2885.1																																																																																				0.522	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
MAGI1	9223	hgsc.bcm.edu	37	3	65372883	65372883	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:65372883G>A	ENST00000330909.8	-	15	2434	c.2435C>T	c.(2434-2436)gCg>gTg	p.A812V	MAGI1_ENST00000402939.2_Intron|MAGI1_ENST00000483466.1_Missense_Mutation_p.A812V|MAGI1_ENST00000497477.2_Intron	NM_015520.1	NP_056335.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	812					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.A812V(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CAATCCCGACGCAGGTGAAGG	0.373																																					p.A812V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2435T	3						.						99.0	101.0	100.0					3																	65372883		2203	4300	6503	65347923	SO:0001583	missense	9223	exon15			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000330909.8:c.2435C>T	3.37:g.65372883G>A	ENSP00000331157:p.Ala812Val	Somatic		Capture	SOLID	Phase_I	65347923	NM_015520	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000330909.8	37	CCDS33781.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.23|15.23	2.772908|2.772908	0.49680|0.49680	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466|ENST00000460329	T;T;T|.	0.17528|.	2.27;2.28;2.27|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|.	.|.	.|.	.|.	T|T	0.53481|0.53481	0.1799|0.1799	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B;D;B|.	0.76494|.	0.419;0.999;0.136|.	B;D;B|.	0.73708|.	0.016;0.981;0.04|.	T|T	0.46830|0.46830	-0.9163|-0.9163	9|5	0.28530|.	T|.	0.3|.	.|.	18.172|18.172	0.89749|0.89749	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	812;812;812|.	A8K188;Q96QZ7-3;Q96QZ7-5|.	.;.;.|.	V|C	812;708;687;812|693	ENSP00000331157:A812V;ENSP00000418177:A687V;ENSP00000420323:A812V|.	ENSP00000331157:A812V|.	A|R	-|-	2|1	0|0	MAGI1|MAGI1	65347923|65347923	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.898000|0.898000	0.52572|0.52572	6.023000|6.023000	0.70848|0.70848	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	GCG|CGT		0.373	MAGI1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349127.2	NM_004742	
SENP5	205564	hgsc.bcm.edu	37	3	196613174	196613174	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr3:196613174C>G	ENST00000323460.5	+	2	1371	c.1122C>G	c.(1120-1122)gaC>gaG	p.D374E	SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_Missense_Mutation_p.D374E	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	374					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.D374E(1)		NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		TGATTCATGACATCCCCTTAC	0.453																																					p.D374E	Ovarian(47;891 1095 11174 13858 51271)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1122G	3						.						73.0	73.0	73.0					3																	196613174		2203	4300	6503	198097571	SO:0001583	missense	205564	exon2			BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1122C>G	3.37:g.196613174C>G	ENSP00000327197:p.Asp374Glu	Somatic		Capture	SOLID	Phase_I	198097571	NM_152699	B4DY82|Q96SA5	Missense_Mutation	SNP	ENST00000323460.5	37	CCDS3322.1	.	.	.	.	.	.	.	.	.	.	C	0.136	-1.107392	0.01813	.	.	ENSG00000119231	ENST00000323460;ENST00000445299	T;T	0.31769	1.48;1.48	5.4	-5.67	0.02444	.	0.456399	0.22578	N	0.058247	T	0.07098	0.0180	N	0.03608	-0.345	0.32587	N	0.527705	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.22208	-1.0223	10	0.13108	T	0.6	-4.3431	0.5401	0.00644	0.2019:0.2807:0.192:0.3255	.	374;374	B4DY82;Q96HI0	.;SENP5_HUMAN	E	374	ENSP00000327197:D374E;ENSP00000390231:D374E	ENSP00000327197:D374E	D	+	3	2	SENP5	198097571	0.000000	0.05858	0.042000	0.18584	0.962000	0.63368	-1.659000	0.01975	-0.639000	0.05502	0.655000	0.94253	GAC		0.453	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699	
RIC8B	55188	hgsc.bcm.edu	37	12	107208780	107208780	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:107208780C>A	ENST00000392839.2	+	3	545	c.439C>A	c.(439-441)Ctc>Atc	p.L147I	RIC8B_ENST00000392837.4_Missense_Mutation_p.L147I|RIC8B_ENST00000549643.1_Intron|RIC8B_ENST00000355478.2_Missense_Mutation_p.L107I	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	147					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.L147I(1)		kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						GCTCTGTAACCTCCTGAGAAA	0.433																																					p.L147I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C439A	12						.						100.0	99.0	99.0					12																	107208780		2203	4300	6503	105732910	SO:0001583	missense	55188	exon3			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.439C>A	12.37:g.107208780C>A	ENSP00000376583:p.Leu147Ile	Somatic		Capture	SOLID	Phase_I	105732910	NM_018157	A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Missense_Mutation	SNP	ENST00000392839.2	37	CCDS9109.2	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018075	0.54576	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	T;T;T	0.57107	0.42;0.42;0.42	5.76	4.69	0.59074	Armadillo-type fold (1);	0.234437	0.42420	D	0.000701	T	0.61211	0.2329	L	0.47716	1.5	0.80722	D	1	P;D;D	0.54601	0.949;0.959;0.967	P;P;P	0.57911	0.465;0.777;0.829	T	0.59295	-0.7481	10	0.42905	T	0.14	-3.3476	15.6933	0.77473	0.0:0.9238:0.0:0.0762	.	107;147;147	Q9NVN3-3;Q9NVN3;B7WPL0	.;RIC8B_HUMAN;.	I	147;147;107	ENSP00000376582:L147I;ENSP00000376583:L147I;ENSP00000347662:L107I	ENSP00000347662:L107I	L	+	1	0	RIC8B	105732910	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.511000	0.60462	2.732000	0.93576	0.655000	0.94253	CTC		0.433	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000291398.2	NM_018157	
ATXN2	6311	hgsc.bcm.edu	37	12	111948298	111948298	+	Silent	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:111948298A>C	ENST00000377617.3	-	12	2288	c.2127T>G	c.(2125-2127)tcT>tcG	p.S709S	ATXN2_ENST00000550104.1_Silent_p.S709S|ATXN2_ENST00000542287.2_Silent_p.S444S|ATXN2_ENST00000535949.1_Silent_p.S420S|ATXN2_ENST00000608853.1_Silent_p.S549S|ATXN2_ENST00000389153.4_Silent_p.S444S	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	709	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.S709S(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						CAGCTTGGGGAGAAGCAAGAA	0.493																																					p.S709S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2127G	12						.						177.0	184.0	181.0					12																	111948298		2203	4300	6503	110432681	SO:0001819	synonymous_variant	6311	exon12			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.2127T>G	12.37:g.111948298A>C		Somatic		Capture	SOLID	Phase_I	110432681	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	37	CCDS31902.1																																																																																				0.493	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
ALDH2	217	hgsc.bcm.edu	37	12	112235943	112235943	+	Missense_Mutation	SNP	C	C	T	rs372769067		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:112235943C>T	ENST00000261733.2	+	10	1206	c.1145C>T	c.(1144-1146)gCg>gTg	p.A382V	ALDH2_ENST00000416293.3_Missense_Mutation_p.A335V	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	382					alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)	p.A382V(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	CAAGAGGGGGCGAAGCTGCTG	0.542			T	HMGA2	leiomyoma																																p.A382V			Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1145T	12						.	C	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	87.0	76.0	79.0		1145,1004	5.4	1.0	12		79	0,8600		0,0,4300	no	missense,missense	ALDH2	NM_000690.3,NM_001204889.1	64,64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	382/518,335/471	112235943	1,13005	2203	4300	6503	110720326	SO:0001583	missense	217	exon10			M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	ENST00000261733.2:c.1145C>T	12.37:g.112235943C>T	ENSP00000261733:p.Ala382Val	Somatic		Capture	SOLID	Phase_I	110720326	NM_000690	B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Missense_Mutation	SNP	ENST00000261733.2	37	CCDS9155.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165108	0.78339	2.27E-4	0.0	ENSG00000111275	ENST00000416293;ENST00000261733;ENST00000553044;ENST00000552234	T;T	0.81330	-1.48;-1.48	5.39	5.39	0.77823	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.047328	0.85682	D	0.000000	D	0.92802	0.7711	H	0.94542	3.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.74348	0.983;0.982;0.972	D	0.94521	0.7727	10	0.87932	D	0	.	19.1701	0.93574	0.0:1.0:0.0:0.0	.	335;306;382	E7EUE5;F8VXI5;P05091	.;.;ALDH2_HUMAN	V	335;382;306;242	ENSP00000403349:A335V;ENSP00000261733:A382V	ENSP00000261733:A382V	A	+	2	0	ALDH2	110720326	1.000000	0.71417	0.995000	0.50966	0.157000	0.22087	7.380000	0.79704	2.543000	0.85770	0.650000	0.86243	GCG		0.542	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405008.1	NM_000690	
RASAL1	8437	hgsc.bcm.edu	37	12	113559372	113559372	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:113559372C>G	ENST00000261729.5	-	6	685	c.370G>C	c.(370-372)Gtg>Ctg	p.V124L	RASAL1_ENST00000546530.1_Missense_Mutation_p.V124L|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Missense_Mutation_p.V124L|RASAL1_ENST00000446861.3_Missense_Mutation_p.V124L			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	124	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.V124L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						AGCATCTGCACTGACAGGCAG	0.557																																					p.V124L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G370C	12						.						124.0	95.0	105.0					12																	113559372		2203	4300	6503	112043755	SO:0001583	missense	8437	exon6			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.370G>C	12.37:g.113559372C>G	ENSP00000261729:p.Val124Leu	Somatic		Capture	SOLID	Phase_I	112043755	NM_004658	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	C	1.067	-0.670952	0.03403	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.08282	3.11;3.11;3.11;3.11	5.43	5.43	0.79202	C2 calcium/lipid-binding domain, CaLB (2);	0.250580	0.35436	N	0.003201	T	0.03220	0.0094	N	0.04805	-0.155	0.28694	N	0.904437	B;B;B;B;B;B;B	0.17667	0.011;0.023;0.019;0.011;0.003;0.004;0.019	B;B;B;B;B;B;B	0.16722	0.007;0.012;0.016;0.007;0.014;0.009;0.016	T	0.41610	-0.9499	10	0.02654	T	1	.	7.2591	0.26193	0.1702:0.7452:0.0:0.0846	.	124;124;124;136;124;124;124	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	L	124	ENSP00000450244:V124L;ENSP00000261729:V124L;ENSP00000395920:V124L;ENSP00000448510:V124L	ENSP00000261729:V124L	V	-	1	0	RASAL1	112043755	0.967000	0.33354	0.954000	0.39281	0.362000	0.29581	1.898000	0.39809	2.547000	0.85894	0.655000	0.94253	GTG		0.557	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658	
DUSP16	80824	hgsc.bcm.edu	37	12	12672871	12672871	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:12672871G>C	ENST00000228862.2	-	3	923	c.292C>G	c.(292-294)Ctc>Gtc	p.L98V	DUSP16_ENST00000298573.4_Missense_Mutation_p.L98V	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	98	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L98V(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		TCTGAAGAGAGAGAGGCAACA	0.438																																					p.L98V	Ovarian(158;443 1896 15437 36069 46477)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C292G	12						.						123.0	108.0	113.0					12																	12672871		2203	4300	6503	12564138	SO:0001583	missense	80824	exon3			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.292C>G	12.37:g.12672871G>C	ENSP00000228862:p.Leu98Val	Somatic		Capture	SOLID	Phase_I	12564138	NM_030640	Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	ENST00000228862.2	37	CCDS8650.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636591	0.47049	.	.	ENSG00000111266	ENST00000228862;ENST00000298573	T;T	0.47869	0.83;0.83	5.75	5.75	0.90469	Rhodanese-like (5);	0.175657	0.39341	N	0.001395	T	0.38719	0.1051	L	0.31664	0.95	0.44627	D	0.997604	B	0.26041	0.14	B	0.33799	0.17	T	0.28522	-1.0041	10	0.49607	T	0.09	.	9.6911	0.40129	0.0728:0.1422:0.785:0.0	.	98	Q9BY84	DUS16_HUMAN	V	98	ENSP00000228862:L98V;ENSP00000298573:L98V	ENSP00000228862:L98V	L	-	1	0	DUSP16	12564138	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.815000	0.69215	2.716000	0.92895	0.655000	0.94253	CTC		0.438	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	NM_030640	
RNF10	9921	hgsc.bcm.edu	37	12	120984350	120984350	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:120984350C>T	ENST00000325954.4	+	2	761	c.300C>T	c.(298-300)ggC>ggT	p.G100G	RNF10_ENST00000413266.2_Silent_p.G100G	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	100	Ser-rich.				negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G100G(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTCAAAGGGGCGGCGGCAGCA	0.438																																					p.G100G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C300T	12						.						69.0	71.0	70.0					12																	120984350		2203	4300	6503	119468733	SO:0001819	synonymous_variant	9921	exon2			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.300C>T	12.37:g.120984350C>T		Somatic		Capture	SOLID	Phase_I	119468733	NM_014868	Q92550|Q9NPP8|Q9ULW4	Silent	SNP	ENST00000325954.4	37	CCDS9201.1																																																																																				0.438	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
TULP3	7289	hgsc.bcm.edu	37	12	3031509	3031509	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:3031509C>T	ENST00000448120.2	+	4	386	c.335C>T	c.(334-336)gCt>gTt	p.A112V	TULP3_ENST00000397132.2_Missense_Mutation_p.A112V	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	112					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)	p.A112V(1)		endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GAAGAAGATGCTGAAAACACC	0.458																																					p.A112V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C335T	12						.						151.0	135.0	140.0					12																	3031509		2203	4300	6503	2901770	SO:0001583	missense	7289	exon4			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.335C>T	12.37:g.3031509C>T	ENSP00000410051:p.Ala112Val	Somatic		Capture	SOLID	Phase_I	2901770	NM_001160408	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075838	0.36662	.	.	ENSG00000078246	ENST00000535226;ENST00000228245;ENST00000448120;ENST00000397132	D;D	0.92397	-3.01;-3.03	4.67	2.84	0.33178	.	1.374730	0.04500	N	0.381121	D	0.87010	0.6071	N	0.24115	0.695	0.23645	N	0.997216	B;B	0.22683	0.0;0.073	B;B	0.20955	0.004;0.032	T	0.73940	-0.3824	10	0.38643	T	0.18	-26.8147	9.4573	0.38762	0.0:0.8259:0.0:0.1741	.	112;112	O75386;F8WBZ9	TULP3_HUMAN;.	V	93;112;112;112	ENSP00000410051:A112V;ENSP00000380321:A112V	ENSP00000228245:A112V	A	+	2	0	TULP3	2901770	0.000000	0.05858	0.001000	0.08648	0.086000	0.17979	-0.636000	0.05465	0.600000	0.29862	0.549000	0.68633	GCT		0.458	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
TULP3	7289	hgsc.bcm.edu	37	12	3043656	3043656	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:3043656A>G	ENST00000448120.2	+	8	904	c.853A>G	c.(853-855)Atc>Gtc	p.I285V	TULP3_ENST00000397132.2_Missense_Mutation_p.I285V	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	285					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGACCGTGGCATCTGCCCCAT	0.532																																					p.I285V												.	.	0			c.A853G	12						.						132.0	138.0	136.0					12																	3043656		2203	4300	6503	2913917	SO:0001583	missense	7289	exon8			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.853A>G	12.37:g.3043656A>G	ENSP00000410051:p.Ile285Val	Somatic		Capture	SOLID	Phase_I	2913917	NM_001160408	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.137355	0.00335	.	.	ENSG00000078246	ENST00000228245;ENST00000544943;ENST00000542730;ENST00000448120;ENST00000397132	D;D;D	0.95949	-3.86;-3.86;-3.86	5.2	3.36	0.38483	Tubby, C-terminal (4);	0.471757	0.24330	N	0.039478	T	0.79839	0.4515	N	0.00517	-1.405	0.09310	N	0.999997	B;B;B	0.13145	0.0;0.0;0.007	B;B;B	0.11329	0.006;0.006;0.006	T	0.70070	-0.4973	10	0.02654	T	1	2.9613	9.8119	0.40828	0.1688:0.0:0.8312:0.0	.	142;285;285	B7Z1E7;O75386;F8WBZ9	.;TULP3_HUMAN;.	V	285;12;142;285;285	ENSP00000442631:I12V;ENSP00000410051:I285V;ENSP00000380321:I285V	ENSP00000228245:I285V	I	+	1	0	TULP3	2913917	0.016000	0.18221	0.630000	0.29268	0.024000	0.10985	1.327000	0.33746	0.568000	0.29311	-0.366000	0.07423	ATC		0.532	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
VAMP1	6843	hgsc.bcm.edu	37	12	6575428	6575428	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:6575428T>A	ENST00000396308.3	-	2	237	c.92A>T	c.(91-93)aAc>aTc	p.N31I	VAMP1_ENST00000400911.3_Missense_Mutation_p.N31I|VAMP1_ENST00000544432.1_Intron|VAMP1_ENST00000535180.1_Missense_Mutation_p.N31I|TAPBPL_ENST00000545700.1_3'UTR|VAMP1_ENST00000361716.3_Missense_Mutation_p.N31I	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)	31					neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)		p.N31I(1)		endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	TAGTCGTCTGTTACTGGTCAT	0.532																																					p.N31I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A92T	12						.						125.0	133.0	130.0					12																	6575428		2203	4300	6503	6445689	SO:0001583	missense	6843	exon2				CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.92A>T	12.37:g.6575428T>A	ENSP00000379602:p.Asn31Ile	Somatic		Capture	SOLID	Phase_I	6445689	NM_016830	A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	Missense_Mutation	SNP	ENST00000396308.3	37	CCDS41740.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.741570	0.89573	.	.	ENSG00000139190	ENST00000400911;ENST00000361716;ENST00000535180;ENST00000355479;ENST00000396308;ENST00000396943;ENST00000539047	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	4.83	4.83	0.62350	Synaptobrevin (1);	0.000000	0.85682	D	0.000000	T	0.71937	0.3399	M	0.94021	3.485	0.80722	D	1	D;D;D	0.54397	0.957;0.966;0.957	P;P;P	0.56865	0.808;0.796;0.808	T	0.80915	-0.1169	10	0.72032	D	0.01	.	14.8575	0.70351	0.0:0.0:0.0:1.0	.	31;31;31	P23763-3;P23763;P23763-2	.;VAMP1_HUMAN;.	I	31	ENSP00000383702:N31I;ENSP00000355122:N31I;ENSP00000444181:N31I;ENSP00000379602:N31I	ENSP00000347664:N31I	N	-	2	0	VAMP1	6445689	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.803000	0.85983	2.150000	0.67090	0.528000	0.53228	AAC		0.532	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399078.1		
CHD4	1108	hgsc.bcm.edu	37	12	6710568	6710568	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:6710568G>A	ENST00000357008.2	-	6	849	c.686C>T	c.(685-687)gCg>gTg	p.A229V	CHD4_ENST00000309577.6_Missense_Mutation_p.A229V|CHD4_ENST00000544484.1_Missense_Mutation_p.A226V|CHD4_ENST00000544040.1_Missense_Mutation_p.A222V	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	229	Poly-Ala.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.A229V(1)		central_nervous_system(2)	2						TGCTGCTGCCGCAGCTGCCAC	0.572																																					p.A229V	Colon(32;586 792 4568 16848 45314)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C686T	12						.						90.0	101.0	97.0					12																	6710568		2203	4300	6503	6580829	SO:0001583	missense	1108	exon6			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.686C>T	12.37:g.6710568G>A	ENSP00000349508:p.Ala229Val	Somatic		Capture	SOLID	Phase_I	6580829	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992813	0.54041	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90900	-2.74;-2.75;-2.73;-2.75;0.57	5.87	5.87	0.94306	.	0.061218	0.64402	D	0.000004	D	0.89001	0.6591	M	0.80183	2.485	0.53005	D	0.99996	B;P;B	0.36909	0.009;0.573;0.009	B;B;B	0.25759	0.007;0.063;0.007	D	0.89117	0.3500	10	0.59425	D	0.04	1.583	13.4113	0.60944	0.0715:0.0:0.9285:0.0	.	229;229;222	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	V	226;222;229;229;203;229	ENSP00000440392:A226V;ENSP00000440542:A222V;ENSP00000312419:A229V;ENSP00000349508:A229V;ENSP00000437506:A229V	ENSP00000312419:A229V	A	-	2	0	CHD4	6580829	1.000000	0.71417	0.172000	0.22920	0.331000	0.28603	5.887000	0.69751	2.774000	0.95407	0.650000	0.86243	GCG		0.572	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
CD163L1	283316	hgsc.bcm.edu	37	12	7522247	7522247	+	Missense_Mutation	SNP	G	G	A	rs142773410	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:7522247G>A	ENST00000313599.3	-	15	3802	c.3745C>T	c.(3745-3747)Cgt>Tgt	p.R1249C	CD163L1_ENST00000416109.2_Missense_Mutation_p.R1259C|CD163L1_ENST00000396630.1_Missense_Mutation_p.R1249C			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1249	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.R1249C(2)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TCTCCTCCACGCACTCTTATT	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.0		0.001	False		,,,				2504	0.0				p.R1249C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C3745T	12						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	65.0	65.0	65.0		3745	-4.8	0.0	12	dbSNP_134	65	0,8600		0,0,4300	no	missense	CD163L1	NM_174941.4	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1249/1454	7522247	1,13005	2203	4300	6503	7413514	SO:0001583	missense	283316	exon15			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3745C>T	12.37:g.7522247G>A	ENSP00000315945:p.Arg1249Cys	Somatic		Capture	SOLID	Phase_I	7413514	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	12.52	1.962352	0.34659	2.27E-4	0.0	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.29142	1.58;1.58;1.58	2.81	-4.82	0.03171	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	2.995580	0.02158	U	0.058542	T	0.49966	0.1588	M	0.76574	2.34	0.09310	N	1	D;D	0.89917	0.998;1.0	D;D	0.69479	0.93;0.964	T	0.56245	-0.8011	10	0.46703	T	0.11	.	6.6918	0.23177	0.0:0.1271:0.6383:0.2346	.	1259;1249	E7EVK4;Q9NR16	.;C163B_HUMAN	C	1249;1259;1249	ENSP00000315945:R1249C;ENSP00000393474:R1259C;ENSP00000379871:R1249C	ENSP00000315945:R1249C	R	-	1	0	CD163L1	7413514	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.227000	0.09126	-0.816000	0.04340	-0.457000	0.05445	CGT		0.522	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
CD163L1	283316	hgsc.bcm.edu	37	12	7548722	7548722	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:7548722A>C	ENST00000313599.3	-	8	2076	c.2019T>G	c.(2017-2019)agT>agG	p.S673R	CD163L1_ENST00000416109.2_Missense_Mutation_p.S683R|CD163L1_ENST00000396630.1_Missense_Mutation_p.S673R			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	673	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.S673R(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CTTCACTGTGACTGCAGTCAT	0.443																																					p.S673R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2019G	12						.						82.0	67.0	72.0					12																	7548722		2203	4300	6503	7439989	SO:0001583	missense	283316	exon8			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2019T>G	12.37:g.7548722A>C	ENSP00000315945:p.Ser673Arg	Somatic		Capture	SOLID	Phase_I	7439989	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	A	4.320	0.058731	0.08339	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.31510	1.49;1.49;1.49	2.23	1.01	0.19927	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	2.299120	0.02810	N	0.124233	T	0.37404	0.1002	N	0.26130	0.795	0.18873	N	0.999985	P;D	0.60160	0.942;0.987	P;P	0.62649	0.58;0.905	T	0.29397	-1.0013	10	0.25106	T	0.35	.	5.8174	0.18500	0.763:0.0:0.0:0.237	.	683;673	E7EVK4;Q9NR16	.;C163B_HUMAN	R	673;683;673	ENSP00000315945:S673R;ENSP00000393474:S683R;ENSP00000379871:S673R	ENSP00000315945:S673R	S	-	3	2	CD163L1	7439989	0.000000	0.05858	0.006000	0.13384	0.005000	0.04900	-2.624000	0.00876	0.259000	0.21709	-0.503000	0.04515	AGT		0.443	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
SLC2A13	114134	hgsc.bcm.edu	37	12	40258656	40258656	+	Silent	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:40258656G>T	ENST00000280871.4	-	6	1277	c.1227C>A	c.(1225-1227)gcC>gcA	p.A409A		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	409					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.A390A(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				CAAATCCCAAGGCAAGAATAA	0.403										HNSCC(50;0.14)																											p.A409A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1227A	12						.						169.0	150.0	156.0					12																	40258656		2203	4300	6503	38544923	SO:0001819	synonymous_variant	114134	exon6			AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1227C>A	12.37:g.40258656G>T		Somatic		Capture	SOLID	Phase_I	38544923	NM_052885	Q17S07	Silent	SNP	ENST00000280871.4	37	CCDS8736.2																																																																																				0.403	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
DBX2	440097	hgsc.bcm.edu	37	12	45429876	45429876	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:45429876A>G	ENST00000332700.6	-	2	596	c.425T>C	c.(424-426)cTg>cCg	p.L142P		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	142					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L142P(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		cggggtgctcagaaggaaagg	0.458																																					p.L142P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T425C	12						.						68.0	75.0	73.0					12																	45429876		2203	4300	6503	43716143	SO:0001583	missense	440097	exon2				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.425T>C	12.37:g.45429876A>G	ENSP00000331470:p.Leu142Pro	Somatic		Capture	SOLID	Phase_I	43716143	NM_001004329		Missense_Mutation	SNP	ENST00000332700.6	37	CCDS31781.1	.	.	.	.	.	.	.	.	.	.	A	14.01	2.408243	0.42715	.	.	ENSG00000185610	ENST00000332700	D	0.91521	-2.86	5.65	4.49	0.54785	.	0.290551	0.24752	N	0.035893	D	0.90256	0.6953	L	0.34521	1.04	0.80722	D	1	D	0.64830	0.994	P	0.58077	0.832	D	0.88306	0.2953	10	0.33940	T	0.23	-2.781	13.0969	0.59197	0.8659:0.1341:0.0:0.0	.	142	Q6ZNG2	DBX2_HUMAN	P	142	ENSP00000331470:L142P	ENSP00000331470:L142P	L	-	2	0	DBX2	43716143	1.000000	0.71417	0.658000	0.29665	0.538000	0.34931	6.533000	0.73829	1.049000	0.40321	0.533000	0.62120	CTG		0.458	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1	NM_001004329	
PCED1B	91523	hgsc.bcm.edu	37	12	47629063	47629063	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:47629063G>A	ENST00000546455.1	+	4	948	c.217G>A	c.(217-219)Ggc>Agc	p.G73S	PCED1B_ENST00000432328.1_Missense_Mutation_p.G73S|RP11-493L12.3_ENST00000547748.1_RNA			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	73							hydrolase activity (GO:0016787)	p.G73S(1)									CATGCACAACGGCCTTAACTA	0.597																																					p.G73S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G217A	12						.						108.0	98.0	101.0					12																	47629063		2203	4300	6503	45915330	SO:0001583	missense	91523	exon2			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.217G>A	12.37:g.47629063G>A	ENSP00000446688:p.Gly73Ser	Somatic		Capture	SOLID	Phase_I	45915330	NM_138371	Q96B20	Missense_Mutation	SNP	ENST00000546455.1	37	CCDS8752.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272405	0.40194	.	.	ENSG00000179715	ENST00000546455;ENST00000432328;ENST00000549500;ENST00000549630	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	3.79	0.844	0.18943	Esterase, SGNH hydrolase-type (1);	0.154442	0.41823	D	0.000804	T	0.35653	0.0939	M	0.80183	2.485	0.36115	D	0.845064	D	0.71674	0.998	D	0.68483	0.958	T	0.34354	-0.9832	10	0.49607	T	0.09	-18.9126	7.4569	0.27272	0.1034:0.5363:0.3603:0.0	.	73	Q96HM7	F113B_HUMAN	S	73	ENSP00000446688:G73S;ENSP00000396040:G73S;ENSP00000449680:G73S;ENSP00000448000:G73S	ENSP00000396040:G73S	G	+	1	0	FAM113B	45915330	1.000000	0.71417	0.253000	0.24343	0.021000	0.10359	3.271000	0.51608	0.176000	0.19873	0.655000	0.94253	GGC		0.597	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
RACGAP1	29127	hgsc.bcm.edu	37	12	50390943	50390943	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:50390943T>A	ENST00000427314.2	-	12	1147	c.924A>T	c.(922-924)aaA>aaT	p.K308N	RACGAP1_ENST00000551016.1_Missense_Mutation_p.K308N|RACGAP1_ENST00000434422.1_Missense_Mutation_p.K308N|RACGAP1_ENST00000312377.5_Missense_Mutation_p.K308N|RACGAP1_ENST00000454520.2_Missense_Mutation_p.K308N|RACGAP1_ENST00000547905.1_Missense_Mutation_p.K308N|RACGAP1_ENST00000547061.1_5'UTR	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1									p.K308N(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						ATTTGCCAAATTTTATCCGCT	0.438																																					p.K308N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A924T	12						.						74.0	66.0	69.0					12																	50390943		2203	4300	6503	48677210	SO:0001583	missense	29127	exon12				CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.924A>T	12.37:g.50390943T>A	ENSP00000404190:p.Lys308Asn	Somatic		Capture	SOLID	Phase_I	48677210	NM_013277		Missense_Mutation	SNP	ENST00000427314.2	37	CCDS8795.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.524752	0.85600	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000548320	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.61	0.534	0.17127	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.89515	0.6737	M	0.79475	2.455	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.85683	0.1302	10	0.26408	T	0.33	-23.0953	9.9683	0.41738	0.0:0.4647:0.0:0.5353	.	308	Q9H0H5	RGAP1_HUMAN	N	308;308;308;308;308;308;25	ENSP00000404190:K308N;ENSP00000309871:K308N;ENSP00000413241:K308N;ENSP00000404808:K308N;ENSP00000449374:K308N;ENSP00000449370:K308N;ENSP00000448507:K25N	ENSP00000309871:K308N	K	-	3	2	RACGAP1	48677210	0.999000	0.42202	1.000000	0.80357	0.949000	0.60115	0.612000	0.24283	0.101000	0.17610	0.533000	0.62120	AAA		0.438	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277	
SMARCD1	6602	hgsc.bcm.edu	37	12	50483720	50483720	+	Silent	SNP	G	G	A	rs1050726		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:50483720G>A	ENST00000394963.4	+	7	1223	c.825G>A	c.(823-825)ccG>ccA	p.P275P	SMARCD1_ENST00000548573.1_Silent_p.P73P|SMARCD1_ENST00000381513.4_Silent_p.P275P	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1									p.P236P(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						TGAAGCGGCCGGGAGACGTGA	0.572																																					p.P275P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G825A	12						.	G	,	0,4406		0,0,2203	229.0	198.0	208.0		825,825	0.2	1.0	12	dbSNP_86	208	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SMARCD1	NM_003076.4,NM_139071.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	275/516,275/475	50483720	1,13005	2203	4300	6503	48769987	SO:0001819	synonymous_variant	6602	exon7			U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.825G>A	12.37:g.50483720G>A		Somatic		Capture	SOLID	Phase_I	48769987	NM_139071		Silent	SNP	ENST00000394963.4	37	CCDS8797.2																																																																																				0.572	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076	
KRT76	51350	hgsc.bcm.edu	37	12	53170645	53170645	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:53170645C>T	ENST00000332411.2	-	1	484	c.431G>A	c.(430-432)gGt>gAt	p.G144D		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	144	Head.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.G144D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GCCAAAGccaccaggaccacc	0.582																																					p.G144D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G431A	12						.						172.0	181.0	178.0					12																	53170645		2203	4299	6502	51456912	SO:0001583	missense	51350	exon1			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.431G>A	12.37:g.53170645C>T	ENSP00000330101:p.Gly144Asp	Somatic		Capture	SOLID	Phase_I	51456912	NM_015848	B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	37	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	C	8.138	0.784530	0.16189	.	.	ENSG00000185069	ENST00000332411	D	0.98747	-5.11	4.34	3.43	0.39272	.	0.000000	0.44483	D	0.000457	D	0.98560	0.9519	M	0.90650	3.135	0.43377	D	0.995472	D	0.59767	0.986	P	0.51415	0.669	D	0.98346	1.0541	10	0.62326	D	0.03	.	9.6404	0.39835	0.0:0.7754:0.1451:0.0795	.	144	Q01546	K22O_HUMAN	D	144	ENSP00000330101:G144D	ENSP00000330101:G144D	G	-	2	0	KRT76	51456912	1.000000	0.71417	0.991000	0.47740	0.291000	0.27294	3.362000	0.52314	1.386000	0.46466	0.455000	0.32223	GGT		0.582	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
CSAD	51380	hgsc.bcm.edu	37	12	53552447	53552447	+	Missense_Mutation	SNP	G	G	A	rs374597733		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:53552447G>A	ENST00000444623.1	-	17	1597	c.1330C>T	c.(1330-1332)Cgc>Tgc	p.R444C	CSAD_ENST00000453446.2_Missense_Mutation_p.R444C|RP11-1136G11.8_ENST00000550908.1_lincRNA|CSAD_ENST00000379843.3_Missense_Mutation_p.R297C|CSAD_ENST00000379846.1_Missense_Mutation_p.R297C|CSAD_ENST00000267085.4_Missense_Mutation_p.R471C	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	444					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)	p.R444C(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	TTCACCATGCGCTCCTTGAGC	0.622													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18748	0.0		0.0	False		,,,				2504	0.0				p.R471C	Ovarian(109;252 1546 16882 28524 44645)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1411T	12						.						53.0	41.0	45.0					12																	53552447		2203	4300	6503	51838714	SO:0001583	missense	51380	exon17			AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1330C>T	12.37:g.53552447G>A	ENSP00000415485:p.Arg444Cys	Somatic		Capture	SOLID	Phase_I	51838714	NM_015989	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	ENST00000444623.1	37	CCDS58235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.004875|4.004875	0.74932|0.74932	.|.	.|.	ENSG00000139631|ENSG00000139631	ENST00000379850|ENST00000308926;ENST00000379843;ENST00000267085;ENST00000379846;ENST00000444623;ENST00000398047;ENST00000453446	.|T;T;T;T;T	.|0.42131	.|0.98;0.98;0.98;0.98;0.98	4.49|4.49	4.49|4.49	0.54785|0.54785	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65080|0.65080	0.2657|0.2657	M|M	0.90759|0.90759	3.145|3.145	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.989;0.999	.|P;P;P	.|0.62491	.|0.89;0.779;0.903	T|T	0.71451|0.71451	-0.4589|-0.4589	5|10	.|0.72032	.|D	.|0.01	-15.5893|-15.5893	10.233|10.233	0.43266|0.43266	0.0:0.0:0.6914:0.3086|0.0:0.0:0.6914:0.3086	.|.	.|471;444;297	.|Q9Y600-3;Q9Y600;Q9Y600-2	.|.;CSAD_HUMAN;.	V|C	469|533;297;471;297;444;405;444	.|ENSP00000369172:R297C;ENSP00000267085:R471C;ENSP00000369175:R297C;ENSP00000415485:R444C;ENSP00000410648:R444C	.|ENSP00000267085:R471C	A|R	-|-	2|1	0|0	CSAD|CSAD	51838714|51838714	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	2.630000|2.630000	0.46494|0.46494	2.505000|2.505000	0.84491|0.84491	0.442000|0.442000	0.29010|0.29010	GCG|CGC		0.622	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989	
RARG	5916	hgsc.bcm.edu	37	12	53607911	53607911	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:53607911G>A	ENST00000425354.2	-	7	1232	c.745C>T	c.(745-747)Cct>Tct	p.P249S	RARG_ENST00000394426.1_Missense_Mutation_p.P249S|RARG_ENST00000338561.5_Missense_Mutation_p.P238S|RARG_ENST00000327550.3_Missense_Mutation_p.P177S|RARG_ENST00000543726.1_Missense_Mutation_p.P227S|RARG_ENST00000543762.1_5'UTR	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	249	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.P249S(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	GTAAAGCCAGGCAACCGCTTG	0.567											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P249S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C745T	12						.						164.0	156.0	159.0					12																	53607911		2203	4300	6503	51894178	SO:0001583	missense	5916	exon7			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.745C>T	12.37:g.53607911G>A	ENSP00000388510:p.Pro249Ser	Somatic	993	Capture	SOLID	Phase_I	51894178	NM_000966	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	ENST00000425354.2	37	CCDS8850.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804270	0.90623	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000538479;ENST00000327550;ENST00000338561;ENST00000543726;ENST00000550265	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.37	5.37	0.77165	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.86619	0.5976	M	0.87758	2.905	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;0.995;0.999;1.0	D	0.88540	0.3109	10	0.87932	D	0	.	18.259	0.90028	0.0:0.0:1.0:0.0	.	286;227;249;238	F8VR45;B7Z4F1;P13631;F1D8P1	.;.;RARG_HUMAN;.	S	249;249;11;177;238;227;286	ENSP00000388510:P249S;ENSP00000377947:P249S;ENSP00000332695:P177S;ENSP00000343698:P238S;ENSP00000444335:P227S	ENSP00000332695:P177S	P	-	1	0	RARG	51894178	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.790000	0.99075	2.688000	0.91661	0.563000	0.77884	CCT		0.567	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109404.2	NM_000966	
MMP19	4327	hgsc.bcm.edu	37	12	56234517	56234517	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:56234517C>T	ENST00000322569.4	-	4	545	c.454G>A	c.(454-456)Gct>Act	p.A152T	MMP19_ENST00000409200.3_Missense_Mutation_p.A152T|MMP19_ENST00000394182.1_5'Flank|MMP19_ENST00000547487.1_5'Flank|MMP19_ENST00000548629.1_Missense_Mutation_p.A129T	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	152					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A152T(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	CGGATGTCAGCCGCACCAGCC	0.592																																					p.A152T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G454A	12						.						82.0	81.0	81.0					12																	56234517		2203	4300	6503	54520784	SO:0001583	missense	4327	exon4			X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.454G>A	12.37:g.56234517C>T	ENSP00000313437:p.Ala152Thr	Somatic		Capture	SOLID	Phase_I	54520784	NM_002429	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597270	0.46318	.	.	ENSG00000123342	ENST00000322569;ENST00000548629;ENST00000409200	T;T;T	0.24151	2.18;1.87;2.18	5.8	5.8	0.92144	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.100449	0.64402	D	0.000002	T	0.62282	0.2415	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.986	T	0.69946	-0.5007	10	0.87932	D	0	.	18.8182	0.92085	0.0:1.0:0.0:0.0	.	152;152	B4E030;Q99542	.;MMP19_HUMAN	T	152;129;152	ENSP00000313437:A152T;ENSP00000446979:A129T;ENSP00000386625:A152T	ENSP00000313437:A152T	A	-	1	0	MMP19	54520784	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	5.439000	0.66556	2.749000	0.94314	0.655000	0.94253	GCT		0.592	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
ESYT1	23344	hgsc.bcm.edu	37	12	56536452	56536452	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:56536452G>A	ENST00000394048.5	+	26	3088	c.2824G>A	c.(2824-2826)Ggg>Agg	p.G942R	ESYT1_ENST00000550878.1_3'UTR|ESYT1_ENST00000267113.4_Missense_Mutation_p.G952R|ESYT1_ENST00000541590.1_Missense_Mutation_p.G952R	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	942					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						AGAGCTCTCGGGGGGACCCCC	0.607																																					p.G942R												.	.	0			c.G2824A	12						.						45.0	49.0	47.0					12																	56536452		2203	4300	6503	54822719	SO:0001583	missense	23344	exon26			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2824G>A	12.37:g.56536452G>A	ENSP00000377612:p.Gly942Arg	Somatic		Capture	SOLID	Phase_I	54822719	NM_015292	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	G	8.681	0.905084	0.17760	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.54071	0.59;0.61;0.61	4.55	3.66	0.41972	.	0.320530	0.26951	N	0.021674	T	0.41604	0.1166	L	0.40543	1.245	0.09310	N	1	B;B	0.29085	0.145;0.232	B;B	0.33254	0.048;0.16	T	0.24297	-1.0164	10	0.23891	T	0.37	-7.6682	8.7365	0.34532	0.1038:0.0:0.8962:0.0	.	952;942	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	R	942;896;952;952	ENSP00000377612:G942R;ENSP00000267113:G952R;ENSP00000445952:G952R	ENSP00000267113:G952R	G	+	1	0	ESYT1	54822719	0.004000	0.15560	0.005000	0.12908	0.092000	0.18411	1.148000	0.31614	1.286000	0.44565	0.561000	0.74099	GGG		0.607	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
PIP4K2C	79837	hgsc.bcm.edu	37	12	57994684	57994684	+	Missense_Mutation	SNP	G	G	A	rs145883345		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:57994684G>A	ENST00000354947.5	+	8	920	c.904G>A	c.(904-906)Gtg>Atg	p.V302M	PIP4K2C_ENST00000422156.3_Missense_Mutation_p.V254M|PIP4K2C_ENST00000550465.1_Missense_Mutation_p.V284M|PIP4K2C_ENST00000540759.2_Missense_Mutation_p.V302M			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	302	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)	p.V302M(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					GGAAGCGCCCGTGCGGGAGGA	0.587																																					p.V302M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G904A	12						.						145.0	149.0	148.0					12																	57994684		2203	4300	6503	56280951	SO:0001583	missense	79837	exon8			AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.904G>A	12.37:g.57994684G>A	ENSP00000347032:p.Val302Met	Somatic		Capture	SOLID	Phase_I	56280951	NM_001146258	B2RDL3|B4DM11|B4DY44|Q9H6N2	Missense_Mutation	SNP	ENST00000354947.5	37	CCDS8946.1	.	.	.	.	.	.	.	.	.	.	G	4.595	0.110603	0.08780	.	.	ENSG00000166908	ENST00000422156;ENST00000540759;ENST00000550465;ENST00000354947	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	4.91	2.09	0.27110	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	8.936830	0.00622	N	0.000458	T	0.28167	0.0695	L	0.32530	0.975	0.09310	N	1	B;B;B	0.23442	0.085;0.033;0.049	B;B;B	0.23419	0.046;0.007;0.046	T	0.24799	-1.0150	10	0.48119	T	0.1	-0.0208	8.0646	0.30652	0.2635:0.0:0.7365:0.0	.	254;284;302	B4DM11;B4DY44;Q8TBX8	.;.;PI42C_HUMAN	M	254;302;284;302	ENSP00000412035:V254M;ENSP00000439878:V302M;ENSP00000447390:V284M;ENSP00000347032:V302M	ENSP00000347032:V302M	V	+	1	0	PIP4K2C	56280951	0.007000	0.16637	0.004000	0.12327	0.123000	0.20343	1.543000	0.36147	0.226000	0.20979	-0.350000	0.07774	GTG		0.587	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407644.1	NM_024779	
OS9	10956	hgsc.bcm.edu	37	12	58088618	58088618	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:58088618A>G	ENST00000315970.7	+	2	289	c.248A>G	c.(247-249)cAg>cGg	p.Q83R	OS9_ENST00000551035.1_Missense_Mutation_p.Q83R|OS9_ENST00000389142.5_Missense_Mutation_p.Q83R|OS9_ENST00000257966.8_Missense_Mutation_p.Q83R|OS9_ENST00000435406.2_Missense_Mutation_p.Q83R|OS9_ENST00000413095.2_Missense_Mutation_p.Q83R|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000439210.2_Intron|OS9_ENST00000552285.1_Missense_Mutation_p.Q83R|OS9_ENST00000389146.6_Missense_Mutation_p.Q83R	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	83					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)	p.Q83R(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			ATTCACTTCCAGCGTGAAAGG	0.537																																					p.Q83R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A248G	12						.						111.0	98.0	103.0					12																	58088618		2203	4300	6503	56374885	SO:0001583	missense	10956	exon2			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.248A>G	12.37:g.58088618A>G	ENSP00000318165:p.Gln83Arg	Somatic		Capture	SOLID	Phase_I	56374885	NM_001017958	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	ENST00000315970.7	37	CCDS31843.1	.	.	.	.	.	.	.	.	.	.	A	18.06	3.540489	0.65085	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000547079;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000550372;ENST00000389142	T;T;T;T;T;T;T;T;T	0.44881	1.92;1.92;0.91;1.92;1.52;1.93;1.92;1.92;1.92	4.87	4.87	0.63330	.	0.054749	0.64402	D	0.000001	T	0.37758	0.1015	N	0.14661	0.345	0.44587	D	0.997552	D;P;P;P;P;B;P	0.56035	0.974;0.956;0.758;0.956;0.645;0.389;0.913	P;P;B;P;B;B;B	0.53861	0.736;0.549;0.245;0.549;0.124;0.065;0.282	T	0.15578	-1.0432	10	0.29301	T	0.29	.	13.5877	0.61942	1.0:0.0:0.0:0.0	.	83;83;83;83;83;83;83	F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;OS9_HUMAN	R	83	ENSP00000450010:Q83R;ENSP00000318165:Q83R;ENSP00000447031:Q83R;ENSP00000373798:Q83R;ENSP00000413112:Q83R;ENSP00000447866:Q83R;ENSP00000257966:Q83R;ENSP00000389632:Q83R;ENSP00000373794:Q83R	ENSP00000257966:Q83R	Q	+	2	0	OS9	56374885	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.466000	0.80914	2.043000	0.60533	0.260000	0.18958	CAG		0.537	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408344.1	NM_006812	
MON2	23041	hgsc.bcm.edu	37	12	62926407	62926407	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:62926407G>T	ENST00000393632.2	+	12	1981	c.1590G>T	c.(1588-1590)caG>caT	p.Q530H	MON2_ENST00000393630.3_Missense_Mutation_p.Q530H|MON2_ENST00000552738.1_Missense_Mutation_p.Q530H|MON2_ENST00000546600.1_Missense_Mutation_p.Q530H|MON2_ENST00000393629.2_Missense_Mutation_p.Q530H|MON2_ENST00000280379.6_Missense_Mutation_p.Q530H|MON2_ENST00000552115.1_Missense_Mutation_p.Q530H	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	530					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.Q530H(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		CGACAGAACAGCAGGATTTAC	0.358																																					p.Q530H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1590T	12						.						135.0	125.0	128.0					12																	62926407		2203	4300	6503	61212674	SO:0001583	missense	23041	exon12				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.1590G>T	12.37:g.62926407G>T	ENSP00000377252:p.Gln530His	Somatic		Capture	SOLID	Phase_I	61212674	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	G	9.613	1.131874	0.21041	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.51;0.5;0.51	5.4	3.47	0.39725	.	0.510995	0.21479	N	0.073873	T	0.27027	0.0662	N	0.08118	0	0.33877	D	0.635646	B;B;B;B	0.33512	0.138;0.216;0.415;0.216	B;B;B;B	0.34301	0.037;0.117;0.179;0.081	T	0.26155	-1.0111	9	.	.	.	0.1771	4.7531	0.13070	0.1697:0.0:0.5133:0.317	.	530;530;530;530	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	H	530;530;530;530;458;530;530;530	ENSP00000377252:Q530H;ENSP00000377250:Q530H;ENSP00000280379:Q530H;ENSP00000447407:Q530H;ENSP00000449215:Q530H;ENSP00000377249:Q530H;ENSP00000446635:Q530H	.	Q	+	3	2	MON2	61212674	0.998000	0.40836	0.999000	0.59377	0.976000	0.68499	0.631000	0.24568	0.545000	0.28902	0.563000	0.77884	CAG		0.358	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
CAND1	55832	hgsc.bcm.edu	37	12	67692852	67692852	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:67692852A>C	ENST00000545606.1	+	7	1414	c.977A>C	c.(976-978)gAt>gCt	p.D326A		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	326	Asp-rich.				cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.D326A(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		atggatgctgatggtggtgat	0.299																																					p.D326A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A977C	12						.						42.0	39.0	40.0					12																	67692852		2197	4296	6493	65979119	SO:0001583	missense	55832	exon7				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.977A>C	12.37:g.67692852A>C	ENSP00000442318:p.Asp326Ala	Somatic		Capture	SOLID	Phase_I	65979119	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.714223	0.48622	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047;ENST00000544619	T;T	0.66638	-0.22;-0.22	5.57	5.57	0.84162	Armadillo-type fold (1);	0.163828	0.52532	D	0.000068	T	0.62624	0.2443	L	0.50333	1.59	0.58432	D	0.999999	B;B	0.30146	0.026;0.27	B;B	0.32465	0.037;0.146	T	0.59600	-0.7424	9	.	.	.	-10.3833	15.3948	0.74784	1.0:0.0:0.0:0.0	.	326;326	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	A	326;326;168;34	ENSP00000442318:D326A;ENSP00000444089:D34A	.	D	+	2	0	CAND1	65979119	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.951000	0.93025	2.102000	0.63906	0.533000	0.62120	GAT		0.299	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
DYRK2	8445	hgsc.bcm.edu	37	12	68051803	68051803	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:68051803T>A	ENST00000344096.3	+	3	1529	c.1116T>A	c.(1114-1116)agT>agA	p.S372R	DYRK2_ENST00000393555.3_Missense_Mutation_p.S299R|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	372	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)	p.S372R(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		TTGGCTCCAGTTGTTACGAGC	0.453																																					p.S299R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T897A	12						.						117.0	114.0	115.0					12																	68051803		2203	4300	6503	66338070	SO:0001583	missense	8445	exon2			Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.1116T>A	12.37:g.68051803T>A	ENSP00000342105:p.Ser372Arg	Somatic		Capture	SOLID	Phase_I	66338070	NM_003583	B2R9V9|Q9BRB5	Missense_Mutation	SNP	ENST00000344096.3	37	CCDS8978.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.683399	0.47991	.	.	ENSG00000127334	ENST00000344096;ENST00000393555	T;T	0.70631	-0.5;-0.5	5.45	-0.112	0.13572	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82706	0.5095	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81095	-0.1088	9	.	.	.	.	10.1736	0.42924	0.0:0.3924:0.0:0.6076	.	372	Q92630	DYRK2_HUMAN	R	372;299	ENSP00000342105:S372R;ENSP00000377186:S299R	.	S	+	3	2	DYRK2	66338070	0.935000	0.31712	0.997000	0.53966	0.872000	0.50106	0.047000	0.14056	-0.177000	0.10690	0.254000	0.18369	AGT		0.453	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402218.1		
CPSF6	11052	hgsc.bcm.edu	37	12	69652698	69652698	+	Silent	SNP	G	G	A	rs559355987		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:69652698G>A	ENST00000435070.2	+	6	1133	c.1023G>A	c.(1021-1023)ccG>ccA	p.P341P	CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000266679.8_Silent_p.P378P|CPSF6_ENST00000456847.3_Silent_p.P268P	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	341	Pro-rich.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P341P(2)		endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			CTCCTCCTCCGCATCTTCCTG	0.612																																					p.P341P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1023A	12						.						127.0	123.0	124.0					12																	69652698		2203	4300	6503	67938965	SO:0001819	synonymous_variant	11052	exon6			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1023G>A	12.37:g.69652698G>A		Somatic		Capture	SOLID	Phase_I	67938965	NM_007007	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Silent	SNP	ENST00000435070.2	37	CCDS8988.1																																																																																				0.612	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
TPH2	121278	hgsc.bcm.edu	37	12	72366421	72366421	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:72366421C>A	ENST00000333850.3	+	6	872	c.731C>A	c.(730-732)cCt>cAt	p.P244H		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	244					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.P244H(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	AAAAACTTCCCTCTGCTGACT	0.438																																					p.P244H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C731A	12						.						288.0	293.0	291.0					12																	72366421		2203	4300	6503	70652688	SO:0001583	missense	121278	exon6			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.731C>A	12.37:g.72366421C>A	ENSP00000329093:p.Pro244His	Somatic		Capture	SOLID	Phase_I	70652688	NM_173353	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784780	0.90282	.	.	ENSG00000139287	ENST00000333850	D	0.99537	-6.11	5.48	5.48	0.80851	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99569	0.9845	M	0.83483	2.645	0.80722	D	1	P	0.52061	0.95	P	0.59948	0.866	D	0.98344	1.0540	10	0.72032	D	0.01	-16.1399	19.3506	0.94384	0.0:1.0:0.0:0.0	.	244	Q8IWU9	TPH2_HUMAN	H	244	ENSP00000329093:P244H	ENSP00000329093:P244H	P	+	2	0	TPH2	70652688	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.814000	0.86154	2.566000	0.86566	0.462000	0.41574	CCT		0.438	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
TRHDE	29953	hgsc.bcm.edu	37	12	72893313	72893313	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:72893313A>C	ENST00000261180.4	+	6	1581	c.1485A>C	c.(1483-1485)gaA>gaC	p.E495D		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	495					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E495D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TTCTGCATGAAGTGATGCTGC	0.448																																					p.E495D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1485C	12						.						178.0	137.0	151.0					12																	72893313		2203	4300	6503	71179580	SO:0001583	missense	29953	exon6			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1485A>C	12.37:g.72893313A>C	ENSP00000261180:p.Glu495Asp	Somatic		Capture	SOLID	Phase_I	71179580	NM_013381	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.747807	0.49257	.	.	ENSG00000072657	ENST00000261180	T	0.02737	4.18	5.46	3.07	0.35406	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.01940	0.0061	N	0.25031	0.7	0.50313	D	0.999869	B	0.30634	0.288	B	0.26416	0.069	T	0.57481	-0.7804	10	0.13853	T	0.58	.	8.5454	0.33417	0.784:0.0:0.216:0.0	.	495	Q9UKU6	TRHDE_HUMAN	D	495	ENSP00000261180:E495D	ENSP00000261180:E495D	E	+	3	2	TRHDE	71179580	1.000000	0.71417	1.000000	0.80357	0.202000	0.24057	3.750000	0.55157	0.907000	0.36646	-0.263000	0.10527	GAA		0.448	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
GLIPR1L1	256710	hgsc.bcm.edu	37	12	75741412	75741412	+	Missense_Mutation	SNP	C	C	T	rs73189097		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:75741412C>T	ENST00000378695.4	+	3	521	c.431C>T	c.(430-432)gCc>gTc	p.A144V	GLIPR1L1_ENST00000312442.2_Missense_Mutation_p.A144V|CAPS2_ENST00000442339.2_Intron			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	144	SCP.				binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)		p.A144V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						TTAGTTTGGGCCAATTCATTT	0.363																																					p.A144V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C431T	12						.	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	150.0	145.0	147.0		431	5.1	1.0	12	dbSNP_130	147	0,8600		0,0,4300	yes	missense	GLIPR1L1	NM_152779.2	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	144/234	75741412	1,13005	2203	4300	6503	74027679	SO:0001583	missense	256710	exon3			BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.431C>T	12.37:g.75741412C>T	ENSP00000367967:p.Ala144Val	Somatic		Capture	SOLID	Phase_I	74027679	NM_152779	Q96L06	Missense_Mutation	SNP	ENST00000378695.4	37		0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	14.12	2.441333	0.43326	2.27E-4	0.0	ENSG00000173401	ENST00000378695;ENST00000312442	T;T	0.09445	2.98;2.98	5.13	5.13	0.70059	Allergen V5/Tpx-1-related, conserved site (1);CAP domain (3);	0.133960	0.47852	D	0.000208	T	0.36799	0.0980	M	0.88105	2.93	0.35735	D	0.818227	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.991	T	0.49986	-0.8880	10	0.38643	T	0.18	.	12.2397	0.54536	0.0:0.8285:0.1715:0.0	.	144;144	Q6UWM5;Q6UWM5-2	GPRL1_HUMAN;.	V	144	ENSP00000367967:A144V;ENSP00000310770:A144V	ENSP00000310770:A144V	A	+	2	0	GLIPR1L1	74027679	0.119000	0.22226	0.961000	0.40146	0.057000	0.15508	0.267000	0.18552	2.564000	0.86499	0.591000	0.81541	GCC		0.363	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405714.1	NM_152779	
E2F7	144455	hgsc.bcm.edu	37	12	77436971	77436971	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:77436971G>A	ENST00000322886.7	-	7	1232	c.997C>T	c.(997-999)Cga>Tga	p.R333*	E2F7_ENST00000416496.2_Nonsense_Mutation_p.R333*	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	333					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R333*(2)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						TAGAGGCGTCGTACCTTTGCT	0.443																																					p.R333X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C997T	12						.						180.0	152.0	161.0					12																	77436971		2203	4300	6503	75961102	SO:0001587	stop_gained	144455	exon7			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.997C>T	12.37:g.77436971G>A	ENSP00000323246:p.Arg333*	Somatic		Capture	SOLID	Phase_I	75961102	NM_203394	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Nonsense_Mutation	SNP	ENST00000322886.7	37	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	G	41	8.961079	0.99018	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2729	19.367	0.94468	0.0:0.0:1.0:0.0	.	.	.	.	X	333	.	ENSP00000323246:R333X	R	-	1	2	E2F7	75961102	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.781000	0.99029	2.826000	0.97356	0.563000	0.77884	CGA		0.443	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871	
TMTC2	160335	hgsc.bcm.edu	37	12	83290045	83290045	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:83290045G>T	ENST00000321196.3	+	3	1810	c.1103G>T	c.(1102-1104)aGc>aTc	p.S368I	TMTC2_ENST00000549919.1_Missense_Mutation_p.S362I|TMTC2_ENST00000548305.1_Missense_Mutation_p.S368I	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	368					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.S368I(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						ACTAAGTCCAGCTTTGCATCC	0.403																																					p.S368I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1103T	12						.						134.0	129.0	131.0					12																	83290045		2203	4300	6503	81814176	SO:0001583	missense	160335	exon3			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1103G>T	12.37:g.83290045G>T	ENSP00000322300:p.Ser368Ile	Somatic		Capture	SOLID	Phase_I	81814176	NM_152588	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	9.990	1.230654	0.22542	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.61627	0.76;0.09;0.65	5.86	4.97	0.65823	.	0.458027	0.28533	N	0.015007	T	0.37785	0.1016	N	0.22421	0.69	0.42268	D	0.992044	B;B;B	0.27416	0.004;0.007;0.178	B;B;B	0.24394	0.007;0.013;0.053	T	0.21895	-1.0232	10	0.22109	T	0.4	-12.733	7.5789	0.27952	0.1326:0.0:0.7328:0.1346	.	368;123;368	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	I	368;368;362;123	ENSP00000322300:S368I;ENSP00000448292:S368I;ENSP00000447609:S362I	ENSP00000322300:S368I	S	+	2	0	TMTC2	81814176	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.469000	0.35343	2.776000	0.95493	0.650000	0.86243	AGC		0.403	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
SLC6A15	55117	hgsc.bcm.edu	37	12	85270337	85270337	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:85270337A>G	ENST00000266682.5	-	6	1347	c.806T>C	c.(805-807)cTc>cCc	p.L269P	SLC6A15_ENST00000551388.1_5'UTR|SLC6A15_ENST00000552192.1_Missense_Mutation_p.L162P	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	269					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.L269P(1)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						TGCTCTGATGAGGAAGCAAAT	0.308																																					p.L269P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T806C	12						.						84.0	84.0	84.0					12																	85270337		2203	4296	6499	83794468	SO:0001583	missense	55117	exon6			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.806T>C	12.37:g.85270337A>G	ENSP00000266682:p.Leu269Pro	Somatic		Capture	SOLID	Phase_I	83794468	NM_182767	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	A	16.31	3.088315	0.55968	.	.	ENSG00000072041	ENST00000266682;ENST00000552192	T;T	0.81330	-1.48;-1.48	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.93736	0.7998	H	0.97962	4.115	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95959	0.8960	10	0.87932	D	0	.	16.0229	0.80512	1.0:0.0:0.0:0.0	.	269	Q9H2J7	S6A15_HUMAN	P	269;162	ENSP00000266682:L269P;ENSP00000450145:L162P	ENSP00000266682:L269P	L	-	2	0	SLC6A15	83794468	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	8.962000	0.93254	2.189000	0.69895	0.459000	0.35465	CTC		0.308	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
DUSP6	1848	hgsc.bcm.edu	37	12	89744461	89744461	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:89744461C>A	ENST00000279488.7	-	2	1973	c.742G>T	c.(742-744)Gag>Tag	p.E248*	DUSP6_ENST00000547140.1_5'UTR|DUSP6_ENST00000308385.6_Intron|DUSP6_ENST00000547291.1_Nonsense_Mutation_p.E123*	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	248	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.E248*(1)		large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						CCTGCGTTCTCAAAGAGATTC	0.478																																					p.E248X	Colon(132;3456 5224)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G742T	12						.						157.0	166.0	163.0					12																	89744461		2203	4300	6503	88268592	SO:0001587	stop_gained	1848	exon2			BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.742G>T	12.37:g.89744461C>A	ENSP00000279488:p.Glu248*	Somatic		Capture	SOLID	Phase_I	88268592	NM_001946	O75109|Q53Y75|Q9BSH6	Nonsense_Mutation	SNP	ENST00000279488.7	37	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	C	49	15.020887	0.99819	.	.	ENSG00000139318	ENST00000279488;ENST00000547291	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	19.7156	0.96119	0.0:1.0:0.0:0.0	.	.	.	.	X	248;123	.	ENSP00000279488:E248X	E	-	1	0	DUSP6	88268592	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.750000	0.85110	2.658000	0.90341	0.655000	0.94253	GAG		0.478	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
MRPL42	28977	hgsc.bcm.edu	37	12	93873236	93873236	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:93873236T>C	ENST00000549982.1	+	4	368	c.207T>C	c.(205-207)taT>taC	p.Y69Y	MRPL42_ENST00000547098.1_Silent_p.Y69Y|MRPL42_ENST00000361630.2_Silent_p.Y69Y|MRPL42_ENST00000552217.1_Silent_p.Y69Y|MRPL42_ENST00000393128.4_Silent_p.Y69Y|MRPL42_ENST00000548545.1_Silent_p.Y69Y	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42	69					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.Y69Y(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						ACATTCCATATGAACACACAA	0.343																																					p.Y69Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T207C	12						.						78.0	75.0	76.0					12																	93873236		2203	4300	6503	92397367	SO:0001819	synonymous_variant	28977	exon5			AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.207T>C	12.37:g.93873236T>C		Somatic		Capture	SOLID	Phase_I	92397367	NM_172178	Q6FID1|Q96Q48|Q9P0S1	Silent	SNP	ENST00000549982.1	37	CCDS9045.1																																																																																				0.343	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407715.1	NM_014050	
IKBIP	121457	hgsc.bcm.edu	37	12	99007531	99007531	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:99007531T>C	ENST00000342502.2	-	3	1296	c.885A>G	c.(883-885)gaA>gaG	p.E295E	IKBIP_ENST00000420861.1_Silent_p.E189E|IKBIP_ENST00000393042.3_3'UTR	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein	295					response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.E295E(1)		NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						TTACTAATGGTTCTAAACGGG	0.343																																					p.E295E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A885G	12						.						105.0	108.0	107.0					12																	99007531		2202	4300	6502	97531662	SO:0001819	synonymous_variant	121457	exon3			AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.885A>G	12.37:g.99007531T>C		Somatic		Capture	SOLID	Phase_I	97531662	NM_201612	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Silent	SNP	ENST00000342502.2	37	CCDS9067.1																																																																																				0.343	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2	NM_153687	
SLC17A8	246213	hgsc.bcm.edu	37	12	100787225	100787225	+	Silent	SNP	C	C	T	rs139101406		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:100787225C>T	ENST00000323346.5	+	4	865	c.552C>T	c.(550-552)tgC>tgT	p.C184C	SLC17A8_ENST00000392989.3_Silent_p.C184C	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	184					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.C184C(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						ATTACGGATGCGTCATGTGTG	0.448																																					p.C184C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C552T	12						.	C	,	1,4405	2.1+/-5.4	0,1,2202	218.0	185.0	196.0		552,552	-1.4	1.0	12	dbSNP_134	196	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SLC17A8	NM_001145288.1,NM_139319.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	184/540,184/590	100787225	1,13005	2203	4300	6503	99311356	SO:0001819	synonymous_variant	246213	exon4			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.552C>T	12.37:g.100787225C>T		Somatic		Capture	SOLID	Phase_I	99311356	NM_139319	B3KXZ6|B7ZKV4|Q17RQ8	Silent	SNP	ENST00000323346.5	37	CCDS9077.1																																																																																				0.448	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
POLE	5426	hgsc.bcm.edu	37	12	133225562	133225562	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr12:133225562C>T	ENST00000320574.5	-	32	4145	c.4102G>A	c.(4102-4104)Gtg>Atg	p.V1368M	POLE_ENST00000535270.1_Missense_Mutation_p.V1341M	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1368			V -> M (found in a colorectal sample; somatic mutation). {ECO:0000269|PubMed:23263490}.		base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.V1368M(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CGCTGGTTCACGTAGAACACA	0.617								DNA polymerases (catalytic subunits)																													p.V1368M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4102A	12						.						121.0	79.0	93.0					12																	133225562		2203	4300	6503	131735635	SO:0001583	missense	5426	exon32				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4102G>A	12.37:g.133225562C>T	ENSP00000322570:p.Val1368Met	Somatic		Capture	SOLID	Phase_I	131735635	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030514	0.93575	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006	T;T;T;T	0.49139	2.0;2.0;2.0;0.79	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.61912	0.2385	M	0.87758	2.905	0.80722	D	1	P;P	0.49961	0.868;0.93	P;B	0.44860	0.462;0.382	T	0.71876	-0.4460	10	0.87932	D	0	.	19.5576	0.95358	0.0:1.0:0.0:0.0	.	1341;1368	F5H1D6;Q07864	.;DPOE1_HUMAN	M	1368;1379;1341;1148	ENSP00000322570:V1368M;ENSP00000406383:V1379M;ENSP00000445753:V1341M;ENSP00000442519:V1148M	ENSP00000322570:V1368M	V	-	1	0	POLE	131735635	1.000000	0.71417	0.998000	0.56505	0.599000	0.36880	7.699000	0.84547	2.627000	0.88993	0.505000	0.49811	GTG		0.617	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
CYFIP1	23191	hgsc.bcm.edu	37	15	22955134	22955134	+	Splice_Site	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:22955134G>A	ENST00000313077.7	+	15	1653	c.1528G>A	c.(1528-1530)Gtc>Atc	p.V510I	CYFIP1_ENST00000560848.1_Splice_Site_p.V510I|CYFIP1_ENST00000435939.2_5'Flank	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1									p.V510I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GGTGTTCAGTGTCCTGCAGGC	0.597																																					p.V510I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1528A	15						.						76.0	73.0	74.0					15																	22955134		2203	4300	6503	20506575	SO:0001630	splice_region_variant	23191	exon15			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1527-1G>A	15.37:g.22955134G>A		Somatic		Capture	SOLID	Phase_I	20506575	NM_014608		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.605913	0.28623	.	.	ENSG00000068793	ENST00000313077;ENST00000412127	T	0.20069	2.1	5.1	4.19	0.49359	.	0.105104	0.41938	N	0.000781	T	0.09379	0.0231	N	0.02403	-0.565	0.80722	D	1	B;B	0.28667	0.219;0.156	B;B	0.36567	0.228;0.122	T	0.15607	-1.0431	10	0.02654	T	1	-30.2767	13.6461	0.62281	0.0746:0.0:0.9254:0.0	.	538;510	E7EQ04;Q7L576	.;CYFP1_HUMAN	I	510;538	ENSP00000324549:V510I	ENSP00000324549:V510I	V	+	1	0	CYFIP1	20506575	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	7.812000	0.86109	1.148000	0.42385	0.561000	0.74099	GTC		0.597	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	Missense_Mutation
CYFIP1	23191	hgsc.bcm.edu	37	15	22955184	22955184	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:22955184G>A	ENST00000313077.7	+	15	1703	c.1578G>A	c.(1576-1578)gaG>gaA	p.E526E	CYFIP1_ENST00000560848.1_Silent_p.E526E|CYFIP1_ENST00000435939.2_5'Flank	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1									p.E526E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CGGGGCATGAGCCCTTCAATG	0.622																																					p.E526E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1578A	15						.						76.0	73.0	74.0					15																	22955184		2203	4300	6503	20506625	SO:0001819	synonymous_variant	23191	exon15			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1578G>A	15.37:g.22955184G>A		Somatic		Capture	SOLID	Phase_I	20506625	NM_014608		Silent	SNP	ENST00000313077.7	37	CCDS10009.1																																																																																				0.622	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
CHRM5	1133	hgsc.bcm.edu	37	15	34355627	34355627	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:34355627A>G	ENST00000383263.5	+	3	1379	c.709A>G	c.(709-711)Acc>Gcc	p.T237A	CHRM5_ENST00000557872.1_Missense_Mutation_p.T237A	NM_012125.3	NP_036257.1	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	237					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|dopamine transport (GO:0015872)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|gastric acid secretion (GO:0001696)|metabolic process (GO:0008152)|regulation of phosphatidylinositol dephosphorylation (GO:0060304)|transmission of nerve impulse (GO:0019226)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.T237A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	20		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Imipramine(DB00458)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Ziprasidone(DB00246)	TGACTCTGTGACCAAAGCTGA	0.562																																					p.T237A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A709G	15						.						105.0	108.0	107.0					15																	34355627		2201	4298	6499	32142919	SO:0001583	missense	1133	exon3				CCDS10031.1	15q26	2012-08-08			ENSG00000184984	ENSG00000184984		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1954	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 5"""	118496					Standard	NM_012125		Approved		uc001zhk.1	P08912	OTTHUMG00000129369	ENST00000383263.5:c.709A>G	15.37:g.34355627A>G	ENSP00000372750:p.Thr237Ala	Somatic		Capture	SOLID	Phase_I	32142919	NM_012125	Q96RG7	Missense_Mutation	SNP	ENST00000383263.5	37	CCDS10031.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.636478	0.00114	.	.	ENSG00000184984	ENST00000383263	T	0.60424	0.19	5.23	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	0.342816	0.25875	N	0.027721	T	0.20373	0.0490	N	0.00436	-1.5	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17048	-1.0382	10	0.02654	T	1	-5.632	13.1985	0.59754	0.0779:0.0:0.9221:0.0	.	237	P08912	ACM5_HUMAN	A	237	ENSP00000372750:T237A	ENSP00000372750:T237A	T	+	1	0	CHRM5	32142919	0.968000	0.33430	0.096000	0.21009	0.088000	0.18126	2.218000	0.42889	1.408000	0.46895	-0.472000	0.04984	ACC		0.562	CHRM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251521.2		
SLC12A6	9990	hgsc.bcm.edu	37	15	34544503	34544503	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:34544503C>T	ENST00000354181.3	-	10	1693	c.1201G>A	c.(1201-1203)Gtc>Atc	p.V401I	SLC12A6_ENST00000458406.2_Missense_Mutation_p.V342I|SLC12A6_ENST00000560611.1_Missense_Mutation_p.V401I|SLC12A6_ENST00000290209.5_Missense_Mutation_p.V350I|SLC12A6_ENST00000558589.1_Missense_Mutation_p.V392I|SLC12A6_ENST00000397707.2_Missense_Mutation_p.V386I|SLC12A6_ENST00000451844.2_Missense_Mutation_p.V213I|SLC12A6_ENST00000560164.1_Missense_Mutation_p.V213I|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000397702.2_Missense_Mutation_p.V342I|SLC12A6_ENST00000558667.1_Missense_Mutation_p.V401I			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	401					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.V350I(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TTTGATGGGACTGTCATGTTG	0.413																																					p.V386I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1156A	15						.						142.0	128.0	133.0					15																	34544503		2201	4298	6499	32331795	SO:0001583	missense	9990	exon8			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.1201G>A	15.37:g.34544503C>T	ENSP00000346112:p.Val401Ile	Somatic		Capture	SOLID	Phase_I	32331795	NM_001042497	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050497	0.55218	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.36	4.44	0.53790	.	0.494060	0.19980	N	0.101789	T	0.57562	0.2062	L	0.48642	1.525	0.34327	D	0.687299	B;B;B;B	0.13145	0.007;0.004;0.004;0.001	B;B;B;B	0.12837	0.008;0.003;0.008;0.006	T	0.63028	-0.6728	10	0.38643	T	0.18	.	9.7547	0.40496	0.0:0.8391:0.0:0.1609	.	386;401;350;213	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	I	350;386;392;342;342;213	ENSP00000290209:V350I;ENSP00000380819:V386I;ENSP00000380814:V342I;ENSP00000387725:V342I;ENSP00000390199:V213I	ENSP00000290209:V350I	V	-	1	0	SLC12A6	32331795	0.019000	0.18553	0.993000	0.49108	0.994000	0.84299	1.189000	0.32114	1.467000	0.48044	0.585000	0.79938	GTC		0.413	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135	
DNAJC17	55192	hgsc.bcm.edu	37	15	41099616	41099616	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:41099616A>G	ENST00000220496.4	-	1	59	c.29T>C	c.(28-30)aTg>aCg	p.M10T	ZFYVE19_ENST00000355341.4_5'UTR|ZFYVE19_ENST00000299173.10_5'Flank|ZFYVE19_ENST00000564258.1_5'UTR|ZFYVE19_ENST00000570108.1_Missense_Mutation_p.I44V|ZFYVE19_ENST00000336455.5_Intron	NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	10					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.M10T(1)		endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GTACAGGTCCATCTGTAAGAG	0.587																																					p.M10T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T29C	15						.						177.0	134.0	148.0					15																	41099616		2203	4300	6503	38886908	SO:0001583	missense	55192	exon1			AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.29T>C	15.37:g.41099616A>G	ENSP00000220496:p.Met10Thr	Somatic		Capture	SOLID	Phase_I	38886908	NM_018163		Missense_Mutation	SNP	ENST00000220496.4	37	CCDS10065.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.768071	0.49680	.	.	ENSG00000104129	ENST00000220496	D	0.81739	-1.53	5.35	5.35	0.76521	Heat shock protein DnaJ, N-terminal (3);	0.035272	0.85682	D	0.000000	T	0.61553	0.2356	N	0.04320	-0.23	0.80722	D	1	B	0.18310	0.027	B	0.17979	0.02	T	0.58912	-0.7552	10	0.16896	T	0.51	.	14.7373	0.69424	1.0:0.0:0.0:0.0	.	10	Q9NVM6	DJC17_HUMAN	T	10	ENSP00000220496:M10T	ENSP00000220496:M10T	M	-	2	0	DNAJC17	38886908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.738000	0.55067	2.371000	0.80710	0.533000	0.62120	ATG		0.587	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252356.2	NM_018163	
DUOX1	53905	hgsc.bcm.edu	37	15	45433240	45433240	+	Missense_Mutation	SNP	C	C	T	rs368147950		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:45433240C>T	ENST00000321429.4	+	14	1944	c.1537C>T	c.(1537-1539)Cgc>Tgc	p.R513C	DUOX1_ENST00000561166.1_Missense_Mutation_p.R159C|DUOX1_ENST00000389037.3_Missense_Mutation_p.R513C	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	513	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.R513C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGATGGTGACCGCTACTGGTT	0.617																																					p.R513C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1537T	15						.	C	CYS/ARG,CYS/ARG	0,4396		0,0,2198	113.0	108.0	110.0		1537,1537	4.5	1.0	15		110	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense	DUOX1	NM_017434.3,NM_175940.1	180,180	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	513/1552,513/1552	45433240	1,12991	2198	4298	6496	43220532	SO:0001583	missense	53905	exon14			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.1537C>T	15.37:g.45433240C>T	ENSP00000317997:p.Arg513Cys	Somatic		Capture	SOLID	Phase_I	43220532	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528445	0.85706	0.0	1.16E-4	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.78924	-1.22;-1.22	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.90570	0.7044	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92004	0.5613	10	0.87932	D	0	-19.2546	10.0939	0.42464	0.2002:0.7998:0.0:0.0	.	513	Q9NRD9	DUOX1_HUMAN	C	513	ENSP00000317997:R513C;ENSP00000373689:R513C	ENSP00000317997:R513C	R	+	1	0	DUOX1	43220532	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	4.506000	0.60428	2.474000	0.83562	0.650000	0.86243	CGC		0.617	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
CGNL1	84952	hgsc.bcm.edu	37	15	57810600	57810600	+	Nonsense_Mutation	SNP	C	C	T	rs187964382		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:57810600C>T	ENST00000281282.5	+	10	2698	c.2620C>T	c.(2620-2622)Cga>Tga	p.R874*		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	874						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.R874*(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GGGAGAAATACGACAGTTAGA	0.478													c|||	1	0.000199681	0.0	0.0014	5008	,	,		20123	0.0		0.0	False		,,,				2504	0.0				p.R874X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2620T	15						.						83.0	72.0	76.0					15																	57810600		2192	4292	6484	55597892	SO:0001587	stop_gained	84952	exon10			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.2620C>T	15.37:g.57810600C>T	ENSP00000281282:p.Arg874*	Somatic		Capture	SOLID	Phase_I	55597892	NM_032866	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Nonsense_Mutation	SNP	ENST00000281282.5	37	CCDS10161.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	c	39	7.534885	0.98342	.	.	ENSG00000128849	ENST00000281282	.	.	.	5.33	3.47	0.39725	.	0.878073	0.09783	N	0.756458	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-7.0105	10.8168	0.46580	0.1305:0.802:0.0:0.0675	.	.	.	.	X	874	.	ENSP00000281282:R874X	R	+	1	2	CGNL1	55597892	0.022000	0.18835	0.002000	0.10522	0.726000	0.41606	0.857000	0.27831	0.838000	0.34948	-0.121000	0.15023	CGA		0.478	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
CCNB2	9133	hgsc.bcm.edu	37	15	59417057	59417057	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:59417057C>A	ENST00000288207.2	+	9	1369	c.1178C>A	c.(1177-1179)cCa>cAa	p.P393Q	CCNB2_ENST00000559622.1_Missense_Mutation_p.P265Q|RP11-59H7.3_ENST00000559026.1_RNA	NM_004701.3	NP_004692.1	O95067	CCNB2_HUMAN	cyclin B2	393					G2/M transition of mitotic cell cycle (GO:0000086)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)		p.P393Q(1)		kidney(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9						CTTGCCTCCCCACTGATAGGA	0.483																																					p.P393Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1178A	15						.						78.0	62.0	67.0					15																	59417057		2191	4291	6482	57204349	SO:0001583	missense	9133	exon9			AF002822	CCDS10170.1	15q21.3	2004-01-19			ENSG00000157456	ENSG00000157456			1580	protein-coding gene	gene with protein product		602755					Standard	NM_004701		Approved	HsT17299	uc002afz.3	O95067	OTTHUMG00000132715	ENST00000288207.2:c.1178C>A	15.37:g.59417057C>A	ENSP00000288207:p.Pro393Gln	Somatic		Capture	SOLID	Phase_I	57204349	NM_004701	B3KM93|Q6FI99	Missense_Mutation	SNP	ENST00000288207.2	37	CCDS10170.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961953	0.34659	.	.	ENSG00000157456	ENST00000288207	T	0.14144	2.53	5.85	4.94	0.65067	.	0.503768	0.23474	N	0.047781	T	0.13329	0.0323	L	0.37630	1.12	0.37375	D	0.91179	B;B	0.21688	0.059;0.059	B;B	0.25291	0.059;0.059	T	0.08659	-1.0711	10	0.33141	T	0.24	.	14.1058	0.65088	0.0:0.9283:0.0:0.0717	.	393;393	Q53HG9;O95067	.;CCNB2_HUMAN	Q	393	ENSP00000288207:P393Q	ENSP00000288207:P393Q	P	+	2	0	CCNB2	57204349	0.954000	0.32549	0.025000	0.17156	0.002000	0.02628	3.647000	0.54403	1.486000	0.48398	-0.258000	0.10820	CCA		0.483	CCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256016.1	NM_004701	
KIF23	9493	hgsc.bcm.edu	37	15	69732651	69732651	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:69732651G>A	ENST00000260363.4	+	17	2009	c.1892G>A	c.(1891-1893)cGt>cAt	p.R631H	KIF23_ENST00000537891.1_Missense_Mutation_p.R448H|KIF23_ENST00000559279.1_Missense_Mutation_p.R631H|KIF23_ENST00000352331.4_Missense_Mutation_p.R631H|KIF23_ENST00000395392.2_Missense_Mutation_p.R631H|KIF23_ENST00000558585.1_Missense_Mutation_p.R448H	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	631					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)	p.R631H(1)		central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						CTGTAGGAGCGTAGAGTGGCA	0.398																																					p.R631H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1892A	15						.						63.0	64.0	63.0					15																	69732651		2199	4298	6497	67519705	SO:0001583	missense	9493	exon17			X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.1892G>A	15.37:g.69732651G>A	ENSP00000260363:p.Arg631His	Somatic		Capture	SOLID	Phase_I	67519705	NM_004856	Q8WVP0	Missense_Mutation	SNP	ENST00000260363.4	37	CCDS32278.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.695470	0.88830	.	.	ENSG00000137807	ENST00000260363;ENST00000352331;ENST00000395392;ENST00000537891	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.68924	0.3054	L	0.34521	1.04	0.58432	D	0.999999	D;D;D	0.89917	0.998;1.0;0.999	P;D;P	0.63877	0.835;0.919;0.891	T	0.68777	-0.5319	10	0.42905	T	0.14	.	17.4155	0.87498	0.0:0.0:1.0:0.0	.	448;631;631	B4E1K0;Q02241-2;Q02241	.;.;KIF23_HUMAN	H	631;631;631;448	ENSP00000260363:R631H;ENSP00000304978:R631H;ENSP00000378790:R631H;ENSP00000442969:R448H	ENSP00000260363:R631H	R	+	2	0	KIF23	67519705	1.000000	0.71417	0.992000	0.48379	0.873000	0.50193	7.761000	0.85260	2.523000	0.85059	0.591000	0.81541	CGT		0.398	KIF23-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
CEMIP	57214	hgsc.bcm.edu	37	15	81201567	81201567	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:81201567C>A	ENST00000394685.3	+	14	2136	c.1717C>A	c.(1717-1719)Cca>Aca	p.P573T	RP11-351M8.1_ENST00000560560.1_Intron|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Missense_Mutation_p.P573T|KIAA1199_ENST00000356249.5_Missense_Mutation_p.P573T			Q8WUJ3	CEMIP_HUMAN		573	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.				hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.P573T(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						AGGTTATGACCCACCCACATA	0.552																																					p.P573T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1717A	15						.						187.0	134.0	152.0					15																	81201567		2203	4300	6503	78988622	SO:0001583	missense	57214	exon13																														ENST00000394685.3:c.1717C>A	15.37:g.81201567C>A	ENSP00000378177:p.Pro573Thr	Somatic		Capture	SOLID	Phase_I	78988622	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.421503	0.25639	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.79554	-1.28;-1.28;-1.28	4.57	4.57	0.56435	Pectin lyase fold/virulence factor (1);	0.000000	0.85682	D	0.000000	D	0.82637	0.5080	L	0.41824	1.3	0.41524	D	0.988414	D	0.76494	0.999	D	0.64144	0.922	T	0.77552	-0.2545	10	0.08381	T	0.77	-12.6838	17.5272	0.87804	0.0:1.0:0.0:0.0	.	573	Q8WUJ3	K1199_HUMAN	T	573	ENSP00000220244:P573T;ENSP00000378177:P573T;ENSP00000348583:P573T	ENSP00000220244:P573T	P	+	1	0	KIAA1199	78988622	1.000000	0.71417	0.825000	0.32803	0.244000	0.25665	4.392000	0.59659	2.368000	0.80403	0.467000	0.42956	CCA		0.552	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
ZNF592	9640	hgsc.bcm.edu	37	15	85326066	85326066	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:85326066T>C	ENST00000560079.2	+	4	448	c.160T>C	c.(160-162)Ttg>Ctg	p.L54L	ZNF592_ENST00000299927.3_Silent_p.L54L	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	54					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L54L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAGTGTGTCCTTGTCTCACTC	0.547																																					p.L54L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T160C	15						.						134.0	116.0	122.0					15																	85326066		2203	4299	6502	83127070	SO:0001819	synonymous_variant	9640	exon4			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.160T>C	15.37:g.85326066T>C		Somatic		Capture	SOLID	Phase_I	83127070	NM_014630	Q2M1T2|Q504Y9	Silent	SNP	ENST00000560079.2	37	CCDS32317.1																																																																																				0.547	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630	
KIF7	374654	hgsc.bcm.edu	37	15	90176163	90176163	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:90176163G>A	ENST00000394412.3	-	14	2859	c.2783C>T	c.(2782-2784)gCg>gTg	p.A928V		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	928					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A415V(1)		central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CTCCTCCAGCGCCCGCCGCTG	0.622																																					p.A928V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2783T	15						.						25.0	24.0	25.0					15																	90176163		2200	4299	6499	87977167	SO:0001583	missense	374654	exon14			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2783C>T	15.37:g.90176163G>A	ENSP00000377934:p.Ala928Val	Somatic		Capture	SOLID	Phase_I	87977167	NM_198525	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	37	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595943	0.46318	.	.	ENSG00000166813	ENST00000394412	T	0.33654	1.4	5.12	5.12	0.69794	.	0.155607	0.56097	D	0.000026	T	0.42966	0.1226	M	0.62723	1.935	0.33219	D	0.554476	D;D	0.63046	0.959;0.992	B;P	0.45794	0.401;0.493	T	0.57820	-0.7745	10	0.35671	T	0.21	.	18.1307	0.89600	0.0:0.0:1.0:0.0	.	414;928	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	V	928	ENSP00000377934:A928V	ENSP00000377934:A928V	A	-	2	0	KIF7	87977167	1.000000	0.71417	0.998000	0.56505	0.740000	0.42216	3.930000	0.56522	2.354000	0.79902	0.462000	0.41574	GCG		0.622	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
CRTC3	64784	hgsc.bcm.edu	37	15	91172591	91172591	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:91172591C>T	ENST00000268184.6	+	11	1097	c.1093C>T	c.(1093-1095)Cgt>Tgt	p.R365C	RP11-387D10.2_ENST00000559531.1_RNA|CRTC3_ENST00000420329.2_Missense_Mutation_p.R365C			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	365					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.R365C(1)	CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CCCTTCGCTCCGTCTGTTTTC	0.557			T	MAML2	salivary gland mucoepidermoid																																p.R365C			Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1093T	15						.						290.0	285.0	287.0					15																	91172591		2198	4298	6496	88973595	SO:0001583	missense	64784	exon11				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.1093C>T	15.37:g.91172591C>T	ENSP00000268184:p.Arg365Cys	Somatic		Capture	SOLID	Phase_I	88973595	NM_022769	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	37	CCDS32331.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.707974	0.48412	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.12672	2.66;2.66	5.18	5.18	0.71444	.	0.236709	0.43260	D	0.000596	T	0.34135	0.0887	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.972;0.987	T	0.01090	-1.1455	10	0.54805	T	0.06	-16.9064	16.2411	0.82409	0.0:1.0:0.0:0.0	.	365;365	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	C	329;365;365	ENSP00000268184:R365C;ENSP00000416573:R365C	ENSP00000268184:R365C	R	+	1	0	CRTC3	88973595	1.000000	0.71417	0.564000	0.28396	0.083000	0.17756	5.611000	0.67674	2.687000	0.91594	0.655000	0.94253	CGT		0.557	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
BLM	641	hgsc.bcm.edu	37	15	91310237	91310237	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr15:91310237A>G	ENST00000355112.3	+	10	2409	c.2291A>G	c.(2290-2292)tAt>tGt	p.Y764C	BLM_ENST00000560509.1_Missense_Mutation_p.Y764C|BLM_ENST00000560136.1_3'UTR	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	764	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.Y764C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			AAACTTCTATATGTCACTCCA	0.264			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.Y764C		yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2291G	15						.						44.0	46.0	45.0					15																	91310237		2196	4283	6479	89111241	SO:0001583	missense	641	exon10	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2291A>G	15.37:g.91310237A>G	ENSP00000347232:p.Tyr764Cys	Somatic		Capture	SOLID	Phase_I	89111241	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.496781	0.64186	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.79247	-1.25	5.74	5.74	0.90152	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93795	0.8016	H	0.99811	4.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96234	0.9170	10	0.87932	D	0	-9.4429	13.995	0.64390	1.0:0.0:0.0:0.0	.	764;389;764	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	C	764;417	ENSP00000347232:Y764C	ENSP00000347232:Y764C	Y	+	2	0	BLM	89111241	1.000000	0.71417	0.990000	0.47175	0.711000	0.40976	8.498000	0.90492	2.187000	0.69744	0.477000	0.44152	TAT		0.264	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
HADH	3033	hgsc.bcm.edu	37	4	108954337	108954337	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:108954337G>A	ENST00000309522.3	+	7	864	c.715G>A	c.(715-717)Gca>Aca	p.A239T	HADH_ENST00000510728.1_3'UTR|HADH_ENST00000403312.1_Missense_Mutation_p.A315T|HADH_ENST00000505878.1_Missense_Mutation_p.A243T|HADH_ENST00000454409.2_Missense_Mutation_p.A243T|HADH_ENST00000603302.1_Missense_Mutation_p.A256T	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase	568					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)	p.A239T(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		CTTAGGTGACGCATCCAAAGA	0.453																																					p.A256T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G766A	4						.						133.0	128.0	130.0					4																	108954337		2203	4300	6503	109173786	SO:0001583	missense	3033	exon8			X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.715G>A	4.37:g.108954337G>A	ENSP00000312288:p.Ala239Thr	Somatic		Capture	SOLID	Phase_I	109173786	NM_001184705	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000309522.3	37	CCDS3678.1	.	.	.	.	.	.	.	.	.	.	G	37	6.288592	0.97444	.	.	ENSG00000138796	ENST00000403312;ENST00000309522;ENST00000505878;ENST00000454409	D;D;D	0.91843	-2.92;-2.92;-2.92	5.86	5.86	0.93980	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.050814	0.85682	D	0.000000	D	0.97043	0.9034	M	0.91196	3.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.986;0.988;0.98	D	0.97420	1.0008	10	0.87932	D	0	-25.3859	18.9646	0.92691	0.0:0.0:1.0:0.0	.	315;243;239	Q16836-2;E9PF18;Q16836	.;.;HCDH_HUMAN	T	256;239;243;243	ENSP00000312288:A239T;ENSP00000425952:A243T;ENSP00000395167:A243T	ENSP00000312288:A239T	A	+	1	0	HADH	109173786	1.000000	0.71417	0.296000	0.24974	0.626000	0.37791	7.718000	0.84743	2.771000	0.95319	0.563000	0.77884	GCA		0.453	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254750.2	NM_005327	
EGF	1950	hgsc.bcm.edu	37	4	110901995	110901995	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:110901995C>T	ENST00000265171.5	+	15	2680	c.2235C>T	c.(2233-2235)tgC>tgT	p.C745C	EGF_ENST00000509793.1_Silent_p.C703C|EGF_ENST00000503392.1_Silent_p.C745C	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	745	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.C745C(1)		breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CAGATCCCTGCTTATATCAAA	0.413																																					p.C745C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2235T	4						.						133.0	128.0	130.0					4																	110901995		2203	4300	6503	111121444	SO:0001819	synonymous_variant	1950	exon15			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2235C>T	4.37:g.110901995C>T		Somatic		Capture	SOLID	Phase_I	111121444	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Silent	SNP	ENST00000265171.5	37	CCDS3689.1																																																																																				0.413	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
ANK2	287	hgsc.bcm.edu	37	4	113970950	113970950	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:113970950G>A	ENST00000357077.4	+	1	119	c.66G>A	c.(64-66)agG>agA	p.R22R	ANK2_ENST00000394537.3_Silent_p.R22R|RP11-650J17.1_ENST00000508959.1_RNA|ANK2_ENST00000264366.6_Silent_p.R22R|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	22					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R22R(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTAGTCAGAGGAGAAAAAGAC	0.413																																					p.R22R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G66A	4						.						80.0	85.0	83.0					4																	113970950		2203	4300	6503	114190399	SO:0001819	synonymous_variant	287	exon1			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.66G>A	4.37:g.113970950G>A		Somatic		Capture	SOLID	Phase_I	114190399	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	CCDS3702.1																																																																																				0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ANK2	287	hgsc.bcm.edu	37	4	114294463	114294463	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:114294463G>A	ENST00000357077.4	+	45	11770	c.11717G>A	c.(11716-11718)cGg>cAg	p.R3906Q	ANK2_ENST00000394537.3_Missense_Mutation_p.R1821Q|ANK2_ENST00000510275.2_Missense_Mutation_p.R504Q|ANK2_ENST00000509550.1_Missense_Mutation_p.R997Q|ANK2_ENST00000264366.6_Missense_Mutation_p.R3873Q|ANK2_ENST00000506722.1_Missense_Mutation_p.R1812Q	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3906			R -> W (in LQT4; loss of function; dbSNP:rs121912706). {ECO:0000269|PubMed:15178757}.		atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R3906Q(2)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATCATTAGGCGGTATGTATCC	0.388																																					p.R1821Q												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G5462A	4						.						82.0	83.0	82.0					4																	114294463		2203	4300	6503	114513912	SO:0001583	missense	287	exon44			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.11717G>A	4.37:g.114294463G>A	ENSP00000349588:p.Arg3906Gln	Somatic		Capture	SOLID	Phase_I	114513912	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541703	0.85917	.	.	ENSG00000145362	ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342	T;T;T;T;T;D;D	0.96913	-0.44;-0.42;-0.53;-0.54;-1.17;-2.16;-4.17	6.06	5.21	0.72293	.	0.152178	0.30959	N	0.008538	D	0.96722	0.8930	L	0.41356	1.27	0.35640	D	0.810947	D;D;D;P;D;P	0.89917	0.968;0.999;0.985;0.948;1.0;0.939	B;P;B;B;D;B	0.87578	0.269;0.822;0.416;0.254;0.998;0.388	D	0.98304	1.0520	10	0.32370	T	0.25	.	15.2349	0.73422	0.0671:0.0:0.9329:0.0	.	997;887;853;1821;3906;1812	E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.;.;.;.;.;.	Q	1812;887;1821;3906;3873;1812;997;504;916	ENSP00000421067:R1812Q;ENSP00000378044:R1821Q;ENSP00000349588:R3906Q;ENSP00000264366:R3873Q;ENSP00000426944:R997Q;ENSP00000421023:R504Q;ENSP00000422498:R916Q	ENSP00000264366:R3873Q	R	+	2	0	ANK2	114513912	1.000000	0.71417	0.973000	0.42090	0.941000	0.58515	5.918000	0.69996	1.565000	0.49641	0.655000	0.94253	CGG		0.388	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
EXOSC9	5393	hgsc.bcm.edu	37	4	122734463	122734463	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:122734463C>T	ENST00000243498.5	+	9	1010	c.902C>T	c.(901-903)gCc>gTc	p.A301V	EXOSC9_ENST00000379663.3_Missense_Mutation_p.A301V|EXOSC9_ENST00000512454.1_Missense_Mutation_p.A285V|EXOSC9_ENST00000509980.1_3'UTR	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	301					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A301V(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						ATGGAAAAGGCCCCTATTGAT	0.398																																					p.A301V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C902T	4						.						103.0	111.0	108.0					4																	122734463		2203	4300	6503	122953913	SO:0001583	missense	5393	exon9			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.902C>T	4.37:g.122734463C>T	ENSP00000243498:p.Ala301Val	Somatic		Capture	SOLID	Phase_I	122953913	NM_001034194	Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	ENST00000243498.5	37	CCDS3722.2	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909045	0.33721	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000512454	T;T;T	0.24151	1.89;1.87;1.89	6.0	6.0	0.97389	.	0.099057	0.64402	D	0.000001	T	0.27454	0.0674	L	0.47716	1.5	0.58432	D	0.999999	B;B;B	0.24132	0.098;0.046;0.071	B;B;B	0.14578	0.009;0.009;0.011	T	0.02115	-1.1211	10	0.30078	T	0.28	-24.23	20.4987	0.99207	0.0:1.0:0.0:0.0	.	285;301;301	D6RIY6;Q06265;Q06265-2	.;EXOS9_HUMAN;.	V	301;301;285	ENSP00000243498:A301V;ENSP00000368984:A301V;ENSP00000425782:A285V	ENSP00000243498:A301V	A	+	2	0	EXOSC9	122953913	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.023000	0.76437	2.855000	0.98099	0.650000	0.86243	GCC		0.398	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033	
LARP1B	55132	hgsc.bcm.edu	37	4	129019465	129019465	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:129019465A>G	ENST00000326639.6	+	8	1004	c.793A>G	c.(793-795)Aac>Gac	p.N265D	LARP1B_ENST00000427266.1_Missense_Mutation_p.N265D|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000441387.1_Missense_Mutation_p.N265D|LARP1B_ENST00000394288.3_Missense_Mutation_p.N265D|LARP1B_ENST00000432347.2_Missense_Mutation_p.N265D|LARP1B_ENST00000512292.1_Missense_Mutation_p.N265D|LARP1B_ENST00000264584.5_Missense_Mutation_p.N218D	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	265	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.N265D(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TCTCACTACAAACCTTAATCT	0.383																																					p.N265D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A793G	4						.						85.0	73.0	77.0					4																	129019465		2203	4300	6503	129238915	SO:0001583	missense	55132	exon8				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.793A>G	4.37:g.129019465A>G	ENSP00000321997:p.Asn265Asp	Somatic		Capture	SOLID	Phase_I	129238915	NM_178043	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	37	CCDS3738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.933|4.933	0.173401|0.173401	0.09391|0.09391	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000507377|ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266	.|T;T;T;T;T;T;T;T	.|0.37235	.|1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.27|5.27	4.11|4.11	0.48088|0.48088	.|Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (3);	.|0.063534	.|0.64402	.|D	.|0.000002	T|T	0.08802|0.08802	0.0218|0.0218	N|N	0.00595|0.00595	-1.35|-1.35	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.21905	.|0.008;0.062;0.003;0.005	.|B;B;B;B	.|0.20184	.|0.023;0.028;0.004;0.011	T|T	0.24154|0.24154	-1.0168|-1.0168	5|10	.|0.02654	.|T	.|1	.|.	7.9277|7.9277	0.29885|0.29885	0.8422:0.0:0.1578:0.0|0.8422:0.0:0.1578:0.0	.|.	.|265;265;265;265	.|Q659C4;G3XAJ5;Q659C4-3;G3V0E9	.|LAR1B_HUMAN;.;.;.	R|D	233|265;265;218;265;265;218;265;265	.|ENSP00000321997:N265D;ENSP00000422850:N265D;ENSP00000427281:N218D;ENSP00000377829:N265D;ENSP00000390395:N265D;ENSP00000264584:N218D;ENSP00000396521:N265D;ENSP00000403586:N265D	.|ENSP00000264584:N218D	K|N	+|+	2|1	0|0	LARP1B|LARP1B	129238915|129238915	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.352000|5.352000	0.66028|0.66028	1.034000|1.034000	0.39945|0.39945	0.528000|0.528000	0.53228|0.53228	AAA|AAC		0.383	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
GAB1	2549	hgsc.bcm.edu	37	4	144361031	144361031	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:144361031T>C	ENST00000262994.4	+	5	1574	c.1272T>C	c.(1270-1272)caT>caC	p.H424H	GAB1_ENST00000262995.4_Silent_p.H424H|GAB1_ENST00000505913.1_Silent_p.H321H	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	424					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.H424H(1)		breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					AAGGCTTCCATAACCACTTTG	0.333																																					p.H424H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1272C	4						.						138.0	130.0	133.0					4																	144361031		2203	4300	6503	144580481	SO:0001819	synonymous_variant	2549	exon5			U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1272T>C	4.37:g.144361031T>C		Somatic		Capture	SOLID	Phase_I	144580481	NM_207123	A8K152|Q4W5G2|Q6P1W2	Silent	SNP	ENST00000262994.4	37	CCDS3759.1																																																																																				0.333	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
FBXW7	55294	hgsc.bcm.edu	37	4	153249385	153249385	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:153249385G>A	ENST00000281708.4	-	9	2622	c.1393C>T	c.(1393-1395)Cgt>Tgt	p.R465C	FBXW7_ENST00000603841.1_Missense_Mutation_p.R465C|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347C|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289C|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465C|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465C(71)|p.R226C(11)|p.R385C(11)|p.R347C(3)|p.R465Y(2)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGCATACAACGCACAGTGGAA	0.413			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385C			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,+1	.	99	Substitution - Missense(98)|Unknown(1)	haematopoietic_and_lymphoid_tissue(41)|large_intestine(27)|endometrium(20)|stomach(6)|biliary_tract(4)|pancreas(1)	c.C1153T	4						.						260.0	223.0	235.0					4																	153249385		2203	4300	6503	153468835	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1393C>T	4.37:g.153249385G>A	ENSP00000281708:p.Arg465Cys	Somatic		Capture	SOLID	Phase_I	153468835	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909959	0.92107	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.71206	2.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.67130	-0.5748	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:0.0:1.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	465;347;385;289	ENSP00000281708:R465C;ENSP00000296555:R347C;ENSP00000263981:R385C;ENSP00000377528:R289C	ENSP00000263981:R385C	R	-	1	0	FBXW7	153468835	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	CGT		0.413	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
FBXW7	55294	hgsc.bcm.edu	37	4	153332617	153332617	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:153332617C>A	ENST00000281708.4	-	2	1568	c.339G>T	c.(337-339)gaG>gaT	p.E113D	FBXW7_ENST00000603841.1_Missense_Mutation_p.E113D|FBXW7_ENST00000603548.1_Missense_Mutation_p.E113D|FBXW7_ENST00000604872.1_Missense_Mutation_p.E113D	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	113					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.E113D(2)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				cctcctcctcctcatcctcct	0.428			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.E113D			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G339T	4						.						294.0	227.0	249.0					4																	153332617		2203	4300	6503	153552067	SO:0001583	missense	55294	exon2			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.339G>T	4.37:g.153332617C>A	ENSP00000281708:p.Glu113Asp	Somatic		Capture	SOLID	Phase_I	153552067	NM_033632	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	7.120	0.577698	0.13686	.	.	ENSG00000109670	ENST00000281708	T	0.56275	0.47	5.33	-1.49	0.08718	WD40/YVTN repeat-like-containing domain (1);	0.162636	0.38005	N	0.001854	T	0.45397	0.1340	N	0.19112	0.55	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.34254	-0.9836	10	0.27785	T	0.31	0.261	6.753	0.23497	0.0:0.3242:0.1207:0.5551	.	113	Q969H0	FBXW7_HUMAN	D	113	ENSP00000281708:E113D	ENSP00000281708:E113D	E	-	3	2	FBXW7	153552067	0.955000	0.32602	0.996000	0.52242	0.992000	0.81027	-0.035000	0.12205	-0.237000	0.09739	-0.142000	0.14014	GAG		0.428	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
FGFBP1	9982	hgsc.bcm.edu	37	4	15937963	15937963	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:15937963C>T	ENST00000382333.1	-	3	587	c.293G>A	c.(292-294)gGc>gAc	p.G98D	FGFBP1_ENST00000259988.2_Missense_Mutation_p.G98D	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	98					cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)	p.G98D(1)		NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						GGTTGGATTGCCAGCAAAGAC	0.483																																					p.G98D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G293A	4						.						119.0	113.0	115.0					4																	15937963		2203	4300	6503	15547061	SO:0001583	missense	9982	exon2			M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.293G>A	4.37:g.15937963C>T	ENSP00000371770:p.Gly98Asp	Somatic		Capture	SOLID	Phase_I	15547061	NM_005130	A8K5J2	Missense_Mutation	SNP	ENST00000382333.1	37	CCDS3418.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708902	0.89018	.	.	ENSG00000137440	ENST00000382333;ENST00000259988	T;T	0.58940	0.3;0.3	5.65	5.65	0.86999	.	0.108339	0.64402	D	0.000007	T	0.77903	0.4200	M	0.78049	2.395	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.79928	-0.1596	10	0.87932	D	0	-0.8688	18.4845	0.90824	0.0:1.0:0.0:0.0	.	98	Q14512	FGFP1_HUMAN	D	98	ENSP00000371770:G98D;ENSP00000259988:G98D	ENSP00000259988:G98D	G	-	2	0	FGFBP1	15547061	1.000000	0.71417	0.733000	0.30861	0.835000	0.47333	4.644000	0.61397	2.681000	0.91329	0.643000	0.83706	GGC		0.483	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214974.1	NM_005130	
ARFIP1	27236	hgsc.bcm.edu	37	4	153809415	153809415	+	Missense_Mutation	SNP	C	C	T	rs367792760		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:153809415C>T	ENST00000451320.2	+	8	1086	c.922C>T	c.(922-924)Cgc>Tgc	p.R308C	ARFIP1_ENST00000405727.2_Missense_Mutation_p.R276C|ARFIP1_ENST00000429148.2_Missense_Mutation_p.R128C|ARFIP1_ENST00000353617.2_Missense_Mutation_p.R308C|ARFIP1_ENST00000356064.3_Missense_Mutation_p.R276C			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	308	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)		p.R308C(1)	ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TGATAAAATGCGCAATGATGT	0.378																																					p.R276C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C826T	4						.	C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	82.0	78.0	80.0		826,922,826	5.8	1.0	4		80	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	ARFIP1	NM_001025593.1,NM_001025595.1,NM_014447.2	180,180,180	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	276/342,308/374,276/342	153809415	1,13003	2203	4299	6502	154028865	SO:0001583	missense	27236	exon7			U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.922C>T	4.37:g.153809415C>T	ENSP00000395083:p.Arg308Cys	Somatic		Capture	SOLID	Phase_I	154028865	NM_001025593	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	37	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.232858	0.79688	0.0	1.16E-4	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	5.85	5.85	0.93711	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.91074	0.7191	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.999	D	0.91429	0.5164	10	0.87932	D	0	-5.3162	20.1731	0.98165	0.0:1.0:0.0:0.0	.	128;276;308	B4DS69;Q2M2X4;P53367	.;.;ARFP1_HUMAN	C	308;128;308;276;276	ENSP00000395083:R308C;ENSP00000396653:R128C;ENSP00000296557:R308C;ENSP00000384189:R276C;ENSP00000348360:R276C	ENSP00000296557:R308C	R	+	1	0	ARFIP1	154028865	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.540000	0.60664	2.768000	0.95171	0.655000	0.94253	CGC		0.378	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447	
ZNF141	7700	hgsc.bcm.edu	37	4	367493	367493	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:367493T>C	ENST00000240499.7	+	4	1416	c.1267T>C	c.(1267-1269)Tac>Cac	p.Y423H	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	423					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y423H(1)		breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						AGATAAACCCTACAAATGTAA	0.363																																					p.Y423H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1267C	4						.						83.0	90.0	87.0					4																	367493		2203	4300	6503	357493	SO:0001583	missense	7700	exon4			L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1267T>C	4.37:g.367493T>C	ENSP00000240499:p.Tyr423His	Somatic		Capture	SOLID	Phase_I	357493	NM_003441	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	T	8.758	0.922973	0.18056	.	.	ENSG00000131127	ENST00000240499	T	0.21734	1.99	1.24	1.24	0.21308	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13756	0.0333	N	0.26162	0.8	0.09310	N	0.999999	B	0.31351	0.32	B	0.34779	0.189	T	0.32052	-0.9921	8	.	.	.	.	6.1877	0.20506	0.0:0.0:0.0:1.0	.	423	Q15928	ZN141_HUMAN	H	423	ENSP00000240499:Y423H	.	Y	+	1	0	ZNF141	357493	0.014000	0.17966	0.011000	0.14972	0.112000	0.19704	1.842000	0.39250	0.495000	0.27882	0.260000	0.18958	TAC		0.363	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
GAK	2580	hgsc.bcm.edu	37	4	871491	871491	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:871491T>C	ENST00000314167.4	-	16	1878	c.1768A>G	c.(1768-1770)Aag>Gag	p.K590E	GAK_ENST00000511163.1_Missense_Mutation_p.K511E	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	590	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.K590E(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		CTCCTCTGCTTGCTGAACAGC	0.637																																					p.K590E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1768G	4						.						61.0	55.0	57.0					4																	871491		2203	4300	6503	861491	SO:0001583	missense	2580	exon16			D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.1768A>G	4.37:g.871491T>C	ENSP00000314499:p.Lys590Glu	Somatic		Capture	SOLID	Phase_I	861491	NM_005255	Q5U4P5|Q9BVY6	Missense_Mutation	SNP	ENST00000314167.4	37	CCDS3340.1	.	.	.	.	.	.	.	.	.	.	T	31	5.103859	0.94245	.	.	ENSG00000178950	ENST00000314167;ENST00000511163	D;D	0.86230	-2.09;-2.09	5.71	5.71	0.89125	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.92583	0.7644	M	0.76838	2.35	0.80722	D	1	P;P;D;D	0.65815	0.765;0.642;0.987;0.995	P;B;P;D	0.65010	0.593;0.33;0.906;0.931	D	0.93404	0.6763	10	0.87932	D	0	-47.7644	13.9333	0.64010	0.0:0.0:0.0:1.0	.	511;511;590;486	Q5U4P5;E9PGR2;O14976;Q59HA5	.;.;GAK_HUMAN;.	E	590;511	ENSP00000314499:K590E;ENSP00000421361:K511E	ENSP00000314499:K590E	K	-	1	0	GAK	861491	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.411000	0.80078	2.178000	0.69098	0.533000	0.62120	AAG		0.637	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239188.1	NM_005255	
WHSC1	7468	hgsc.bcm.edu	37	4	1920130	1920130	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:1920130T>C	ENST00000382895.3	+	7	1621	c.1190T>C	c.(1189-1191)aTg>aCg	p.M397T	WHSC1_ENST00000508803.1_Missense_Mutation_p.M397T|WHSC1_ENST00000382891.5_Missense_Mutation_p.M397T|WHSC1_ENST00000420906.2_Missense_Mutation_p.M397T|WHSC1_ENST00000514045.1_Missense_Mutation_p.M397T|WHSC1_ENST00000382892.2_Missense_Mutation_p.M397T|WHSC1_ENST00000503128.1_Missense_Mutation_p.M397T|WHSC1_ENST00000398261.1_Missense_Mutation_p.M397T	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	397					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.M397T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TGCATTCCCATGAAGAGAAGG	0.532			T	IGH@	MM																																p.M397T			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1190C	4						.						62.0	62.0	62.0					4																	1920130		2203	4300	6503	1889928	SO:0001583	missense	7468	exon6			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1190T>C	4.37:g.1920130T>C	ENSP00000372351:p.Met397Thr	Somatic		Capture	SOLID	Phase_I	1889928	NM_133331	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	T	0.078	-1.189220	0.01607	.	.	ENSG00000109685	ENST00000508803;ENST00000514045;ENST00000382891;ENST00000382892;ENST00000420906;ENST00000382895;ENST00000503128;ENST00000398261	D;T;D;D;T;D;T;T	0.94650	-3.48;1.36;-3.48;-3.48;1.36;-3.48;1.35;1.35	5.02	0.979	0.19745	.	0.906384	0.09367	N	0.811863	T	0.79879	0.4522	N	0.02011	-0.69	0.24031	N	0.996117	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.001	T	0.68930	-0.5279	10	0.13470	T	0.59	.	1.5647	0.02602	0.1135:0.2068:0.2345:0.4452	.	397;397;397;397	O96028-3;O96028;O96028-5;O96028-6	.;NSD2_HUMAN;.;.	T	397	ENSP00000423972:M397T;ENSP00000421681:M397T;ENSP00000372347:M397T;ENSP00000372348:M397T;ENSP00000399251:M397T;ENSP00000372351:M397T;ENSP00000425761:M397T;ENSP00000381311:M397T	ENSP00000308780:M397T	M	+	2	0	WHSC1	1889928	0.003000	0.15002	0.016000	0.15963	0.599000	0.36880	-0.069000	0.11542	0.007000	0.14760	0.454000	0.30748	ATG		0.532	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
ZBTB49	166793	hgsc.bcm.edu	37	4	4304088	4304088	+	Silent	SNP	G	G	A	rs115129306	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:4304088G>A	ENST00000337872.4	+	3	646	c.525G>A	c.(523-525)ccG>ccA	p.P175P	ZBTB49_ENST00000538529.1_5'UTR|ZBTB49_ENST00000355834.3_Silent_p.P175P	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P175P(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						AATCGCATCCGCATGCTTCAC	0.463													G|||	24	0.00479233	0.0174	0.0014	5008	,	,		22183	0.0		0.0	False		,,,				2504	0.0				p.P175P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G525A	4						.	G		77,4329	67.6+/-105.2	2,73,2128	105.0	104.0	104.0		525	-6.7	0.0	4	dbSNP_132	104	0,8600		0,0,4300	no	coding-synonymous	ZBTB49	NM_145291.3		2,73,6428	AA,AG,GG		0.0,1.7476,0.592		175/766	4304088	77,12929	2203	4300	6503	4354989	SO:0001819	synonymous_variant	166793	exon3			AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.525G>A	4.37:g.4304088G>A		Somatic		Capture	SOLID	Phase_I	4354989	NM_145291	Q59FJ4|Q5EBN0|Q8TB80	Silent	SNP	ENST00000337872.4	37	CCDS3375.1																																																																																				0.463	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3	NM_145291	
NCAPG	64151	hgsc.bcm.edu	37	4	17826619	17826619	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:17826619C>T	ENST00000251496.2	+	10	1588	c.1412C>T	c.(1411-1413)gCg>gTg	p.A471V		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	471					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A471V(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		GAGATTCGGGCGCCCATTGTT	0.323																																					p.A471V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1412T	4						.						76.0	76.0	76.0					4																	17826619		2203	4300	6503	17435717	SO:0001583	missense	64151	exon10			AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.1412C>T	4.37:g.17826619C>T	ENSP00000251496:p.Ala471Val	Somatic		Capture	SOLID	Phase_I	17435717	NM_022346	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000251496.2	37	CCDS3424.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252453	0.59212	.	.	ENSG00000109805	ENST00000251496;ENST00000510063	T;T	0.43294	1.47;0.95	5.72	3.82	0.43975	Armadillo-type fold (1);	0.144593	0.64402	D	0.000009	T	0.31606	0.0802	L	0.51422	1.61	0.29852	N	0.82837	B	0.28783	0.222	B	0.10450	0.005	T	0.30679	-0.9970	10	0.49607	T	0.09	-7.066	6.8585	0.24054	0.3705:0.5384:0.0:0.0911	.	471	Q9BPX3	CND3_HUMAN	V	471;34	ENSP00000251496:A471V;ENSP00000425625:A34V	ENSP00000251496:A471V	A	+	2	0	NCAPG	17435717	0.993000	0.37304	0.929000	0.37066	0.942000	0.58702	3.085000	0.50151	1.444000	0.47605	0.585000	0.79938	GCG		0.323	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346	
AFM	173	hgsc.bcm.edu	37	4	74361133	74361133	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:74361133G>A	ENST00000226355.3	+	9	1268	c.1175G>A	c.(1174-1176)gGt>gAt	p.G392D		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	392	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)	p.G392D(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AACCCTCCAGGTTGTTACCGT	0.378																																					p.G392D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1175A	4						.						69.0	76.0	74.0					4																	74361133		2203	4300	6503	74579997	SO:0001583	missense	173	exon9			L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.1175G>A	4.37:g.74361133G>A	ENSP00000226355:p.Gly392Asp	Somatic		Capture	SOLID	Phase_I	74579997	NM_001133	A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	ENST00000226355.3	37	CCDS3557.1	.	.	.	.	.	.	.	.	.	.	G	6.239	0.412304	0.11812	.	.	ENSG00000079557	ENST00000226355	T	0.73258	-0.73	4.01	-0.226	0.13106	Serum albumin, conserved site (1);Serum albumin-like (1);Serum albumin, N-terminal (3);	1.193830	0.05929	N	0.634912	T	0.41627	0.1167	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.23655	-1.0182	10	0.11485	T	0.65	.	6.1208	0.20151	0.6348:0.0:0.3652:0.0	.	392	P43652	AFAM_HUMAN	D	392	ENSP00000226355:G392D	ENSP00000226355:G392D	G	+	2	0	AFM	74579997	0.006000	0.16342	0.010000	0.14722	0.476000	0.33039	0.952000	0.29149	-0.047000	0.13423	-1.223000	0.01593	GGT		0.378	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2		
CDKL2	8999	hgsc.bcm.edu	37	4	76551136	76551136	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:76551136C>T	ENST00000429927.2	-	2	740	c.37G>A	c.(37-39)Ggg>Agg	p.G13R	CDKL2_ENST00000307465.4_Missense_Mutation_p.G13R	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	13	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.G13R(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CCATAACTCCCTTCTCCAACC	0.328																																					p.G13R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G37A	4						.						168.0	168.0	168.0					4																	76551136		2203	4300	6503	76770160	SO:0001583	missense	8999	exon2			U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.37G>A	4.37:g.76551136C>T	ENSP00000412365:p.Gly13Arg	Somatic		Capture	SOLID	Phase_I	76770160	NM_003948	B2R695	Missense_Mutation	SNP	ENST00000429927.2	37	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925582	0.92319	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	D;D	0.96365	-3.99;-3.99	4.91	4.91	0.64330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.98966	0.9648	H	0.98629	4.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99116	1.0848	9	0.87932	D	0	-14.1497	17.3874	0.87420	0.0:1.0:0.0:0.0	.	13;13	B4DH08;Q92772	.;CDKL2_HUMAN	R	13	ENSP00000412365:G13R;ENSP00000306340:G13R	ENSP00000306340:G13R	G	-	1	0	CDKL2	76770160	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.119000	0.77145	2.707000	0.92482	0.563000	0.77884	GGG		0.328	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
PRKG2	5593	hgsc.bcm.edu	37	4	82090862	82090862	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:82090862C>A	ENST00000395578.1	-	5	919	c.803G>T	c.(802-804)aGg>aTg	p.R268M	RP11-100N20.1_ENST00000512502.1_RNA|PRKG2_ENST00000264399.1_Missense_Mutation_p.R268M|PRKG2_ENST00000418486.2_Missense_Mutation_p.R268M			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	268					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)	p.R268M(2)		NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						TTGGGCTGTCCTCCTCATTAT	0.368																																					p.R268M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G803T	4						.						185.0	168.0	173.0					4																	82090862		2203	4299	6502	82309886	SO:0001583	missense	5593	exon4			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.803G>T	4.37:g.82090862C>A	ENSP00000378945:p.Arg268Met	Somatic		Capture	SOLID	Phase_I	82309886	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872900	0.51695	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	D;D;D	0.92911	-3.13;-3.13;-3.13	6.07	5.23	0.72850	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.396420	0.29884	N	0.010960	D	0.89556	0.6749	L	0.37697	1.125	0.80722	D	1	P;P	0.34462	0.454;0.454	P;B	0.45037	0.467;0.365	D	0.87321	0.2318	10	0.59425	D	0.04	-27.33	6.7834	0.23659	0.1502:0.7088:0.0:0.1409	.	268;268	E7EPE6;Q13237	.;KGP2_HUMAN	M	268	ENSP00000378945:R268M;ENSP00000264399:R268M;ENSP00000389038:R268M	ENSP00000264399:R268M	R	-	2	0	PRKG2	82309886	0.998000	0.40836	1.000000	0.80357	0.985000	0.73830	2.172000	0.42463	2.885000	0.99019	0.655000	0.94253	AGG		0.368	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
HNRNPD	3184	hgsc.bcm.edu	37	4	83278485	83278485	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:83278485T>C	ENST00000313899.7	-	5	1011	c.734A>G	c.(733-735)cAc>cGc	p.H245R	HNRNPD_ENST00000541060.1_Missense_Mutation_p.H91R|HNRNPD_ENST00000352301.4_Missense_Mutation_p.H226R|HNRNPD_ENST00000543098.1_Missense_Mutation_p.H193R|HNRNPD_ENST00000353341.4_Missense_Mutation_p.H245R|HNRNPD_ENST00000508119.1_5'UTR	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	245	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.H245R(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						ACCAACATTGTGGTATTTCTT	0.373																																					p.H245R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A734G	4						.						171.0	158.0	163.0					4																	83278485		2203	4300	6503	83497509	SO:0001583	missense	3184	exon5			AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.734A>G	4.37:g.83278485T>C	ENSP00000313199:p.His245Arg	Somatic		Capture	SOLID	Phase_I	83497509	NM_031370	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Missense_Mutation	SNP	ENST00000313899.7	37	CCDS3592.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527617	0.64860	.	.	ENSG00000138668	ENST00000313899;ENST00000353341;ENST00000352301;ENST00000543098;ENST00000307213;ENST00000541060;ENST00000509263	T;D;T;T;T;T	0.88509	-0.88;-2.39;-0.88;-0.88;-0.88;-0.88	5.95	5.95	0.96441	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	D	0.94470	0.8220	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.65815	0.995;0.995;0.991;0.993	D;D;D;D	0.70487	0.962;0.962;0.931;0.969	D	0.95003	0.8145	10	0.87932	D	0	.	16.4116	0.83717	0.0:0.0:0.0:1.0	.	226;245;226;245	Q14103-4;Q14103-3;Q14103-2;Q14103	.;.;.;HNRPD_HUMAN	R	245;245;226;193;220;91;178	ENSP00000313199:H245R;ENSP00000313327:H245R;ENSP00000305860:H226R;ENSP00000439380:H193R;ENSP00000437416:H91R;ENSP00000420926:H178R	ENSP00000307544:H220R	H	-	2	0	HNRNPD	83497509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.276000	0.75962	0.528000	0.53228	CAC		0.373	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252630.2	NM_031370	
WDFY3	23001	hgsc.bcm.edu	37	4	85750172	85750172	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:85750172C>T	ENST00000295888.4	-	9	1348	c.941G>A	c.(940-942)tGt>tAt	p.C314Y	WDFY3_ENST00000322366.6_Missense_Mutation_p.C314Y	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	314					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.C314Y(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAAGAGATCACAAAGAAAATT	0.348																																					p.C314Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G941A	4						.						81.0	82.0	81.0					4																	85750172		2203	4300	6503	85969196	SO:0001583	missense	23001	exon9			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.941G>A	4.37:g.85750172C>T	ENSP00000295888:p.Cys314Tyr	Somatic		Capture	SOLID	Phase_I	85969196	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	8.586	0.883520	0.17467	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.17054	2.3;2.3	5.5	4.65	0.58169	.	0.046711	0.85682	D	0.000000	T	0.07503	0.0189	N	0.08118	0	0.46654	D	0.999143	B;P	0.36837	0.158;0.571	B;B	0.27608	0.07;0.081	T	0.34950	-0.9808	10	0.35671	T	0.21	.	10.6595	0.45694	0.1388:0.5927:0.2685:0.0	.	314;314	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	Y	314	ENSP00000318466:C314Y;ENSP00000295888:C314Y	ENSP00000295888:C314Y	C	-	2	0	WDFY3	85969196	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.467000	0.45093	1.300000	0.44818	0.655000	0.94253	TGT		0.348	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
UNC5C	8633	hgsc.bcm.edu	37	4	96140377	96140377	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:96140377A>G	ENST00000453304.1	-	9	1736	c.1388T>C	c.(1387-1389)aTc>aCc	p.I463T	UNC5C_ENST00000506749.1_Missense_Mutation_p.I482T	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	463					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.I463T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GGTCATTGGGATTTTGTCTGA	0.522																																					p.I463T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1388C	4						.						341.0	328.0	333.0					4																	96140377		2203	4300	6503	96359400	SO:0001583	missense	8633	exon9			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1388T>C	4.37:g.96140377A>G	ENSP00000406022:p.Ile463Thr	Somatic		Capture	SOLID	Phase_I	96359400	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279124	0.80692	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.58210	0.65;0.36;0.35	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.74007	0.3660	M	0.83953	2.67	0.80722	D	1	P;D;D	0.63880	0.855;0.993;0.993	P;D;D	0.72338	0.574;0.977;0.977	T	0.78130	-0.2324	10	0.59425	D	0.04	.	15.099	0.72258	1.0:0.0:0.0:0.0	.	463;482;463	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	T	463;422;482;482	ENSP00000406022:I463T;ENSP00000426924:I482T;ENSP00000426153:I482T	ENSP00000328673:I422T	I	-	2	0	UNC5C	96359400	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	1.975000	0.57531	0.533000	0.62120	ATC		0.522	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
FSTL5	56884	hgsc.bcm.edu	37	4	162697123	162697123	+	Silent	SNP	G	G	A	rs201353835		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr4:162697123G>A	ENST00000306100.5	-	5	949	c.513C>T	c.(511-513)gaC>gaT	p.D171D	FSTL5_ENST00000536695.1_Silent_p.D170D|FSTL5_ENST00000427802.2_Silent_p.D170D|FSTL5_ENST00000379164.4_Silent_p.D170D	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	171						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.D171D(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GAGATATGTCGTCGCCATTAG	0.303													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15117	0.0		0.0	False		,,,				2504	0.0				p.D171D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C513T	4						.	G	,,	0,4406		0,0,2203	99.0	99.0	99.0		510,510,513	1.2	0.9	4		99	1,8587	1.2+/-3.3	0,1,4293	no	coding-synonymous,coding-synonymous,coding-synonymous	FSTL5	NM_001128427.1,NM_001128428.1,NM_020116.3	,,	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	,,	170/847,170/838,171/848	162697123	1,12993	2203	4294	6497	162916573	SO:0001819	synonymous_variant	56884	exon5			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.513C>T	4.37:g.162697123G>A		Somatic		Capture	SOLID	Phase_I	162916573	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Silent	SNP	ENST00000306100.5	37	CCDS3802.1																																																																																				0.303	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
GPRASP1	9737	hgsc.bcm.edu	37	X	101912272	101912272	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:101912272G>A	ENST00000361600.5	+	5	4232	c.3431G>A	c.(3430-3432)tGc>tAc	p.C1144Y	GPRASP1_ENST00000444152.1_Missense_Mutation_p.C1144Y|GPRASP1_ENST00000537097.1_Missense_Mutation_p.C1144Y|GPRASP1_ENST00000415986.1_Missense_Mutation_p.C1144Y|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1144	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.C1144Y(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TCCTGTAACTGCATACAATGT	0.388																																					p.C1144Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3431A	X						.						98.0	89.0	92.0					X																	101912272		2203	4300	6503	101798928	SO:0001583	missense	9737	exon3			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3431G>A	X.37:g.101912272G>A	ENSP00000355146:p.Cys1144Tyr	Somatic		Capture	SOLID	Phase_I	101798928	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	6.294	0.422372	0.11928	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	2.74	2.74	0.32292	Armadillo-type fold (1);	.	.	.	.	T	0.47303	0.1438	M	0.75264	2.295	0.28639	N	0.907259	D	0.89917	1.0	D	0.91635	0.999	T	0.27971	-1.0058	9	0.87932	D	0	-3.6847	8.175	0.31276	0.0:0.0:1.0:0.0	.	1144	Q5JY77	GASP1_HUMAN	Y	1144	ENSP00000393691:C1144Y;ENSP00000409420:C1144Y;ENSP00000355146:C1144Y;ENSP00000445683:C1144Y	ENSP00000355146:C1144Y	C	+	2	0	GPRASP1	101798928	1.000000	0.71417	0.939000	0.37840	0.294000	0.27393	3.606000	0.54095	1.646000	0.50622	0.284000	0.19432	TGC		0.388	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
ATP1B4	23439	hgsc.bcm.edu	37	X	119500597	119500597	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:119500597G>T	ENST00000218008.3	+	2	338	c.281G>T	c.(280-282)tGg>tTg	p.W94L	ATP1B4_ENST00000361319.3_Missense_Mutation_p.W94L|ATP1B4_ENST00000539306.1_Missense_Mutation_p.W94L	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	94					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)	p.W94L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						GAATACCTGTGGGATCCAGAG	0.507																																					p.W94L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G281T	X						.						103.0	86.0	92.0					X																	119500597		2203	4300	6503	119384625	SO:0001583	missense	23439	exon2			AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.281G>T	X.37:g.119500597G>T	ENSP00000218008:p.Trp94Leu	Somatic		Capture	SOLID	Phase_I	119384625	NM_001142447	Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595523	0.66219	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.38077	1.18;1.18;1.16	5.36	4.47	0.54385	.	0.052048	0.85682	N	0.000000	T	0.63850	0.2546	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.999	T	0.68277	-0.5451	10	0.48119	T	0.1	-12.6953	13.5374	0.61653	0.0:0.0:0.8433:0.1567	.	94;94;94	B7ZKW0;Q9UN42;Q9UN42-2	.;AT1B4_HUMAN;.	L	94	ENSP00000218008:W94L;ENSP00000355346:W94L;ENSP00000443334:W94L	ENSP00000218008:W94L	W	+	2	0	ATP1B4	119384625	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	6.380000	0.73158	1.085000	0.41206	0.589000	0.80489	TGG		0.507	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447	
PRPS2	5634	hgsc.bcm.edu	37	X	12827404	12827404	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:12827404G>T	ENST00000380668.5	+	3	486	c.358G>T	c.(358-360)Ggg>Tgg	p.G120W	PRPS2_ENST00000489404.1_Missense_Mutation_p.G120W|PRPS2_ENST00000398491.2_Missense_Mutation_p.G123W	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	120					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.G120W(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						GTCGGTGGCTGGGGCGGATCA	0.403																																					p.G123W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G367T	X						.						151.0	132.0	138.0					X																	12827404		2203	4300	6503	12737325	SO:0001583	missense	5634	exon3			Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.358G>T	X.37:g.12827404G>T	ENSP00000370043:p.Gly120Trp	Somatic		Capture	SOLID	Phase_I	12737325	NM_001039091	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	ENST00000380668.5	37	CCDS14150.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610511	0.87258	.	.	ENSG00000101911	ENST00000380663;ENST00000380668;ENST00000398491;ENST00000489404;ENST00000461630;ENST00000460220	D;D;D;D;D	0.99711	-6.49;-6.49;-6.49;-6.49;-6.49	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.99900	0.9952	H	0.99969	5.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95723	0.8768	10	0.87932	D	0	-30.6174	18.0503	0.89345	0.0:0.0:1.0:0.0	.	120;123	P11908;P11908-2	PRPS2_HUMAN;.	W	120;120;123;120;33;10	ENSP00000370038:G120W;ENSP00000370043:G120W;ENSP00000381504:G123W;ENSP00000419380:G120W;ENSP00000418911:G33W	ENSP00000370038:G120W	G	+	1	0	PRPS2	12737325	1.000000	0.71417	0.855000	0.33649	0.924000	0.55760	9.273000	0.95719	2.285000	0.76669	0.544000	0.68410	GGG		0.403	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
ATP1B4	23439	hgsc.bcm.edu	37	X	119504623	119504623	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:119504623A>T	ENST00000218008.3	+	3	439	c.382A>T	c.(382-384)Acc>Tcc	p.T128S	ATP1B4_ENST00000361319.3_Missense_Mutation_p.T124S|ATP1B4_ENST00000539306.1_Intron	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	128					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)	p.T124S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						TGCTGTGATCACCCTCTGCAT	0.502																																					p.T128S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A382T	X						.						411.0	322.0	352.0					X																	119504623		2203	4300	6503	119388651	SO:0001583	missense	23439	exon3			AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.382A>T	X.37:g.119504623A>T	ENSP00000218008:p.Thr128Ser	Somatic		Capture	SOLID	Phase_I	119388651	NM_001142447	Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845027	0.32606	.	.	ENSG00000101892	ENST00000218008;ENST00000361319	T;T	0.30448	1.53;1.53	5.39	4.17	0.49024	.	0.096942	0.64402	D	0.000002	T	0.18087	0.0434	L	0.31752	0.955	0.80722	D	1	B;P;P	0.36086	0.379;0.536;0.48	B;B;B	0.35688	0.193;0.208;0.132	T	0.06215	-1.0839	10	0.33141	T	0.24	-15.8115	3.2505	0.06812	0.6433:0.0:0.1753:0.1814	.	93;128;124	B7ZKV9;Q9UN42;Q9UN42-2	.;AT1B4_HUMAN;.	S	128;124	ENSP00000218008:T128S;ENSP00000355346:T124S	ENSP00000218008:T128S	T	+	1	0	ATP1B4	119388651	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	1.863000	0.39459	1.783000	0.52377	0.345000	0.21793	ACC		0.502	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447	
ZNF280C	55609	hgsc.bcm.edu	37	X	129373666	129373666	+	Splice_Site	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:129373666T>G	ENST00000370978.4	-	6	536	c.383A>C	c.(382-384)gAt>gCt	p.D128A		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	128	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D128A(1)		endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						CTTTGTAAAATCCTGTAAAAA	0.284																																					p.D128A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A383C	X						.						45.0	42.0	43.0					X																	129373666		2203	4296	6499	129201347	SO:0001630	splice_region_variant	55609	exon6			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.382-1A>C	X.37:g.129373666T>G		Somatic		Capture	SOLID	Phase_I	129201347	NM_017666	A8K2V8|Q9NXR3	Missense_Mutation	SNP	ENST00000370978.4	37	CCDS14622.1	.	.	.	.	.	.	.	.	.	.	T	9.702	1.154627	0.21371	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	T;T	0.27104	1.69;1.69	3.66	-0.341	0.12639	.	.	.	.	.	T	0.26955	0.0660	M	0.61703	1.905	0.09310	N	1	P;P	0.42649	0.786;0.786	P;P	0.46510	0.519;0.519	T	0.16012	-1.0417	9	0.29301	T	0.29	.	4.0024	0.09585	0.0:0.132:0.4404:0.4276	.	128;128	Q9UJJ2;Q8ND82	.;Z280C_HUMAN	A	128	ENSP00000360017:D128A;ENSP00000408521:D128A	ENSP00000066465:D128A	D	-	2	0	ZNF280C	129201347	0.189000	0.23263	0.082000	0.20525	0.108000	0.19459	-0.072000	0.11486	-0.006000	0.14370	0.412000	0.27726	GAT		0.284	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666	Missense_Mutation
ARHGAP36	158763	hgsc.bcm.edu	37	X	130217764	130217764	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:130217764A>G	ENST00000276211.5	+	4	721	c.376A>G	c.(376-378)Acc>Gcc	p.T126A	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.T114A|ARHGAP36_ENST00000370921.1_5'UTR	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	126					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.T126A(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GAACGAGTTTACCCGCCGCAA	0.562																																					p.T126A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A376G	X						.						128.0	126.0	127.0					X																	130217764		2203	4300	6503	130045445	SO:0001583	missense	158763	exon4				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.376A>G	X.37:g.130217764A>G	ENSP00000276211:p.Thr126Ala	Somatic		Capture	SOLID	Phase_I	130045445	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	A	6.074	0.381868	0.11524	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.07800	3.16;3.16;3.19	4.3	3.14	0.36123	Rho GTPase-activating protein domain (1);	0.130908	0.35407	N	0.003228	T	0.08802	0.0218	N	0.11560	0.145	0.80722	D	1	D;D;P	0.56035	0.974;0.974;0.956	D;D;D	0.70487	0.969;0.969;0.931	T	0.46624	-0.9178	10	0.11794	T	0.64	.	5.8436	0.18647	0.8815:0.0:0.1185:0.0	.	95;114;126	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	A	126;114;78;95	ENSP00000276211:T126A;ENSP00000359960:T114A;ENSP00000408515:T95A	ENSP00000276211:T126A	T	+	1	0	ARHGAP36	130045445	0.975000	0.34042	1.000000	0.80357	0.012000	0.07955	1.414000	0.34736	0.774000	0.33427	-0.329000	0.08387	ACC		0.562	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
MAGEC2	51438	hgsc.bcm.edu	37	X	141291560	141291560	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:141291560G>A	ENST00000247452.3	-	3	561	c.214C>T	c.(214-216)Ccc>Tcc	p.P72S		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	72					cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.P72S(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					ACACCAGAGGGCACCTCCTCC	0.542										HNSCC(46;0.14)																											p.P72S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C214T	X						.						76.0	71.0	73.0					X																	141291560		2203	4300	6503	141119226	SO:0001583	missense	51438	exon3			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.214C>T	X.37:g.141291560G>A	ENSP00000354660:p.Pro72Ser	Somatic		Capture	SOLID	Phase_I	141119226	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	2.495	-0.316637	0.05422	.	.	ENSG00000046774	ENST00000247452	T	0.02369	4.32	0.896	-0.0838	0.13692	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.01695	0.0054	N	0.14661	0.345	0.09310	N	1	B	0.28233	0.204	B	0.19391	0.025	T	0.47699	-0.9097	8	0.36615	T	0.2	.	.	.	.	.	72	Q9UBF1	MAGC2_HUMAN	S	72	ENSP00000354660:P72S	ENSP00000354660:P72S	P	-	1	0	MAGEC2	141119226	0.000000	0.05858	0.013000	0.15412	0.033000	0.12548	-1.411000	0.02478	-0.106000	0.12110	0.411000	0.27672	CCC		0.542	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
Unknown	0	hgsc.bcm.edu	37	Unknown	0	0	+	IGR	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrUnknown:0A>G								None (None upstream) : None (None downstream)																								0.0																																					p.F235F												.	.	0			c.T705C	X						.																																			148576467	SO:0001628	intergenic_variant	4110	exon5																															Unknown.37:g.0A>G		Somatic		Capture	SOLID	Phase_I	148576467	NM_001011544		Silent	SNP		37																																																																																				0	0								
CNGA2	1260	hgsc.bcm.edu	37	X	150907322	150907322	+	Silent	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:150907322C>A	ENST00000329903.4	+	2	207	c.174C>A	c.(172-174)gcC>gcA	p.A58A		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	58					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.A58A(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					ACGTGGATGCCCCACAGCAGG	0.602																																					p.A58A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C174A	X						.						51.0	44.0	46.0					X																	150907322		2172	4239	6411	150657978	SO:0001819	synonymous_variant	1260	exon3			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.174C>A	X.37:g.150907322C>A		Somatic		Capture	SOLID	Phase_I	150657978	NM_005140	A0AVD0	Silent	SNP	ENST00000329903.4	37	CCDS14701.1																																																																																				0.602	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
GABRQ	55879	hgsc.bcm.edu	37	X	151815621	151815621	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:151815621C>T	ENST00000370306.2	+	4	539	c.519C>T	c.(517-519)taC>taT	p.Y173Y		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	173					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.Y173Y(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CGGTGCGGTACGGCATCCGGT	0.517																																					p.Y173Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C519T	X						.						145.0	106.0	119.0					X																	151815621		2203	4300	6503	151566277	SO:0001819	synonymous_variant	55879	exon4			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.519C>T	X.37:g.151815621C>T		Somatic		Capture	SOLID	Phase_I	151566277	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	37	CCDS14707.1																																																																																				0.517	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
G6PD	2539	hgsc.bcm.edu	37	X	153762676	153762676	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:153762676C>T	ENST00000393564.2	-	6	633	c.521G>A	c.(520-522)gGg>gAg	p.G174E	G6PD_ENST00000497281.1_5'Flank|G6PD_ENST00000393562.2_Missense_Mutation_p.G204E|G6PD_ENST00000369620.2_Missense_Mutation_p.G174E	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	174					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.G174E(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGGTCCCTCCCGAAGGGCTT	0.617																																					p.G204E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G611A	X						.						82.0	69.0	74.0					X																	153762676		2203	4300	6503	153415870	SO:0001583	missense	2539	exon6			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.521G>A	X.37:g.153762676C>T	ENSP00000377194:p.Gly174Glu	Somatic		Capture	SOLID	Phase_I	153415870	NM_000402	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	37	CCDS44023.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648473	0.87958	.	.	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620;ENST00000439227;ENST00000440967;ENST00000433845	D;D;D;D;D;D	0.99848	-7.14;-7.14;-7.14;-7.14;-7.14;-7.14	5.65	5.65	0.86999	NAD(P)-binding domain (1);Glucose-6-phosphate dehydrogenase, NAD-binding (1);	0.000000	0.85682	D	0.000000	D	0.99921	0.9963	H	0.99851	4.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	D	0.95918	0.8928	10	0.87932	D	0	.	15.9286	0.79644	0.0:1.0:0.0:0.0	.	174;204	P11413;P11413-3	G6PD_HUMAN;.	E	204;174;174;174;175;175;174	ENSP00000377192:G204E;ENSP00000377194:G174E;ENSP00000358633:G174E;ENSP00000395599:G175E;ENSP00000400648:G175E;ENSP00000394690:G174E	ENSP00000291567:G174E	G	-	2	0	G6PD	153415870	1.000000	0.71417	0.964000	0.40570	0.682000	0.39822	7.518000	0.81795	2.361000	0.80049	0.513000	0.50165	GGG		0.617	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402	
SHROOM2	357	hgsc.bcm.edu	37	X	9859071	9859071	+	Silent	SNP	C	C	T	rs201142240		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:9859071C>T	ENST00000380913.3	+	3	462	c.372C>T	c.(370-372)gaC>gaT	p.D124D		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	124					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.D124D(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				AGTTCTCTGACAGCCACCCCG	0.662																																					p.D124D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C372T	X						.						67.0	45.0	52.0					X																	9859071		2200	4299	6499	9819071	SO:0001819	synonymous_variant	357	exon3			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.372C>T	X.37:g.9859071C>T		Somatic		Capture	SOLID	Phase_I	9819071	NM_001649	B9EIQ7	Silent	SNP	ENST00000380913.3	37	CCDS14135.1																																																																																				0.662	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
SH3KBP1	30011	hgsc.bcm.edu	37	X	19702079	19702079	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:19702079G>A	ENST00000397821.3	-	6	878	c.588C>T	c.(586-588)gcC>gcT	p.A196A	SH3KBP1_ENST00000379698.4_Silent_p.A159A|SH3KBP1_ENST00000379697.3_Silent_p.A240A	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	196					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.A196A(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						CTGTCCCGTTGGCACCTTCAG	0.512																																					p.A159A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C477T	X						.						151.0	124.0	133.0					X																	19702079		2203	4300	6503	19612000	SO:0001819	synonymous_variant	30011	exon5			AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.588C>T	X.37:g.19702079G>A		Somatic		Capture	SOLID	Phase_I	19612000	NM_001024666	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Silent	SNP	ENST00000397821.3	37	CCDS14193.1																																																																																				0.512	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	
ZFX	7543	hgsc.bcm.edu	37	X	24225531	24225531	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:24225531C>T	ENST00000379177.1	+	7	1162	c.735C>T	c.(733-735)ggC>ggT	p.G245G	ZFX_ENST00000379188.3_Silent_p.G245G|ZFX_ENST00000338565.3_Intron|ZFX_ENST00000539115.1_Silent_p.G16G|ZFX_ENST00000304543.5_Silent_p.G245G|ZFX_ENST00000540034.1_Silent_p.G284G|ZFX_ENST00000459724.1_3'UTR	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	245					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.G245G(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						AAGTGGATGGCACTTGCCCTG	0.418																																					p.G245G	Esophageal Squamous(20;306 562 7346 32868 37983)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C735T	X						.						171.0	153.0	159.0					X																	24225531		2203	4300	6503	24135452	SO:0001819	synonymous_variant	7543	exon4				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.735C>T	X.37:g.24225531C>T		Somatic		Capture	SOLID	Phase_I	24135452	NM_001178095	B9EG97|O43668|Q8WYJ8	Silent	SNP	ENST00000379177.1	37	CCDS14211.1																																																																																				0.418	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
IL1RAPL1	11141	hgsc.bcm.edu	37	X	29972686	29972686	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:29972686G>A	ENST00000378993.1	+	10	1922	c.1249G>A	c.(1249-1251)Gac>Aac	p.D417N	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.D417N	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	417	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.D417N(1)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						AGTGGATCCTGACCAGTGGAA	0.358																																					p.D417N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1249A	X						.						97.0	81.0	87.0					X																	29972686		2202	4300	6502	29882607	SO:0001583	missense	11141	exon10			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1249G>A	X.37:g.29972686G>A	ENSP00000368278:p.Asp417Asn	Somatic		Capture	SOLID	Phase_I	29882607	NM_014271	A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	G	35	5.551725	0.96501	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.05081	3.5;3.5	5.81	5.81	0.92471	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	M	0.73598	2.24	0.58432	D	0.999999	P	0.45827	0.867	P	0.54060	0.741	T	0.00098	-1.2070	9	.	.	.	.	19.0725	0.93145	0.0:0.0:1.0:0.0	.	417	Q9NZN1	IRPL1_HUMAN	N	417	ENSP00000368278:D417N;ENSP00000305200:D417N	.	D	+	1	0	IL1RAPL1	29882607	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.453000	0.82957	0.594000	0.82650	GAC		0.358	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271	
MAGEB4	4115	hgsc.bcm.edu	37	X	30260604	30260604	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:30260604C>A	ENST00000378982.2	+	1	548	c.352C>A	c.(352-354)Cag>Aag	p.Q118K	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	118	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.Q118K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GATGTTAGTGCAGTTCCTGCT	0.443																																					p.Q118K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C352A	X						.						55.0	41.0	46.0					X																	30260604		2202	4300	6502	30170525	SO:0001583	missense	4115	exon1				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.352C>A	X.37:g.30260604C>A	ENSP00000368266:p.Gln118Lys	Somatic		Capture	SOLID	Phase_I	30170525	NM_002367	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.244151	0.22796	.	.	ENSG00000120289	ENST00000378982	T	0.04706	3.57	3.19	1.36	0.22044	.	0.000000	0.64402	U	0.000003	T	0.05227	0.0139	L	0.54908	1.71	0.09310	N	1	B	0.33777	0.425	B	0.36378	0.223	T	0.29671	-1.0004	10	0.46703	T	0.11	.	3.457	0.07519	0.2474:0.6092:0.0:0.1434	.	118	O15481	MAGB4_HUMAN	K	118	ENSP00000368266:Q118K	ENSP00000368266:Q118K	Q	+	1	0	MAGEB4	30170525	0.000000	0.05858	0.001000	0.08648	0.222000	0.24845	-0.185000	0.09684	0.226000	0.20979	-0.296000	0.09543	CAG		0.443	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
DMD	1756	hgsc.bcm.edu	37	X	31224764	31224764	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:31224764C>T	ENST00000357033.4	-	66	9790	c.9584G>A	c.(9583-9585)cGt>cAt	p.R3195H	DMD_ENST00000378677.2_Missense_Mutation_p.R3191H|DMD_ENST00000378680.2_Missense_Mutation_p.R127H|DMD_ENST00000343523.2_Missense_Mutation_p.R735H|DMD_ENST00000541735.1_Missense_Mutation_p.R735H|DMD_ENST00000474231.1_Missense_Mutation_p.R735H|DMD_ENST00000378707.3_Missense_Mutation_p.R735H|DMD_ENST00000361471.4_Missense_Mutation_p.R127H|DMD_ENST00000378723.3_Missense_Mutation_p.R127H|DMD_ENST00000378702.4_Missense_Mutation_p.R127H|DMD_ENST00000359836.1_Missense_Mutation_p.R735H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3195	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R3190H(2)|p.R735H(2)|p.R1854H(1)|p.R3191P(1)|p.R3195P(1)|p.R127P(1)|p.R1854P(1)|p.R3190P(1)|p.R735P(1)|p.R3191H(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGACAGGACACGGATCCTCCC	0.373																																					p.R127H												.	.	12	Substitution - Missense(12)	large_intestine(6)|endometrium(6)	c.G380A	X						.						97.0	81.0	87.0					X																	31224764		2202	4300	6502	31134685	SO:0001583	missense	1756	exon5			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9584G>A	X.37:g.31224764C>T	ENSP00000354923:p.Arg3195His	Somatic		Capture	SOLID	Phase_I	31134685	NM_004015	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888553	0.91814	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680	T;T;T;T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.21	5.21	0.72293	EF-hand domain, type 1 (1);	0.000000	0.37053	U	0.002276	D	0.86314	0.5903	M	0.92219	3.285	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.83275	0.965;0.979;0.996;0.996;0.996;0.996;0.984;0.963;0.973;0.996;0.993;0.99;0.972;0.973;0.953;0.991	D	0.89765	0.3950	10	0.87932	D	0	.	17.8941	0.88881	0.0:1.0:0.0:0.0	.	127;3187;3195;3191;1854;1851;735;735;735;735;735;3072;127;127;127;127	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.	H	3187;1854;1851;127;891;3191;3195;735;735;3195;3072;735;735;127;735;127;127	ENSP00000367997:R127H;ENSP00000350765:R891H;ENSP00000367948:R3191H;ENSP00000354923:R3195H;ENSP00000352894:R735H;ENSP00000340057:R735H;ENSP00000367979:R735H;ENSP00000444119:R735H;ENSP00000367974:R127H;ENSP00000417123:R735H;ENSP00000354464:R127H;ENSP00000367951:R127H	ENSP00000340057:R735H	R	-	2	0	DMD	31134685	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.458000	0.80787	2.415000	0.81967	0.600000	0.82982	CGT		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
CHDC2	286464	hgsc.bcm.edu	37	X	36122793	36122793	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:36122793A>G	ENST00000313548.4	+	8	1216	c.1030A>G	c.(1030-1032)Aaa>Gaa	p.K344E		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	344	CH.					integral component of membrane (GO:0016021)		p.K344E(1)									TGTGATATGGAAAAACTGTCA	0.333																																					p.K344E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1030G	X						.						56.0	50.0	52.0					X																	36122793		2202	4299	6501	36032714	SO:0001583	missense	286464	exon8			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1030A>G	X.37:g.36122793A>G	ENSP00000324767:p.Lys344Glu	Somatic		Capture	SOLID	Phase_I	36032714	NM_173695		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	A	11.29	1.593791	0.28445	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.53	0.405	0.16361	Calponin homology domain (3);	0.461253	0.18320	N	0.144835	T	0.43255	0.1239	L	0.50333	1.59	0.18873	N	0.999982	D	0.54601	0.967	P	0.52454	0.699	T	0.30534	-0.9975	9	0.41790	T	0.15	-10.3801	8.6491	0.34025	0.681:0.0:0.319:0.0	.	344	Q8N9S7	CX059_HUMAN	E	344	.	ENSP00000324767:K344E	K	+	1	0	CXorf59	36032714	0.904000	0.30761	0.383000	0.26132	0.187000	0.23431	0.699000	0.25586	-0.013000	0.14199	0.486000	0.48141	AAA		0.333	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
RPGR	6103	hgsc.bcm.edu	37	X	38160586	38160586	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:38160586C>T	ENST00000339363.3	-	9	1140	c.973G>A	c.(973-975)Gga>Aga	p.G325R	RPGR_ENST00000338898.3_Missense_Mutation_p.G325R|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.G325R|RPGR_ENST00000342811.3_Missense_Mutation_p.G325R|RPGR_ENST00000318842.7_Missense_Mutation_p.G325R|RPGR_ENST00000309513.3_Missense_Mutation_p.G325R			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	325					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.G325R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CCTAATTTTCCGTGGCGACCA	0.328																																					p.G325R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G973A	X						.						83.0	74.0	77.0					X																	38160586		2202	4300	6502	38045530	SO:0001583	missense	6103	exon9			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.973G>A	X.37:g.38160586C>T	ENSP00000343671:p.Gly325Arg	Somatic		Capture	SOLID	Phase_I	38045530	NM_000328	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37		.	.	.	.	.	.	.	.	.	.	c	28.9	4.957362	0.92726	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	D;D;D;D;D;D	0.92647	-3.08;-2.01;-3.08;-3.08;-3.08;-3.08	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97269	0.9107	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98145	1.0438	10	0.87932	D	0	.	18.4879	0.90836	0.0:1.0:0.0:0.0	.	325;325	E9PE28;Q92834-2	.;.	R	325	ENSP00000343671:G325R;ENSP00000308783:G325R;ENSP00000340208:G325R;ENSP00000322219:G325R;ENSP00000339531:G325R;ENSP00000367766:G325R	ENSP00000308783:G325R	G	-	1	0	RPGR	38045530	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.969000	0.76092	2.407000	0.81776	0.590000	0.80494	GGA		0.328	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
MED14	9282	hgsc.bcm.edu	37	X	40514249	40514249	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:40514249C>T	ENST00000324817.1	-	29	4154	c.4036G>A	c.(4036-4038)Gcg>Acg	p.A1346T		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1346					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.A1346T(1)		NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ATCGGCGGCGCGCTGGGAGGG	0.478																																					p.A1346T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4036A	X						.						91.0	77.0	82.0					X																	40514249		2203	4300	6503	40399193	SO:0001583	missense	9282	exon29			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.4036G>A	X.37:g.40514249C>T	ENSP00000323720:p.Ala1346Thr	Somatic		Capture	SOLID	Phase_I	40399193	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750463	0.49257	.	.	ENSG00000180182	ENST00000324817;ENST00000416199;ENST00000433003	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.60856	0.2301	L	0.41492	1.28	0.80722	D	1	D;D	0.69078	0.997;0.997	P;P	0.52189	0.692;0.692	T	0.66019	-0.6027	9	0.62326	D	0.03	.	17.0398	0.86486	0.0:1.0:0.0:0.0	.	1346;1346	A8KAK5;O60244	.;MED14_HUMAN	T	1346;58;245	.	ENSP00000323720:A1346T	A	-	1	0	MED14	40399193	1.000000	0.71417	0.402000	0.26371	0.051000	0.14879	7.445000	0.80570	2.030000	0.59900	0.544000	0.68410	GCG		0.478	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	
MED14	9282	hgsc.bcm.edu	37	X	40556295	40556295	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:40556295C>T	ENST00000324817.1	-	13	1749	c.1631G>A	c.(1630-1632)cGc>cAc	p.R544H		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	544	Interaction with SREBF1.|Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R544H(1)		NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTGTGGAAGGCGGGTAAGTTT	0.353																																					p.R544H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1631A	X						.						144.0	135.0	138.0					X																	40556295		2203	4300	6503	40441239	SO:0001583	missense	9282	exon13			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.1631G>A	X.37:g.40556295C>T	ENSP00000323720:p.Arg544His	Somatic		Capture	SOLID	Phase_I	40441239	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774890	0.90108	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.76090	0.3939	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.65140	0.932	T	0.75747	-0.3209	9	0.42905	T	0.14	.	18.363	0.90382	0.0:1.0:0.0:0.0	.	544	O60244	MED14_HUMAN	H	544	.	ENSP00000323720:R544H	R	-	2	0	MED14	40441239	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.487000	0.81328	2.276000	0.75962	0.538000	0.68166	CGC		0.353	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	
USP9X	8239	hgsc.bcm.edu	37	X	41045841	41045841	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:41045841C>T	ENST00000324545.8	+	24	4263	c.3630C>T	c.(3628-3630)tcC>tcT	p.S1210S	USP9X_ENST00000378308.2_Silent_p.S1210S	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1210					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.S1203S(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ATCCATCATCCGAGTGCATGC	0.403																																					p.S1210S	Ovarian(172;1807 2695 35459 49286)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3630T	X						.						205.0	183.0	190.0					X																	41045841		2203	4300	6503	40930785	SO:0001819	synonymous_variant	8239	exon24			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.3630C>T	X.37:g.41045841C>T		Somatic		Capture	SOLID	Phase_I	40930785	NM_001039590	O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	CCDS43930.1																																																																																				0.403	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
GPR34	2857	hgsc.bcm.edu	37	X	41555109	41555109	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:41555109G>A	ENST00000378142.4	+	3	507	c.223G>A	c.(223-225)Gcc>Acc	p.A75T	CASK_ENST00000421587.2_Intron|GPR34_ENST00000378138.5_Missense_Mutation_p.A75T|CASK_ENST00000378158.1_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000378166.4_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	75					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.A75T(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						GAACATAATCGCCCTCTATGT	0.403																																					p.A75T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G223A	X						.						112.0	96.0	101.0					X																	41555109		2203	4300	6503	41440053	SO:0001583	missense	2857	exon3			AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.223G>A	X.37:g.41555109G>A	ENSP00000367384:p.Ala75Thr	Somatic		Capture	SOLID	Phase_I	41440053	NM_005300	O95853	Missense_Mutation	SNP	ENST00000378142.4	37	CCDS14258.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232868	0.79688	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	T;T	0.72505	-0.66;-0.66	5.87	5.87	0.94306	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84234	0.5427	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	D	0.84525	0.0630	10	0.52906	T	0.07	-8.8313	19.1264	0.93386	0.0:0.0:1.0:0.0	.	75	Q9UPC5	GPR34_HUMAN	T	75;75;28	ENSP00000367384:A75T;ENSP00000367378:A75T	ENSP00000367378:A75T	A	+	1	0	GPR34	41440053	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	8.058000	0.89460	2.466000	0.83321	0.594000	0.82650	GCC		0.403	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056264.1	NM_005300	
UBA1	7317	hgsc.bcm.edu	37	X	47070571	47070571	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:47070571G>A	ENST00000335972.6	+	20	2594	c.2411G>A	c.(2410-2412)gGc>gAc	p.G804D	UBA1_ENST00000377269.3_Missense_Mutation_p.G252D|UBA1_ENST00000377351.4_Missense_Mutation_p.G804D	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	804					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.G804D(1)		breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCCAAGTCTGGCGTCAAGATC	0.602																																					p.G804D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2411A	X						.						116.0	84.0	95.0					X																	47070571		2203	4300	6503	46955515	SO:0001583	missense	7317	exon20			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.2411G>A	X.37:g.47070571G>A	ENSP00000338413:p.Gly804Asp	Somatic		Capture	SOLID	Phase_I	46955515	NM_153280	Q5JRR8|Q96E13	Missense_Mutation	SNP	ENST00000335972.6	37	CCDS14275.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094710	0.56075	.	.	ENSG00000130985	ENST00000377351;ENST00000335972;ENST00000377269	T;T;T	0.48836	0.8;0.8;0.8	4.66	4.66	0.58398	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.046711	0.85682	D	0.000000	T	0.65091	0.2658	M	0.64997	1.995	0.80722	D	1	P;D	0.76494	0.951;0.999	P;D	0.85130	0.738;0.997	T	0.63959	-0.6519	10	0.37606	T	0.19	-17.6515	15.6561	0.77136	0.0:0.0:1.0:0.0	.	252;804	Q5JRR6;P22314	.;UBA1_HUMAN	D	804;804;252	ENSP00000366568:G804D;ENSP00000338413:G804D;ENSP00000366481:G252D	ENSP00000338413:G804D	G	+	2	0	UBA1	46955515	1.000000	0.71417	0.952000	0.39060	0.975000	0.68041	7.453000	0.80700	2.296000	0.77279	0.529000	0.55759	GGC		0.602	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334	
ARAF	369	hgsc.bcm.edu	37	X	47430737	47430737	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:47430737G>T	ENST00000377045.4	+	16	1896	c.1702G>T	c.(1702-1704)Gag>Tag	p.E568*	ARAF_ENST00000470206.1_3'UTR	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	568	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.E568Q(1)|p.E568*(1)		biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	GGCCACAATTGAGCTGCTGCA	0.632																																					p.E568X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(1)|lung(1)	c.G1702T	X						.						69.0	49.0	56.0					X																	47430737		2203	4300	6503	47315681	SO:0001587	stop_gained	369	exon16			X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.1702G>T	X.37:g.47430737G>T	ENSP00000366244:p.Glu568*	Somatic		Capture	SOLID	Phase_I	47315681	NM_001654	P07557|Q5H9B2|Q5H9B3	Nonsense_Mutation	SNP	ENST00000377045.4	37	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	g	39	7.900406	0.98551	.	.	ENSG00000078061	ENST00000377045	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.5116	0.75786	0.0:0.0:1.0:0.0	.	.	.	.	X	568	.	ENSP00000366244:E568X	E	+	1	0	ARAF	47315681	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.422000	0.97458	2.345000	0.79718	0.519000	0.50382	GAG		0.632	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1		
EBP	10682	hgsc.bcm.edu	37	X	48382377	48382377	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:48382377G>T	ENST00000495186.1	+	2	1041	c.218G>T	c.(217-219)gGg>gTg	p.G73V	EBP_ENST00000276096.6_3'UTR	NM_006579.2	NP_006570.1	Q15125	EBP_HUMAN	emopamil binding protein (sterol isomerase)	73					cholesterol biosynthetic process (GO:0006695)|cholesterol metabolic process (GO:0008203)|drug transmembrane transport (GO:0006855)|hemopoiesis (GO:0030097)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	C-8 sterol isomerase activity (GO:0000247)|cholestenol delta-isomerase activity (GO:0047750)|drug transmembrane transporter activity (GO:0015238)|steroid delta-isomerase activity (GO:0004769)|transmembrane signaling receptor activity (GO:0004888)	p.G73V(1)		NS(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|stomach(1)	11					Tamoxifen(DB00675)	GCAGTGTGTGGGTTCATTCAC	0.542																																					p.G73V	Ovarian(41;550 1000 33077 33474 52335)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G218T	X						.						189.0	161.0	171.0					X																	48382377		2203	4300	6503	48267321	SO:0001583	missense	10682	exon2			Z37986	CCDS14300.1	Xp11.23-p11.22	2013-05-22	2001-11-28		ENSG00000147155	ENSG00000147155			3133	protein-coding gene	gene with protein product	"""3-beta-hydroxysteroid-delta-8,delta-7-isomerase"", ""Chondrodysplasia punctata-2, X-linked dominant (Happle syndrome)"", ""sterol 8-isomerase"""	300205	"""emopamil-binding protein (sterol isomerase)"""	CDPX2		7706302, 8938429	Standard	NM_006579		Approved	CPX, CPXD, CHO2	uc004djx.4	Q15125	OTTHUMG00000034482	ENST00000495186.1:c.218G>T	X.37:g.48382377G>T	ENSP00000417052:p.Gly73Val	Somatic		Capture	SOLID	Phase_I	48267321	NM_006579	Q6FGL3|Q6IBI9	Missense_Mutation	SNP	ENST00000495186.1	37	CCDS14300.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643977	0.67244	.	.	ENSG00000147155	ENST00000495186;ENST00000446158;ENST00000414061	D;D;D	0.98649	-5.05;-5.05;-5.05	5.72	2.72	0.32119	.	0.377447	0.29100	N	0.013148	D	0.98745	0.9578	M	0.89601	3.045	0.54753	D	0.999989	P	0.47604	0.898	P	0.51229	0.663	D	0.98333	1.0534	10	0.56958	D	0.05	-4.3368	14.0776	0.64900	0.0:0.5682:0.4318:0.0	.	73	Q15125	EBP_HUMAN	V	73	ENSP00000417052:G73V;ENSP00000390031:G73V;ENSP00000405832:G73V	ENSP00000405832:G73V	G	+	2	0	EBP	48267321	1.000000	0.71417	0.920000	0.36463	0.971000	0.66376	2.805000	0.47939	0.534000	0.28695	0.536000	0.68110	GGG		0.542	EBP-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083372.1	NM_006579	
SUV39H1	6839	hgsc.bcm.edu	37	X	48559092	48559092	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:48559092G>A	ENST00000376687.3	+	3	966	c.776G>A	c.(775-777)cGc>cAc	p.R259H	SUV39H1_ENST00000337852.6_Missense_Mutation_p.R270H|AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000453214.2_Missense_Mutation_p.A107T	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	259	Mediates interaction with MECOM. {ECO:0000250}.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.R259H(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						TGGGGCGTCCGCACCCTGGAG	0.592																																					p.R259H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G776A	X						.						46.0	34.0	38.0					X																	48559092		2203	4300	6503	48444036	SO:0001583	missense	6839	exon3			AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.776G>A	X.37:g.48559092G>A	ENSP00000365877:p.Arg259His	Somatic		Capture	SOLID	Phase_I	48444036	NM_003173	B2R6E8|B4DST0|Q53G60|Q6FHK6	Missense_Mutation	SNP	ENST00000376687.3	37	CCDS14304.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.076653|4.076653	0.76415|0.76415	.|.	.|.	ENSG00000101945|ENSG00000101945	ENST00000448548;ENST00000453214|ENST00000337852;ENST00000376687;ENST00000422496	.|D;D	.|0.84070	.|-1.8;-1.8	5.06|5.06	5.06|5.06	0.68205|0.68205	.|SET domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91751|0.91751	0.7391|0.7391	M|M	0.87758|0.87758	2.905|2.905	0.26050|0.26050	N|N	0.981499|0.981499	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.77004	.|0.989;0.989	D|D	0.86491|0.86491	0.1797|0.1797	6|10	0.21540|0.87932	T|D	0.41|0	.|.	14.8243|14.8243	0.70097|0.70097	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|270;259	.|B4DST0;O43463	.|.;SUV91_HUMAN	T|H	256;107|270;259;117	.|ENSP00000337976:R270H;ENSP00000365877:R259H	ENSP00000410043:A256T|ENSP00000337976:R270H	A|R	+|+	1|2	0|0	SUV39H1|SUV39H1	48444036|48444036	0.846000|0.846000	0.29590|0.29590	0.984000|0.984000	0.44739|0.44739	0.752000|0.752000	0.42762|0.42762	2.526000|2.526000	0.45607|0.45607	2.082000|2.082000	0.62665|0.62665	0.591000|0.591000	0.81541|0.81541	GCA|CGC		0.592	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058909.1	NM_003173	
FOXP3	50943	hgsc.bcm.edu	37	X	49107806	49107806	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:49107806G>A	ENST00000376207.4	-	12	1472	c.1285C>T	c.(1285-1287)Cct>Tct	p.P429S	FOXP3_ENST00000455775.2_Missense_Mutation_p.P402S|FOXP3_ENST00000376197.1_Missense_Mutation_p.P439S|FOXP3_ENST00000376199.2_Missense_Mutation_p.P394S|FOXP3_ENST00000557224.1_Missense_Mutation_p.P454S|FOXP3_ENST00000518685.1_Missense_Mutation_p.P394S	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3	429					B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P429S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					CAGGGGCCAGGTGTAGGGTTG	0.617																																					p.P429S	GBM(182;1432 2112 16160 23073 31774)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1285T	X						.						69.0	50.0	57.0					X																	49107806		2203	4299	6502	48994750	SO:0001583	missense	50943	exon12				CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.1285C>T	X.37:g.49107806G>A	ENSP00000365380:p.Pro429Ser	Somatic		Capture	SOLID	Phase_I	48994750	NM_014009	A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Missense_Mutation	SNP	ENST00000376207.4	37	CCDS14323.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705994	0.48412	.	.	ENSG00000049768	ENST00000376207;ENST00000376199;ENST00000557224;ENST00000518685;ENST00000376197;ENST00000455775	D;D;D;D;D;D	0.97791	-3.62;-3.6;-4.54;-3.6;-4.51;-3.98	4.58	2.66	0.31614	.	0.000000	0.34067	N	0.004290	D	0.95360	0.8494	N	0.08118	0	0.09310	N	0.999999	D;D;P;D;D	0.76494	0.997;0.999;0.784;0.997;0.998	D;D;P;D;D	0.75484	0.96;0.986;0.494;0.96;0.982	D	0.87706	0.2563	10	0.72032	D	0.01	.	5.3006	0.15776	0.1093:0.0:0.5554:0.3352	.	402;452;454;429;394	B9UN80;B7ZLG1;Q9BZS1-3;Q9BZS1;Q9BZS1-2	.;.;.;FOXP3_HUMAN;.	S	429;394;454;394;439;402	ENSP00000365380:P429S;ENSP00000365372:P394S;ENSP00000451208:P454S;ENSP00000428952:P394S;ENSP00000365369:P439S;ENSP00000396415:P402S	ENSP00000365369:P439S	P	-	1	0	FOXP3	48994750	0.001000	0.12720	0.973000	0.42090	0.903000	0.53119	0.185000	0.16958	1.870000	0.54199	0.431000	0.28591	CCT		0.617	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060814.1	NM_014009	
CLCN5	1184	hgsc.bcm.edu	37	X	49834584	49834584	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:49834584G>T	ENST00000307367.2	+	2	295	c.4G>T	c.(4-6)Gac>Tac	p.D2Y	CLCN5_ENST00000376108.3_Missense_Mutation_p.D2Y|CLCN5_ENST00000376091.3_Missense_Mutation_p.D72Y|CLCN5_ENST00000376088.3_Missense_Mutation_p.D72Y			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	2					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.D2Y(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TAGGATCATGGACTTCTTGGA	0.418																																					p.D72Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214T	X						.						109.0	87.0	94.0					X																	49834584		2203	4300	6503	49721324	SO:0001583	missense	1184	exon5			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.4G>T	X.37:g.49834584G>T	ENSP00000304257:p.Asp2Tyr	Somatic		Capture	SOLID	Phase_I	49721324	NM_001127899	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544494	0.86022	.	.	ENSG00000171365	ENST00000376088;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.90676	-2.71;-2.71;-2.69;-2.69	5.48	5.48	0.80851	.	0.224065	0.47455	D	0.000224	D	0.94414	0.8203	M	0.67953	2.075	0.80722	D	1	D;D	0.71674	0.998;0.99	D;D	0.67103	0.949;0.912	D	0.94972	0.8118	10	0.87932	D	0	-0.568	16.9645	0.86282	0.0:0.0:1.0:0.0	.	2;72	P51795;P51795-2	CLCN5_HUMAN;.	Y	72;72;2;2	ENSP00000365256:D72Y;ENSP00000365259:D72Y;ENSP00000365276:D2Y;ENSP00000304257:D2Y	ENSP00000304257:D2Y	D	+	1	0	CLCN5	49721324	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.628000	0.98415	2.268000	0.75426	0.506000	0.49869	GAC		0.418	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
SMC1A	8243	hgsc.bcm.edu	37	X	53426613	53426613	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:53426613C>T	ENST00000322213.4	-	16	2587	c.2460G>A	c.(2458-2460)caG>caA	p.Q820Q		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	820					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.Q820Q(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CAAAATCCAACTGAATGCCCA	0.398																																					p.Q820Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2460A	X						.						137.0	112.0	120.0					X																	53426613		2203	4300	6503	53443338	SO:0001819	synonymous_variant	8243	exon16			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2460G>A	X.37:g.53426613C>T		Somatic		Capture	SOLID	Phase_I	53443338	NM_006306	O14995|Q16351|Q2M228	Silent	SNP	ENST00000322213.4	37	CCDS14352.1																																																																																				0.398	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
AR	367	hgsc.bcm.edu	37	X	66937336	66937336	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:66937336C>T	ENST00000374690.3	+	5	2714	c.2190C>T	c.(2188-2190)caC>caT	p.H730H	AR_ENST00000396043.2_Silent_p.H198H|AR_ENST00000396044.3_Intron	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	729	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.		V -> M (in prostate cancer; increases transcription activation). {ECO:0000269|PubMed:1631125, ECO:0000269|PubMed:7591265}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.H730H(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GCAACTTACACGTGGACGACC	0.552									Androgen Insensitivity Syndrome																												p.H198H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C594T	X						.						124.0	82.0	97.0					X																	66937336		2203	4300	6503	66854061	SO:0001819	synonymous_variant	367	exon5	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2190C>T	X.37:g.66937336C>T		Somatic		Capture	SOLID	Phase_I	66854061	NM_001011645	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	37	CCDS14387.1																																																																																				0.552	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
SNX12	29934	hgsc.bcm.edu	37	X	70282759	70282759	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:70282759C>T	ENST00000374274.3	-	2	322	c.206G>A	c.(205-207)cGg>cAg	p.R69Q	SNX12_ENST00000276105.3_Missense_Mutation_p.R65Q|SNX12_ENST00000465030.1_5'UTR	NM_001256185.1|NM_001256188.1|NM_013346.3	NP_001243114.1|NP_001243117.1|NP_037478.2	Q9UMY4	SNX12_HUMAN	sorting nexin 12	69	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of protein transport (GO:0051224)|regulation of endocytosis (GO:0030100)	early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)	p.R69Q(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	Renal(35;0.156)					GTAGCGCCGCCGTACGCAGGA	0.468																																					p.R69Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G206A	X						.						85.0	68.0	74.0					X																	70282759		2203	4300	6503	70199484	SO:0001583	missense	29934	exon2			AF171229	CCDS14405.1, CCDS59169.1	Xq13.1	2008-03-11			ENSG00000147164	ENSG00000147164		"""Sorting nexins"""	14976	protein-coding gene	gene with protein product		300883					Standard	NM_013346		Approved		uc004dyr.2	Q9UMY4	OTTHUMG00000021786	ENST00000374274.3:c.206G>A	X.37:g.70282759C>T	ENSP00000363392:p.Arg69Gln	Somatic		Capture	SOLID	Phase_I	70199484	NM_013346	F8W8K5|Q8WUG9	Missense_Mutation	SNP	ENST00000374274.3	37	CCDS14405.1	.	.	.	.	.	.	.	.	.	.	c	15.63	2.889069	0.52014	.	.	ENSG00000147164	ENST00000374274;ENST00000276105	T;T	0.39229	1.09;1.09	5.1	3.34	0.38264	.	0.056947	0.64402	D	0.000002	T	0.38348	0.1037	L	0.50919	1.6	0.34565	D	0.712858	B	0.34329	0.449	B	0.37692	0.256	T	0.50206	-0.8855	10	0.46703	T	0.11	-13.3499	9.9083	0.41390	0.0:0.8325:0.0:0.1675	.	69	Q3SYF1	.	Q	69;65	ENSP00000363392:R69Q;ENSP00000276105:R65Q	ENSP00000276105:R65Q	R	-	2	0	SNX12	70199484	1.000000	0.71417	0.065000	0.19835	0.969000	0.65631	4.729000	0.62008	0.557000	0.29117	0.597000	0.82753	CGG		0.468	SNX12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057094.1	NM_013346	
NLGN3	54413	hgsc.bcm.edu	37	X	70389350	70389350	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:70389350G>A	ENST00000358741.3	+	8	2253	c.1950G>A	c.(1948-1950)ccG>ccA	p.P650P	NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000374051.3_Silent_p.P630P|NLGN3_ENST00000536169.1_Silent_p.P610P	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	650					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.P630P(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					TGCCGCCTCCGGATACCACCC	0.587																																					p.P610P	Esophageal Squamous(103;760 1488 16849 22250 40351)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1830A	X						.						68.0	54.0	59.0					X																	70389350		2201	4299	6500	70306075	SO:0001819	synonymous_variant	54413	exon6			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1950G>A	X.37:g.70389350G>A		Somatic		Capture	SOLID	Phase_I	70306075	NM_001166660	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	CCDS55441.1																																																																																				0.587	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
DACH2	117154	hgsc.bcm.edu	37	X	85403790	85403790	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:85403790G>A	ENST00000373125.4	+	1	166	c.166G>A	c.(166-168)Gga>Aga	p.G56R	DACH2_ENST00000373131.1_Missense_Mutation_p.G56R	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	56	Poly-Gly.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G56R(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CAACAGTGCCGGAGGCGGCGG	0.567																																					p.G56R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G166A	X						.						67.0	53.0	58.0					X																	85403790		2203	4300	6503	85290446	SO:0001583	missense	117154	exon1			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.166G>A	X.37:g.85403790G>A	ENSP00000362217:p.Gly56Arg	Somatic		Capture	SOLID	Phase_I	85290446	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.415210	0.01136	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;D	0.83419	-1.72;-1.72	4.28	0.109	0.14578	DNA binding domain, putative (1);Transforming protein Ski (1);	0.772618	0.10896	N	0.622141	T	0.66799	0.2826	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.54050	-0.8351	10	0.51188	T	0.08	.	1.6564	0.02782	0.2698:0.134:0.457:0.1391	.	56;56	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	R	56	ENSP00000362223:G56R;ENSP00000362217:G56R	ENSP00000345134:G56R	G	+	1	0	DACH2	85290446	0.645000	0.27286	0.000000	0.03702	0.039000	0.13416	0.723000	0.25939	-0.035000	0.13691	-0.276000	0.10085	GGA		0.567	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
DACH2	117154	hgsc.bcm.edu	37	X	85969558	85969558	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:85969558T>C	ENST00000373125.4	+	6	939	c.939T>C	c.(937-939)gaT>gaC	p.D313D	DACH2_ENST00000510272.1_Silent_p.D94D|DACH2_ENST00000508860.1_Silent_p.D146D|DACH2_ENST00000373131.1_Silent_p.D300D	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	313					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D300D(1)|p.D313D(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TAGGACTGGATCTGCCATTTA	0.353																																					p.D313D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T939C	X						.						189.0	156.0	167.0					X																	85969558		2203	4300	6503	85856214	SO:0001819	synonymous_variant	117154	exon6			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.939T>C	X.37:g.85969558T>C		Somatic		Capture	SOLID	Phase_I	85856214	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Silent	SNP	ENST00000373125.4	37	CCDS14455.1																																																																																				0.353	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
NAP1L3	4675	hgsc.bcm.edu	37	X	92927847	92927847	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:92927847C>T	ENST00000373079.3	-	1	720	c.457G>A	c.(457-459)Gca>Aca	p.A153T	FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.A146T|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	153					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.A153T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TCGTATTCTGCATTGATGATT	0.418																																					p.A153T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G457A	X						.						64.0	51.0	55.0					X																	92927847		2203	4300	6503	92814503	SO:0001583	missense	4675	exon1				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.457G>A	X.37:g.92927847C>T	ENSP00000362171:p.Ala153Thr	Somatic		Capture	SOLID	Phase_I	92814503	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089137	0.76756	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.42900	0.96	3.66	3.66	0.41972	.	0.000000	0.85682	D	0.000000	T	0.58836	0.2150	M	0.64170	1.965	0.33673	D	0.611143	D	0.89917	1.0	D	0.74674	0.984	T	0.71708	-0.4511	10	0.87932	D	0	-11.8727	12.5309	0.56115	0.0:1.0:0.0:0.0	.	153	Q99457	NP1L3_HUMAN	T	153;146	ENSP00000362171:A153T	ENSP00000362171:A153T	A	-	1	0	NAP1L3	92814503	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.930000	0.40124	2.109000	0.64355	0.529000	0.55759	GCA		0.418	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
TMLHE	55217	hgsc.bcm.edu	37	X	154754274	154754274	+	Silent	SNP	G	G	A	rs147945106	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chrX:154754274G>A	ENST00000334398.3	-	3	346	c.201C>T	c.(199-201)acC>acT	p.T67T	TMLHE-AS1_ENST00000452506.1_RNA|TMLHE_ENST00000369439.4_Silent_p.T67T	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	67					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)	p.T67T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	AGCGCATCACGGTATTAGCAT	0.428													G|||	6	0.0015894	0.0045	0.0	3775	,	,		13275	0.0		0.0	False		,,,				2504	0.0				p.T67T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C201T	X						.	G	,	7,3827		0,7,1625,570	127.0	109.0	115.0		201,201	-6.3	0.2	X	dbSNP_134	115	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous	TMLHE	NM_001184797.1,NM_018196.3	,	0,7,4053,2442	AA,AG,GG,G		0.0,0.1826,0.0663	,	67/377,67/422	154754274	7,10555	2202	4300	6502	154407468	SO:0001819	synonymous_variant	55217	exon3			AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.201C>T	X.37:g.154754274G>A		Somatic		Capture	SOLID	Phase_I	154407468	NM_001184797	A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	Silent	SNP	ENST00000334398.3	37	CCDS14768.1																																																																																				0.428	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058817.1	NM_018196	
LONRF2	164832	hgsc.bcm.edu	37	2	100903525	100903525	+	Splice_Site	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:100903525C>T	ENST00000393437.3	-	11	2560	c.1921G>A	c.(1921-1923)Gtg>Atg	p.V641M	LONRF2_ENST00000409647.1_Splice_Site_p.V398M	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	641	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						GGACCCTCCACCTGATCAGGG	0.507																																					p.V641M												.	.	0			c.G1921A	2						.						78.0	56.0	64.0					2																	100903525		2203	4300	6503	100269957	SO:0001630	splice_region_variant	164832	exon11			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1921-1G>A	2.37:g.100903525C>T		Somatic		Capture	SOLID	Phase_I	100269957	NM_198461	B9A006|Q6ZSR4	Missense_Mutation	SNP	ENST00000393437.3	37	CCDS2046.2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233265	0.79688	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	D;D	0.86230	-1.94;-2.09	4.95	4.95	0.65309	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.064498	0.64402	D	0.000008	D	0.92189	0.7523	L	0.60957	1.885	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.92626	0.6112	10	0.56958	D	0.05	-14.6194	18.2043	0.89850	0.0:1.0:0.0:0.0	.	641	Q1L5Z9	LONF2_HUMAN	M	641;398	ENSP00000377086:V641M;ENSP00000386823:V398M	ENSP00000377086:V641M	V	-	1	0	LONRF2	100269957	1.000000	0.71417	0.938000	0.37757	0.477000	0.33069	5.703000	0.68340	2.288000	0.76882	0.655000	0.94253	GTG		0.507	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	Missense_Mutation
CHST10	9486	hgsc.bcm.edu	37	2	101023137	101023137	+	Start_Codon_SNP	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:101023137T>C	ENST00000264249.3	-	3	386	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CHST10_ENST00000485085.1_5'Flank|CHST10_ENST00000542617.1_Missense_Mutation_p.M49V|CHST10_ENST00000409701.1_Start_Codon_SNP_p.M1V	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	1					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)	p.M1V(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						TGGTGGTGCATGTTGTCACAC	0.478																																					p.M1V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1G	2						.						148.0	144.0	146.0					2																	101023137		2203	4300	6503	100389569	SO:0001582	initiator_codon_variant	9486	exon3			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.1A>G	2.37:g.101023137T>C	ENSP00000264249:p.Met1Val	Somatic		Capture	SOLID	Phase_I	100389569	NM_004854	Q53T18	Missense_Mutation	SNP	ENST00000264249.3	37	CCDS2047.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.291498	0.80914	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046;ENST00000420858;ENST00000448989;ENST00000421474;ENST00000418201;ENST00000435960	T;T;T;T;T;T;T;T;T	0.73258	-0.59;-0.73;-0.59;0.62;0.52;0.21;0.39;0.17;-0.21	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.82857	0.5128	.	.	.	0.80722	D	1	D	0.54964	0.969	D	0.63381	0.914	D	0.85411	0.1137	9	0.72032	D	0.01	-37.0696	15.3465	0.74343	0.0:0.0:0.0:1.0	.	1	O43529	CHSTA_HUMAN	V	1;49;1;1;1;49;1;1;1	ENSP00000264249:M1V;ENSP00000438869:M49V;ENSP00000387309:M1V;ENSP00000387121:M1V;ENSP00000405922:M1V;ENSP00000387977:M49V;ENSP00000407525:M1V;ENSP00000416831:M1V;ENSP00000395643:M1V	ENSP00000264249:M1V	M	-	1	0	CHST10	100389569	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.780000	0.75063	2.084000	0.62774	0.533000	0.62120	ATG		0.478	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	Missense_Mutation
MFSD9	84804	hgsc.bcm.edu	37	2	103334923	103334923	+	Nonsense_Mutation	SNP	G	G	A	rs369281175		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:103334923G>A	ENST00000258436.5	-	6	1424	c.1381C>T	c.(1381-1383)Cga>Tga	p.R461*	MFSD9_ENST00000496253.1_5'Flank	NM_032718.3	NP_116107.3	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing 9	461					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R461*(1)		breast(3)|large_intestine(7)|liver(1)|lung(6)|ovary(2)|skin(1)	20						CTAGAGTGTCGCTTGTTTAGA	0.493																																					p.R461X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1381T	2						.	G	stop/ARG	0,4406		0,0,2203	74.0	78.0	77.0		1381	3.7	0.0	2		77	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	MFSD9	NM_032718.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		461/475	103334923	1,13005	2203	4300	6503	102701355	SO:0001587	stop_gained	84804	exon6				CCDS2063.1	2q12.1	2007-01-12			ENSG00000135953	ENSG00000135953			28158	protein-coding gene	gene with protein product							Standard	NM_032718		Approved	MGC11332	uc002tcb.2	Q8NBP5	OTTHUMG00000130781	ENST00000258436.5:c.1381C>T	2.37:g.103334923G>A	ENSP00000258436:p.Arg461*	Somatic		Capture	SOLID	Phase_I	102701355	NM_032718	Q4ZG89|Q53TU0|Q96GQ4|Q9BRI8	Nonsense_Mutation	SNP	ENST00000258436.5	37	CCDS2063.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666050	0.88251	0.0	1.16E-4	ENSG00000135953	ENST00000258436	.	.	.	5.47	3.66	0.41972	.	0.492535	0.22632	N	0.057564	.	.	.	.	.	.	0.42359	D	0.992401	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-13.6816	3.7428	0.08537	0.1418:0.1324:0.5887:0.1371	.	.	.	.	X	461	.	ENSP00000258436:R461X	R	-	1	2	MFSD9	102701355	0.933000	0.31639	0.001000	0.08648	0.043000	0.13939	0.972000	0.29409	0.785000	0.33685	0.650000	0.86243	CGA		0.493	MFSD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253295.2	NM_032718	
PTPN4	5775	hgsc.bcm.edu	37	2	120714604	120714604	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:120714604G>T	ENST00000263708.2	+	22	2855	c.2084G>T	c.(2083-2085)cGg>cTg	p.R695L	PTPN4_ENST00000544261.1_Missense_Mutation_p.R328L	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	695	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.R695L(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	GATGCCACACGGGTCATTTTA	0.279																																					p.R695L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2084T	2						.						41.0	44.0	43.0					2																	120714604		2201	4294	6495	120431074	SO:0001583	missense	5775	exon22				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2084G>T	2.37:g.120714604G>T	ENSP00000263708:p.Arg695Leu	Somatic		Capture	SOLID	Phase_I	120431074	NM_002830	B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926931	0.92319	.	.	ENSG00000088179	ENST00000263708;ENST00000544261	T;T	0.29142	1.58;1.58	5.28	5.28	0.74379	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.68586	0.3017	M	0.94142	3.5	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.78949	-0.2002	10	0.87932	D	0	.	18.9077	0.92469	0.0:0.0:1.0:0.0	.	695	P29074	PTN4_HUMAN	L	695;328	ENSP00000263708:R695L;ENSP00000445841:R328L	ENSP00000263708:R695L	R	+	2	0	PTPN4	120431074	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.760000	0.98935	2.449000	0.82847	0.655000	0.94253	CGG		0.279	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2		
SAP130	79595	hgsc.bcm.edu	37	2	128753926	128753926	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:128753926G>A	ENST00000259235.3	-	11	1560	c.1431C>T	c.(1429-1431)aaC>aaT	p.N477N	SAP130_ENST00000259234.6_Silent_p.N451N|SAP130_ENST00000357702.5_Silent_p.N477N	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	477					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.N477N(1)		NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		CCTCCTACCTGTTGTCACTTC	0.498																																					p.N477N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1431T	2						.						121.0	99.0	106.0					2																	128753926		2203	4300	6503	128470396	SO:0001819	synonymous_variant	79595	exon11			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1431C>T	2.37:g.128753926G>A		Somatic		Capture	SOLID	Phase_I	128470396	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Silent	SNP	ENST00000259235.3	37	CCDS2153.1																																																																																				0.498	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
NBAS	51594	hgsc.bcm.edu	37	2	15698735	15698735	+	Silent	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:15698735A>C	ENST00000281513.5	-	2	166	c.141T>G	c.(139-141)ggT>ggG	p.G47G	NBAS_ENST00000441750.1_Silent_p.G47G	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	47					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.G47G(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TAAAGGATGCACCATGTTTTT	0.308																																					p.G47G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T141G	2						.						129.0	117.0	121.0					2																	15698735		2203	4298	6501	15616186	SO:0001819	synonymous_variant	51594	exon2			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.141T>G	2.37:g.15698735A>C		Somatic		Capture	SOLID	Phase_I	15616186	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	CCDS1685.1																																																																																				0.308	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
LRP1B	53353	hgsc.bcm.edu	37	2	141762925	141762925	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:141762925C>T	ENST00000389484.3	-	15	3453	c.2482G>A	c.(2482-2484)Gaa>Aaa	p.E828K		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	828	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.E828K(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTCCCATTTTCATCCAAAAGT	0.418										TSP Lung(27;0.18)																											p.E828K	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2482A	2						.						70.0	68.0	69.0					2																	141762925		2203	4300	6503	141479395	SO:0001583	missense	53353	exon15			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2482G>A	2.37:g.141762925C>T	ENSP00000374135:p.Glu828Lys	Somatic		Capture	SOLID	Phase_I	141479395	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.886415	0.33348	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.96587	-4.06	5.99	5.11	0.69529	.	0.066216	0.64402	U	0.000013	D	0.93090	0.7800	L	0.47078	1.49	0.34449	D	0.700421	B	0.09022	0.002	B	0.10450	0.005	D	0.89982	0.4101	10	0.06891	T	0.86	.	15.1544	0.72730	0.0:0.9326:0.0:0.0673	.	828	Q9NZR2	LRP1B_HUMAN	K	828;766	ENSP00000374135:E828K	ENSP00000374135:E828K	E	-	1	0	LRP1B	141479395	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.580000	0.53907	1.534000	0.49203	0.655000	0.94253	GAA		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
PLA2R1	22925	hgsc.bcm.edu	37	2	160876668	160876668	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:160876668C>T	ENST00000283243.7	-	8	1607	c.1401G>A	c.(1399-1401)gaG>gaA	p.E467E	PLA2R1_ENST00000392771.1_Silent_p.E467E	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	467	C-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.E467E(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						AAATGTGGGGCTCAAGTGTGT	0.408																																					p.E467E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1401A	2						.						84.0	84.0	84.0					2																	160876668		2203	4300	6503	160584914	SO:0001819	synonymous_variant	22925	exon8			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.1401G>A	2.37:g.160876668C>T		Somatic		Capture	SOLID	Phase_I	160584914	NM_007366	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	CCDS33309.1																																																																																				0.408	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
SCN1A	6323	hgsc.bcm.edu	37	2	166898900	166898900	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:166898900C>A	ENST00000303395.4	-	12	2077	c.2078G>T	c.(2077-2079)aGg>aTg	p.R693M	SCN1A_ENST00000375405.3_Missense_Mutation_p.R682M|SCN1A_ENST00000423058.2_Missense_Mutation_p.R693M|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.R665M|AC010127.3_ENST00000599041.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	693					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.R682M(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGAACTTGACCTTCTCTTTCT	0.363																																					p.R665M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1994T	2						.						141.0	136.0	137.0					2																	166898900		2203	4300	6503	166607146	SO:0001583	missense	6323	exon12			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2078G>T	2.37:g.166898900C>A	ENSP00000303540:p.Arg693Met	Somatic		Capture	SOLID	Phase_I	166607146	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297678	0.23650	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83	5.72	5.72	0.89469	Domain of unknown function DUF3451 (1);	0.160099	0.44285	D	0.000475	D	0.89605	0.6763	M	0.70903	2.155	0.39678	D	0.970853	B;B;B	0.25486	0.104;0.127;0.001	B;B;B	0.34722	0.118;0.188;0.012	D	0.85471	0.1173	10	0.30854	T	0.27	.	9.0839	0.36570	0.157:0.7679:0.0:0.075	.	682;665;693	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	M	693;693;682;665	ENSP00000407030:R693M;ENSP00000303540:R693M;ENSP00000364554:R682M;ENSP00000386312:R665M	ENSP00000303540:R693M	R	-	2	0	SCN1A	166607146	0.847000	0.29606	0.999000	0.59377	0.975000	0.68041	2.026000	0.41069	2.689000	0.91719	0.655000	0.94253	AGG		0.363	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
LRP2	4036	hgsc.bcm.edu	37	2	170092504	170092504	+	Missense_Mutation	SNP	C	C	T	rs587780385		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:170092504C>T	ENST00000263816.3	-	29	5051	c.4766G>A	c.(4765-4767)cGc>cAc	p.R1589H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1589					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R1589H(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AATGACAGTGCGCATGCTGCC	0.517																																					p.R1589H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4766A	2						.						101.0	84.0	90.0					2																	170092504		2203	4300	6503	169800750	SO:0001583	missense	4036	exon29				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.4766G>A	2.37:g.170092504C>T	ENSP00000263816:p.Arg1589His	Somatic		Capture	SOLID	Phase_I	169800750	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458261	0.84317	.	.	ENSG00000081479	ENST00000263816	D	0.97553	-4.43	5.59	5.59	0.84812	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.98896	0.9626	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99387	1.0924	10	0.87932	D	0	.	19.9651	0.97262	0.0:1.0:0.0:0.0	.	1589	P98164	LRP2_HUMAN	H	1589	ENSP00000263816:R1589H	ENSP00000263816:R1589H	R	-	2	0	LRP2	169800750	1.000000	0.71417	0.977000	0.42913	0.158000	0.22134	7.750000	0.85110	2.793000	0.96121	0.655000	0.94253	CGC		0.517	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
COL3A1	1281	hgsc.bcm.edu	37	2	189875587	189875587	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:189875587A>C	ENST00000304636.3	+	50	4395	c.4225A>C	c.(4225-4227)Acc>Ccc	p.T1409P	COL3A1_ENST00000317840.5_Missense_Mutation_p.T1106P	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1409	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TAGCAAATTCACCTACACAGT	0.398																																					p.T1409P												.	.	0			c.A4225C	2						.						100.0	92.0	95.0					2																	189875587		2203	4300	6503	189583832	SO:0001583	missense	1281	exon50			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.4225A>C	2.37:g.189875587A>C	ENSP00000304408:p.Thr1409Pro	Somatic		Capture	SOLID	Phase_I	189583832	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.119616	0.56613	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.74209	-0.82;-0.82	5.53	4.38	0.52667	Fibrillar collagen, C-terminal (4);	0.117296	0.38164	N	0.001796	T	0.79034	0.4378	M	0.78344	2.41	0.33945	D	0.643714	P	0.45672	0.864	P	0.49421	0.61	D	0.83736	0.0201	10	0.37606	T	0.19	.	11.3595	0.49636	0.929:0.0:0.071:0.0	.	1409	P02461	CO3A1_HUMAN	P	1409;1106	ENSP00000304408:T1409P;ENSP00000315243:T1106P	ENSP00000304408:T1409P	T	+	1	0	COL3A1	189583832	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.492000	0.81482	0.936000	0.37367	0.533000	0.62120	ACC		0.398	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
PLCL1	5334	hgsc.bcm.edu	37	2	198950750	198950750	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:198950750G>T	ENST00000428675.1	+	2	2907	c.2509G>T	c.(2509-2511)Gag>Tag	p.E837*	PLCL1_ENST00000437704.2_Nonsense_Mutation_p.E739*	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	837					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.E739*(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TGACATCATGGAGCACGTAAC	0.458																																					p.E837X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2509T	2						.						182.0	153.0	163.0					2																	198950750		2203	4300	6503	198658995	SO:0001587	stop_gained	5334	exon2			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2509G>T	2.37:g.198950750G>T	ENSP00000402861:p.Glu837*	Somatic		Capture	SOLID	Phase_I	198658995	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Nonsense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	G	38	6.937402	0.97948	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	.	.	.	5.41	5.41	0.78517	.	0.193546	0.36591	N	0.002515	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9299	0.70906	0.0:0.1425:0.8575:0.0	.	.	.	.	X	837;739	.	.	E	+	1	0	PLCL1	198658995	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.803000	0.75180	2.814000	0.96858	0.591000	0.81541	GAG		0.458	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
ORC2	4999	hgsc.bcm.edu	37	2	201796103	201796103	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:201796103T>C	ENST00000234296.2	-	11	1125	c.876A>G	c.(874-876)caA>caG	p.Q292Q		NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	292					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)	p.Q292Q(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TTTCATACTGTTGATTTAGTT	0.299																																					p.Q292Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A876G	2						.						66.0	67.0	67.0					2																	201796103		2203	4300	6503	201504348	SO:0001819	synonymous_variant	4999	exon11				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.876A>G	2.37:g.201796103T>C		Somatic		Capture	SOLID	Phase_I	201504348	NM_006190	Q13204|Q53TX5	Silent	SNP	ENST00000234296.2	37	CCDS2334.1																																																																																				0.299	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	
CASP8	841	hgsc.bcm.edu	37	2	202149710	202149710	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:202149710G>A	ENST00000432109.2	+	9	1163	c.974G>A	c.(973-975)gGc>gAc	p.G325D	CASP8_ENST00000264275.5_Missense_Mutation_p.G342D|CASP8_ENST00000358485.4_Missense_Mutation_p.G384D|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000323492.7_Missense_Mutation_p.G310D|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264274.9_Missense_Mutation_p.G241D	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	325					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.G342D(3)|p.G384D(2)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						ATCATCTATGGCACTGATGGA	0.458										HNSCC(4;0.00038)																											p.G310D	Melanoma(82;831 1348 20716 36952 40159)											.	.	5	Substitution - Missense(5)	cervix(3)|large_intestine(2)	c.G929A	2						.						166.0	141.0	149.0					2																	202149710		2203	4300	6503	201857955	SO:0001583	missense	841	exon7			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.974G>A	2.37:g.202149710G>A	ENSP00000412523:p.Gly325Asp	Somatic		Capture	SOLID	Phase_I	201857955	NM_033356	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140243	0.77775	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.68	5.68	0.88126	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.85682	D	0.000000	D	0.83580	0.5285	H	0.97707	4.06	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;1.0	D	0.89028	0.3440	10	0.87932	D	0	.	19.7761	0.96393	0.0:0.0:1.0:0.0	.	241;384;325;310;342	Q14790-3;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;CASP8_HUMAN;.;.	D	310;241;325;342;384;310;104	ENSP00000376091:G310D;ENSP00000264274:G241D;ENSP00000412523:G325D;ENSP00000264275:G342D;ENSP00000351273:G384D;ENSP00000325722:G310D;ENSP00000394434:G104D	ENSP00000264274:G241D	G	+	2	0	CASP8	201857955	1.000000	0.71417	0.880000	0.34516	0.252000	0.25951	7.903000	0.87398	2.687000	0.91594	0.561000	0.74099	GGC		0.458	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
MAP2	4133	hgsc.bcm.edu	37	2	210557806	210557806	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:210557806G>T	ENST00000360351.4	+	7	1418	c.912G>T	c.(910-912)tgG>tgT	p.W304C	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.W300C|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	304					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.W304C(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCCCAAAATGGGAAGGGAAAC	0.438																																					p.W304C	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G912T	2						.						63.0	63.0	63.0					2																	210557806		2203	4300	6503	210266051	SO:0001583	missense	4133	exon7				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.912G>T	2.37:g.210557806G>T	ENSP00000353508:p.Trp304Cys	Somatic		Capture	SOLID	Phase_I	210266051	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780985	0.49891	.	.	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	T;T;T	0.21543	2.0;2.0;2.0	5.8	5.8	0.92144	.	0.149414	0.33309	N	0.005060	T	0.43233	0.1238	M	0.62723	1.935	0.58432	D	0.99999	D;D	0.76494	0.999;0.999	D;P	0.65443	0.935;0.862	T	0.20338	-1.0278	10	0.87932	D	0	-5.0021	15.6185	0.76787	0.0:0.0:1.0:0.0	.	300;304	P11137-3;P11137	.;MAP2_HUMAN	C	304;386;300	ENSP00000353508:W304C;ENSP00000409969:W386C;ENSP00000392164:W300C	ENSP00000353508:W304C	W	+	3	0	MAP2	210266051	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.854000	0.62918	2.775000	0.95449	0.650000	0.86243	TGG		0.438	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
CPS1	1373	hgsc.bcm.edu	37	2	211476996	211476996	+	Silent	SNP	G	G	A	rs371426184		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:211476996G>A	ENST00000233072.5	+	20	2743	c.2547G>A	c.(2545-2547)acG>acA	p.T849T	CPS1_ENST00000451903.2_Silent_p.T398T|CPS1_ENST00000430249.2_Silent_p.T855T	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	849					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.T849T(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CAAGCAGCACGCGTATCTATG	0.428																																					p.T398T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1194A	2						.	G	,,	0,4406		0,0,2203	97.0	96.0	96.0		2565,1194,2547	-1.4	1.0	2		96	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	CPS1	NM_001122633.2,NM_001122634.2,NM_001875.4	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	855/1507,398/1050,849/1501	211476996	1,13005	2203	4300	6503	211185241	SO:0001819	synonymous_variant	1373	exon10			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2547G>A	2.37:g.211476996G>A		Somatic		Capture	SOLID	Phase_I	211185241	NM_001122634	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	37	CCDS2393.1																																																																																				0.428	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
SPAG16	79582	hgsc.bcm.edu	37	2	215274978	215274978	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:215274978C>A	ENST00000331683.5	+	16	1930	c.1835C>A	c.(1834-1836)tCt>tAt	p.S612Y	AC107218.3_ENST00000437883.1_RNA|VWC2L_ENST00000427124.1_5'Flank|SPAG16_ENST00000374309.3_Missense_Mutation_p.S518Y|AC107218.3_ENST00000412896.1_RNA|VWC2L_ENST00000312504.5_5'Flank	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	612					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.S612Y(1)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GTTGTGTTTTCTCACGACGGG	0.507																																					p.S612Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1835A	2						.						134.0	129.0	131.0					2																	215274978		2203	4300	6503	214983223	SO:0001583	missense	79582	exon16			AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1835C>A	2.37:g.215274978C>A	ENSP00000332592:p.Ser612Tyr	Somatic		Capture	SOLID	Phase_I	214983223	NM_024532	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704571	0.68615	.	.	ENSG00000144451	ENST00000331683;ENST00000374309;ENST00000451561	T;T;T	0.66460	-0.21;-0.21;-0.21	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.488232	0.18858	N	0.129209	D	0.84419	0.5468	M	0.91663	3.23	0.30136	N	0.80436	D;D;D	0.89917	0.996;1.0;0.996	D;D;D	0.79108	0.93;0.992;0.93	D	0.83671	0.0166	10	0.72032	D	0.01	.	12.5482	0.56212	0.2081:0.7918:0.0:0.0	.	518;552;612	B4DYB5;Q4G1A2;Q8N0X2	.;.;SPG16_HUMAN	Y	612;518;236	ENSP00000332592:S612Y;ENSP00000363428:S518Y;ENSP00000416600:S236Y	ENSP00000332592:S612Y	S	+	2	0	SPAG16	214983223	0.979000	0.34478	0.965000	0.40720	0.934000	0.57294	2.306000	0.43673	2.737000	0.93849	0.563000	0.77884	TCT		0.507	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
FN1	2335	hgsc.bcm.edu	37	2	216299478	216299478	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:216299478G>A	ENST00000359671.1	-	2	483	c.218C>T	c.(217-219)gCg>gTg	p.A73V	AC012462.1_ENST00000412951.1_RNA|FN1_ENST00000356005.4_Missense_Mutation_p.A73V|FN1_ENST00000323926.6_Missense_Mutation_p.A73V|FN1_ENST00000354785.4_Missense_Mutation_p.A73V|FN1_ENST00000432072.2_Missense_Mutation_p.A73V|FN1_ENST00000346544.3_Missense_Mutation_p.A73V|FN1_ENST00000357009.2_Missense_Mutation_p.A73V|FN1_ENST00000336916.4_Missense_Mutation_p.A73V|FN1_ENST00000446046.1_Missense_Mutation_p.A73V|FN1_ENST00000443816.1_Missense_Mutation_p.A73V|FN1_ENST00000421182.1_Missense_Mutation_p.A73V|FN1_ENST00000345488.5_Missense_Mutation_p.A73V|FN1_ENST00000357867.4_Missense_Mutation_p.A73V|FN1_ENST00000426059.1_Missense_Mutation_p.A73V			P02751	FINC_HUMAN	fibronectin 1	73	Fibrin- and heparin-binding 1.|Fibronectin type-I 1. {ECO:0000255|PROSITE-ProRule:PRU00478}.			A -> V (in Ref. 11; CAA26536). {ECO:0000305}.	acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.A73V(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ACAAACCAACGCATTGCCTAG	0.403																																					p.A73V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C218T	2						.						223.0	201.0	209.0					2																	216299478		2203	4300	6503	216007723	SO:0001583	missense	2335	exon2				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.218C>T	2.37:g.216299478G>A	ENSP00000352696:p.Ala73Val	Somatic		Capture	SOLID	Phase_I	216007723	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	G	25.3	4.626148	0.87560	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12	6.06	6.06	0.98353	.	0.177576	0.39985	N	0.001206	T	0.48333	0.1494	N	0.08118	0	0.53005	D	0.999967	B;D;B;B;B;B;B;P;B;B;P	0.89917	0.006;1.0;0.131;0.393;0.308;0.133;0.174;0.726;0.308;0.308;0.603	B;D;B;B;B;B;B;B;B;B;B	0.80764	0.004;0.994;0.102;0.107;0.035;0.058;0.038;0.278;0.035;0.035;0.177	T	0.56214	-0.8016	10	0.51188	T	0.08	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	73;73;73;73;73;73;73;73;73;73;73	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	V	73	ENSP00000394423:A73V;ENSP00000323534:A73V;ENSP00000338200:A73V;ENSP00000350534:A73V;ENSP00000346839:A73V;ENSP00000352696:A73V;ENSP00000265312:A73V;ENSP00000273049:A73V;ENSP00000349509:A73V;ENSP00000410422:A73V;ENSP00000415018:A73V;ENSP00000399538:A73V;ENSP00000348285:A73V;ENSP00000398907:A73V	ENSP00000265313:A73V	A	-	2	0	FN1	216007723	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.667000	0.54547	2.882000	0.98803	0.655000	0.94253	GCG		0.403	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
CCDC108	255101	hgsc.bcm.edu	37	2	219890819	219890819	+	Silent	SNP	C	C	T	rs374891392		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:219890819C>T	ENST00000341552.5	-	14	2357	c.2274G>A	c.(2272-2274)acG>acA	p.T758T	CCDC108_ENST00000441968.1_Silent_p.T758T|CCDC108_ENST00000453220.1_Silent_p.T758T	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	758						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.T758T(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGCCCGCACCGTCAGGCACC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		20155	0.001		0.0	False		,,,				2504	0.0				p.T758T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2274A	2						.						78.0	69.0	72.0					2																	219890819		2203	4300	6503	219599063	SO:0001819	synonymous_variant	255101	exon14			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2274G>A	2.37:g.219890819C>T		Somatic		Capture	SOLID	Phase_I	219599063	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	37	CCDS2430.2																																																																																				0.592	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
FAM134A	79137	hgsc.bcm.edu	37	2	220046823	220046823	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:220046823C>T	ENST00000430297.2	+	9	1240	c.1104C>T	c.(1102-1104)ccC>ccT	p.P368P		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	368						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCCCCTCCCGAAGACCTAC	0.592																																					p.P368P												.	.	0			c.C1104T	2						.						88.0	95.0	93.0					2																	220046823		2203	4300	6503	219755067	SO:0001819	synonymous_variant	79137	exon9			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.1104C>T	2.37:g.220046823C>T		Somatic		Capture	SOLID	Phase_I	219755067	NM_024293	Q6P1P5|Q9H0K7	Silent	SNP	ENST00000430297.2	37	CCDS2434.1	.	.	.	.	.	.	.	.	.	.	C	0.468	-0.885886	0.02511	.	.	ENSG00000144567	ENST00000420189	.	.	.	4.79	-6.98	0.01611	.	.	.	.	.	.	.	.	.	.	.	0.38396	D	0.945528	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.9627	2.5819	0.04820	0.1804:0.1253:0.1801:0.5141	.	.	.	.	X	63	.	.	R	+	1	2	FAM134A	219755067	0.000000	0.05858	0.450000	0.26969	0.232000	0.25224	-2.144000	0.01296	-1.401000	0.02058	-0.137000	0.14449	CGA		0.592	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
FAM134A	79137	hgsc.bcm.edu	37	2	220047261	220047261	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:220047261G>A	ENST00000430297.2	+	9	1678	c.1542G>A	c.(1540-1542)ccG>ccA	p.P514P		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	514						integral component of membrane (GO:0016021)		p.P514P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGAGACACCGCCAAAACCCC	0.597																																					p.P514P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1542A	2						.						60.0	65.0	64.0					2																	220047261		2203	4300	6503	219755505	SO:0001819	synonymous_variant	79137	exon9			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.1542G>A	2.37:g.220047261G>A		Somatic		Capture	SOLID	Phase_I	219755505	NM_024293	Q6P1P5|Q9H0K7	Silent	SNP	ENST00000430297.2	37	CCDS2434.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.804700	0.00611	.	.	ENSG00000144567	ENST00000420189	.	.	.	5.24	1.43	0.22495	.	.	.	.	.	T	0.44993	0.1320	.	.	.	0.39599	D	0.969701	.	.	.	.	.	.	T	0.26677	-1.0096	4	.	.	.	0.0488	3.1631	0.06527	0.0933:0.4011:0.266:0.2396	.	.	.	.	T	174	.	.	A	+	1	0	FAM134A	219755505	0.000000	0.05858	0.007000	0.13788	0.128000	0.20619	-0.603000	0.05674	-0.104000	0.12154	-3.279000	0.00047	GCC		0.597	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
SLC4A3	6508	hgsc.bcm.edu	37	2	220504340	220504340	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:220504340G>A	ENST00000358055.3	+	20	3672	c.3160G>A	c.(3160-3162)Gtc>Atc	p.V1054I	SLC4A3_ENST00000373762.3_Missense_Mutation_p.V1081I|SLC4A3_ENST00000373760.2_Missense_Mutation_p.V1054I|SLC4A3_ENST00000273063.6_Missense_Mutation_p.V1081I|SLC4A3_ENST00000317151.3_Missense_Mutation_p.V1054I			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	1054	Membrane (anion exchange).			V -> I (in Ref. 3; AAN34939). {ECO:0000305}.	bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.V1081I(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGTCCGCTCCGTCACCCATGT	0.652																																					p.V1054I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3160A	2						.						67.0	61.0	63.0					2																	220504340		2203	4300	6503	220212584	SO:0001583	missense	6508	exon20				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.3160G>A	2.37:g.220504340G>A	ENSP00000350756:p.Val1054Ile	Somatic		Capture	SOLID	Phase_I	220212584	NM_005070	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	37	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.240287	0.58995	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000356251;ENST00000317151	T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17	4.38	4.38	0.52667	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69079	0.3071	L	0.28400	0.85	0.80722	D	1	B;P;P	0.45078	0.314;0.85;0.848	B;P;P	0.44647	0.107;0.452;0.456	T	0.68002	-0.5524	10	0.33141	T	0.24	.	12.0724	0.53624	0.0841:0.0:0.9159:0.0	.	758;1054;1081	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	I	1054;1054;1081;1081;314;1054	ENSP00000350756:V1054I;ENSP00000362865:V1054I;ENSP00000273063:V1081I;ENSP00000362867:V1081I;ENSP00000314006:V1054I	ENSP00000273063:V1081I	V	+	1	0	SLC4A3	220212584	1.000000	0.71417	0.947000	0.38551	0.707000	0.40811	6.338000	0.72963	2.431000	0.82371	0.539000	0.68188	GTC		0.652	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
KCNE4	23704	hgsc.bcm.edu	37	2	223917686	223917686	+	Silent	SNP	C	C	T	rs377154931		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:223917686C>T	ENST00000281830.3	+	2	622	c.291C>T	c.(289-291)taC>taT	p.Y97Y	KCNE4_ENST00000488477.2_Intron|KCNE4_ENST00000604125.1_Silent_p.Y46Y			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	97						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)	p.Y46Y(1)		large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGTCCTTCTACGGCATTTTCT	0.592																																					p.Y46Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C138T	2						.	C		0,4406		0,0,2203	99.0	80.0	87.0		138	-3.9	0.8	2		87	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNE4	NM_080671.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		46/171	223917686	1,13005	2203	4300	6503	223625930	SO:0001819	synonymous_variant	23704	exon2			AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.291C>T	2.37:g.223917686C>T		Somatic		Capture	SOLID	Phase_I	223625930	NM_080671	B7Z275|Q53SM4|Q96CC4	Silent	SNP	ENST00000281830.3	37																																																																																					0.592	KCNE4-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000330997.2	NM_080671	
SERPINE2	5270	hgsc.bcm.edu	37	2	224862945	224862945	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:224862945G>T	ENST00000258405.4	-	3	616	c.374C>A	c.(373-375)cCt>cAt	p.P125H	SERPINE2_ENST00000447280.2_Missense_Mutation_p.P137H|SERPINE2_ENST00000409840.3_Missense_Mutation_p.P125H|SERPINE2_ENST00000409304.1_Missense_Mutation_p.P125H	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	125					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.P125H(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TGTAACAAAAGGCACTTCAAT	0.428																																					p.P137H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C410A	2						.						126.0	115.0	119.0					2																	224862945		2203	4300	6503	224571189	SO:0001583	missense	5270	exon3			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.374C>A	2.37:g.224862945G>T	ENSP00000258405:p.Pro125His	Somatic		Capture	SOLID	Phase_I	224571189	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	37	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992481	0.54041	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738	D;T;D;D;D	0.84146	-1.81;-0.84;-1.81;-1.81;-1.81	5.75	5.75	0.90469	Serpin domain (3);	0.219070	0.49305	D	0.000154	D	0.89417	0.6709	L	0.39245	1.2	0.54753	D	0.999987	D;D	0.58970	0.984;0.984	D;D	0.65443	0.935;0.935	D	0.88776	0.3267	10	0.49607	T	0.09	.	19.9542	0.97213	0.0:0.0:1.0:0.0	.	137;125	B4DIF2;P07093	.;GDN_HUMAN	H	125;125;125;137;125	ENSP00000386412:P125H;ENSP00000258405:P125H;ENSP00000386969:P125H;ENSP00000415786:P137H;ENSP00000408452:P125H	ENSP00000258405:P125H	P	-	2	0	SERPINE2	224571189	1.000000	0.71417	0.449000	0.26957	0.031000	0.12232	7.045000	0.76585	2.728000	0.93425	0.650000	0.86243	CCT		0.428	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
TRIP12	9320	hgsc.bcm.edu	37	2	230675716	230675716	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:230675716G>A	ENST00000283943.5	-	14	2135	c.1957C>T	c.(1957-1959)Caa>Taa	p.Q653*	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Nonsense_Mutation_p.Q701*|TRIP12_ENST00000389045.3_Nonsense_Mutation_p.Q356*	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	653					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AACAGCTGTTGAACATTTGTA	0.378																																					p.Q653X												.	.	0			c.C1957T	2						.						64.0	65.0	65.0					2																	230675716		2203	4300	6503	230383960	SO:0001587	stop_gained	9320	exon14			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1957C>T	2.37:g.230675716G>A	ENSP00000283943:p.Gln653*	Somatic		Capture	SOLID	Phase_I	230383960	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Nonsense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	G	39	7.838859	0.98519	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.5388	0.95266	0.0:0.0:1.0:0.0	.	.	.	.	X	653;356;701	.	ENSP00000283943:Q653X	Q	-	1	0	TRIP12	230383960	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.767000	0.98960	2.622000	0.88805	0.650000	0.86243	CAA		0.378	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
PSMD1	5707	hgsc.bcm.edu	37	2	231943447	231943447	+	Silent	SNP	T	T	C	rs180963792		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:231943447T>C	ENST00000308696.6	+	10	1308	c.1146T>C	c.(1144-1146)agT>agC	p.S382S	PSMD1_ENST00000409643.1_Silent_p.S382S|PSMD1_ENST00000373635.4_Silent_p.S382S	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	382					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.S382S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GGACAACCAGTGACCAGTTTC	0.333																																					p.S382S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1146C	2						.						126.0	122.0	124.0					2																	231943447		2203	4300	6503	231651691	SO:0001819	synonymous_variant	5707	exon10			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.1146T>C	2.37:g.231943447T>C		Somatic		Capture	SOLID	Phase_I	231651691	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Silent	SNP	ENST00000308696.6	37	CCDS2482.1																																																																																				0.333	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
ECEL1	9427	hgsc.bcm.edu	37	2	233349766	233349766	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:233349766C>T	ENST00000304546.1	-	4	1101	c.891G>A	c.(889-891)gtG>gtA	p.V297V	ECEL1_ENST00000409941.1_Silent_p.V297V	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	297					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)	p.V297V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GGAGGCTGAGCACTCGCTCCA	0.637																																					p.V297V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G891A	2						.						69.0	65.0	66.0					2																	233349766		2203	4300	6503	233058010	SO:0001819	synonymous_variant	9427	exon4			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.891G>A	2.37:g.233349766C>T		Somatic		Capture	SOLID	Phase_I	233058010	NM_004826	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Silent	SNP	ENST00000304546.1	37	CCDS2493.1																																																																																				0.637	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
NCOA1	8648	hgsc.bcm.edu	37	2	24991146	24991146	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:24991146C>T	ENST00000406961.1	+	23	4864	c.4212C>T	c.(4210-4212)ggC>ggT	p.G1404G	NCOA1_ENST00000538539.1_3'UTR|NCOA1_ENST00000395856.3_Silent_p.G1403G|NCOA1_ENST00000407230.1_3'UTR|NCOA1_ENST00000288599.5_3'UTR|NCOA1_ENST00000348332.3_Silent_p.G1404G|NCOA1_ENST00000405141.1_3'UTR			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1404					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.G1404G(1)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCTGGTAGGCGGGGACCCTT	0.557			T	PAX3	alveolar rhadomyosarcoma																																p.G1404G			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4212T	2						.						100.0	101.0	100.0					2																	24991146		2203	4300	6503	24844650	SO:0001819	synonymous_variant	8648	exon21			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.4212C>T	2.37:g.24991146C>T		Somatic		Capture	SOLID	Phase_I	24844650	NM_003743	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	37	CCDS1712.1																																																																																				0.557	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
ADCY3	109	hgsc.bcm.edu	37	2	25141412	25141412	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:25141412C>T	ENST00000260600.5	-	1	1296	c.445G>A	c.(445-447)Gcc>Acc	p.A149T		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	149					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.A149T(1)		NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					AAGATCTGGGCGGTTATGAGC	0.602																																					p.A149T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G445A	2						.						83.0	88.0	86.0					2																	25141412		2203	4300	6503	24994916	SO:0001583	missense	109	exon1			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.445G>A	2.37:g.25141412C>T	ENSP00000260600:p.Ala149Thr	Somatic		Capture	SOLID	Phase_I	24994916	NM_004036	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.730257	0.30684	.	.	ENSG00000138031	ENST00000260600;ENST00000415879;ENST00000435135	T;T	0.80738	-1.41;-1.05	4.38	4.38	0.52667	.	0.197137	0.43110	D	0.000603	T	0.70491	0.3230	L	0.43152	1.355	0.80722	D	1	B;B	0.34329	0.449;0.449	B;B	0.21917	0.037;0.037	T	0.69617	-0.5097	10	0.22706	T	0.39	.	15.6941	0.77481	0.0:1.0:0.0:0.0	.	149;149	B7ZLX9;O60266	.;ADCY3_HUMAN	T	149;124;149	ENSP00000260600:A149T;ENSP00000389799:A149T	ENSP00000260600:A149T	A	-	1	0	ADCY3	24994916	1.000000	0.71417	0.918000	0.36340	0.410000	0.31052	4.371000	0.59523	2.269000	0.75478	0.563000	0.77884	GCC		0.602	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
DPYSL5	56896	hgsc.bcm.edu	37	2	27165508	27165508	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:27165508C>T	ENST00000288699.6	+	11	1488	c.1330C>T	c.(1330-1332)Cgc>Tgc	p.R444C	DPYSL5_ENST00000401478.1_Missense_Mutation_p.R444C	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	444					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.R444C(2)		breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCCGGGGGCGCGTCGTGTA	0.612											OREG0014510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R444C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1330T	2						.						60.0	55.0	57.0					2																	27165508		2203	4300	6503	27019012	SO:0001583	missense	56896	exon11			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.1330C>T	2.37:g.27165508C>T	ENSP00000288699:p.Arg444Cys	Somatic	792	Capture	SOLID	Phase_I	27019012	NM_020134	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	37	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	C	31	5.063141	0.93898	.	.	ENSG00000157851	ENST00000288699;ENST00000401478	D;D	0.86865	-2.18;-2.18	6.08	5.15	0.70609	Metal-dependent hydrolase, composite domain (1);	0.098818	0.64402	D	0.000002	D	0.93000	0.7772	M	0.85859	2.78	0.80722	D	1	D	0.76494	0.999	P	0.61275	0.886	D	0.93585	0.6916	10	0.87932	D	0	-19.4965	15.1498	0.72689	0.1419:0.858:0.0:0.0	.	444	Q9BPU6	DPYL5_HUMAN	C	444	ENSP00000288699:R444C;ENSP00000385549:R444C	ENSP00000288699:R444C	R	+	1	0	DPYSL5	27019012	0.903000	0.30736	0.360000	0.25837	0.894000	0.52154	1.902000	0.39848	2.894000	0.99253	0.655000	0.94253	CGC		0.612	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
ALK	238	hgsc.bcm.edu	37	2	29430046	29430046	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:29430046G>T	ENST00000389048.3	-	26	4835	c.3929C>A	c.(3928-3930)aCa>aAa	p.T1310K	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1310	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T1310K(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CCATGTGTCTGTTTTAGAAGT	0.542			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.T1310K		yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3929A	2						.						92.0	88.0	90.0					2																	29430046		2203	4300	6503	29283550	SO:0001583	missense	238	exon26	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3929C>A	2.37:g.29430046G>T	ENSP00000373700:p.Thr1310Lys	Somatic		Capture	SOLID	Phase_I	29283550	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147185	0.77888	.	.	ENSG00000171094	ENST00000389048	D	0.83335	-1.71	5.56	5.56	0.83823	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.49305	D	0.000144	D	0.90827	0.7119	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90464	0.4448	9	.	.	.	.	17.6983	0.88288	0.0:0.0:1.0:0.0	.	1310	Q9UM73	ALK_HUMAN	K	1310	ENSP00000373700:T1310K	.	T	-	2	0	ALK	29283550	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	9.864000	0.99589	2.625000	0.88918	0.650000	0.86243	ACA		0.542	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
FOXN2	3344	hgsc.bcm.edu	37	2	48573522	48573522	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:48573522A>G	ENST00000340553.3	+	3	430	c.169A>G	c.(169-171)Aca>Gca	p.T57A		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	57					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T57A(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TGATGAACTCACAAACTTGAA	0.453																																					p.T57A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A169G	2						.						132.0	126.0	128.0					2																	48573522		2203	4300	6503	48427026	SO:0001583	missense	3344	exon3				CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.169A>G	2.37:g.48573522A>G	ENSP00000343633:p.Thr57Ala	Somatic		Capture	SOLID	Phase_I	48427026	NM_002158	Q15769|Q6P4Q2	Missense_Mutation	SNP	ENST00000340553.3	37	CCDS1838.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425097	0.83667	.	.	ENSG00000170802	ENST00000413569;ENST00000340553	D;D	0.96830	-4.1;-4.14	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.97554	0.9199	M	0.69358	2.11	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.98316	1.0526	10	0.87932	D	0	.	15.0203	0.71624	1.0:0.0:0.0:0.0	.	57	P32314	FOXN2_HUMAN	A	57	ENSP00000388486:T57A;ENSP00000343633:T57A	ENSP00000343633:T57A	T	+	1	0	FOXN2	48427026	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.139000	0.94554	2.212000	0.71576	0.482000	0.46254	ACA		0.453	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251240.3	NM_002158	
SPTBN1	6711	hgsc.bcm.edu	37	2	54856187	54856187	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:54856187G>A	ENST00000356805.4	+	14	2197	c.1916G>A	c.(1915-1917)cGc>cAc	p.R639H	SPTBN1_ENST00000333896.5_Missense_Mutation_p.R626H	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	639					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.R639H(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAGTCCCGCCGCCTCTGGAAG	0.602																																					p.R639H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1916A	2						.						57.0	64.0	62.0					2																	54856187		2202	4300	6502	54709691	SO:0001583	missense	6711	exon14				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1916G>A	2.37:g.54856187G>A	ENSP00000349259:p.Arg639His	Somatic		Capture	SOLID	Phase_I	54709691	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745370	0.89663	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;T	0.51071	1.29;0.72;1.29	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.73908	0.3647	M	0.87180	2.865	0.53688	D	0.999972	D;D	0.89917	0.999;1.0	D;D	0.68765	0.933;0.96	T	0.78099	-0.2336	10	0.72032	D	0.01	.	19.6322	0.95713	0.0:0.0:1.0:0.0	.	626;639	Q01082-3;Q01082	.;SPTB2_HUMAN	H	639;639;626	ENSP00000349259:R639H;ENSP00000374630:R639H;ENSP00000334156:R626H	ENSP00000334156:R626H	R	+	2	0	SPTBN1	54709691	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.993000	0.88291	2.652000	0.90054	0.655000	0.94253	CGC		0.602	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
RTN4	57142	hgsc.bcm.edu	37	2	55253724	55253724	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:55253724A>G	ENST00000337526.6	-	3	1754	c.1511T>C	c.(1510-1512)aTa>aCa	p.I504T	RTN4_ENST00000405240.1_Missense_Mutation_p.I298T|RTN4_ENST00000404909.1_Missense_Mutation_p.I298T|RTN4_ENST00000354474.6_Missense_Mutation_p.I272T|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Missense_Mutation_p.I298T|RTN4_ENST00000394611.2_Missense_Mutation_p.I298T|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000357732.4_Intron	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	504					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.I298T(1)|p.I504T(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						CTCTGTTACTATTTGGGCCTT	0.353																																					p.I504T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1511C	2						.						135.0	129.0	131.0					2																	55253724		2203	4300	6503	55107228	SO:0001583	missense	57142	exon3			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1511T>C	2.37:g.55253724A>G	ENSP00000337838:p.Ile504Thr	Somatic		Capture	SOLID	Phase_I	55107228	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	A	6.117	0.389826	0.11581	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.19105	2.17;2.17;2.38;2.17;2.17;2.19	6.06	3.67	0.42095	.	0.128766	0.35179	N	0.003395	T	0.14830	0.0358	L	0.50333	1.59	0.25922	N	0.983108	B	0.30824	0.296	B	0.23419	0.046	T	0.20940	-1.0260	10	0.30854	T	0.27	-6.155	3.9617	0.09413	0.6692:0.1342:0.0682:0.1283	.	504	Q9NQC3	RTN4_HUMAN	T	298;298;504;298;298;272	ENSP00000384471:I298T;ENSP00000349944:I298T;ENSP00000337838:I504T;ENSP00000378109:I298T;ENSP00000385650:I298T;ENSP00000346465:I272T	ENSP00000337838:I504T	I	-	2	0	RTN4	55107228	0.886000	0.30341	0.987000	0.45799	0.970000	0.65996	1.733000	0.38156	0.520000	0.28426	0.528000	0.53228	ATA		0.353	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
CCDC88A	55704	hgsc.bcm.edu	37	2	55573373	55573373	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:55573373T>C	ENST00000436346.1	-	10	1820	c.979A>G	c.(979-981)Agt>Ggt	p.S327G	CCDC88A_ENST00000336838.6_Missense_Mutation_p.S327G|CCDC88A_ENST00000263630.8_Missense_Mutation_p.S327G|CCDC88A_ENST00000413716.2_Missense_Mutation_p.S327G|AC012358.8_ENST00000594078.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	327					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.S327G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CTGACTTCACTTTCAAGCTTA	0.363																																					p.S327G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A979G	2						.						164.0	157.0	159.0					2																	55573373		2203	4300	6503	55426877	SO:0001583	missense	55704	exon10			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.979A>G	2.37:g.55573373T>C	ENSP00000410608:p.Ser327Gly	Somatic		Capture	SOLID	Phase_I	55426877	NM_001135597	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.	.	.	.	.	.	.	.	.	.	T	18.36	3.606694	0.66558	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.26	5.26	0.73747	.	0.000000	0.56097	U	0.000027	T	0.60894	0.2304	M	0.68952	2.095	0.80722	D	1	B;D;P	0.76494	0.182;0.999;0.526	B;D;P	0.78314	0.173;0.991;0.45	T	0.57929	-0.7726	10	0.24483	T	0.36	-1.5441	15.1824	0.72968	0.0:0.0:0.0:1.0	.	327;327;327	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	G	327	ENSP00000338728:S327G;ENSP00000263630:S327G;ENSP00000410608:S327G;ENSP00000404431:S327G	ENSP00000263630:S327G	S	-	1	0	CCDC88A	55426877	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.629000	0.83207	1.986000	0.57962	0.533000	0.62120	AGT		0.363	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
CCDC88A	55704	hgsc.bcm.edu	37	2	55582769	55582769	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:55582769A>G	ENST00000436346.1	-	8	1587	c.746T>C	c.(745-747)cTg>cCg	p.L249P	CCDC88A_ENST00000413716.2_Missense_Mutation_p.L249P|CCDC88A_ENST00000263630.8_Missense_Mutation_p.L249P|CCDC88A_ENST00000336838.6_Missense_Mutation_p.L249P	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	249					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.L249P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TTCCACCGACAGATGTTGTCG	0.463																																					p.L249P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T746C	2						.						130.0	113.0	119.0					2																	55582769		2203	4300	6503	55436273	SO:0001583	missense	55704	exon8			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.746T>C	2.37:g.55582769A>G	ENSP00000410608:p.Leu249Pro	Somatic		Capture	SOLID	Phase_I	55436273	NM_001135597	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.	.	.	.	.	.	.	.	.	.	A	25.0	4.595347	0.86953	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.05	5.05	0.67936	.	0.000000	0.38058	U	0.001822	D	0.84392	0.5462	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.86937	0.2077	10	0.87932	D	0	-5.5733	15.0728	0.72053	1.0:0.0:0.0:0.0	.	249;249;249	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	P	249	ENSP00000338728:L249P;ENSP00000263630:L249P;ENSP00000410608:L249P;ENSP00000404431:L249P	ENSP00000263630:L249P	L	-	2	0	CCDC88A	55436273	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.883000	0.92426	2.036000	0.60181	0.482000	0.46254	CTG		0.463	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
EFEMP1	2202	hgsc.bcm.edu	37	2	56104885	56104885	+	Silent	SNP	G	G	A	rs536279337		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:56104885G>A	ENST00000394555.2	-	6	1191	c.756C>T	c.(754-756)tgC>tgT	p.C252C	EFEMP1_ENST00000424836.2_Intron|EFEMP1_ENST00000355426.3_Silent_p.C252C|EFEMP1_ENST00000394554.1_Silent_p.C252C	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	252	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.C252C(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCTTACCTACGCAGGTATAGT	0.428													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17662	0.0		0.0	False		,,,				2504	0.0				p.C252C	GBM(92;934 1319 7714 28760 40110)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C756T	2						.						141.0	129.0	133.0					2																	56104885		2203	4300	6503	55958389	SO:0001819	synonymous_variant	2202	exon7			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.756C>T	2.37:g.56104885G>A		Somatic		Capture	SOLID	Phase_I	55958389	NM_001039348	A8K3I4|B4DW75|D6W5D2|Q541U7	Silent	SNP	ENST00000394555.2	37	CCDS1857.1																																																																																				0.428	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
PLEK	5341	hgsc.bcm.edu	37	2	68607476	68607476	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:68607476C>T	ENST00000234313.7	+	2	238	c.59C>T	c.(58-60)aCg>aTg	p.T20M		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	20	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)	p.T20M(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		GTGTTCAATACGTGGAAACCC	0.418																																					p.T20M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C59T	2						.						68.0	66.0	67.0					2																	68607476		2203	4300	6503	68460980	SO:0001583	missense	5341	exon2			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.59C>T	2.37:g.68607476C>T	ENSP00000234313:p.Thr20Met	Somatic		Capture	SOLID	Phase_I	68460980	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713185	0.68730	.	.	ENSG00000115956	ENST00000234313	T	0.77877	-1.13	5.07	4.14	0.48551	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.283582	0.40385	N	0.001106	D	0.82563	0.5064	L	0.56769	1.78	0.42362	D	0.992418	D;P	0.58268	0.982;0.955	P;P	0.59357	0.856;0.783	D	0.84595	0.0669	10	0.87932	D	0	.	12.0671	0.53594	0.1247:0.738:0.1373:0.0	.	38;20	Q59GZ2;P08567	.;PLEK_HUMAN	M	20	ENSP00000234313:T20M	ENSP00000234313:T20M	T	+	2	0	PLEK	68460980	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.690000	0.54713	2.356000	0.79943	0.655000	0.94253	ACG		0.418	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
RAB11FIP5	26056	hgsc.bcm.edu	37	2	73303282	73303282	+	Missense_Mutation	SNP	C	C	T	rs528799264		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:73303282C>T	ENST00000258098.6	-	4	1837	c.1597G>A	c.(1597-1599)Gcc>Acc	p.A533T	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	533					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)	p.A533T(1)		biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TCCACAGGGGCGGCACTGAGG	0.612													c|||	1	0.000199681	0.0008	0.0	5008	,	,		16644	0.0		0.0	False		,,,				2504	0.0				p.A533T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1597A	2						.						108.0	119.0	115.0					2																	73303282		2203	4300	6503	73156790	SO:0001583	missense	26056	exon4			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1597G>A	2.37:g.73303282C>T	ENSP00000258098:p.Ala533Thr	Somatic		Capture	SOLID	Phase_I	73156790	NM_015470	O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	37	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	c	0.486	-0.877387	0.02550	.	.	ENSG00000135631	ENST00000258098	T	0.44881	0.91	5.29	2.51	0.30379	.	0.348304	0.27319	N	0.019912	T	0.22859	0.0552	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.14811	-1.0459	10	0.23891	T	0.37	-3.585	7.8847	0.29642	0.0:0.6762:0.0:0.3238	.	533	Q9BXF6	RFIP5_HUMAN	T	533	ENSP00000258098:A533T	ENSP00000258098:A533T	A	-	1	0	RAB11FIP5	73156790	0.000000	0.05858	0.248000	0.24265	0.264000	0.26372	-0.071000	0.11505	0.742000	0.32697	-0.150000	0.13652	GCC		0.612	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470	
DUSP11	8446	hgsc.bcm.edu	37	2	74001019	74001019	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:74001019A>T	ENST00000272444.3	-	4	523	c.482T>A	c.(481-483)aTt>aAt	p.I161N	DUSP11_ENST00000480948.1_5'UTR|DUSP11_ENST00000377706.4_Missense_Mutation_p.I114N|DUSP11_ENST00000443070.1_Missense_Mutation_p.I161N	NM_003584.2	NP_003575.2	O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	114	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)|polynucleotide 5' dephosphorylation (GO:0098507)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphatase activity (GO:0016791)|poly(A) RNA binding (GO:0044822)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA binding (GO:0003723)	p.I114N(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12						AACTGTAAAAATTTTTAAGTA	0.294																																					p.I161N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T482A	2						.						69.0	78.0	75.0					2																	74001019		2203	4298	6501	73854527	SO:0001583	missense	8446	exon4			AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092				9685386	Standard	NM_003584		Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.482T>A	2.37:g.74001019A>T	ENSP00000272444:p.Ile161Asn	Somatic		Capture	SOLID	Phase_I	73854527	NM_003584	B2RCT8|Q6AI47|Q9BWE3	Missense_Mutation	SNP	ENST00000272444.3	37	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	A	20.4	3.986669	0.74589	.	.	ENSG00000144048	ENST00000272444;ENST00000443070;ENST00000377706;ENST00000452812	T;D	0.88201	1.12;-2.35	4.95	4.95	0.65309	Dual specificity phosphatase, catalytic domain (1);	0.159438	0.56097	D	0.000034	D	0.95027	0.8390	M	0.90759	3.145	0.54753	D	0.999984	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.95701	0.8749	10	0.87932	D	0	-7.0312	12.9075	0.58160	1.0:0.0:0.0:0.0	.	161;114	C9JYA6;O75319	.;DUS11_HUMAN	N	161;161;114;112	ENSP00000413444:I161N;ENSP00000366935:I114N	ENSP00000272444:I161N	I	-	2	0	DUSP11	73854527	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	6.773000	0.75006	2.216000	0.71823	0.533000	0.62120	ATT		0.294	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3		
TACR1	6869	hgsc.bcm.edu	37	2	75425970	75425970	+	Missense_Mutation	SNP	G	G	T	rs200409378		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:75425970G>T	ENST00000305249.5	-	1	856	c.91C>A	c.(91-93)Caa>Aaa	p.Q31K	TACR1_ENST00000409848.3_Missense_Mutation_p.Q31K	NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	31					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)	p.Q31K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	AGGACAATTTGCCAGGCTGGT	0.522																																					p.Q31K	Pancreas(64;62 1268 3653 14826 43765)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C91A	2						.						147.0	134.0	138.0					2																	75425970		2203	4300	6503	75279478	SO:0001583	missense	6869	exon1			M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.91C>A	2.37:g.75425970G>T	ENSP00000303522:p.Gln31Lys	Somatic		Capture	SOLID	Phase_I	75279478	NM_015727	A8K150	Missense_Mutation	SNP	ENST00000305249.5	37	CCDS1958.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.111463	0.56398	.	.	ENSG00000115353	ENST00000305249;ENST00000409848	T;T	0.37058	1.22;1.22	5.5	5.5	0.81552	.	0.050505	0.85682	D	0.000000	T	0.38746	0.1052	M	0.66939	2.045	0.80722	D	1	B	0.29270	0.24	B	0.24848	0.056	T	0.13442	-1.0509	10	0.33940	T	0.23	.	16.9498	0.86242	0.0:0.0:1.0:0.0	.	31	P25103	NK1R_HUMAN	K	31	ENSP00000303522:Q31K;ENSP00000386448:Q31K	ENSP00000303522:Q31K	Q	-	1	0	TACR1	75279478	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.216000	0.58540	2.854000	0.98071	0.655000	0.94253	CAA		0.522	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252239.3	NM_001058	
MAL	4118	hgsc.bcm.edu	37	2	95719166	95719166	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:95719166C>T	ENST00000309988.4	+	4	537	c.428C>T	c.(427-429)gCg>gTg	p.A143V	AC103563.9_ENST00000442200.1_RNA|MAL_ENST00000349807.3_Missense_Mutation_p.A45V|MAL_ENST00000353004.3_Missense_Mutation_p.A101V|MAL_ENST00000354078.3_Missense_Mutation_p.A87V	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein	143	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)	p.A143V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		GTGGTCCATGCGGTGTTCTCT	0.507																																					p.A143V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C428T	2						.						214.0	200.0	205.0					2																	95719166		2203	4300	6503	95082893	SO:0001583	missense	4118	exon4				CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.428C>T	2.37:g.95719166C>T	ENSP00000310880:p.Ala143Val	Somatic		Capture	SOLID	Phase_I	95082893	NM_002371	Q6FH77	Missense_Mutation	SNP	ENST00000309988.4	37	CCDS2006.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.503245	0.44558	.	.	ENSG00000172005	ENST00000309988;ENST00000353004;ENST00000354078;ENST00000349807	T;T	0.48836	1.63;0.8	5.57	5.57	0.84162	Marvel (1);MARVEL-like domain (1);	0.482456	0.24988	N	0.034009	T	0.66297	0.2775	M	0.82923	2.615	0.09310	N	0.999999	D;D;D;P	0.64830	0.994;0.994;0.979;0.955	P;P;B;B	0.56751	0.805;0.663;0.409;0.426	T	0.63065	-0.6720	10	0.49607	T	0.09	.	15.4703	0.75437	0.0:1.0:0.0:0.0	.	45;101;87;143	P21145-4;P21145-2;P21145-3;P21145	.;.;.;MAL_HUMAN	V	143;101;87;45	ENSP00000310880:A143V;ENSP00000306568:A101V	ENSP00000310880:A143V	A	+	2	0	MAL	95082893	0.005000	0.15991	0.449000	0.26957	0.257000	0.26127	1.368000	0.34216	2.808000	0.96608	0.650000	0.86243	GCG		0.507	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254982.3	NM_002371	
PER2	8864	hgsc.bcm.edu	37	2	239166973	239166973	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:239166973G>A	ENST00000254657.3	-	16	2123	c.1844C>T	c.(1843-1845)gCg>gTg	p.A615V	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	615	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.A615V(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GGACCTTAGCGCTGGGACGTT	0.527																																					p.A615V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1844T	2						.						120.0	94.0	102.0					2																	239166973		2203	4300	6503	238831712	SO:0001583	missense	8864	exon16			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1844C>T	2.37:g.239166973G>A	ENSP00000254657:p.Ala615Val	Somatic		Capture	SOLID	Phase_I	238831712	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.182505	0.38511	.	.	ENSG00000132326	ENST00000254657	T	0.12361	2.69	4.25	2.42	0.29668	.	1.451210	0.04448	N	0.372041	T	0.08758	0.0217	N	0.08118	0	0.30246	N	0.794575	B;B	0.20671	0.043;0.047	B;B	0.14578	0.007;0.011	T	0.21655	-1.0239	10	0.66056	D	0.02	-4.2045	7.9054	0.29759	0.2078:0.0:0.7922:0.0	.	615;615	B4DH14;O15055	.;PER2_HUMAN	V	615	ENSP00000254657:A615V	ENSP00000254657:A615V	A	-	2	0	PER2	238831712	0.971000	0.33674	0.001000	0.08648	0.007000	0.05969	4.023000	0.57211	1.101000	0.41535	0.561000	0.74099	GCG		0.527	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
TGFBR1	7046	hgsc.bcm.edu	37	9	101909976	101909976	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:101909976A>G	ENST00000374994.4	+	8	1413	c.1296A>G	c.(1294-1296)gtA>gtG	p.V432V	TGFBR1_ENST00000552516.1_Silent_p.V436V|TGFBR1_ENST00000550253.1_Silent_p.V363V|RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000374990.2_Silent_p.V355V	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	432	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.V432V(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				ATGATCTTGTACCTTCTGACC	0.338																																					p.V432V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1296G	9						.						91.0	91.0	91.0					9																	101909976		2203	4300	6503	100949797	SO:0001819	synonymous_variant	7046	exon8				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1296A>G	9.37:g.101909976A>G		Somatic		Capture	SOLID	Phase_I	100949797	NM_004612	Q6IR47|Q706C0|Q706C1	Silent	SNP	ENST00000374994.4	37	CCDS6738.1																																																																																				0.338	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
ALG2	85365	hgsc.bcm.edu	37	9	101980931	101980931	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:101980931A>T	ENST00000476832.1	-	2	597	c.536T>A	c.(535-537)tTc>tAc	p.F179Y	ALG2_ENST00000319033.6_Missense_Mutation_p.F86Y	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.F179Y(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				AGCAGCTGTGAACTGGCTGTT	0.438																																					p.F179Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T536A	9						.						95.0	98.0	97.0					9																	101980931		2203	4300	6503	101020752	SO:0001583	missense	85365	exon2			AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.536T>A	9.37:g.101980931A>T	ENSP00000417764:p.Phe179Tyr	Somatic		Capture	SOLID	Phase_I	101020752	NM_033087	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000476832.1	37	CCDS6739.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.851922	0.71719	.	.	ENSG00000119523	ENST00000476832;ENST00000319033	T;T	0.79454	-1.27;-1.27	5.16	3.99	0.46301	.	0.044965	0.85682	N	0.000000	T	0.77961	0.4209	M	0.71871	2.18	0.80722	D	1	P;P	0.39131	0.661;0.567	B;B	0.42798	0.398;0.341	T	0.75938	-0.3141	10	0.42905	T	0.14	-24.6193	11.2082	0.48782	0.8582:0.0:0.0:0.1418	.	86;179	Q9H553-2;Q9H553	.;ALG2_HUMAN	Y	179;86	ENSP00000417764:F179Y;ENSP00000326609:F86Y	ENSP00000432675:F86Y	F	-	2	0	ALG2	101020752	1.000000	0.71417	0.987000	0.45799	0.995000	0.86356	7.038000	0.76537	0.866000	0.35629	0.528000	0.53228	TTC		0.438	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215080.1	NM_033087	
ZNF189	7743	hgsc.bcm.edu	37	9	104171427	104171427	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:104171427T>C	ENST00000339664.2	+	3	1506	c.1377T>C	c.(1375-1377)gaT>gaC	p.D459D	ZNF189_ENST00000259395.4_Silent_p.D417D|ZNF189_ENST00000374861.3_Silent_p.D445D	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	459					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D459D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				ATAAATGTGATGAATGTGGGA	0.368																																					p.D417D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1251C	9						.						90.0	92.0	91.0					9																	104171427		2203	4300	6503	103211248	SO:0001819	synonymous_variant	7743	exon4			AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.1377T>C	9.37:g.104171427T>C		Somatic		Capture	SOLID	Phase_I	103211248	NM_197977	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Silent	SNP	ENST00000339664.2	37	CCDS6754.1																																																																																				0.368	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452	
GRIN3A	116443	hgsc.bcm.edu	37	9	104357063	104357063	+	Intron	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:104357063C>T	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Silent_p.P50P	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.P50P(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GGCGCAGCTCCGGCAGGGACA	0.537																																					p.P50P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G150A	9						.						65.0	65.0	65.0					9																	104357063		2203	4300	6503	103396884	SO:0001627	intron_variant	5535	exon1				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15421G>A	9.37:g.104357063C>T		Somatic		Capture	SOLID	Phase_I	103396884	NM_147180	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	ENST00000361820.3	37	CCDS6758.1																																																																																				0.537	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
URM1	81605	hgsc.bcm.edu	37	9	131151567	131151567	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:131151567C>T	ENST00000372853.4	+	4	278	c.216C>T	c.(214-216)aaC>aaT	p.N72N	RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000452446.1_Silent_p.N72N|URM1_ENST00000483206.1_3'UTR|URM1_ENST00000372850.1_3'UTR	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1									p.N72N(3)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						TGCTGATTAACGATGCCGACT	0.597																																					p.N72N												.	.	3	Substitution - coding silent(3)	endometrium(2)|large_intestine(1)	c.C216T	9						.						99.0	90.0	93.0					9																	131151567		2203	4300	6503	130191388	SO:0001819	synonymous_variant	81605	exon4			AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.216C>T	9.37:g.131151567C>T		Somatic		Capture	SOLID	Phase_I	130191388	NM_001135947		Silent	SNP	ENST00000372853.4	37	CCDS6900.1																																																																																				0.597	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054422.1	NM_030914	
SPTAN1	6709	hgsc.bcm.edu	37	9	131370209	131370209	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:131370209G>A	ENST00000372731.4	+	33	4335	c.4225G>A	c.(4225-4227)Gga>Aga	p.G1409R	SPTAN1_ENST00000358161.5_Missense_Mutation_p.G1409R|SPTAN1_ENST00000372739.3_Missense_Mutation_p.G1409R	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1409					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.G1409R(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GTTGGCTCACGGACACTATGC	0.547																																					p.G1389R	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4165A	9						.						78.0	74.0	75.0					9																	131370209		2203	4300	6503	130410030	SO:0001583	missense	6709	exon32			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4225G>A	9.37:g.131370209G>A	ENSP00000361816:p.Gly1409Arg	Somatic		Capture	SOLID	Phase_I	130410030	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145205	0.57044	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.54675	0.56;0.56;0.56	5.54	4.65	0.58169	.	0.048617	0.85682	N	0.000000	T	0.68348	0.2991	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	B;D;D	0.75484	0.411;0.976;0.986	T	0.71702	-0.4513	10	0.66056	D	0.02	.	14.7251	0.69339	0.0699:0.0:0.9301:0.0	.	1389;1409;1409	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	R	1409;1409;1409;1389	ENSP00000350882:G1409R;ENSP00000361816:G1409R;ENSP00000361824:G1409R	ENSP00000350882:G1409R	G	+	1	0	SPTAN1	130410030	1.000000	0.71417	0.996000	0.52242	0.938000	0.57974	6.594000	0.74104	1.488000	0.48433	0.591000	0.81541	GGA		0.547	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
SH3GLB2	56904	hgsc.bcm.edu	37	9	131777051	131777051	+	Splice_Site	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:131777051G>A	ENST00000372564.3	-	4	612	c.467C>T	c.(466-468)tCg>tTg	p.S156L	SH3GLB2_ENST00000416629.1_Splice_Site_p.S156L|SH3GLB2_ENST00000417224.1_Splice_Site_p.S156L|SH3GLB2_ENST00000372559.1_Splice_Site_p.S156L|SH3GLB2_ENST00000372554.4_Splice_Site_p.S156L	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	156	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)		p.S156L(1)		NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						GGCCCTCACCGAGATGGTCTT	0.577																																					p.S156L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C467T	9						.						89.0	95.0	93.0					9																	131777051		2203	4300	6503	130816872	SO:0001630	splice_region_variant	56904	exon4			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.468+1C>T	9.37:g.131777051G>A		Somatic		Capture	SOLID	Phase_I	130816872	NM_020145	A6NC47|A8MPS4|Q8WY61|Q96JH9	Missense_Mutation	SNP	ENST00000372564.3	37	CCDS6916.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807153	0.90623	.	.	ENSG00000148341	ENST00000372564;ENST00000372559;ENST00000543311;ENST00000372554;ENST00000417224;ENST00000416629	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.46	5.46	0.80206	BAR (3);IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.64983	0.2648	L	0.46947	1.48	0.80722	D	1	D;B	0.57899	0.981;0.033	P;B	0.50490	0.642;0.021	T	0.59461	-0.7450	10	0.23302	T	0.38	-3.7225	18.6617	0.91473	0.0:0.0:1.0:0.0	.	156;156	Q9NR46-2;Q9NR46	.;SHLB2_HUMAN	L	156	ENSP00000361645:S156L;ENSP00000361640:S156L;ENSP00000361634:S156L;ENSP00000402566:S156L;ENSP00000388282:S156L	ENSP00000361634:S156L	S	-	2	0	SH3GLB2	130816872	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	5.336000	0.65935	2.728000	0.93425	0.655000	0.94253	TCG		0.577	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054535.2		Missense_Mutation
SETX	23064	hgsc.bcm.edu	37	9	135204405	135204405	+	Silent	SNP	G	G	A	rs372003572		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:135204405G>A	ENST00000224140.5	-	10	2762	c.2580C>T	c.(2578-2580)aaC>aaT	p.N860N	SETX_ENST00000372169.2_Silent_p.N860N|SETX_ENST00000393220.1_Silent_p.N860N	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	860					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.N860N(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GCAATACATTGTTTTGAGATT	0.313																																					p.N860N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2580T	9						.						48.0	47.0	47.0					9																	135204405		2202	4297	6499	134194226	SO:0001819	synonymous_variant	23064	exon10			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.2580C>T	9.37:g.135204405G>A		Somatic		Capture	SOLID	Phase_I	134194226	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	ENST00000224140.5	37	CCDS6947.1																																																																																				0.313	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
ADAMTSL2	9719	hgsc.bcm.edu	37	9	136439951	136439951	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:136439951G>A	ENST00000354484.4	+	19	3378	c.2821G>A	c.(2821-2823)Gcg>Acg	p.A941T	ADAMTSL2_ENST00000393060.1_Missense_Mutation_p.A941T|ADAMTSL2_ENST00000393061.3_Missense_Mutation_p.A1050T	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	941	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A941T(1)		kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		CTACAGCAAGGCGTGCTGCCG	0.642																																					p.A941T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2821A	9						.						1.0	1.0	1.0					9																	136439951		363	1011	1374	135429772	SO:0001583	missense	9719	exon19			AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.2821G>A	9.37:g.136439951G>A	ENSP00000346478:p.Ala941Thr	Somatic		Capture	SOLID	Phase_I	135429772	NM_001145320	B1B0D5|O60345	Missense_Mutation	SNP	ENST00000354484.4	37	CCDS6976.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688220	0.88639	.	.	ENSG00000197859	ENST00000354484;ENST00000393061;ENST00000393060	T;T;T	0.45668	0.89;0.89;0.89	3.74	3.74	0.42951	PLAC (2);	0.000000	0.85682	U	0.000000	T	0.59662	0.2210	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.996;1.0	T	0.60586	-0.7234	10	0.38643	T	0.18	.	15.8994	0.79362	0.0:0.0:1.0:0.0	.	370;941	B3KXC5;Q86TH1	.;ATL2_HUMAN	T	941;1050;941	ENSP00000346478:A941T;ENSP00000376781:A1050T;ENSP00000376780:A941T	ENSP00000346478:A941T	A	+	1	0	ADAMTSL2	135429772	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.248000	0.95456	1.806000	0.52798	0.462000	0.41574	GCG		0.642	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694	
DBH	1621	hgsc.bcm.edu	37	9	136507457	136507457	+	Silent	SNP	G	G	A	rs538630117		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:136507457G>A	ENST00000393056.2	+	3	627	c.615G>A	c.(613-615)ccG>ccA	p.P205P		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	205					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.P205P(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	TCCCCGAACCGGAGTTGCCCT	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18829	0.0		0.0	False		,,,				2504	0.001				p.P205P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G615A	9						.						67.0	63.0	64.0					9																	136507457		2203	4300	6503	135497278	SO:0001819	synonymous_variant	1621	exon3			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.615G>A	9.37:g.136507457G>A		Somatic		Capture	SOLID	Phase_I	135497278	NM_000787	Q5T381|Q96AG2	Silent	SNP	ENST00000393056.2	37	CCDS6977.2																																																																																				0.607	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787	
BNC2	54796	hgsc.bcm.edu	37	9	16435881	16435881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:16435881C>T	ENST00000380672.4	-	6	2368	c.2311G>A	c.(2311-2313)Gtc>Atc	p.V771I	BNC2_ENST00000380666.2_Missense_Mutation_p.V771I|BNC2_ENST00000545497.1_Missense_Mutation_p.V676I|BNC2_ENST00000380667.2_Missense_Mutation_p.V704I	NM_017637.5	NP_060107.3			basonuclin 2									p.V771I(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		ACCTTGATGACGTCCTGGTGA	0.502																																					p.V771I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2311A	9						.						111.0	90.0	97.0					9																	16435881		2203	4300	6503	16425881	SO:0001583	missense	54796	exon6			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.2311G>A	9.37:g.16435881C>T	ENSP00000370047:p.Val771Ile	Somatic		Capture	SOLID	Phase_I	16425881	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	8.226	0.803542	0.16467	.	.	ENSG00000173068	ENST00000380672;ENST00000411752;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T;T	0.47528	1.47;0.84;1.47;1.48;1.48;1.47	5.71	1.5	0.22942	.	0.319946	0.33650	N	0.004684	T	0.31451	0.0797	L	0.29908	0.895	0.40627	D	0.981827	B;B;B;B;B;B;B;B;B	0.10296	0.001;0.001;0.0;0.0;0.003;0.001;0.002;0.0;0.001	B;B;B;B;B;B;B;B;B	0.04013	0.001;0.0;0.001;0.001;0.001;0.0;0.0;0.0;0.0	T	0.08310	-1.0728	10	0.22706	T	0.39	-5.0323	10.2503	0.43364	0.0:0.7209:0.0:0.2791	.	676;704;771;597;771;728;771;676;536	F5H586;B1APH0;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;BNC2_HUMAN;.;.	I	771;164;728;704;676;597;771;771	ENSP00000370047:V771I;ENSP00000392212:V164I;ENSP00000408370:V728I;ENSP00000370042:V704I;ENSP00000444640:V676I;ENSP00000370041:V771I	ENSP00000370041:V771I	V	-	1	0	BNC2	16425881	0.753000	0.28349	0.258000	0.24420	0.954000	0.61252	1.385000	0.34408	0.012000	0.14892	-0.150000	0.13652	GTC		0.502	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
ACER2	340485	hgsc.bcm.edu	37	9	19446292	19446292	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:19446292C>T	ENST00000340967.2	+	5	543	c.517C>T	c.(517-519)Cgt>Tgt	p.R173C		NM_001010887.2	NP_001010887.2	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2	173					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to drug (GO:0035690)|ceramide metabolic process (GO:0006672)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of protein glycosylation in Golgi (GO:0090285)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)	p.R173C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	13						TGACAACATGCGTGTGTTTAA	0.577																																					p.R173C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517T	9						.						137.0	129.0	132.0					9																	19446292		2203	4300	6503	19436292	SO:0001583	missense	340485	exon5			AK123581	CCDS34992.1	9p21.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000177076	ENSG00000177076	3.5.1.23	"""Alkaline ceramidase"""	23675	protein-coding gene	gene with protein product		613492	"""N-acylsphingosine amidohydrolase 3-like"""	ASAH3L		18945876	Standard	XM_005251447		Approved	FLJ41587	uc003zny.1	Q5QJU3	OTTHUMG00000019644	ENST00000340967.2:c.517C>T	9.37:g.19446292C>T	ENSP00000342609:p.Arg173Cys	Somatic		Capture	SOLID	Phase_I	19436292	NM_001010887	A2A3R8|Q569G5|Q5VZR7|Q71RD2	Missense_Mutation	SNP	ENST00000340967.2	37	CCDS34992.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892625	0.91889	.	.	ENSG00000177076	ENST00000340967	T	0.45276	0.9	4.79	4.79	0.61399	.	0.111433	0.64402	D	0.000008	T	0.65080	0.2657	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.66787	-0.5835	9	.	.	.	.	18.1677	0.89733	0.0:1.0:0.0:0.0	.	173	Q5QJU3	ACER2_HUMAN	C	173	ENSP00000342609:R173C	.	R	+	1	0	ACER2	19436292	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	4.760000	0.62235	2.363000	0.80096	0.561000	0.74099	CGT		0.577	ACER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051864.1	XM_294540	
TAF1L	138474	hgsc.bcm.edu	37	9	32633102	32633102	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:32633102G>T	ENST00000242310.4	-	1	2565	c.2476C>A	c.(2476-2478)Cta>Ata	p.L826I	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	826					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.L826I(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AAAACCTGTAGAAAGTCTCGA	0.433																																					p.L826I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2476A	9						.						121.0	124.0	123.0					9																	32633102		2203	4300	6503	32623102	SO:0001583	missense	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2476C>A	9.37:g.32633102G>T	ENSP00000418379:p.Leu826Ile	Somatic		Capture	SOLID	Phase_I	32623102	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	8.911	0.958656	0.18507	.	.	ENSG00000122728	ENST00000242310	T	0.21932	1.98	1.19	1.19	0.21007	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.064498	0.64402	D	0.000007	T	0.43765	0.1262	M	0.86805	2.84	0.48341	D	0.999637	D	0.64830	0.994	D	0.65573	0.936	T	0.43458	-0.9390	10	0.87932	D	0	.	7.8312	0.29344	0.0:0.0:1.0:0.0	.	826	Q8IZX4	TAF1L_HUMAN	I	826	ENSP00000418379:L826I	ENSP00000418379:L826I	L	-	1	2	TAF1L	32623102	1.000000	0.71417	0.986000	0.45419	0.579000	0.36224	3.417000	0.52714	0.632000	0.30432	0.195000	0.17529	CTA		0.433	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
NOL6	65083	hgsc.bcm.edu	37	9	33465245	33465245	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:33465245C>T	ENST00000379471.2	-	20	2728	c.2641G>A	c.(2641-2643)Gct>Act	p.A881T	NOL6_ENST00000455041.2_Missense_Mutation_p.A829T|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	881					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A881T(1)		endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AAAAGGGCAGCGGCCACCAGA	0.617																																					p.A881T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2641A	9						.						35.0	26.0	29.0					9																	33465245		2202	4298	6500	33455245	SO:0001583	missense	65083	exon20			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.2641G>A	9.37:g.33465245C>T	ENSP00000368784:p.Ala881Thr	Somatic		Capture	SOLID	Phase_I	33455245	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	37		.	.	.	.	.	.	.	.	.	.	C	36	5.599134	0.96614	.	.	ENSG00000165271	ENST00000297990;ENST00000379471;ENST00000541373;ENST00000325914;ENST00000455041	T;T;T	0.50277	0.75;0.75;0.75	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.73575	0.3604	M	0.84433	2.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.995;0.998;0.99;0.995	T	0.75213	-0.3397	10	0.48119	T	0.1	.	19.5045	0.95110	0.0:1.0:0.0:0.0	.	829;878;881;881	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4	.;.;.;NOL6_HUMAN	T	881;881;437;881;829	ENSP00000297990:A881T;ENSP00000368784:A881T;ENSP00000395915:A829T	ENSP00000297990:A881T	A	-	1	0	NOL6	33455245	1.000000	0.71417	0.991000	0.47740	0.981000	0.71138	7.427000	0.80284	2.623000	0.88846	0.462000	0.41574	GCT		0.617	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917	
CCL27	10850	hgsc.bcm.edu	37	9	34662565	34662565	+	Silent	SNP	T	T	C	rs573809663		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:34662565T>C	ENST00000259631.4	-	1	124	c.66A>G	c.(64-66)acA>acG	p.T22T	CCL27_ENST00000557161.1_Intron|RP11-195F19.30_ENST00000564224.1_RNA	NM_006664.2	NP_006655.1	Q9Y4X3	CCL27_HUMAN	chemokine (C-C motif) ligand 27	22					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.T22T(1)		kidney(1)|large_intestine(3)|ovary(1)	5	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		ACTCACCTGCTGTAGGGTCTG	0.547													T|||	1	0.000199681	0.0	0.0014	5008	,	,		20340	0.0		0.0	False		,,,				2504	0.0				p.T22T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A66G	9						.						49.0	50.0	50.0					9																	34662565		2203	4300	6503	34652565	SO:0001819	synonymous_variant	10850	exon1			AJ243542	CCDS6569.1	9p13	2014-05-16	2002-08-22	2002-08-23	ENSG00000213927	ENSG00000213927		"""Chemokine ligands"", ""Endogenous ligands"""	10626	protein-coding gene	gene with protein product	"""CC chemokine ILC"", ""IL-11 Ralpha-locus chemokine"", ""cutaneous T-cell attracting chemokine"""	604833	"""small inducible cytokine subfamily A (Cys-Cys), member 27"""	SCYA27		10556532, 10588729	Standard	NM_006664		Approved	ALP, ILC, CTACK, skinkine, ESkine, PESKY, CTAK	uc003zvm.1	Q9Y4X3	OTTHUMG00000019834	ENST00000259631.4:c.66A>G	9.37:g.34662565T>C		Somatic		Capture	SOLID	Phase_I	34652565	NM_006664		Silent	SNP	ENST00000259631.4	37	CCDS6569.1																																																																																				0.547	CCL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052228.1	NM_006664	
VCP	7415	hgsc.bcm.edu	37	9	35059647	35059647	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:35059647delT	ENST00000358901.6	-	14	2742	c.1847delA	c.(1846-1848)aatfs	p.N616fs		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	616					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)	p.N616fs*63(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GATGAACACATTTTTTTTTGT	0.512																																					p.N616fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1847delA	9						.						206.0	164.0	179.0					9																	35059647		2203	4300	6503	35049647	SO:0001589	frameshift_variant	7415	exon14			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1847delA	9.37:g.35059647delT	ENSP00000351777:p.Asn616fs	Somatic		Capture	SOLID	Phase_I	35049647	NM_007126	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Frame_Shift_Del	DEL	ENST00000358901.6	37	CCDS6573.1																																																																																				0.512	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126	
PCSK5	5125	hgsc.bcm.edu	37	9	78638759	78638759	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:78638759G>T	ENST00000545128.1	+	4	1055	c.517G>T	c.(517-519)Gga>Tga	p.G173*	PCSK5_ENST00000376767.3_Nonsense_Mutation_p.G173*|PCSK5_ENST00000376752.4_Nonsense_Mutation_p.G173*	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	173	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.G173*(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CCTGGATGACGGAATTGAGAG	0.463																																					p.G173X												.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.G517T	9						.						193.0	165.0	175.0					9																	78638759		2203	4300	6503	77828579	SO:0001587	stop_gained	5125	exon4				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.517G>T	9.37:g.78638759G>T	ENSP00000446280:p.Gly173*	Somatic		Capture	SOLID	Phase_I	77828579	NM_001190482	F5H2G7|Q13527|Q96EP4	Nonsense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	41	8.934001	0.99008	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2825	0.98528	0.0:0.0:1.0:0.0	.	.	.	.	X	173	.	ENSP00000365943:G173X	G	+	1	0	PCSK5	77828579	1.000000	0.71417	0.978000	0.43139	0.390000	0.30446	9.420000	0.97426	2.873000	0.98535	0.561000	0.74099	GGA		0.463	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
GKAP1	80318	hgsc.bcm.edu	37	9	86421246	86421247	+	Frame_Shift_Del	DEL	TC	TC	-	rs576067814		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	TC	TC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:86421246_86421247delTC	ENST00000376371.2	-	3	586_587	c.186_187delGA	c.(184-189)aagaagfs	p.KK62fs	GKAP1_ENST00000376365.3_Frame_Shift_Del_p.KK62fs	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	62					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)		p.K63fs*6(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						TGCTGttccttcttttttcttc	0.371																																					p.62_63del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.186_187del	9						.																																			85611067	SO:0001589	frameshift_variant	80318	exon3			BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.186_187delGA	9.37:g.86421246_86421247delTC	ENSP00000365550:p.Lys62fs	Somatic		Capture	SOLID	Phase_I	85611066	NM_025211	Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Frame_Shift_Del	DEL	ENST00000376371.2	37	CCDS35049.1																																																																																				0.371	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052839.2	NM_025211	
GKAP1	80318	hgsc.bcm.edu	37	9	86421252	86421252	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:86421252T>G	ENST00000376371.2	-	3	581	c.181A>C	c.(181-183)Aaa>Caa	p.K61Q	GKAP1_ENST00000376365.3_Missense_Mutation_p.K61Q	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	61					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)		p.K61Q(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						tccttcttttttcttcttttc	0.368																																					p.K61Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A181C	9						.						114.0	110.0	112.0					9																	86421252		2174	4235	6409	85611072	SO:0001583	missense	80318	exon3			BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.181A>C	9.37:g.86421252T>G	ENSP00000365550:p.Lys61Gln	Somatic		Capture	SOLID	Phase_I	85611072	NM_025211	Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Missense_Mutation	SNP	ENST00000376371.2	37	CCDS35049.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973031	0.74246	.	.	ENSG00000165113	ENST00000376371;ENST00000376365	.	.	.	5.31	5.31	0.75309	.	0.092146	0.85682	D	0.000000	T	0.73961	0.3654	M	0.68317	2.08	0.39582	D	0.969442	D;D	0.63046	0.977;0.992	P;P	0.59171	0.73;0.853	T	0.78094	-0.2338	9	0.59425	D	0.04	-10.7408	14.9231	0.70856	0.0:0.0:0.0:1.0	.	61;61	Q5VSY0-2;Q5VSY0	.;GKAP1_HUMAN	Q	61	.	ENSP00000365544:K61Q	K	-	1	0	GKAP1	85611072	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.133000	0.64764	2.016000	0.59253	0.454000	0.30748	AAA		0.368	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052839.2	NM_025211	
COL5A1	1289	hgsc.bcm.edu	37	9	137593103	137593103	+	Missense_Mutation	SNP	G	G	A	rs142933609		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr9:137593103G>A	ENST00000371817.3	+	4	992	c.578G>A	c.(577-579)cGc>cAc	p.R193H	COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	193	Laminin G-like.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.R193H(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TTCCTCGACCGCAGCGACCAC	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20085	0.0		0.0	False		,,,				2504	0.0				p.R193H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G578A	9						.						170.0	124.0	140.0					9																	137593103		2203	4300	6503	136732924	SO:0001583	missense	1289	exon4			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.578G>A	9.37:g.137593103G>A	ENSP00000360882:p.Arg193His	Somatic		Capture	SOLID	Phase_I	136732924	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	19.78	3.890497	0.72524	.	.	ENSG00000130635	ENST00000371817	T	0.78246	-1.16	5.07	5.07	0.68467	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.000000	0.64402	U	0.000002	D	0.90817	0.7116	M	0.91038	3.17	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.92682	0.6159	10	0.72032	D	0.01	.	18.8039	0.92029	0.0:0.0:1.0:0.0	.	193	P20908	CO5A1_HUMAN	H	193	ENSP00000360882:R193H	ENSP00000360882:R193H	R	+	2	0	COL5A1	136732924	1.000000	0.71417	0.982000	0.44146	0.547000	0.35210	9.489000	0.97949	2.498000	0.84270	0.591000	0.81541	CGC		0.522	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
TEX29	121793	hgsc.bcm.edu	37	13	111980581	111980581	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:111980581G>A	ENST00000283547.1	+	3	239	c.110G>A	c.(109-111)cGa>cAa	p.R37Q		NM_152324.1	NP_689537.1	Q8N6K0	TEX29_HUMAN	testis expressed 29	37						integral component of membrane (GO:0016021)		p.R37Q(1)									TCCAGGGACCGATGCCAGGAG	0.567																																					p.R37Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G110A	13						.						130.0	112.0	119.0					13																	111980581		2203	4300	6503	110778582	SO:0001583	missense	121793	exon3			BC029889	CCDS9522.1	13q34	2012-03-23	2012-02-07	2012-02-07	ENSG00000153495	ENSG00000153495			20370	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 16"""	C13orf16			Standard	NM_152324		Approved	bA474D23.1, MGC35169	uc001vsa.3	Q8N6K0	OTTHUMG00000017358	ENST00000283547.1:c.110G>A	13.37:g.111980581G>A	ENSP00000283547:p.Arg37Gln	Somatic		Capture	SOLID	Phase_I	110778582	NM_152324		Missense_Mutation	SNP	ENST00000283547.1	37	CCDS9522.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743853	0.30865	.	.	ENSG00000153495	ENST00000283547	.	.	.	5.17	-1.13	0.09775	.	0.895692	0.09075	N	0.852292	T	0.26412	0.0645	N	0.20986	0.625	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.23440	-1.0188	9	0.34782	T	0.22	-12.6146	8.2977	0.31995	0.6012:0.0:0.3988:0.0	.	37	Q8N6K0	CM016_HUMAN	Q	37	.	ENSP00000283547:R37Q	R	+	2	0	C13orf16	110778582	0.004000	0.15560	0.011000	0.14972	0.907000	0.53573	0.078000	0.14761	-0.118000	0.11851	-0.333000	0.08304	CGA		0.567	TEX29-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045812.2	NM_152324	
MICU2	221154	hgsc.bcm.edu	37	13	22084180	22084180	+	Silent	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:22084180T>G	ENST00000382374.4	-	8	789	c.724A>C	c.(724-726)Aga>Cga	p.R242R		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	242	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)	p.R242R(1)									CTTTGTCCTCTTTTTCCAAAG	0.254																																					p.R242R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A724C	13						.						41.0	47.0	45.0					13																	22084180		2195	4273	6468	20982180	SO:0001819	synonymous_variant	221154	exon8			AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.724A>C	13.37:g.22084180T>G		Somatic		Capture	SOLID	Phase_I	20982180	NM_152726	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	CCDS9297.1																																																																																				0.254	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
RNF6	6049	hgsc.bcm.edu	37	13	26789264	26789264	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:26789264C>T	ENST00000381588.4	-	5	1507	c.755G>A	c.(754-756)cGc>cAc	p.R252H	RNF6_ENST00000399762.2_Intron|RNF6_ENST00000468480.1_Intron|RNF6_ENST00000346166.3_Missense_Mutation_p.R252H|RNF6_ENST00000381570.3_Missense_Mutation_p.R252H	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	252					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R252H(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		GAAATTAGTGCGTGAAGCGTT	0.493																																					p.R252H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G755A	13						.						128.0	117.0	121.0					13																	26789264		2203	4300	6503	25687264	SO:0001583	missense	6049	exon5			AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.755G>A	13.37:g.26789264C>T	ENSP00000371000:p.Arg252His	Somatic		Capture	SOLID	Phase_I	25687264	NM_005977	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Missense_Mutation	SNP	ENST00000381588.4	37	CCDS9316.1	.	.	.	.	.	.	.	.	.	.	C	8.952	0.968333	0.18659	.	.	ENSG00000127870	ENST00000346166;ENST00000381588;ENST00000381570	T;T;T	0.07444	3.19;3.19;3.19	4.92	-2.95	0.05564	.	1.757910	0.02677	N	0.109210	T	0.06735	0.0172	N	0.25647	0.755	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38351	-0.9665	10	0.22109	T	0.4	0.0269	8.933	0.35682	0.0944:0.5038:0.0:0.4018	.	252	Q9Y252	RNF6_HUMAN	H	252	ENSP00000342121:R252H;ENSP00000371000:R252H;ENSP00000370982:R252H	ENSP00000342121:R252H	R	-	2	0	RNF6	25687264	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.472000	0.00989	-0.853000	0.04136	-2.049000	0.00408	CGC		0.493	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044246.2	NM_005977	
WASF3	10810	hgsc.bcm.edu	37	13	27241738	27241738	+	Missense_Mutation	SNP	C	C	T	rs367882739		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:27241738C>T	ENST00000335327.5	+	5	531	c.353C>T	c.(352-354)cCt>cTt	p.P118L	WASF3_ENST00000361042.4_Missense_Mutation_p.P118L|WASF3_ENST00000496788.1_3'UTR	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	118					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)		p.P118L(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		AACAGCATTCCTAATCCTGTT	0.423																																					p.P118L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C353T	13						.	C	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	97.0	92.0	94.0		353	5.1	0.6	13		94	0,8600		0,0,4300	no	missense	WASF3	NM_006646.5	98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	118/503	27241738	1,13005	2203	4300	6503	26139738	SO:0001583	missense	10810	exon5			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.353C>T	13.37:g.27241738C>T	ENSP00000335055:p.Pro118Leu	Somatic		Capture	SOLID	Phase_I	26139738	NM_006646	O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	37	CCDS9318.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934020	0.92458	2.27E-4	0.0	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.54866	0.55;0.55	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.77491	0.4138	M	0.89904	3.07	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.65443	0.893;0.935	T	0.83297	-0.0030	10	0.87932	D	0	-19.7581	18.4771	0.90797	0.0:1.0:0.0:0.0	.	118;118	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	L	118	ENSP00000354325:P118L;ENSP00000335055:P118L	ENSP00000335055:P118L	P	+	2	0	WASF3	26139738	1.000000	0.71417	0.583000	0.28640	0.967000	0.64934	7.400000	0.79949	2.356000	0.79943	0.655000	0.94253	CCT		0.423	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1		
WASF3	10810	hgsc.bcm.edu	37	13	27255207	27255207	+	Missense_Mutation	SNP	G	G	A	rs77613105	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:27255207G>A	ENST00000335327.5	+	8	911	c.733G>A	c.(733-735)Gtt>Att	p.V245I	WASF3_ENST00000361042.4_Missense_Mutation_p.V242I	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	245					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)		p.V245I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		TGCATCGGACGTTACGGATTA	0.483													G|||	3	0.000599042	0.0	0.0	5008	,	,		16679	0.003		0.0	False		,,,				2504	0.0				p.V245I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G733A	13						.						86.0	95.0	92.0					13																	27255207		2203	4300	6503	26153207	SO:0001583	missense	10810	exon8			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.733G>A	13.37:g.27255207G>A	ENSP00000335055:p.Val245Ile	Somatic		Capture	SOLID	Phase_I	26153207	NM_006646	O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	37	CCDS9318.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	3.298	-0.143458	0.06669	.	.	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.43688	0.94;0.99	5.94	4.21	0.49690	.	0.401503	0.29100	N	0.013144	T	0.20047	0.0482	N	0.25890	0.77	0.31418	N	0.674648	B;B	0.12013	0.003;0.005	B;B	0.04013	0.001;0.001	T	0.15009	-1.0452	10	0.29301	T	0.29	-33.779	8.4408	0.32814	0.2798:0.0:0.7202:0.0	.	242;245	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	I	242;245	ENSP00000354325:V242I;ENSP00000335055:V245I	ENSP00000335055:V245I	V	+	1	0	WASF3	26153207	0.993000	0.37304	0.317000	0.25265	0.041000	0.13682	1.458000	0.35223	1.530000	0.49136	0.555000	0.69702	GTT		0.483	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1		
BRCA2	675	hgsc.bcm.edu	37	13	32954180	32954180	+	Missense_Mutation	SNP	C	C	T	rs80359750|rs45580035		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:32954180C>T	ENST00000380152.3	+	24	9387	c.9154C>T	c.(9154-9156)Cgg>Tgg	p.R3052W	BRCA2_ENST00000544455.1_Missense_Mutation_p.R3052W			P51587	BRCA2_HUMAN	breast cancer 2, early onset	3052			R -> W (could be associated with cancer susceptibility; has abrogated function consistent with pathogenicity; multifactorial likelihood analysis provides evidence for pathogenicity).		brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.R3052W(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTACCAGCCACGGGAGCCCCT	0.358			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.R3052W	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C9154T	13	GRCh37	CM082511	BRCA2	M	rs45580035	.						50.0	52.0	51.0					13																	32954180		2203	4300	6503	31852180	SO:0001583	missense	675	exon24	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.9154C>T	13.37:g.32954180C>T	ENSP00000369497:p.Arg3052Trp	Somatic		Capture	SOLID	Phase_I	31852180	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.780772	0.70222	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.87887	-2.31;-2.31	5.5	1.4	0.22301	Nucleic acid-binding, OB-fold-like (1);BRCA2, oligonucleotide/oligosaccharide-binding 3 (1);	0.000000	0.85682	D	0.000000	D	0.92525	0.7626	M	0.79805	2.47	0.52501	D	0.999955	D	0.89917	1.0	D	0.97110	1.0	D	0.92507	0.6013	10	0.87932	D	0	.	12.9995	0.58667	0.5964:0.4036:0.0:0.0	rs45580035	3052	P51587	BRCA2_HUMAN	W	3052	ENSP00000369497:R3052W;ENSP00000439902:R3052W	ENSP00000369497:R3052W	R	+	1	2	BRCA2	31852180	0.989000	0.36119	0.757000	0.31301	0.935000	0.57460	2.920000	0.48844	0.443000	0.26582	-0.271000	0.10264	CGG		0.358	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
KBTBD6	89890	hgsc.bcm.edu	37	13	41705067	41705067	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:41705067A>G	ENST00000379485.1	-	1	1815	c.1581T>C	c.(1579-1581)tgT>tgC	p.C527C	KBTBD6_ENST00000499385.2_Silent_p.C461C	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	527								p.C527C(1)		NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		TATCACAGATACAATAGATCT	0.438																																					p.C527C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1581C	13						.						118.0	113.0	114.0					13																	41705067		2203	4300	6503	40603067	SO:0001819	synonymous_variant	89890	exon1			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1581T>C	13.37:g.41705067A>G		Somatic		Capture	SOLID	Phase_I	40603067	NM_152903	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Silent	SNP	ENST00000379485.1	37	CCDS9376.1																																																																																				0.438	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
ENOX1	55068	hgsc.bcm.edu	37	13	43872544	43872544	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:43872544C>A	ENST00000261488.6	-	12	1961	c.1384G>T	c.(1384-1386)Gaa>Taa	p.E462*	ENOX1_ENST00000412891.1_Nonsense_Mutation_p.E462*	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	462					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)	p.E462*(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		GTGAGGTTTTCTTCTGTTCGG	0.463																																					p.E462X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1384T	13						.						176.0	148.0	158.0					13																	43872544		2203	4300	6503	42770544	SO:0001587	stop_gained	55068	exon12			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.1384G>T	13.37:g.43872544C>A	ENSP00000261488:p.Glu462*	Somatic		Capture	SOLID	Phase_I	42770544	NM_001127615	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Nonsense_Mutation	SNP	ENST00000261488.6	37	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	C	38	6.664498	0.97747	.	.	ENSG00000120658	ENST00000261488;ENST00000412891	.	.	.	5.2	4.34	0.51931	.	0.149463	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	0.1609	15.3579	0.74443	0.1407:0.8593:0.0:0.0	.	.	.	.	X	462	.	ENSP00000261488:E462X	E	-	1	0	ENOX1	42770544	1.000000	0.71417	0.315000	0.25238	0.370000	0.29829	7.356000	0.79445	1.297000	0.44761	0.655000	0.94253	GAA		0.463	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	
ABCC4	10257	hgsc.bcm.edu	37	13	95858995	95858995	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:95858995C>T	ENST00000376887.4	-	8	1066	c.952G>A	c.(952-954)Ggg>Agg	p.G318R	ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000536256.1_Missense_Mutation_p.G243R|ABCC4_ENST00000431522.1_Missense_Mutation_p.G318R|ABCC4_ENST00000412704.1_Missense_Mutation_p.G318R	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	318	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.G318R(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	AAATTCATCCCTCTGAGGCAG	0.463																																					p.G318R												.	.	1	Substitution - Missense(1)	ovary(1)	c.G952A	13						.						159.0	157.0	158.0					13																	95858995		2203	4300	6503	94656996	SO:0001583	missense	10257	exon8			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.952G>A	13.37:g.95858995C>T	ENSP00000366084:p.Gly318Arg	Somatic		Capture	SOLID	Phase_I	94656996	NM_001105515	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	37	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	C	32	5.106715	0.94292	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53	5.59	5.59	0.84812	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.049745	0.85682	D	0.000000	D	0.96131	0.8739	M	0.94063	3.49	0.80722	D	1	D;D;D;D;D	0.64830	0.984;0.994;0.986;0.994;0.988	D;D;D;D;D	0.73708	0.962;0.981;0.955;0.981;0.973	D	0.96831	0.9611	10	0.87932	D	0	.	19.1869	0.93647	0.0:1.0:0.0:0.0	.	243;318;318;318;318	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	R	318;318;243;318	ENSP00000388657:G318R;ENSP00000366084:G318R;ENSP00000442024:G243R;ENSP00000398562:G318R	ENSP00000366084:G318R	G	-	1	0	ABCC4	94656996	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.206000	0.77891	2.608000	0.88229	0.655000	0.94253	GGG		0.463	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
RASA3	22821	hgsc.bcm.edu	37	13	114766383	114766383	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr13:114766383G>A	ENST00000334062.7	-	19	1889	c.1768C>T	c.(1768-1770)Cgg>Tgg	p.R590W	RASA3_ENST00000389544.4_Missense_Mutation_p.R558W	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	590	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.R590W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			AAGCGCTTCCGTCCTTGGGCC	0.527																																					p.R590W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1768T	13						.						99.0	103.0	101.0					13																	114766383		2203	4300	6503	113784485	SO:0001583	missense	22821	exon19				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1768C>T	13.37:g.114766383G>A	ENSP00000335029:p.Arg590Trp	Somatic		Capture	SOLID	Phase_I	113784485	NM_007368	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390437	0.42410	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	D;D	0.93859	-3.3;-3.3	5.6	0.646	0.17789	Rho GTPase activation protein (1);Pleckstrin homology-type (1);Pleckstrin homology domain (3);Ras GTPase-activating protein (1);	0.000000	0.85682	D	0.000000	D	0.96818	0.8961	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96257	0.9188	9	.	.	.	.	14.913	0.70773	0.0:0.0:0.3536:0.6464	.	590	Q14644	RASA3_HUMAN	W	590;558	ENSP00000335029:R590W;ENSP00000374195:R558W	.	R	-	1	2	RASA3	113784485	0.994000	0.37717	0.476000	0.27291	0.091000	0.18340	2.248000	0.43160	-0.101000	0.12219	-0.397000	0.06425	CGG		0.527	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
ABCC2	1244	hgsc.bcm.edu	37	10	101601801	101601801	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:101601801A>G	ENST00000370449.4	+	26	3805	c.3692A>G	c.(3691-3693)gAt>gGt	p.D1231G		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1231	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.D1231G(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ATTTATAGAGATACCCTAAGT	0.453																																					p.D1231G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3692G	10						.						247.0	225.0	233.0					10																	101601801		2203	4300	6503	101591791	SO:0001583	missense	1244	exon26			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3692A>G	10.37:g.101601801A>G	ENSP00000359478:p.Asp1231Gly	Somatic		Capture	SOLID	Phase_I	101591791	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	A	2.808	-0.247598	0.05867	.	.	ENSG00000023839	ENST00000370449	D	0.90133	-2.62	6.16	-0.689	0.11313	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.972957	0.08519	N	0.933791	T	0.78155	0.4239	N	0.17248	0.465	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.61043	-0.7142	10	0.28530	T	0.3	-2.0861	0.4351	0.00478	0.3918:0.2195:0.1769:0.2118	.	1231	Q92887	MRP2_HUMAN	G	1231	ENSP00000359478:D1231G	ENSP00000359478:D1231G	D	+	2	0	ABCC2	101591791	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.644000	0.24766	-0.355000	0.08199	0.528000	0.53228	GAT		0.453	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
DNMBP	23268	hgsc.bcm.edu	37	10	101715038	101715038	+	Silent	SNP	G	G	A	rs191661557		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:101715038G>A	ENST00000324109.4	-	4	2284	c.2193C>T	c.(2191-2193)acC>acT	p.T731T	DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Silent_p.T731T	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	731					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GATCCTCGAGGGTCTCTGCTC	0.418																																					p.T731T												.	.	0			c.C2193T	10						.						124.0	115.0	118.0					10																	101715038		2203	4300	6503	101705028	SO:0001819	synonymous_variant	23268	exon4			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.2193C>T	10.37:g.101715038G>A		Somatic		Capture	SOLID	Phase_I	101705028	NM_015221	Q8IVY3|Q9Y2L3	Silent	SNP	ENST00000324109.4	37	CCDS7485.1																																																																																				0.418	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
COL17A1	1308	hgsc.bcm.edu	37	10	105798223	105798223	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:105798223G>A	ENST00000353479.5	-	45	3301	c.3011C>T	c.(3010-3012)cCg>cTg	p.P1004L	COL17A1_ENST00000369733.3_Missense_Mutation_p.P959L	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1004	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P1004L(2)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GATAGAGCCCGGAGGCCCAGG	0.607																																					p.P1004L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3011T	10						.						90.0	100.0	97.0					10																	105798223		2199	4293	6492	105788213	SO:0001583	missense	1308	exon45			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3011C>T	10.37:g.105798223G>A	ENSP00000340937:p.Pro1004Leu	Somatic		Capture	SOLID	Phase_I	105788213	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901321	0.52227	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.96136	-3.92;-2.94	4.81	4.81	0.61882	.	0.000000	0.43579	D	0.000547	D	0.97688	0.9242	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98208	1.0471	10	0.59425	D	0.04	-2.5077	14.8213	0.70074	0.0:0.0:1.0:0.0	.	1004	Q9UMD9	COHA1_HUMAN	L	1004;959	ENSP00000340937:P1004L;ENSP00000358748:P959L	ENSP00000340937:P1004L	P	-	2	0	COL17A1	105788213	1.000000	0.71417	0.933000	0.37362	0.112000	0.19704	3.846000	0.55888	2.222000	0.72286	0.462000	0.41574	CCG		0.607	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
SORCS1	114815	hgsc.bcm.edu	37	10	108923852	108923852	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:108923852G>A	ENST00000263054.6	-	1	440	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	SORCS1_ENST00000344440.6_Missense_Mutation_p.R145W	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	145					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.R145W(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TCCGGGTCCCGCTCCCGAGTC	0.657																																					p.R145W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C433T	10						.						46.0	47.0	47.0					10																	108923852		2202	4299	6501	108913842	SO:0001583	missense	114815	exon1			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.433C>T	10.37:g.108923852G>A	ENSP00000263054:p.Arg145Trp	Somatic		Capture	SOLID	Phase_I	108913842	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452470	0.63290	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.18174	2.23;2.25	3.95	0.941	0.19519	.	0.695840	0.13373	N	0.392728	T	0.15478	0.0373	N	0.24115	0.695	0.30349	N	0.78494	D;D;P;D;P	0.62365	0.976;0.986;0.949;0.991;0.949	P;P;P;P;P	0.52957	0.522;0.714;0.714;0.617;0.714	T	0.16217	-1.0410	9	.	.	.	-8.9356	6.3871	0.21566	0.0885:0.0:0.4516:0.4599	.	145;145;145;145;145	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	W	145	ENSP00000263054:R145W;ENSP00000345964:R145W	.	R	-	1	2	SORCS1	108913842	0.990000	0.36364	0.938000	0.37757	0.939000	0.58152	1.322000	0.33689	0.200000	0.20447	0.655000	0.94253	CGG		0.657	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
ABLIM1	3983	hgsc.bcm.edu	37	10	116444096	116444096	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:116444096T>C	ENST00000369252.4	-	1	318	c.17A>G	c.(16-18)gAa>gGa	p.E6G	ABLIM1_ENST00000533213.2_Missense_Mutation_p.E6G	NM_001003407.1|NM_001003408.1	NP_001003407.1|NP_001003408.1	O14639	ABLM1_HUMAN	actin binding LIM protein 1	0					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.E6G(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		CTCAGTCATTTCCAAGGTCAT	0.488																																					p.E6G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A17G	10						.						199.0	159.0	173.0					10																	116444096		2203	4300	6503	116434086	SO:0001583	missense	3983	exon1			AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000369252.4:c.17A>G	10.37:g.116444096T>C	ENSP00000358256:p.Glu6Gly	Somatic		Capture	SOLID	Phase_I	116434086	NM_001003407	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000369252.4	37	CCDS31288.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081008	0.76528	.	.	ENSG00000099204	ENST00000369252;ENST00000369267;ENST00000533213	T;T	0.27104	1.69;1.69	5.45	-9.21	0.00678	.	.	.	.	.	T	0.09512	0.0234	N	0.08118	0	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37865	-0.9687	9	0.66056	D	0.02	.	4.948	0.14000	0.0997:0.3182:0.4356:0.1465	.	6;6	F8W8M4;A6NKJ2	.;.	G	6	ENSP00000358256:E6G;ENSP00000433629:E6G	ENSP00000358256:E6G	E	-	2	0	ABLIM1	116434086	0.000000	0.05858	0.000000	0.03702	0.947000	0.59692	-0.359000	0.07632	-1.618000	0.01568	-0.331000	0.08364	GAA		0.488	ABLIM1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
GFRA1	2674	hgsc.bcm.edu	37	10	118029036	118029036	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:118029036G>A	ENST00000355422.6	-	4	947	c.397C>T	c.(397-399)Cgg>Tgg	p.R133W	GFRA1_ENST00000369236.1_Missense_Mutation_p.R133W|GFRA1_ENST00000490345.1_5'Flank|GFRA1_ENST00000439649.3_Missense_Mutation_p.R133W	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	133					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.R133W(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		GGGACCACCCGGAATATATCT	0.413																																					p.R133W	Ovarian(128;329 1725 45498 46808 50759)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C397T	10						.						162.0	143.0	150.0					10																	118029036		2203	4300	6503	118019026	SO:0001583	missense	2674	exon4			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.397C>T	10.37:g.118029036G>A	ENSP00000347591:p.Arg133Trp	Somatic		Capture	SOLID	Phase_I	118019026	NM_001145453	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797787	0.70567	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000369234	T;T;T;T	0.36520	1.27;1.27;1.25;1.25	5.69	5.69	0.88448	.	0.192811	0.42548	D	0.000691	T	0.53948	0.1828	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68765	0.936;0.96	T	0.52786	-0.8529	10	0.56958	D	0.05	-17.0693	12.8336	0.57761	0.0:0.0:0.7284:0.2716	.	133;133	P56159;P56159-2	GFRA1_HUMAN;.	W	133	ENSP00000393725:R133W;ENSP00000358239:R133W;ENSP00000347591:R133W;ENSP00000358237:R133W	ENSP00000347591:R133W	R	-	1	2	GFRA1	118019026	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.489000	0.60309	2.696000	0.92011	0.655000	0.94253	CGG		0.413	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
C10orf88	80007	hgsc.bcm.edu	37	10	124708277	124708277	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:124708277G>C	ENST00000481909.1	-	4	760	c.536C>G	c.(535-537)gCt>gGt	p.A179G	C10orf88_ENST00000368891.5_5'UTR	NM_024942.3	NP_079218.2	Q9H8K7	CJ088_HUMAN	chromosome 10 open reading frame 88	179								p.A179G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)	18		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		TGATCCTAGAGCAGGAGAGCT	0.438																																					p.A179G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C536G	10						.						121.0	111.0	115.0					10																	124708277		2203	4300	6503	124698267	SO:0001583	missense	80007	exon4			AK023552	CCDS7632.1	10q26.13	2012-11-09			ENSG00000119965	ENSG00000119965			25822	protein-coding gene	gene with protein product						12477932	Standard	NM_024942		Approved	FLJ13490, Em:AC073585.5	uc001lgw.2	Q9H8K7	OTTHUMG00000019190	ENST00000481909.1:c.536C>G	10.37:g.124708277G>C	ENSP00000419126:p.Ala179Gly	Somatic		Capture	SOLID	Phase_I	124698267	NM_024942	Q0P6C6|Q8N597	Missense_Mutation	SNP	ENST00000481909.1	37	CCDS7632.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232994	0.58777	.	.	ENSG00000119965	ENST00000481909	.	.	.	4.33	4.33	0.51752	.	0.502145	0.18267	U	0.146453	T	0.44393	0.1291	L	0.59436	1.845	0.27044	N	0.963938	P	0.49559	0.925	P	0.47162	0.54	T	0.37056	-0.9722	9	0.39692	T	0.17	.	10.8906	0.46994	0.0887:0.0:0.9113:0.0	.	179	Q9H8K7	CJ088_HUMAN	G	179	.	ENSP00000419126:A179G	A	-	2	0	C10orf88	124698267	1.000000	0.71417	0.510000	0.27712	0.962000	0.63368	1.971000	0.40530	2.111000	0.64477	0.440000	0.28878	GCT		0.438	C10orf88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050807.1	NM_024942	
DIP2C	22982	hgsc.bcm.edu	37	10	445104	445104	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:445104C>T	ENST00000280886.6	-	10	1292	c.1205G>A	c.(1204-1206)gGc>gAc	p.G402D	DIP2C_ENST00000381496.3_Missense_Mutation_p.G295D	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	402						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.G402D(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CAGCAGGCAGCCGTAGAAAGC	0.627																																					p.G402D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1205A	10						.						71.0	63.0	65.0					10																	445104		2203	4300	6503	435104	SO:0001583	missense	22982	exon10			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.1205G>A	10.37:g.445104C>T	ENSP00000280886:p.Gly402Asp	Somatic		Capture	SOLID	Phase_I	435104	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	c	21.4	4.139449	0.77775	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	T;T	0.15718	2.4;2.4	5.58	5.58	0.84498	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.50514	0.1620	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.57300	-0.7835	10	0.87932	D	0	-28.6791	19.1746	0.93599	0.0:1.0:0.0:0.0	.	295;402	E7EPU2;Q9Y2E4	.;DIP2C_HUMAN	D	402;295	ENSP00000280886:G402D;ENSP00000370907:G295D	ENSP00000280886:G402D	G	-	2	0	DIP2C	435104	1.000000	0.71417	0.997000	0.53966	0.066000	0.16364	7.570000	0.82390	2.623000	0.88846	0.558000	0.71614	GGC		0.627	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
OLAH	55301	hgsc.bcm.edu	37	10	15098973	15098973	+	Intron	DEL	T	T	-			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:15098973delT	ENST00000378228.3	+	4	417				OLAH_ENST00000378217.3_Frame_Shift_Del_p.I105fs	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase						fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)	p.F107fs*5(1)		endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						tggattctaattttttttagt	0.423																																					p.I105fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.314delT	10						.		,	1,2937		0,1,1468	277.0	279.0	279.0		,	-0.9	0.0	10		277	0,5098		0,0,2549	no	frameshift,intron	OLAH	NM_018324.2,NM_001039702.2	,	0,1,4017	A1A1,A1R,RR		0.0,0.034,0.0124	,	,	15098973	1,8035	1327	2309	3636	15138979	SO:0001627	intron_variant	55301	exon4			AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.164-4750T>-	10.37:g.15098973delT		Somatic		Capture	SOLID	Phase_I	15138979	NM_018324	Q5VUB6|Q9NUW1	Frame_Shift_Del	DEL	ENST00000378228.3	37	CCDS31152.1																																																																																				0.423	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046964.1	NM_018324	
FAM171A1	221061	hgsc.bcm.edu	37	10	15290672	15290672	+	Silent	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:15290672G>T	ENST00000378116.4	-	5	726	c.720C>A	c.(718-720)gcC>gcA	p.A240A	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	240						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A240A(1)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CCGCGACATAGGCATTGTGCC	0.567																																					p.A240A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C720A	10						.						88.0	79.0	82.0					10																	15290672		2203	4300	6503	15330678	SO:0001819	synonymous_variant	221061	exon5			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.720C>A	10.37:g.15290672G>T		Somatic		Capture	SOLID	Phase_I	15330678	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	CCDS31154.1																																																																																				0.567	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
SVIL	6840	hgsc.bcm.edu	37	10	29813448	29813448	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:29813448T>C	ENST00000355867.4	-	14	3291	c.2539A>G	c.(2539-2541)Aac>Gac	p.N847D	SVIL_ENST00000375398.2_Missense_Mutation_p.N847D|SVIL_ENST00000535393.1_5'Flank|SVIL_ENST00000375400.3_Missense_Mutation_p.N421D	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	847					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.N847D(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TAGCGAGCGTTCATTCTCCTC	0.468																																					p.N421D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1261G	10						.						186.0	167.0	173.0					10																	29813448		2203	4300	6503	29853454	SO:0001583	missense	6840	exon12			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2539A>G	10.37:g.29813448T>C	ENSP00000348128:p.Asn847Asp	Somatic		Capture	SOLID	Phase_I	29853454	NM_003174	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.473939	0.84640	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.54866	0.55;0.55;0.55	5.82	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.70798	0.3265	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.971	T	0.71738	-0.4502	9	.	.	.	-24.0088	13.1098	0.59267	0.0:0.0:0.1339:0.8661	.	421;847	O95425-2;O95425	.;SVIL_HUMAN	D	421;847;847	ENSP00000364549:N421D;ENSP00000364547:N847D;ENSP00000348128:N847D	.	N	-	1	0	SVIL	29853454	1.000000	0.71417	0.944000	0.38274	0.879000	0.50718	7.603000	0.82811	1.009000	0.39289	0.459000	0.35465	AAC		0.468	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
ZEB1	6935	hgsc.bcm.edu	37	10	31809331	31809331	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:31809331A>C	ENST00000320985.10	+	7	1178	c.1068A>C	c.(1066-1068)aaA>aaC	p.K356N	ZEB1_ENST00000446923.2_Missense_Mutation_p.K340N|ZEB1_ENST00000560721.2_Missense_Mutation_p.K336N|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000361642.5_Missense_Mutation_p.K357N|ZEB1_ENST00000542815.3_Missense_Mutation_p.K289N			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	356					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.K356N(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				ATGAATTCAAACCCATAGTGG	0.433																																					p.K336N	Ovarian(40;423 959 14296 36701 49589)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1008C	10						.						66.0	71.0	69.0					10																	31809331		2203	4300	6503	31849337	SO:0001583	missense	6935	exon6			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1068A>C	10.37:g.31809331A>C	ENSP00000319248:p.Lys356Asn	Somatic		Capture	SOLID	Phase_I	31849337	NM_001174093	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	A	16.87	3.242328	0.58995	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.16196	2.69;2.37;2.43;2.36;2.41	5.62	0.576	0.17380	.	0.000000	0.64402	D	0.000003	T	0.34106	0.0886	M	0.72894	2.215	0.58432	D	0.999997	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999;1.0;0.999;0.999	D;D;D;D;D;D;D;D	0.97110	1.0;0.981;0.957;0.957;0.961;0.987;0.961;0.957	T	0.02251	-1.1188	10	0.42905	T	0.14	-28.2115	8.6342	0.33936	0.3634:0.0:0.6366:0.0	.	289;356;340;356;356;336;357;356	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	N	138;356;357;356;289;356;336;215;247;340	ENSP00000444282:K138N;ENSP00000354487:K357N;ENSP00000444891:K289N;ENSP00000319248:K356N;ENSP00000391612:K340N	ENSP00000319248:K356N	K	+	3	2	ZEB1	31849337	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.513000	0.35823	0.098000	0.17522	0.533000	0.62120	AAA		0.433	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
ITGB1	3688	hgsc.bcm.edu	37	10	33200929	33200929	+	Silent	SNP	G	G	A	rs149055349		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:33200929G>A	ENST00000396033.2	-	12	1728	c.1593C>T	c.(1591-1593)tgC>tgT	p.C531C	ITGB1_ENST00000423113.1_Silent_p.C531C|ITGB1_ENST00000374956.4_Silent_p.C531C|ITGB1_ENST00000302278.3_Silent_p.C531C	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	531	Cysteine-rich tandem repeats.				axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)	p.C531C(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	GTCCGCAGACGCACTCTCCAT	0.398																																					p.C531C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1593T	10						.	G	,,	0,4406		0,0,2203	188.0	160.0	170.0		1593,1593,1593	-0.9	1.0	10	dbSNP_134	170	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ITGB1	NM_002211.3,NM_033668.2,NM_133376.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	531/799,531/802,531/799	33200929	1,13005	2203	4300	6503	33240935	SO:0001819	synonymous_variant	3688	exon12			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.1593C>T	10.37:g.33200929G>A		Somatic		Capture	SOLID	Phase_I	33240935	NM_133376	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Silent	SNP	ENST00000396033.2	37	CCDS7174.1																																																																																				0.398	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211	
SLC18A3	6572	hgsc.bcm.edu	37	10	50820194	50820194	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:50820194C>T	ENST00000374115.3	+	1	1848	c.1408C>T	c.(1408-1410)Cgc>Tgc	p.R470C	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000455728.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	470					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.R470C(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						GCTGCTGCTCCGCAACGTGGG	0.637																																					p.R470C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1408T	10						.						70.0	51.0	57.0					10																	50820194		2203	4300	6503	50490200	SO:0001583	missense	6572	exon1			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1408C>T	10.37:g.50820194C>T	ENSP00000363229:p.Arg470Cys	Somatic		Capture	SOLID	Phase_I	50490200	NM_003055	B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.409231	0.42715	.	.	ENSG00000187714	ENST00000374115	D	0.81908	-1.55	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.165679	0.38436	U	0.001684	D	0.91023	0.7176	M	0.86178	2.8	0.58432	D	0.999993	D	0.89917	1.0	D	0.72338	0.977	D	0.92167	0.5740	10	0.87932	D	0	-18.2522	12.7483	0.57293	0.2771:0.7229:0.0:0.0	.	470	Q16572	VACHT_HUMAN	C	470	ENSP00000363229:R470C	ENSP00000363229:R470C	R	+	1	0	SLC18A3	50490200	1.000000	0.71417	1.000000	0.80357	0.251000	0.25915	2.695000	0.47043	2.380000	0.81148	0.561000	0.74099	CGC		0.637	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055	
HERC4	26091	hgsc.bcm.edu	37	10	69750115	69750115	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:69750115T>C	ENST00000395198.3	-	14	1733	c.1486A>G	c.(1486-1488)Agc>Ggc	p.S496G	HERC4_ENST00000277817.6_Missense_Mutation_p.S386G|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000373700.4_Missense_Mutation_p.S496G|HERC4_ENST00000412272.2_Missense_Mutation_p.S496G	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	496					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S496G(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						GGTAAGGAGCTAGTCAGTTTA	0.343																																					p.S496G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1486G	10						.						86.0	81.0	82.0					10																	69750115		2203	4300	6503	69420121	SO:0001583	missense	26091	exon14			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1486A>G	10.37:g.69750115T>C	ENSP00000378624:p.Ser496Gly	Somatic		Capture	SOLID	Phase_I	69420121	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.023698	0.54683	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.48522	1.06;0.81;0.81;0.81	5.74	4.61	0.57282	.	0.202987	0.64402	N	0.000012	T	0.49592	0.1566	M	0.76002	2.32	0.80722	D	1	P;B;B;B;B;B	0.47106	0.89;0.321;0.241;0.215;0.321;0.215	B;B;B;B;B;B	0.43413	0.419;0.205;0.147;0.101;0.205;0.101	T	0.48433	-0.9036	10	0.30854	T	0.27	.	11.662	0.51352	0.0:0.0692:0.0:0.9308	.	496;386;496;346;496;496	Q5GLZ8-3;Q5GLZ8-6;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;.;HERC4_HUMAN	G	386;496;496;496	ENSP00000277817:S386G;ENSP00000416504:S496G;ENSP00000378624:S496G;ENSP00000362804:S496G	ENSP00000277817:S386G	S	-	1	0	HERC4	69420121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.818000	0.48041	1.009000	0.39289	0.482000	0.46254	AGC		0.343	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
CDHR1	92211	hgsc.bcm.edu	37	10	85965587	85965587	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:85965587C>T	ENST00000372117.3	+	10	970	c.867C>T	c.(865-867)aaC>aaT	p.N289N	CDHR1_ENST00000440770.2_Silent_p.N48N|CDHR1_ENST00000332904.3_Silent_p.N289N	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)	p.N289N(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						TGACAGGGAACGATGGAGCCT	0.562											OREG0020333	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N289N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C867T	10						.						70.0	66.0	67.0					10																	85965587		2203	4300	6503	85955567	SO:0001819	synonymous_variant	92211	exon10			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.867C>T	10.37:g.85965587C>T		Somatic	1240	Capture	SOLID	Phase_I	85955567	NM_001171971	Q69YZ8|Q8IXY5	Silent	SNP	ENST00000372117.3	37	CCDS7372.1																																																																																				0.562	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
KIF20B	9585	hgsc.bcm.edu	37	10	91469105	91469105	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:91469105T>C	ENST00000371728.3	+	4	303	c.238T>C	c.(238-240)Tgt>Cgt	p.C80R	KIF20B_ENST00000260753.4_Missense_Mutation_p.C80R|KIF20B_ENST00000416354.1_Missense_Mutation_p.C80R|KIF20B_ENST00000394289.2_Missense_Mutation_p.C80R	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	80	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.C80R(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TTTCTAGGGCTGTGTGCATAT	0.353																																					p.C80R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T238C	10						.						120.0	120.0	120.0					10																	91469105		2203	4300	6503	91459085	SO:0001583	missense	9585	exon4			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.238T>C	10.37:g.91469105T>C	ENSP00000360793:p.Cys80Arg	Somatic		Capture	SOLID	Phase_I	91459085	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	T	21.3	4.122212	0.77436	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728;ENST00000439656;ENST00000447580	T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;2.29	5.26	5.26	0.73747	Kinesin, motor domain (4);	0.000000	0.52532	D	0.000076	D	0.83468	0.5261	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.999;0.958	D;D	0.81914	0.995;0.929	D	0.85822	0.1386	10	0.87932	D	0	-9.8125	15.4672	0.75409	0.0:0.0:0.0:1.0	.	80;80	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	R	80	ENSP00000260753:C80R;ENSP00000411545:C80R;ENSP00000377830:C80R;ENSP00000360793:C80R;ENSP00000390946:C80R	ENSP00000260753:C80R	C	+	1	0	KIF20B	91459085	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.613000	0.74192	2.104000	0.64026	0.533000	0.62120	TGT		0.353	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
TLL2	7093	hgsc.bcm.edu	37	10	98173023	98173023	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:98173023C>A	ENST00000357947.3	-	8	1199	c.974G>T	c.(973-975)aGg>aTg	p.R325M	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	325	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R325M(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AATGGTTGGCCTGACGCCATT	0.527																																					p.R325M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G974T	10						.						67.0	61.0	63.0					10																	98173023		2203	4300	6503	98163013	SO:0001583	missense	7093	exon8			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.974G>T	10.37:g.98173023C>A	ENSP00000350630:p.Arg325Met	Somatic		Capture	SOLID	Phase_I	98163013	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	C	30	5.056293	0.93793	.	.	ENSG00000095587	ENST00000357947	T	0.64085	-0.08	5.28	5.28	0.74379	Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.000000	0.47093	D	0.000252	T	0.75852	0.3906	L	0.55103	1.725	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.76198	-0.3047	10	0.51188	T	0.08	.	17.9	0.88900	0.0:1.0:0.0:0.0	.	325	Q9Y6L7	TLL2_HUMAN	M	325	ENSP00000350630:R325M	ENSP00000350630:R325M	R	-	2	0	TLL2	98163013	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.783000	0.85696	2.478000	0.83669	0.455000	0.32223	AGG		0.527	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
CTBP2	1488	hgsc.bcm.edu	37	10	126715930	126715930	+	Intron	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr10:126715930G>A	ENST00000337195.5	-	3	458				CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Silent_p.S133S|CTBP2_ENST00000531469.1_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)	p.S133S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		GGACCGGCCGGCTGACTCCTG	0.652																																					p.S133S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C399T	10						.						44.0	47.0	46.0					10																	126715930		2203	4300	6503	126705920	SO:0001627	intron_variant	1488	exon1			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+11635C>T	10.37:g.126715930G>A		Somatic		Capture	SOLID	Phase_I	126705920	NM_022802	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	ENST00000337195.5	37	CCDS7643.1																																																																																				0.652	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
SLCO6A1	133482	hgsc.bcm.edu	37	5	101748828	101748828	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:101748828G>T	ENST00000506729.1	-	9	1663	c.1492C>A	c.(1492-1494)Ctc>Atc	p.L498I	SLCO6A1_ENST00000379807.3_Missense_Mutation_p.L498I|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.L245I|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.L245I|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.L436I			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	498	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.L498I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GGAGCCGTGAGGTTTCCCAAC	0.338																																					p.L498I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1492A	5						.						43.0	44.0	44.0					5																	101748828		2203	4294	6497	101776727	SO:0001583	missense	133482	exon9			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1492C>A	5.37:g.101748828G>T	ENSP00000421339:p.Leu498Ile	Somatic		Capture	SOLID	Phase_I	101776727	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	G	10.64	1.406666	0.25378	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11	5.25	2.39	0.29439	Major facilitator superfamily domain, general substrate transporter (1);	0.143577	0.30556	N	0.009367	T	0.72558	0.3475	M	0.79123	2.44	0.09310	N	0.999997	D;D;D	0.76494	0.999;0.977;0.999	D;D;D	0.67900	0.922;0.941;0.954	T	0.59799	-0.7386	10	0.51188	T	0.08	.	6.2457	0.20815	0.1674:0.0:0.6811:0.1515	.	436;245;498	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	I	498;498;436;245;245	ENSP00000421339:L498I;ENSP00000369135:L498I;ENSP00000373671:L436I;ENSP00000421990:L245I;ENSP00000369138:L245I	ENSP00000369135:L498I	L	-	1	0	SLCO6A1	101776727	0.996000	0.38824	0.697000	0.30258	0.087000	0.18053	0.975000	0.29449	1.436000	0.47453	0.655000	0.94253	CTC		0.338	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
GDF9	2661	hgsc.bcm.edu	37	5	132197722	132197722	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:132197722C>G	ENST00000378673.2	-	3	1790	c.924G>C	c.(922-924)gaG>gaC	p.E308D	GDF9_ENST00000296875.2_Missense_Mutation_p.E308D|GDF9_ENST00000464378.1_5'Flank			O60383	GDF9_HUMAN	growth differentiation factor 9	308					female gamete generation (GO:0007292)|negative regulation of cell growth (GO:0030308)|oocyte growth (GO:0001555)|positive regulation of cell proliferation (GO:0008284)|regulation of progesterone secretion (GO:2000870)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.E308D(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	22		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATCTCCCATCCTCAGCAGCCT	0.522																																					p.E308D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G924C	5						.						49.0	50.0	50.0					5																	132197722		2203	4300	6503	132225621	SO:0001583	missense	2661	exon2				CCDS4162.1, CCDS75299.1	5q31.1	2014-01-30			ENSG00000164404	ENSG00000164404		"""Endogenous ligands"""	4224	protein-coding gene	gene with protein product		601918				7760846	Standard	NM_005260		Approved		uc003kxz.1	O60383	OTTHUMG00000059842	ENST00000378673.2:c.924G>C	5.37:g.132197722C>G	ENSP00000367942:p.Glu308Asp	Somatic		Capture	SOLID	Phase_I	132225621	NM_005260	Q4VAW5	Missense_Mutation	SNP	ENST00000378673.2	37	CCDS4162.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322592	0.41096	.	.	ENSG00000164404	ENST00000378673;ENST00000296875	T;T	0.80738	-1.41;-1.41	5.6	2.87	0.33458	.	1.155570	0.06144	N	0.672900	T	0.75686	0.3883	M	0.76574	2.34	0.09310	N	1	P	0.41041	0.736	B	0.33196	0.159	T	0.59418	-0.7458	10	0.25751	T	0.34	.	5.4692	0.16660	0.0:0.5778:0.1371:0.2851	.	308	O60383	GDF9_HUMAN	D	308	ENSP00000367942:E308D;ENSP00000296875:E308D	ENSP00000296875:E308D	E	-	3	2	GDF9	132225621	0.002000	0.14202	0.000000	0.03702	0.374000	0.29953	1.308000	0.33528	0.476000	0.27440	0.644000	0.83932	GAG		0.522	GDF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133060.2	NM_005260	
JADE2	23338	hgsc.bcm.edu	37	5	133914580	133914580	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:133914580G>A	ENST00000282605.4	+	12	2164	c.2078G>A	c.(2077-2079)cGt>cAt	p.R693H	PHF15_ENST00000395003.1_Missense_Mutation_p.R649H|PHF15_ENST00000361895.2_Missense_Mutation_p.R650H|PHF15_ENST00000402835.1_3'UTR														p.R649H(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGCCACCACGTCGGACATCT	0.662																																					p.R649H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1946A	5						.						69.0	79.0	75.0					5																	133914580		2203	4300	6503	133942479	SO:0001583	missense	23338	exon11																														ENST00000282605.4:c.2078G>A	5.37:g.133914580G>A	ENSP00000282605:p.Arg693His	Somatic		Capture	SOLID	Phase_I	133942479	NM_015288		Missense_Mutation	SNP	ENST00000282605.4	37		.	.	.	.	.	.	.	.	.	.	G	11.08	1.532191	0.27387	.	.	ENSG00000043143	ENST00000413974;ENST00000448712;ENST00000282605;ENST00000361895;ENST00000432594;ENST00000395003	T;T;T	0.49139	0.86;0.79;0.79	5.16	4.08	0.47627	.	0.762586	0.11394	N	0.568524	T	0.27063	0.0663	N	0.08118	0	0.09310	N	1	P;P;D	0.56287	0.928;0.928;0.975	B;B;B	0.39027	0.288;0.288;0.288	T	0.04115	-1.0976	10	0.37606	T	0.19	.	12.3806	0.55305	0.1334:0.0:0.8666:0.0	.	649;650;709	Q9NQC1;D3DQA3;B3KPL2	JADE2_HUMAN;.;.	H	652;709;693;650;650;649	ENSP00000282605:R693H;ENSP00000354425:R650H;ENSP00000378451:R649H	ENSP00000282605:R693H	R	+	2	0	PHF15	133942479	0.362000	0.24980	1.000000	0.80357	0.422000	0.31414	0.909000	0.28558	2.417000	0.82017	0.313000	0.20887	CGT		0.662	PHF15-003	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251170.1		
PCDHAC1	56135	hgsc.bcm.edu	37	5	140307836	140307836	+	Silent	SNP	C	C	T	rs267600404		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:140307836C>T	ENST00000253807.2	+	1	1359	c.1359C>T	c.(1357-1359)ttC>ttT	p.F453F	PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHAC1_ENST00000409700.3_Silent_p.F453F|PCDHA13_ENST00000409494.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	453	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.F453F(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAACTTTTCGTTGCTGAAA	0.532																																					p.F453F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1359T	5						.	C	,,,,,,,,,,,,,,,,,	0,4406		0,0,2203	65.0	70.0	69.0		1359,,,,,,,,,,,,,,,,,1359	0.1	1.0	5		69	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding-synonymous	PCDHA9,PCDHAC1,PCDHA13,PCDHA12,PCDHA11,PCDHA10,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018898.3,NM_018900.2,NM_018901.2,NM_018902.3,NM_018903.2,NM_018904.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1,NM_031860.1,NM_031882.2	,,,,,,,,,,,,,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,,,,,,,,,,,,	453/964,,,,,,,,,,,,,,,,,453/819	140307836	1,13005	2203	4300	6503	140288020	SO:0001819	synonymous_variant	56135	exon1			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1359C>T	5.37:g.140307836C>T		Somatic		Capture	SOLID	Phase_I	140288020	NM_031882	Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	37	CCDS4241.1																																																																																				0.532	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
ARAP3	64411	hgsc.bcm.edu	37	5	141041612	141041612	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:141041612G>A	ENST00000239440.4	-	20	3076	c.3011C>T	c.(3010-3012)gCt>gTt	p.A1004V	ARAP3_ENST00000513878.1_Missense_Mutation_p.A666V|ARAP3_ENST00000508305.1_Intron|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1004	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.A1004V(1)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						AGGAATACCAGCAGCCTCCCT	0.577																																					p.A1004V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3011T	5						.						81.0	74.0	76.0					5																	141041612		2203	4300	6503	141021796	SO:0001583	missense	64411	exon20			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3011C>T	5.37:g.141041612G>A	ENSP00000239440:p.Ala1004Val	Somatic		Capture	SOLID	Phase_I	141021796	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712968	0.89112	.	.	ENSG00000120318	ENST00000239440;ENST00000513878	T;T	0.11821	2.74;2.74	5.55	5.55	0.83447	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.32556	0.0833	L	0.46947	1.48	0.58432	D	0.999993	D;D	0.71674	0.993;0.998	D;D	0.70227	0.963;0.968	T	0.00239	-1.1888	10	0.51188	T	0.08	.	19.2909	0.94098	0.0:0.0:1.0:0.0	.	666;1004	B4DIT1;Q8WWN8	.;ARAP3_HUMAN	V	1004;666	ENSP00000239440:A1004V;ENSP00000421468:A666V	ENSP00000239440:A1004V	A	-	2	0	ARAP3	141021796	1.000000	0.71417	0.989000	0.46669	0.882000	0.50991	6.067000	0.71193	2.894000	0.99253	0.655000	0.94253	GCT		0.577	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
TCERG1	10915	hgsc.bcm.edu	37	5	145849285	145849285	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:145849285A>C	ENST00000296702.5	+	7	1415	c.1377A>C	c.(1375-1377)aaA>aaC	p.K459N	TCERG1_ENST00000394421.2_Missense_Mutation_p.K438N	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	459	Glu-rich.|WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.K459N(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTGGGAAAAACCCCAAGAAC	0.313																																					p.K438N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1314C	5						.						48.0	57.0	54.0					5																	145849285		2198	4294	6492	145829478	SO:0001583	missense	10915	exon6			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.1377A>C	5.37:g.145849285A>C	ENSP00000296702:p.Lys459Asn	Somatic		Capture	SOLID	Phase_I	145829478	NM_001040006	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	37	CCDS4282.1	.	.	.	.	.	.	.	.	.	.	A	15.63	2.890183	0.52014	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	D;D	0.84589	-1.87;-1.87	5.71	0.728	0.18260	WW/Rsp5/WWP (6);	0.047502	0.85682	D	0.000000	D	0.90116	0.6912	M	0.79475	2.455	0.58432	D	0.999999	D;P;P	0.67145	0.996;0.939;0.951	D;P;P	0.67382	0.951;0.484;0.619	D	0.88708	0.3220	10	0.87932	D	0	-21.9042	10.9413	0.47275	0.5937:0.0:0.4063:0.0	.	438;438;459	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	N	459;438	ENSP00000296702:K459N;ENSP00000377943:K438N	ENSP00000296702:K459N	K	+	3	2	TCERG1	145829478	0.970000	0.33590	0.998000	0.56505	0.996000	0.88848	0.298000	0.19120	-0.086000	0.12550	0.460000	0.39030	AAA		0.313	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
NDST1	3340	hgsc.bcm.edu	37	5	149918889	149918889	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:149918889G>A	ENST00000261797.6	+	7	2039	c.1537G>A	c.(1537-1539)Gag>Aag	p.E513K	NDST1_ENST00000523767.1_Missense_Mutation_p.E513K	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	513	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.E513K(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAACGGGGGCGAGCTCTTCCT	0.607																																					p.E513K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1537A	5						.						171.0	162.0	165.0					5																	149918889		2203	4300	6503	149899082	SO:0001583	missense	3340	exon7			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1537G>A	5.37:g.149918889G>A	ENSP00000261797:p.Glu513Lys	Somatic		Capture	SOLID	Phase_I	149899082	NM_001543	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	G	36	5.914692	0.97099	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;T	0.55588	0.51;0.85	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.79341	0.4429	M	0.90483	3.12	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.986	T	0.83013	-0.0171	10	0.87932	D	0	.	19.7859	0.96437	0.0:0.0:1.0:0.0	.	513;513;513	E7EVJ3;P52848-2;P52848	.;.;NDST1_HUMAN	K	513	ENSP00000428604:E513K;ENSP00000261797:E513K	ENSP00000261797:E513K	E	+	1	0	NDST1	149899082	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.751000	0.98889	2.746000	0.94184	0.655000	0.94253	GAG		0.607	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543	
SLC36A3	285641	hgsc.bcm.edu	37	5	150678160	150678160	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:150678160G>A	ENST00000335230.3	-	2	624	c.213C>T	c.(211-213)ggC>ggT	p.G71G	SLC36A3_ENST00000377713.3_Silent_p.G71G	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	71						integral component of membrane (GO:0016021)		p.G71G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTACCAACAAGCCGGCATTCT	0.507																																					p.G71G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C213T	5						.						88.0	75.0	79.0					5																	150678160		2203	4300	6503	150658353	SO:0001819	synonymous_variant	285641	exon2			AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.213C>T	5.37:g.150678160G>A		Somatic		Capture	SOLID	Phase_I	150658353	NM_181774	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Silent	SNP	ENST00000335230.3	37	CCDS4314.1																																																																																				0.507	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
FAT2	2196	hgsc.bcm.edu	37	5	150922305	150922305	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:150922305G>A	ENST00000261800.5	-	9	8395	c.8383C>T	c.(8383-8385)Cct>Tct	p.P2795S		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2795	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2795S(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCAAATACAGGCCTATTGTCA	0.478																																					p.P2795S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8383T	5						.						159.0	147.0	151.0					5																	150922305		2203	4300	6503	150902498	SO:0001583	missense	2196	exon9			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8383C>T	5.37:g.150922305G>A	ENSP00000261800:p.Pro2795Ser	Somatic		Capture	SOLID	Phase_I	150902498	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694530	0.68386	.	.	ENSG00000086570	ENST00000261800	T	0.81415	-1.49	5.64	5.64	0.86602	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.64402	D	0.000007	D	0.94978	0.8375	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97025	0.9746	10	0.87932	D	0	.	19.7115	0.96098	0.0:0.0:1.0:0.0	.	2795	Q9NYQ8	FAT2_HUMAN	S	2795	ENSP00000261800:P2795S	ENSP00000261800:P2795S	P	-	1	0	FAT2	150902498	1.000000	0.71417	0.877000	0.34402	0.910000	0.53928	9.787000	0.99055	2.675000	0.91044	0.462000	0.41574	CCT		0.478	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
GRIA1	2890	hgsc.bcm.edu	37	5	153030063	153030063	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:153030063A>G	ENST00000285900.5	+	4	977	c.634A>G	c.(634-636)Atc>Gtc	p.I212V	GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000521843.2_Missense_Mutation_p.I143V|GRIA1_ENST00000448073.4_Missense_Mutation_p.I222V|GRIA1_ENST00000518783.1_Missense_Mutation_p.I222V|GRIA1_ENST00000518142.1_Missense_Mutation_p.I132V|GRIA1_ENST00000340592.5_Missense_Mutation_p.I212V	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	212					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.I212V(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CCTCAATGCTATCTTGGGCCA	0.537																																					p.I212V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A634G	5						.						77.0	69.0	72.0					5																	153030063		2203	4300	6503	153010256	SO:0001583	missense	2890	exon4				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.634A>G	5.37:g.153030063A>G	ENSP00000285900:p.Ile212Val	Somatic		Capture	SOLID	Phase_I	153010256	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.658224	0.88154	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.6	5.6	0.85130	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89536	0.6743	L	0.49778	1.585	0.80722	D	1	P;P;B;P;P;B	0.52316	0.952;0.952;0.032;0.952;0.94;0.053	D;D;B;D;D;B	0.68353	0.957;0.957;0.061;0.957;0.928;0.04	D	0.88573	0.3131	10	0.37606	T	0.19	.	14.9587	0.71138	1.0:0.0:0.0:0.0	.	222;222;132;222;212;212	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	V	212;212;132;166;212;143;143;222;222	ENSP00000285900:I212V;ENSP00000427920:I132V;ENSP00000339343:I212V;ENSP00000427864:I143V;ENSP00000442108:I143V;ENSP00000428994:I222V;ENSP00000415569:I222V	ENSP00000285900:I212V	I	+	1	0	GRIA1	153010256	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	8.592000	0.90828	2.123000	0.65237	0.528000	0.53228	ATC		0.537	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
LARP1	23367	hgsc.bcm.edu	37	5	154179581	154179581	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:154179581G>A	ENST00000336314.4	+	10	1488	c.1464G>A	c.(1462-1464)cgG>cgA	p.R488R		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	565					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.R565R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGAGGCCTCGGCCATCCCCAG	0.577																																					p.R488R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1464A	5						.						51.0	49.0	50.0					5																	154179581		2203	4300	6503	154159774	SO:0001819	synonymous_variant	23367	exon10			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1464G>A	5.37:g.154179581G>A		Somatic		Capture	SOLID	Phase_I	154159774	NM_015315	O94836|Q8N4M2|Q8NB73|Q9UFD7	Silent	SNP	ENST00000336314.4	37	CCDS4328.1																																																																																				0.577	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
ADRA1B	147	hgsc.bcm.edu	37	5	159344422	159344422	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:159344422G>T	ENST00000306675.3	+	1	633	c.510G>T	c.(508-510)tgG>tgT	p.W170C		NM_000679.3	NP_000670.1	P35368	ADA1B_HUMAN	adrenoceptor alpha 1B	170					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|adult heart development (GO:0007512)|behavioral response to cocaine (GO:0048148)|blood vessel remodeling (GO:0001974)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|multicellular organismal development (GO:0007275)|negative regulation of glycogen catabolic process (GO:0045818)|organ growth (GO:0035265)|positive regulation of glycogen catabolic process (GO:0045819)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of the force of heart contraction by epinephrine-norepinephrine (GO:0001997)|regulation of cardiac muscle contraction (GO:0055117)|regulation of vasoconstriction (GO:0019229)|response to amphetamine (GO:0001975)|response to morphine (GO:0043278)|vasoconstriction of artery involved in baroreceptor response to lowering of systemic arterial blood pressure (GO:0001987)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)|protein heterodimerization activity (GO:0046982)	p.W170C(1)		endometrium(3)|large_intestine(6)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acepromazine(DB01614)|Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Dapiprazole(DB00298)|Desipramine(DB01151)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Ziprasidone(DB00246)	TCAGTGTCTGGGTCTTGTCCA	0.612																																					p.W170C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G510T	5						.						87.0	78.0	81.0					5																	159344422		2203	4300	6503	159277000	SO:0001583	missense	147	exon1			L31773	CCDS4347.1	5q33.3	2012-08-08	2012-05-09		ENSG00000170214	ENSG00000170214		"""GPCR / Class A : Adrenoceptors : alpha"""	278	protein-coding gene	gene with protein product		104220	"""adrenergic, alpha-1B-, receptor"""				Standard	XM_005265818		Approved		uc003lxt.1	P35368	OTTHUMG00000130327	ENST00000306675.3:c.510G>T	5.37:g.159344422G>T	ENSP00000306662:p.Trp170Cys	Somatic		Capture	SOLID	Phase_I	159277000	NM_000679	B0LPE1	Missense_Mutation	SNP	ENST00000306675.3	37	CCDS4347.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128343	0.56721	.	.	ENSG00000170214	ENST00000306675	D	0.88818	-2.43	5.67	5.67	0.87782	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97356	0.9135	H	0.99545	4.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98942	1.0791	10	0.87932	D	0	.	18.3329	0.90276	0.0:0.0:1.0:0.0	.	170	P35368	ADA1B_HUMAN	C	170	ENSP00000306662:W170C	ENSP00000306662:W170C	W	+	3	0	ADRA1B	159277000	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	9.869000	0.99810	2.689000	0.91719	0.462000	0.41574	TGG		0.612	ADRA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252676.1		
SPDL1	54908	hgsc.bcm.edu	37	5	169021196	169021196	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:169021196G>A	ENST00000265295.4	+	5	858	c.579G>A	c.(577-579)caG>caA	p.Q193Q	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1									p.Q193Q(1)									GACAAGAACAGCTAGAACTTC	0.378																																					p.Q193Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G579A	5						.						79.0	79.0	79.0					5																	169021196		2203	4300	6503	168953774	SO:0001819	synonymous_variant	54908	exon5			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.579G>A	5.37:g.169021196G>A		Somatic		Capture	SOLID	Phase_I	168953774	NM_017785		Silent	SNP	ENST00000265295.4	37	CCDS4370.1	.	.	.	.	.	.	.	.	.	.	G	0.408	-0.914958	0.02415	.	.	ENSG00000040275	ENST00000505977	.	.	.	5.81	0.409	0.16382	.	.	.	.	.	T	0.65260	0.2674	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60601	-0.7231	4	.	.	.	-9.3419	12.6478	0.56744	0.4399:0.0:0.5601:0.0	.	.	.	.	T	122	.	.	A	+	1	0	CCDC99	168953774	0.960000	0.32886	0.811000	0.32455	0.071000	0.16799	0.677000	0.25262	-0.139000	0.11414	0.655000	0.94253	GCT		0.378	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
BRD9	65980	hgsc.bcm.edu	37	5	864637	864637	+	Silent	SNP	G	G	A	rs540370412		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:864637G>A	ENST00000467963.1	-	16	1906	c.1740C>T	c.(1738-1740)caC>caT	p.H580H	BRD9_ENST00000323510.4_Silent_p.H484H|BRD9_ENST00000483173.1_Silent_p.H527H|BRD9_ENST00000388890.4_Silent_p.H464H	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	580					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)	p.H484H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CATAGGGGTCGTGGGTGACGT	0.502													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18668	0.0		0.0	False		,,,				2504	0.0				p.H580H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1740T	5						.						74.0	77.0	76.0					5																	864637		2203	4300	6503	917637	SO:0001819	synonymous_variant	65980	exon16			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1740C>T	5.37:g.864637G>A		Somatic		Capture	SOLID	Phase_I	917637	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Silent	SNP	ENST00000467963.1	37	CCDS34127.2																																																																																				0.502	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	
PAPD7	11044	hgsc.bcm.edu	37	5	6737678	6737678	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:6737678G>A	ENST00000230859.6	+	2	151	c.22G>A	c.(22-24)Gca>Aca	p.A8T		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	238					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)	p.A8T(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TCCTGAAGAAGCAGCTATGAG	0.413																																					p.A8T	NSCLC(7;212 333 5667 23379 46547)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G22A	5						.						211.0	169.0	183.0					5																	6737678		2203	4300	6503	6790678	SO:0001583	missense	11044	exon2			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.22G>A	5.37:g.6737678G>A	ENSP00000230859:p.Ala8Thr	Somatic		Capture	SOLID	Phase_I	6790678	NM_001171805	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	CCDS3871.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098688	0.56183	.	.	ENSG00000112941	ENST00000230859;ENST00000515721	T	0.40476	1.03	4.93	4.93	0.64822	.	0.176759	0.48767	D	0.000162	T	0.33673	0.0871	L	0.32530	0.975	0.58432	D	0.999999	B	0.26935	0.164	B	0.24394	0.053	T	0.09840	-1.0656	10	0.17832	T	0.49	-9.6951	18.1564	0.89693	0.0:0.0:1.0:0.0	.	8	Q5XG87	PAPD7_HUMAN	T	8	ENSP00000230859:A8T	ENSP00000230859:A8T	A	+	1	0	PAPD7	6790678	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.815000	0.91973	2.290000	0.77057	0.430000	0.28490	GCA		0.413	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999	
ADCY2	108	hgsc.bcm.edu	37	5	7706890	7706890	+	Silent	SNP	C	C	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:7706890C>T	ENST00000338316.4	+	8	1232	c.1143C>T	c.(1141-1143)aaC>aaT	p.N381N	ADCY2_ENST00000537121.1_Silent_p.N201N|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	381					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TTGATATCAACATGCGCGTGG	0.468																																					p.N381N												.	.	0			c.C1143T	5						.						273.0	240.0	251.0					5																	7706890		2203	4300	6503	7759890	SO:0001819	synonymous_variant	108	exon8			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1143C>T	5.37:g.7706890C>T		Somatic		Capture	SOLID	Phase_I	7759890	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																				0.468	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
PDZD2	23037	hgsc.bcm.edu	37	5	32010547	32010547	+	Missense_Mutation	SNP	G	G	A	rs148515549		TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:32010547G>A	ENST00000438447.1	+	6	1754	c.1366G>A	c.(1366-1368)Ggg>Agg	p.G456R	PDZD2_ENST00000282493.3_Missense_Mutation_p.G456R			O15018	PDZD2_HUMAN	PDZ domain containing 2	456					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.G456R(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGAGGCAGACGGGGAAGAGGA	0.517																																					p.G456R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1366A	5						.	G	ARG/GLY	0,4406		0,0,2203	75.0	71.0	72.0		1366	3.9	0.4	5	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense	PDZD2	NM_178140.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	456/2840	32010547	1,13005	2203	4300	6503	32046304	SO:0001583	missense	23037	exon5			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.1366G>A	5.37:g.32010547G>A	ENSP00000402033:p.Gly456Arg	Somatic		Capture	SOLID	Phase_I	32046304	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890189	0.33348	0.0	1.16E-4	ENSG00000133401	ENST00000438447;ENST00000282493	T;T	0.06218	3.33;3.33	5.69	3.89	0.44902	.	0.172306	0.28109	N	0.016565	T	0.02119	0.0066	N	0.03608	-0.345	0.24518	N	0.994177	B;P	0.42456	0.238;0.78	B;B	0.29716	0.02;0.106	T	0.46952	-0.9154	10	0.17832	T	0.49	.	9.1253	0.36812	0.1708:0.0:0.8292:0.0	.	282;456	B4E3P2;O15018	.;PDZD2_HUMAN	R	456	ENSP00000402033:G456R;ENSP00000282493:G456R	ENSP00000282493:G456R	G	+	1	0	PDZD2	32046304	0.997000	0.39634	0.362000	0.25862	0.745000	0.42441	2.832000	0.48152	0.736000	0.32559	-0.142000	0.14014	GGG		0.517	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
EGFLAM	133584	hgsc.bcm.edu	37	5	38352389	38352389	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:38352389T>G	ENST00000354891.3	+	5	847	c.501T>G	c.(499-501)agT>agG	p.S167R	EGFLAM_ENST00000322350.5_Missense_Mutation_p.S167R	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	167	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.S167R(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CTGGAGCGAGTGAAGGAAGCG	0.532																																					p.S167R	Colon(62;485 1295 3347 17454)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T501G	5						.						133.0	130.0	131.0					5																	38352389		2203	4300	6503	38388146	SO:0001583	missense	133584	exon5			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.501T>G	5.37:g.38352389T>G	ENSP00000346964:p.Ser167Arg	Somatic		Capture	SOLID	Phase_I	38388146	NM_152403	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.529640	0.44969	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.54279	0.58;0.58	4.73	-0.614	0.11590	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.289856	0.36409	N	0.002602	T	0.45617	0.1351	L	0.45698	1.435	0.80722	D	1	D;P	0.53745	0.962;0.953	P;P	0.49387	0.609;0.474	T	0.38156	-0.9674	10	0.87932	D	0	-30.1662	4.1977	0.10452	0.0:0.2866:0.1722:0.5412	.	167;167	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	R	167	ENSP00000346964:S167R;ENSP00000313084:S167R	ENSP00000313084:S167R	S	+	3	2	EGFLAM	38388146	0.999000	0.42202	0.982000	0.44146	0.192000	0.23643	0.320000	0.19540	-0.367000	0.08052	-0.376000	0.06991	AGT		0.532	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
LIFR	3977	hgsc.bcm.edu	37	5	38510691	38510691	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:38510691A>G	ENST00000263409.4	-	7	1028	c.866T>C	c.(865-867)tTg>tCg	p.L289S	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Missense_Mutation_p.L289S	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	289					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.L289S(1)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AAGATGGATCAAGGGGCAGTT	0.368			T	PLAG1	salivary adenoma																																p.L289S	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T866C	5						.						106.0	95.0	98.0					5																	38510691		2203	4300	6503	38546448	SO:0001583	missense	3977	exon7			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.866T>C	5.37:g.38510691A>G	ENSP00000263409:p.Leu289Ser	Somatic		Capture	SOLID	Phase_I	38546448	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	A	13.43	2.236330	0.39498	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.69040	-0.37;-0.37	5.65	4.5	0.54988	.	0.831933	0.11067	N	0.603347	T	0.68787	0.3039	M	0.69823	2.125	0.36084	D	0.843006	D	0.65815	0.995	P	0.50934	0.654	T	0.67304	-0.5704	10	0.15499	T	0.54	-11.9494	7.5458	0.27766	0.9066:0.0:0.0934:0.0	.	289	P42702	LIFR_HUMAN	S	289	ENSP00000263409:L289S;ENSP00000398368:L289S	ENSP00000263409:L289S	L	-	2	0	LIFR	38546448	0.998000	0.40836	0.862000	0.33874	0.369000	0.29798	2.600000	0.46240	2.150000	0.67090	0.533000	0.62120	TTG		0.368	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
CARD6	84674	hgsc.bcm.edu	37	5	40853594	40853594	+	Silent	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:40853594T>C	ENST00000254691.5	+	3	2359	c.2160T>C	c.(2158-2160)ggT>ggC	p.G720G	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	720					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)			p.G720G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						ATCTCTATGGTACCCCAGTAT	0.458																																					p.G720G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2160C	5						.						167.0	177.0	174.0					5																	40853594		2203	4300	6503	40889351	SO:0001819	synonymous_variant	84674	exon3			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.2160T>C	5.37:g.40853594T>C		Somatic		Capture	SOLID	Phase_I	40889351	NM_032587	Q52LR2	Silent	SNP	ENST00000254691.5	37	CCDS3935.1																																																																																				0.458	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
CARD6	84674	hgsc.bcm.edu	37	5	40853769	40853769	+	Nonsense_Mutation	SNP	C	C	T	rs576218644	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:40853769C>T	ENST00000254691.5	+	3	2534	c.2335C>T	c.(2335-2337)Cga>Tga	p.R779*	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	779					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)			p.R779*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						GGCCCAGGGCCGAGGTAAAAG	0.488													C|||	2	0.000399361	0.0	0.0	5008	,	,		18196	0.0		0.0	False		,,,				2504	0.002				p.R779X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2335T	5						.						92.0	107.0	102.0					5																	40853769		2203	4300	6503	40889526	SO:0001587	stop_gained	84674	exon3			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.2335C>T	5.37:g.40853769C>T	ENSP00000254691:p.Arg779*	Somatic		Capture	SOLID	Phase_I	40889526	NM_032587	Q52LR2	Nonsense_Mutation	SNP	ENST00000254691.5	37	CCDS3935.1	.	.	.	.	.	.	.	.	.	.	C	37	6.145766	0.97324	.	.	ENSG00000132357	ENST00000254691	.	.	.	4.9	0.714	0.18180	.	0.891801	0.09382	N	0.809866	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0704	9.1419	0.36908	0.4915:0.3834:0.125:0.0	.	.	.	.	X	779	.	ENSP00000254691:R779X	R	+	1	2	CARD6	40889526	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	0.130000	0.15850	-0.068000	0.12953	-0.277000	0.10078	CGA		0.488	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
GHR	2690	hgsc.bcm.edu	37	5	42718974	42718974	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:42718974A>G	ENST00000230882.4	+	10	1555	c.1365A>G	c.(1363-1365)aaA>aaG	p.K455K	GHR_ENST00000537449.1_Silent_p.K268K|GHR_ENST00000357703.3_Silent_p.K433K	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	455					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.K455K(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	AGAAAAACAAACCACAACCAC	0.443																																					p.K455K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1365G	5						.						69.0	62.0	64.0					5																	42718974		2203	4300	6503	42754731	SO:0001819	synonymous_variant	2690	exon10				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1365A>G	5.37:g.42718974A>G		Somatic		Capture	SOLID	Phase_I	42754731	NM_000163	Q9HCX2	Silent	SNP	ENST00000230882.4	37	CCDS3940.1																																																																																				0.443	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163	
SNX18	112574	hgsc.bcm.edu	37	5	53814682	53814682	+	Silent	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:53814682G>A	ENST00000326277.3	+	1	1090	c.900G>A	c.(898-900)ctG>ctA	p.L300L	SNX18_ENST00000381410.4_Silent_p.L300L|SNX18_ENST00000343017.6_Silent_p.L300L	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	300	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.L300L(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CCTACAAGCTGGTGCCCACGC	0.627																																					p.L300L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G900A	5						.						76.0	69.0	71.0					5																	53814682		2203	4300	6503	53850439	SO:0001819	synonymous_variant	112574	exon1			AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.900G>A	5.37:g.53814682G>A		Somatic		Capture	SOLID	Phase_I	53850439	NM_001145427	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	ENST00000326277.3	37	CCDS3962.1																																																																																				0.627	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
DHX29	54505	hgsc.bcm.edu	37	5	54567971	54567971	+	Silent	SNP	A	A	G			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:54567971A>G	ENST00000251636.5	-	18	2956	c.2808T>C	c.(2806-2808)ggT>ggC	p.G936G	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	936	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.G936G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				GAATAGTGATACCCGTCTCTG	0.269																																					p.G936G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2808C	5						.						48.0	51.0	50.0					5																	54567971		2200	4294	6494	54603728	SO:0001819	synonymous_variant	54505	exon18			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.2808T>C	5.37:g.54567971A>G		Somatic		Capture	SOLID	Phase_I	54603728	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Silent	SNP	ENST00000251636.5	37	CCDS34158.1																																																																																				0.269	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
PTCD2	79810	hgsc.bcm.edu	37	5	71654197	71654197	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:71654197G>T	ENST00000380639.5	+	10	1126	c.1110G>T	c.(1108-1110)aaG>aaT	p.K370N	PTCD2_ENST00000536805.1_Missense_Mutation_p.K198N|PTCD2_ENST00000460837.2_3'UTR|PTCD2_ENST00000503868.1_Missense_Mutation_p.K261N|CTC-365E16.1_ENST00000606310.1_lincRNA	NM_024754.3	NP_079030.3	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	370					kidney development (GO:0001822)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|muscle fiber development (GO:0048747)|regulation of mRNA processing (GO:0050684)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)	p.K370N(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(1)|skin(1)	11		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		TATTAAACAAGAGGATGGTCA	0.552																																					p.K370N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1110T	5						.						72.0	62.0	65.0					5																	71654197		2203	4300	6503	71689953	SO:0001583	missense	79810	exon10			BC018720	CCDS4014.2, CCDS68891.1, CCDS68892.1, CCDS75258.1	5q13.2	2008-02-05			ENSG00000049883	ENSG00000049883			25734	protein-coding gene	gene with protein product		615484				12477932	Standard	XM_005248601		Approved	FLJ12598	uc003kcb.3	Q8WV60	OTTHUMG00000100953	ENST00000380639.5:c.1110G>T	5.37:g.71654197G>T	ENSP00000370013:p.Lys370Asn	Somatic		Capture	SOLID	Phase_I	71689953	NM_024754	B7Z5D0|B7Z8L7|E9PFV7|Q6IA65|Q9H9R0	Missense_Mutation	SNP	ENST00000380639.5	37	CCDS4014.2	.	.	.	.	.	.	.	.	.	.	G	8.652	0.898499	0.17686	.	.	ENSG00000049883	ENST00000380639;ENST00000503868;ENST00000510676;ENST00000536805	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.42	4.55	0.56014	.	0.437886	0.26418	N	0.024496	T	0.45657	0.1353	L	0.59436	1.845	0.38136	D	0.938314	P;B;P	0.48162	0.454;0.091;0.906	B;B;P	0.46585	0.055;0.07;0.521	T	0.44697	-0.9311	10	0.15499	T	0.54	.	9.7885	0.40690	0.0946:0.0:0.9054:0.0	.	261;198;370	E9PFV7;B7Z8L7;Q8WV60	.;.;PTCD2_HUMAN	N	370;261;199;198	ENSP00000370013:K370N;ENSP00000427349:K261N;ENSP00000426295:K199N;ENSP00000444772:K198N	ENSP00000308948:K370N	K	+	3	2	PTCD2	71689953	1.000000	0.71417	0.773000	0.31616	0.044000	0.14063	2.510000	0.45468	1.290000	0.44636	0.491000	0.48974	AAG		0.552	PTCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218562.6	NM_024754	
TNPO1	3842	hgsc.bcm.edu	37	5	72178296	72178296	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:72178296T>C	ENST00000337273.5	+	10	1349	c.923T>C	c.(922-924)tTg>tCg	p.L308S	TNPO1_ENST00000506351.2_Missense_Mutation_p.L300S|TNPO1_ENST00000523768.1_Missense_Mutation_p.L258S|TNPO1_ENST00000447967.2_3'UTR|TNPO1_ENST00000454282.1_Missense_Mutation_p.L258S	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	308					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)	p.L300S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CTTTATAGGTTGATTCCTGTG	0.294																																					p.L300S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T899C	5						.						134.0	142.0	139.0					5																	72178296		2203	4298	6501	72214052	SO:0001583	missense	3842	exon10			U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.923T>C	5.37:g.72178296T>C	ENSP00000336712:p.Leu308Ser	Somatic		Capture	SOLID	Phase_I	72214052	NM_153188	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.527712	0.85706	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89687	0.6787	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	D	0.92335	0.5877	10	0.87932	D	0	-8.6463	15.9833	0.80130	0.0:0.0:0.0:1.0	.	258;308	Q92973-3;Q92973	.;TNPO1_HUMAN	S	308;258;258;300	ENSP00000336712:L308S;ENSP00000398524:L258S;ENSP00000428899:L258S;ENSP00000425118:L300S	ENSP00000336712:L308S	L	+	2	0	TNPO1	72214052	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.642000	0.83385	2.238000	0.73509	0.528000	0.53228	TTG		0.294	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
VCAN	1462	hgsc.bcm.edu	37	5	82817499	82817499	+	Missense_Mutation	SNP	G	G	A	rs146606609	byFrequency	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:82817499G>A	ENST00000265077.3	+	7	3939	c.3374G>A	c.(3373-3375)cGc>cAc	p.R1125H	VCAN_ENST00000512590.2_Missense_Mutation_p.R1077H|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.R1125H	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1125	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.R1125H(3)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CTAACACCACGCATTGGGCCA	0.398																																					p.R1125H												.	.	3	Substitution - Missense(3)	large_intestine(2)|endometrium(1)	c.G3374A	5						.	G	,,HIS/ARG,HIS/ARG	12,4394	20.2+/-43.8	0,12,2191	68.0	62.0	64.0		,,3374,3374	-0.4	0.0	5	dbSNP_134	64	0,8600		0,0,4300	yes	intron,intron,missense,missense	VCAN	NM_001126336.2,NM_001164097.1,NM_001164098.1,NM_004385.4	,,29,29	0,12,6491	AA,AG,GG		0.0,0.2724,0.0923	,,possibly-damaging,possibly-damaging	,,1125/1643,1125/3397	82817499	12,12994	2203	4300	6503	82853255	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3374G>A	5.37:g.82817499G>A	ENSP00000265077:p.Arg1125His	Somatic		Capture	SOLID	Phase_I	82853255	NM_001164098	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	3.014	-0.203292	0.06180	0.002724	0.0	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	D;D;D	0.85556	-1.89;-1.97;-2.0	5.81	-0.402	0.12404	.	0.982777	0.08328	N	0.962738	T	0.67562	0.2906	N	0.08118	0	0.09310	N	1	P;P	0.40000	0.651;0.698	B;B	0.34722	0.188;0.092	T	0.58918	-0.7551	10	0.62326	D	0.03	.	7.3139	0.26489	0.215:0.3072:0.4777:0.0	.	1125;1125	P13611-3;P13611	.;CSPG2_HUMAN	H	1125;1125;1077	ENSP00000265077:R1125H;ENSP00000342768:R1125H;ENSP00000425959:R1077H	ENSP00000265077:R1125H	R	+	2	0	VCAN	82853255	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.409000	0.07160	-0.095000	0.12351	-1.850000	0.00570	CGC		0.398	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
RASA1	5921	hgsc.bcm.edu	37	5	86672825	86672825	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:86672825G>A	ENST00000274376.6	+	17	2876	c.2312G>A	c.(2311-2313)tGc>tAc	p.C771Y	RASA1_ENST00000512763.1_Missense_Mutation_p.C604Y|RASA1_ENST00000456692.2_Missense_Mutation_p.C594Y|CTC-428H11.2_ENST00000607486.1_RNA|RASA1_ENST00000506290.1_Missense_Mutation_p.C605Y	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	771	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)	p.C771Y(1)		NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		TTGTTGTTATGCACACTAAAT	0.388																																					p.C771Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2312A	5						.						151.0	139.0	143.0					5																	86672825		2203	4300	6503	86708581	SO:0001583	missense	5921	exon17				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2312G>A	5.37:g.86672825G>A	ENSP00000274376:p.Cys771Tyr	Somatic		Capture	SOLID	Phase_I	86708581	NM_002890	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	37	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209589	0.58343	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	5.52	5.52	0.82312	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.045706	0.85682	D	0.000000	T	0.64360	0.2591	N	0.19112	0.55	0.58432	D	0.999992	P;P;P;B;D	0.52996	0.619;0.619;0.619;0.264;0.957	B;B;B;B;B	0.35655	0.06;0.06;0.038;0.036;0.207	T	0.69375	-0.5162	10	0.44086	T	0.13	.	19.8119	0.96549	0.0:0.0:1.0:0.0	.	605;604;605;594;771	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	Y	771;804;594;604;605	ENSP00000274376:C771Y;ENSP00000411221:C594Y;ENSP00000422008:C604Y;ENSP00000420905:C605Y	ENSP00000274376:C771Y	C	+	2	0	RASA1	86708581	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.813000	0.99286	2.756000	0.94617	0.563000	0.77884	TGC		0.388	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
CLK4	57396	hgsc.bcm.edu	37	5	178030649	178030649	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr5:178030649T>C	ENST00000316308.4	-	13	1583	c.1415A>G	c.(1414-1416)cAt>cGt	p.H472R		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	472	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.H472R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		AAAGAAAGGATGCTGCAATGC	0.343																																					p.H472R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1415G	5						.						81.0	80.0	80.0					5																	178030649		2203	4300	6503	177963255	SO:0001583	missense	57396	exon13			AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.1415A>G	5.37:g.178030649T>C	ENSP00000316948:p.His472Arg	Somatic		Capture	SOLID	Phase_I	177963255	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	37	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.423470	0.62733	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.30714	1.52	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051422	0.85682	D	0.000000	T	0.66147	0.2760	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.76828	-0.2815	10	0.87932	D	0	.	12.8753	0.57988	0.0:0.0:0.0:1.0	.	472;472	B9EG64;Q9HAZ1	.;CLK4_HUMAN	R	472;364	ENSP00000316948:H472R	ENSP00000316948:H472R	H	-	2	0	CLK4	177963255	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.811000	0.69187	1.916000	0.55485	0.482000	0.46254	CAT		0.343	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
ZNF826P	664701	hgsc.bcm.edu	37	19	20577434	20577434	+	RNA	SNP	T	T	C			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr19:20577434T>C	ENST00000502675.1	-	0	1818				MIR1270-2_ENST00000408220.1_RNA	NR_036455.1		Q6ZT77	ZN826_HUMAN	zinc finger protein 826, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(4)	4						GAGTTGAGGATGCAGTAAAGG	0.388																																					.												.	.	0			.	19						.																																			20369274			664701	.			BC016785		19p12	2010-08-03	2010-08-03	2010-08-03	ENSG00000231205	ENSG00000231205			33875	pseudogene	pseudogene			"""zinc finger protein 826"""	ZNF826			Standard	NR_036455		Approved	FLJ44894	uc021urn.2	Q6ZT77	OTTHUMG00000162773		19.37:g.20577434T>C		Somatic		Capture	SOLID	Phase_I	20369274	.		Silent	SNP	ENST00000502675.1	37																																																																																					0.388	ZNF826P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000370365.1	NM_001039884	
MAT2A	4144	hgsc.bcm.edu	37	2	85769871	85769871	+	Splice_Site	SNP	G	G	A			TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3518-01A-02W-0833-10	TCGA-AA-3518-10A-01W-0833-10	g.chr2:85769871G>A	ENST00000306434.3	+	7	1074		c.e7+1		MAT2A_ENST00000409017.1_Splice_Site	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha						cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)	p.?(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TCTTGTTCAGGTATACACTCT	0.398																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	2						.						82.0	83.0	83.0					2																	85769871		2203	4300	6503	85623382	SO:0001630	splice_region_variant	4144	.				CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.951+1G>A	2.37:g.85769871G>A		Somatic		Capture	SOLID	Phase_I	85623382	.	A8K511|B4DN45|D6W5L1|Q53SP5	Splice_Site	SNP	ENST00000306434.3	37	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957998	0.73902	.	.	ENSG00000168906	ENST00000306434;ENST00000424323;ENST00000409017	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2073	0.86921	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAT2A	85623382	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.415000	0.97375	2.665000	0.90641	0.462000	0.41574	.		0.398	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	Intron
