#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NME8	51314	hgsc.bcm.edu	37	7	37903995	37903995	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr7:37903995G>T	ENST00000199447.4	+	9	872	c.500G>T	c.(499-501)aGt>aTt	p.S167I	NME8_ENST00000440017.1_Missense_Mutation_p.S167I|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	167	NDK 1.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.S167I(1)									GCTGTGATTAGTAAAAAAGTT	0.284																																					p.S167I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G500T	7						.						24.0	26.0	25.0					7																	37903995		2187	4282	6469	37870520	SO:0001583	missense	51314	exon9			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.500G>T	7.37:g.37903995G>T	ENSP00000199447:p.Ser167Ile	Somatic		Capture	SOLID	Phase_I	37870520	NM_016616	Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	G	9.545	1.114477	0.20795	.	.	ENSG00000086288	ENST00000199447;ENST00000455500;ENST00000444718;ENST00000440017	T;T;T	0.56103	0.48;0.48;0.48	4.45	-6.88	0.01665	.	1.947300	0.02049	N	0.049895	T	0.42630	0.1211	L	0.50333	1.59	0.09310	N	1	B	0.22346	0.068	B	0.29440	0.102	T	0.21827	-1.0234	10	0.33141	T	0.24	-0.656	3.5398	0.07807	0.528:0.2372:0.1346:0.1003	.	167	Q8N427	TXND3_HUMAN	I	167;112;112;167	ENSP00000199447:S167I;ENSP00000390596:S112I;ENSP00000397063:S167I	ENSP00000199447:S167I	S	+	2	0	TXNDC3	37870520	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.767000	0.01795	-1.556000	0.01695	-0.251000	0.11542	AGT		0.284	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
WBSCR17	64409	hgsc.bcm.edu	37	7	70885989	70885989	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr7:70885989G>A	ENST00000333538.5	+	5	1494	c.860G>A	c.(859-861)cGg>cAg	p.R287Q	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	287					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R287Q(2)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GAGGTGCAGCGGTACGAGAAC	0.582																																					p.R287Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G860A	7						.						147.0	135.0	139.0					7																	70885989		2203	4300	6503	70523925	SO:0001583	missense	64409	exon5			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.860G>A	7.37:g.70885989G>A	ENSP00000329654:p.Arg287Gln	Somatic		Capture	SOLID	Phase_I	70523925	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703232	0.48412	.	.	ENSG00000185274	ENST00000333538	T	0.63913	-0.07	5.32	5.32	0.75619	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.41003	0.1140	N	0.05259	-0.085	0.80722	D	1	B	0.33883	0.43	B	0.26969	0.075	T	0.41106	-0.9527	10	0.34782	T	0.22	.	18.0015	0.89199	0.0:0.0:1.0:0.0	.	287	Q6IS24	GLTL3_HUMAN	Q	287	ENSP00000329654:R287Q	ENSP00000329654:R287Q	R	+	2	0	WBSCR17	70523925	1.000000	0.71417	0.976000	0.42696	0.989000	0.77384	9.476000	0.97823	2.490000	0.84030	0.557000	0.71058	CGG		0.582	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
GTPBP10	85865	hgsc.bcm.edu	37	7	89976069	89976069	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr7:89976069G>A	ENST00000222511.6	+	1	80	c.14G>A	c.(13-15)aGt>aAt	p.S5N	GTPBP10_ENST00000257659.8_Missense_Mutation_p.S5N	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	5					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)	p.S5N(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						GTGCATTGCAGTTGCGTGTTG	0.597											OREG0018158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S5N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14A	7						.						209.0	194.0	199.0					7																	89976069		2203	4300	6503	89814005	SO:0001583	missense	85865	exon1				CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.14G>A	7.37:g.89976069G>A	ENSP00000222511:p.Ser5Asn	Somatic	1271	Capture	SOLID	Phase_I	89814005	NM_033107	B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	ENST00000222511.6	37	CCDS5617.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784352	0.31593	.	.	ENSG00000105793	ENST00000257659;ENST00000222511;ENST00000417207	T;T;T	0.32023	1.85;2.71;1.47	4.81	4.81	0.61882	.	0.831180	0.11247	N	0.584081	T	0.29256	0.0728	L	0.38531	1.155	0.09310	N	1	P;B	0.41848	0.763;0.361	B;B	0.39027	0.288;0.051	T	0.17592	-1.0364	9	.	.	.	-5.6976	17.4111	0.87486	0.0:0.0:1.0:0.0	.	5;5	A4D1E9-2;A4D1E9	.;GTPBA_HUMAN	N	5	ENSP00000257659:S5N;ENSP00000222511:S5N;ENSP00000416596:S5N	.	S	+	2	0	GTPBP10	89814005	0.502000	0.26107	0.010000	0.14722	0.083000	0.17756	4.988000	0.63863	2.657000	0.90304	0.655000	0.94253	AGT		0.597	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	NM_033107	
TES	26136	hgsc.bcm.edu	37	7	115890508	115890508	+	Silent	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr7:115890508G>A	ENST00000358204.4	+	4	875	c.660G>A	c.(658-660)ggG>ggA	p.G220G	AC073130.3_ENST00000444244.1_RNA|TES_ENST00000537767.1_Intron|TES_ENST00000393481.2_Silent_p.G211G|AC002066.1_ENST00000446355.2_RNA	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)	220					negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G220G(1)		endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			CAGCAGTGGGGGCCATGGAGG	0.468																																					p.G220G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G660A	7						.						58.0	62.0	60.0					7																	115890508		2203	4300	6503	115677744	SO:0001819	synonymous_variant	26136	exon4			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.660G>A	7.37:g.115890508G>A		Somatic		Capture	SOLID	Phase_I	115677744	NM_015641	A4D0U6|Q9GZQ1|Q9HAJ9	Silent	SNP	ENST00000358204.4	37	CCDS5763.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.338223	0.24253	.	.	ENSG00000135269	ENST00000393484	T	0.63096	-0.02	5.39	1.39	0.22231	.	0.239284	0.36778	N	0.002420	T	0.60676	0.2287	.	.	.	0.32166	N	0.582248	.	.	.	.	.	.	T	0.65742	-0.6094	7	0.87932	D	0	-15.0326	5.462	0.16622	0.3261:0.0:0.5288:0.1451	.	.	.	.	E	7	ENSP00000377124:G7E	ENSP00000377124:G7E	G	+	2	0	TES	115677744	0.760000	0.28428	0.710000	0.30468	0.473000	0.32948	0.403000	0.20982	0.309000	0.22966	0.655000	0.94253	GGG		0.468	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059413.2	NM_015641	
SIRPB1	10326	hgsc.bcm.edu	37	20	1551639	1551639	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr20:1551639G>A	ENST00000381605.4	-	4	960	c.896C>T	c.(895-897)tCg>tTg	p.S299L	SIRPB1_ENST00000262929.5_Intron|RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381603.3_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	299	Ig-like C1-type 2.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.S299L(1)		central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						TATGAGGGTCGAAGCTGTTTC	0.557																																					p.S299L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C896T	20						.						212.0	188.0	196.0					20																	1551639		2203	4300	6503	1499639	SO:0001583	missense	10326	exon4			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.896C>T	20.37:g.1551639G>A	ENSP00000371018:p.Ser299Leu	Somatic		Capture	SOLID	Phase_I	1499639	NM_006065	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	37	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	0.574	-0.840079	0.02692	.	.	ENSG00000101307	ENST00000381605	T	0.03272	3.99	2.51	-1.68	0.08212	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.715331	0.12620	N	0.453091	T	0.02970	0.0088	L	0.52266	1.64	0.09310	N	0.999999	B	0.21520	0.057	B	0.20767	0.031	T	0.49409	-0.8943	10	0.07990	T	0.79	.	4.238	0.10635	0.1721:0.4498:0.3781:0.0	.	299	O00241	SIRB1_HUMAN	L	299	ENSP00000371018:S299L	ENSP00000371018:S299L	S	-	2	0	SIRPB1	1499639	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.028000	0.12350	-0.527000	0.06374	0.462000	0.41574	TCG		0.557	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
MYH6	4624	hgsc.bcm.edu	37	14	23857459	23857459	+	Missense_Mutation	SNP	G	G	A	rs200465713		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr14:23857459G>A	ENST00000356287.3	-	29	4293	c.4264C>T	c.(4264-4266)Cgg>Tgg	p.R1422W	MYH6_ENST00000405093.3_Missense_Mutation_p.R1422W|MIR208A_ENST00000362287.1_RNA			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1422					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.R1422W(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TTCTGTAGCCGGTGCTTGGTC	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19741	0.0		0.0	False		,,,				2504	0.0				p.R1422W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4264T	14						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	142.0	137.0	139.0		4264	3.7	1.0	14		139	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYH6	NM_002471.3	101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	1422/1940	23857459	2,13004	2203	4300	6503	22927299	SO:0001583	missense	4624	exon30			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.4264C>T	14.37:g.23857459G>A	ENSP00000348634:p.Arg1422Trp	Somatic		Capture	SOLID	Phase_I	22927299	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	g	19.47	3.834413	0.71373	2.27E-4	1.16E-4	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.83837	-1.77;-1.77	4.64	3.72	0.42706	Myosin tail (1);	.	.	.	.	D	0.93871	0.8039	H	0.97291	3.975	0.52501	D	0.999952	D	0.89917	1.0	D	0.97110	1.0	D	0.95148	0.8270	9	0.87932	D	0	.	13.2232	0.59901	0.0:0.0:0.7036:0.2964	.	1422	P13533	MYH6_HUMAN	W	1422	ENSP00000386041:R1422W;ENSP00000348634:R1422W	ENSP00000348634:R1422W	R	-	1	2	MYH6	22927299	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.652000	0.37313	1.018000	0.39521	0.561000	0.74099	CGG		0.567	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
ADRA1A	148	hgsc.bcm.edu	37	8	26722039	26722039	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr8:26722039C>T	ENST00000519229.1	-	1	454	c.448G>A	c.(448-450)Gtc>Atc	p.V150I	ADRA1A_ENST00000380572.3_Missense_Mutation_p.V150I|ADRA1A_ENST00000354550.4_Missense_Mutation_p.V150I|ADRA1A_ENST00000380573.3_Missense_Mutation_p.V150I|ADRA1A_ENST00000276393.4_Missense_Mutation_p.V150I|ADRA1A_ENST00000380581.2_Missense_Mutation_p.V150I|ADRA1A_ENST00000380587.1_Missense_Mutation_p.V150I|ADRA1A_ENST00000380586.1_Missense_Mutation_p.V150I|ADRA1A_ENST00000358857.5_Missense_Mutation_p.V150I|ADRA1A_ENST00000380582.3_Missense_Mutation_p.V150I			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	220					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)	p.V150I(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	AGTGCCCAGACGCAGAGCAGA	0.637																																					p.V150I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G448A	8						.						62.0	64.0	63.0					8																	26722039		2203	4300	6503	26777956	SO:0001583	missense	148	exon1			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.448G>A	8.37:g.26722039C>T	ENSP00000430793:p.Val150Ile	Somatic		Capture	SOLID	Phase_I	26777956	NM_033302	Q9NPY0	Missense_Mutation	SNP	ENST00000519229.1	37		.	.	.	.	.	.	.	.	.	.	C	13.66	2.304590	0.40795	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72;-0.72;-0.72;-0.72;-0.72;-0.72	4.94	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	0.152719	0.44688	D	0.000434	T	0.57344	0.2047	L	0.38733	1.17	0.42300	D	0.992178	P;P;B;P;B;B	0.48230	0.774;0.907;0.171;0.596;0.023;0.211	B;B;B;B;B;B	0.41646	0.244;0.362;0.272;0.178;0.005;0.131	T	0.58967	-0.7542	10	0.54805	T	0.06	.	6.3559	0.21400	0.0:0.6829:0.1575:0.1595	.	150;150;150;150;150;150	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	I	150	ENSP00000369960:V150I;ENSP00000369961:V150I;ENSP00000369956:V150I;ENSP00000369955:V150I;ENSP00000430793:V150I;ENSP00000346557:V150I;ENSP00000276393:V150I;ENSP00000369947:V150I;ENSP00000369946:V150I;ENSP00000351725:V150I	ENSP00000276393:V150I	V	-	1	0	ADRA1A	26777956	0.275000	0.24201	1.000000	0.80357	0.981000	0.71138	0.626000	0.24492	1.147000	0.42369	0.563000	0.77884	GTC		0.637	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000376207.1	NM_033303	
PAX7	5081	hgsc.bcm.edu	37	1	18962858	18962858	+	Silent	SNP	C	C	T	rs142590581		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr1:18962858C>T	ENST00000375375.3	+	4	1177	c.579C>T	c.(577-579)ggC>ggT	p.G193G	PAX7_ENST00000420770.2_Silent_p.G193G|PAX7_ENST00000400661.3_Silent_p.G191G	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	193	Sufficient to mediate interaction with PAXBP1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G193G(1)	PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GCATCCTGGGCGACAAAGGTA	0.627			T	FOXO1A	alveolar rhabdomyosarcoma																																p.G191G			Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C573T	1						.						202.0	172.0	182.0					1																	18962858		2203	4300	6503	18835445	SO:0001819	synonymous_variant	5081	exon4			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.579C>T	1.37:g.18962858C>T		Somatic		Capture	SOLID	Phase_I	18835445	NM_013945	E9PFV9|Q0VA99|Q2PJS5	Silent	SNP	ENST00000375375.3	37	CCDS186.1																																																																																				0.627	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584	
NOTCH2NL	388677	hgsc.bcm.edu	37	1	145248876	145248876	+	Missense_Mutation	SNP	A	A	G	rs200866084		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr1:145248876A>G	ENST00000369340.3	+	3	464	c.20A>G	c.(19-21)aAt>aGt	p.N7S	RP11-458D21.5_ENST00000468030.1_Missense_Mutation_p.N7S|NOTCH2NL_ENST00000344859.3_Missense_Mutation_p.N7S|NOTCH2NL_ENST00000362074.6_Missense_Mutation_p.N7S			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	7	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.N7S(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ACCTACCACAATGGCACAGGA	0.348																																					p.N7S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A20G	1						.						11.0	10.0	10.0					1																	145248876		2011	4104	6115	143960233	SO:0001583	missense	388677	exon2				CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.20A>G	1.37:g.145248876A>G	ENSP00000358346:p.Asn7Ser	Somatic		Capture	SOLID	Phase_I	143960233	NM_203458	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Missense_Mutation	SNP	ENST00000369340.3	37	CCDS909.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596096	0.46318	.	.	ENSG00000213240	ENST00000362074;ENST00000344859;ENST00000369340	T;T;T	0.63255	-0.03;-0.03;-0.03	3.15	3.15	0.36227	Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.47432	0.1445	L	0.35793	1.09	0.22552	N	0.998997	D;D	0.63880	0.993;0.988	P;P	0.55391	0.775;0.6	T	0.26087	-1.0113	9	0.49607	T	0.09	.	7.9433	0.29971	1.0:0.0:0.0:0.0	.	7;7	Q7Z3S9-2;Q7Z3S9	.;NT2NL_HUMAN	S	7	ENSP00000354929:N7S;ENSP00000344557:N7S;ENSP00000358346:N7S	ENSP00000344557:N7S	N	+	2	0	NOTCH2NL	143960233	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.487000	0.60293	1.439000	0.47511	0.329000	0.21502	AAT		0.348	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038546.1	NM_203458	
EFHD2	79180	hgsc.bcm.edu	37	1	15752509	15752509	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr1:15752509C>T	ENST00000375980.4	+	2	528	c.451C>T	c.(451-453)Cgg>Tgg	p.R151W		NM_024329.5	NP_077305.2	Q96C19	EFHD2_HUMAN	EF-hand domain family, member D2	151	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.R151W(1)		large_intestine(1)|skin(1)	2		Renal(390;0.00145)|Breast(348;0.00173)|Colorectal(325;0.00215)|all_lung(284;0.00366)|Lung NSC(340;0.00395)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)|Hepatocellular(190;0.152)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.59e-07)|COAD - Colon adenocarcinoma(227;3.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000119)|KIRC - Kidney renal clear cell carcinoma(229;0.00251)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGAGCTTCCGGGAGGTAAG	0.587																																					p.R151W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C451T	1						.						47.0	55.0	52.0					1																	15752509		2203	4300	6503	15625096	SO:0001583	missense	79180	exon2			BC014923	CCDS155.1	1p36	2014-07-01	2005-01-25		ENSG00000142634	ENSG00000142634		"""EF-hand domain containing"""	28670	protein-coding gene	gene with protein product	"""swiprosin-1"""		"""EF hand domain containing 2"""			21244694	Standard	NM_024329		Approved	MGC4342	uc001awh.2	Q96C19	OTTHUMG00000002254	ENST00000375980.4:c.451C>T	1.37:g.15752509C>T	ENSP00000365147:p.Arg151Trp	Somatic		Capture	SOLID	Phase_I	15625096	NM_024329	Q5JYW9	Missense_Mutation	SNP	ENST00000375980.4	37	CCDS155.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.959209|3.959209	0.74016|0.74016	.|.	.|.	ENSG00000142634|ENSG00000142634	ENST00000445566|ENST00000375980;ENST00000375975	.|T	.|0.71222	.|-0.55	4.64|4.64	2.71|2.71	0.32032|0.32032	.|EF-hand-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85186|0.85186	0.5639|0.5639	M|M	0.92077|0.92077	3.27|3.27	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.85101|0.85101	0.0957|0.0957	5|10	.|0.87932	.|D	.|0	-36.7109|-36.7109	8.5759|8.5759	0.33598|0.33598	0.1523:0.765:0.0:0.0828|0.1523:0.765:0.0:0.0828	.|.	.|151	.|Q96C19	.|EFHD2_HUMAN	L|W	53|151;52	.|ENSP00000365147:R151W	.|ENSP00000365142:R52W	P|R	+|+	2|1	0|2	EFHD2|EFHD2	15625096|15625096	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	4.900000|4.900000	0.63252|0.63252	0.620000|0.620000	0.30215|0.30215	0.655000|0.655000	0.94253|0.94253	CCG|CGG		0.587	EFHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006433.1	NM_024329	
LUZP1	7798	hgsc.bcm.edu	37	1	23417742	23417742	+	Missense_Mutation	SNP	G	G	A	rs75606656		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr1:23417742G>A	ENST00000302291.4	-	4	3814	c.3013C>T	c.(3013-3015)Cgt>Tgt	p.R1005C	LUZP1_ENST00000374623.3_Missense_Mutation_p.R1005C|LUZP1_ENST00000418342.1_Missense_Mutation_p.R1005C|LUZP1_ENST00000314174.5_Missense_Mutation_p.R1005C			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	1005					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)		p.R1005C(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		CGATTCCGACGGGTAAGCACC	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18199	0.0		0.0	False		,,,				2504	0.0				p.R1005C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3013T	1						.	G	CYS/ARG,CYS/ARG	3,4403	6.2+/-15.9	0,3,2200	69.0	56.0	60.0		3013,3013	3.5	0.8	1	dbSNP_131	60	0,8600		0,0,4300	yes	missense,missense	LUZP1	NM_001142546.1,NM_033631.3	180,180	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	probably-damaging,probably-damaging	1005/1077,1005/1077	23417742	3,13003	2203	4300	6503	23290329	SO:0001583	missense	7798	exon4			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.3013C>T	1.37:g.23417742G>A	ENSP00000303758:p.Arg1005Cys	Somatic		Capture	SOLID	Phase_I	23290329	NM_033631	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	37	CCDS30628.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	17.37	3.371888	0.61624	6.81E-4	0.0	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.18657	2.41;2.41;2.41;2.2	4.5	3.53	0.40419	.	0.151246	0.31113	N	0.008221	T	0.35941	0.0949	L	0.57536	1.79	0.21627	N	0.999611	D;D	0.76494	0.994;0.999	P;P	0.61003	0.742;0.882	T	0.05599	-1.0875	10	0.87932	D	0	.	11.503	0.50448	0.0:0.0:0.8223:0.1777	.	1005;1005	Q86V48-2;Q86V48	.;LUZP1_HUMAN	C	1005	ENSP00000393460:R1005C;ENSP00000363752:R1005C;ENSP00000303758:R1005C;ENSP00000313705:R1005C	ENSP00000303758:R1005C	R	-	1	0	LUZP1	23290329	0.387000	0.25188	0.752000	0.31206	0.932000	0.56968	2.806000	0.47947	2.341000	0.79615	0.585000	0.79938	CGT		0.587	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631	
GRIK3	2899	hgsc.bcm.edu	37	1	37307503	37307503	+	Missense_Mutation	SNP	G	G	A	rs376333303		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr1:37307503G>A	ENST00000373091.3	-	10	1380	c.1364C>T	c.(1363-1365)aCg>aTg	p.T455M	GRIK3_ENST00000373093.4_Missense_Mutation_p.T455M	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	455					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.T455M(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CCCGTATAGCGTCCTGTCTGA	0.577																																					p.T455M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1364T	1						.	G	MET/THR	0,4406		0,0,2203	171.0	157.0	162.0		1364	4.9	0.9	1		162	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRIK3	NM_000831.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	455/920	37307503	1,13005	2203	4300	6503	37080090	SO:0001583	missense	2899	exon10			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1364C>T	1.37:g.37307503G>A	ENSP00000362183:p.Thr455Met	Somatic		Capture	SOLID	Phase_I	37080090	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014316	0.35511	0.0	1.16E-4	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.77750	-1.12;-1.12	4.95	4.95	0.65309	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.060705	0.64402	D	0.000003	T	0.73729	0.3624	L	0.28054	0.825	0.36253	D	0.854055	P;P	0.40970	0.734;0.734	P;P	0.49665	0.618;0.492	T	0.76152	-0.3064	10	0.29301	T	0.29	.	12.9613	0.58460	0.0783:0.0:0.9217:0.0	.	455;455	A9Z1Z8;Q13003	.;GRIK3_HUMAN	M	455	ENSP00000362183:T455M;ENSP00000362185:T455M	ENSP00000362183:T455M	T	-	2	0	GRIK3	37080090	1.000000	0.71417	0.924000	0.36721	0.340000	0.28889	6.789000	0.75110	2.446000	0.82766	0.655000	0.94253	ACG		0.577	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
LRRC7	57554	hgsc.bcm.edu	37	1	70505051	70505051	+	Missense_Mutation	SNP	G	G	A	rs61734800	byFrequency	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr1:70505051G>A	ENST00000035383.5	+	19	3460	c.3430G>A	c.(3430-3432)Ggc>Agc	p.G1144S	LRRC7_ENST00000310961.5_Missense_Mutation_p.G1149S|LRRC7_ENST00000415775.2_Missense_Mutation_p.G428S	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1144						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.G1144S(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TGATAGGTACGGCAGACCCCC	0.557													G|||	17	0.00339457	0.0121	0.0	5008	,	,		17705	0.0		0.001	False		,,,				2504	0.0				p.G1144S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3430A	1						.	G	SER/GLY	48,4358	49.6+/-84.7	0,48,2155	64.0	67.0	66.0		3430	3.9	0.9	1	dbSNP_129	66	0,8600		0,0,4300	yes	missense	LRRC7	NM_020794.2	56	0,48,6455	AA,AG,GG		0.0,1.0894,0.3691	benign	1144/1538	70505051	48,12958	2203	4300	6503	70277639	SO:0001583	missense	57554	exon19				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.3430G>A	1.37:g.70505051G>A	ENSP00000035383:p.Gly1144Ser	Somatic		Capture	SOLID	Phase_I	70277639	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	5	0.0022893772893772895	4	0.008130081300813009	0	0.0	0	0.0	1	0.0013192612137203166	G	4.339	0.062353	0.08388	0.010894	0.0	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.36520	1.25;1.31;2.41	5.94	3.89	0.44902	.	0.064045	0.64402	D	0.000007	T	0.13670	0.0331	L	0.38531	1.155	0.39527	D	0.968603	B;B;B	0.30068	0.267;0.025;0.056	B;B;B	0.16722	0.016;0.006;0.008	T	0.02983	-1.1086	10	0.48119	T	0.1	.	12.9103	0.58177	0.1109:0.0:0.8891:0.0	rs61734800	428;1144;1144	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	S	1149;1144;428;967	ENSP00000309245:G1149S;ENSP00000035383:G1144S;ENSP00000394867:G428S	ENSP00000035383:G1144S	G	+	1	0	LRRC7	70277639	1.000000	0.71417	0.860000	0.33809	0.003000	0.03518	0.767000	0.26575	0.711000	0.32018	0.650000	0.86243	GGC		0.557	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
MFSD4	148808	hgsc.bcm.edu	37	1	205555273	205555273	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr1:205555273C>T	ENST00000367147.4	+	6	1180	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	MFSD4_ENST00000536357.1_Missense_Mutation_p.R276W|MFSD4_ENST00000539267.1_Missense_Mutation_p.R363W	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4	363					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.R363W(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CACACTGGGCCGGCTCCTCTC	0.562																																					p.R363W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1087T	1						.						62.0	61.0	61.0					1																	205555273		2203	4300	6503	203821896	SO:0001583	missense	148808	exon6			BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.1087C>T	1.37:g.205555273C>T	ENSP00000356115:p.Arg363Trp	Somatic		Capture	SOLID	Phase_I	203821896	NM_181644	B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Missense_Mutation	SNP	ENST00000367147.4	37	CCDS1455.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600193	0.66332	.	.	ENSG00000174514	ENST00000367147;ENST00000539267;ENST00000536357	D;D;D	0.81821	-1.54;-1.54;-1.54	5.27	4.35	0.52113	Major facilitator superfamily domain, general substrate transporter (1);	0.052004	0.85682	D	0.000000	D	0.89660	0.6779	M	0.84846	2.72	0.54753	D	0.999983	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.95;1.0;0.997	D	0.90781	0.4679	10	0.87932	D	0	-14.7846	12.0608	0.53561	0.4163:0.5837:0.0:0.0	.	308;276;363	B7Z8X0;B7Z8X3;Q8N468	.;.;MFSD4_HUMAN	W	363;363;276	ENSP00000356115:R363W;ENSP00000445329:R363W;ENSP00000440183:R276W	ENSP00000356115:R363W	R	+	1	2	MFSD4	203821896	0.968000	0.33430	1.000000	0.80357	0.979000	0.70002	0.983000	0.29552	1.335000	0.45486	0.655000	0.94253	CGG		0.562	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090391.1	NM_181644	
GUCY1A2	2977	hgsc.bcm.edu	37	11	106558336	106558336	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr11:106558336G>A	ENST00000526355.2	-	8	2606	c.2138C>T	c.(2137-2139)tCg>tTg	p.S713L	GUCY1A2_ENST00000282249.2_Missense_Mutation_p.S744L|GUCY1A2_ENST00000347596.2_Missense_Mutation_p.S734L	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	713					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)	p.S713L(1)		breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	TTTTATTCTCGACGAAGAAAG	0.473																																					p.S713L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2138T	11						.						165.0	162.0	163.0					11																	106558336		2201	4298	6499	106063546	SO:0001583	missense	2977	exon8			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.2138C>T	11.37:g.106558336G>A	ENSP00000431245:p.Ser713Leu	Somatic		Capture	SOLID	Phase_I	106063546	NM_000855	A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	37	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.515087	0.44763	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.86956	-1.86;-2.19;-1.85	5.38	5.38	0.77491	.	0.372828	0.18853	U	0.129347	T	0.74801	0.3764	N	0.14661	0.345	0.35763	D	0.820291	B;B;B	0.30482	0.226;0.281;0.226	B;B;B	0.19391	0.025;0.023;0.01	T	0.76780	-0.2833	10	0.32370	T	0.25	.	11.8941	0.52646	0.08:0.0:0.92:0.0	.	734;744;713	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	L	713;744;734	ENSP00000431245:S713L;ENSP00000282249:S744L;ENSP00000344874:S734L	ENSP00000282249:S744L	S	-	2	0	GUCY1A2	106063546	1.000000	0.71417	0.994000	0.49952	0.934000	0.57294	5.758000	0.68776	2.689000	0.91719	0.305000	0.20034	TCG		0.473	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2		
BTG4	54766	hgsc.bcm.edu	37	11	111365994	111365994	+	Missense_Mutation	SNP	G	G	A	rs140812937	byFrequency	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr11:111365994G>A	ENST00000356018.2	-	5	755	c.556C>T	c.(556-558)Cgc>Tgc	p.R186C		NM_017589.3	NP_060059.1	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4	186					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|neuron differentiation (GO:0030182)			p.R186C(1)		large_intestine(2)|upper_aerodigestive_tract(1)	3		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		TTCTTTTTGCGGGGGATTTGT	0.448																																					p.R186C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C556T	11						.	G	CYS/ARG	0,4402		0,0,2201	83.0	79.0	81.0		556	0.6	0.0	11	dbSNP_134	81	3,8591	3.0+/-9.4	0,3,4294	no	missense	BTG4	NM_017589.2	180	0,3,6495	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	186/224	111365994	3,12993	2201	4297	6498	110871204	SO:0001583	missense	54766	exon5			AJ271351	CCDS8346.1	11q23	2008-05-27				ENSG00000137707			13862	protein-coding gene	gene with protein product		605673				10995567	Standard	NM_017589		Approved	PC3B	uc001plj.3	Q9NY30		ENST00000356018.2:c.556C>T	11.37:g.111365994G>A	ENSP00000348300:p.Arg186Cys	Somatic		Capture	SOLID	Phase_I	110871204	NM_017589	Q8NEH7	Missense_Mutation	SNP	ENST00000356018.2	37	CCDS8346.1	.	.	.	.	.	.	.	.	.	.	G	7.707	0.694385	0.15039	0.0	3.49E-4	ENSG00000137707	ENST00000356018	.	.	.	5.97	0.604	0.17547	.	0.408414	0.26776	N	0.022553	T	0.43942	0.1270	M	0.75447	2.3	0.09310	N	1	B	0.24618	0.107	B	0.17433	0.018	T	0.43829	-0.9367	9	0.87932	D	0	.	9.1067	0.36703	0.3769:0.0:0.623:0.0	.	186	Q9NY30	BTG4_HUMAN	C	186	.	ENSP00000348300:R186C	R	-	1	0	BTG4	110871204	0.921000	0.31238	0.002000	0.10522	0.107000	0.19398	0.935000	0.28924	-0.119000	0.11830	-0.136000	0.14681	CGC		0.448	BTG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391177.1		
NKAPL	222698	hgsc.bcm.edu	37	6	28227180	28227180	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr6:28227180G>A	ENST00000343684.3	+	1	83	c.31G>A	c.(31-33)Gag>Aag	p.E11K	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	11								p.E11K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						CAGCTATTCCGAGGACATCGT	0.657																																					p.E11K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G31A	6						.						29.0	27.0	28.0					6																	28227180		2197	4282	6479	28335159	SO:0001583	missense	222698	exon1			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.31G>A	6.37:g.28227180G>A	ENSP00000345716:p.Glu11Lys	Somatic		Capture	SOLID	Phase_I	28335159	NM_001007531	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	ENST00000343684.3	37	CCDS34353.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166371	0.38217	.	.	ENSG00000189134	ENST00000343684	T	0.13901	2.55	3.6	2.73	0.32206	.	4.451740	0.00786	N	0.001302	T	0.05686	0.0149	L	0.45581	1.43	0.09310	N	1	B	0.24317	0.101	B	0.13407	0.009	T	0.28650	-1.0037	10	0.87932	D	0	-7.5218	7.1765	0.25747	0.1215:0.0:0.8785:0.0	.	11	Q5M9Q1	NKAPL_HUMAN	K	11	ENSP00000345716:E11K	ENSP00000345716:E11K	E	+	1	0	NKAPL	28335159	0.004000	0.15560	0.037000	0.18230	0.004000	0.04260	0.175000	0.16762	1.097000	0.41459	0.655000	0.94253	GAG		0.657	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1		
DNAH8	1769	hgsc.bcm.edu	37	6	38854740	38854740	+	Silent	SNP	T	T	C			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr6:38854740T>C	ENST00000359357.3	+	55	8036	c.7782T>C	c.(7780-7782)aaT>aaC	p.N2594N	DNAH8_ENST00000449981.2_Silent_p.N2811N|DNAH8_ENST00000441566.1_Silent_p.N2558N			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2594	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N2594N(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CTGTGTTTAATTGTACATTGC	0.333																																					p.N2594N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T7782C	6						.						110.0	106.0	108.0					6																	38854740		2203	4300	6503	38962718	SO:0001819	synonymous_variant	1769	exon55			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7782T>C	6.37:g.38854740T>C		Somatic		Capture	SOLID	Phase_I	38962718	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					0.333	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DEFB112	245915	hgsc.bcm.edu	37	6	50016290	50016290	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr6:50016290T>C	ENST00000322246.4	-	1	74	c.75A>G	c.(73-75)atA>atG	p.I25M		NM_001037498.1	NP_001032587.1	Q30KQ8	DB112_HUMAN	defensin, beta 112	25					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.I25M(1)		central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.042)					CCTTTTCAAATATTGTGGAAG	0.328																																					p.I25M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A75G	6						.						136.0	132.0	134.0					6																	50016290		2203	4298	6501	50124249	SO:0001583	missense	245915	exon1			DQ012016	CCDS34476.1	6p12.3	2010-03-30			ENSG00000180872	ENSG00000180872		"""Defensins, beta"""	18093	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037498		Approved	DEFB-12	uc011dws.2	Q30KQ8	OTTHUMG00000160215	ENST00000322246.4:c.75A>G	6.37:g.50016290T>C	ENSP00000319126:p.Ile25Met	Somatic		Capture	SOLID	Phase_I	50124249	NM_001037498	Q8NET0	Missense_Mutation	SNP	ENST00000322246.4	37	CCDS34476.1	.	.	.	.	.	.	.	.	.	.	T	10.06	1.246918	0.22796	.	.	ENSG00000180872	ENST00000322246	.	.	.	3.53	1.2	0.21068	.	0.660218	0.12543	N	0.459689	T	0.07999	0.0200	N	0.24115	0.695	0.09310	N	1	B	0.34290	0.447	B	0.29440	0.102	T	0.17531	-1.0366	9	0.87932	D	0	.	4.7837	0.13215	0.0:0.264:0.0:0.736	.	25	Q30KQ8	DB112_HUMAN	M	25	.	ENSP00000319126:I25M	I	-	3	3	DEFB112	50124249	0.000000	0.05858	0.004000	0.12327	0.062000	0.15995	0.450000	0.21762	0.257000	0.21650	0.533000	0.62120	ATA		0.328	DEFB112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359672.1	NM_001037498	
BMP5	653	hgsc.bcm.edu	37	6	55638954	55638954	+	Missense_Mutation	SNP	G	G	A	rs376630543		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr6:55638954G>A	ENST00000370830.3	-	4	1618	c.920C>T	c.(919-921)gCg>gTg	p.A307V	BMP5_ENST00000446683.2_Missense_Mutation_p.A307V	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	307					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)	p.A307V(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TACCTCACTCGCCTTGAAGAA	0.463																																					p.A307V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C920T	6						.	G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	214.0	186.0	196.0		920	5.7	1.0	6		196	0,8600		0,0,4300	no	missense	BMP5	NM_021073.2	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	307/455	55638954	1,13005	2203	4300	6503	55746913	SO:0001583	missense	653	exon4				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.920C>T	6.37:g.55638954G>A	ENSP00000359866:p.Ala307Val	Somatic		Capture	SOLID	Phase_I	55746913	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555880	0.65425	2.27E-4	0.0	ENSG00000112175	ENST00000370830;ENST00000446683	T;T	0.72505	-0.66;-0.25	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.33030	0.0849	N	0.04203	-0.255	0.80722	D	1	P;P	0.40266	0.579;0.71	B;B	0.28385	0.062;0.089	T	0.41466	-0.9507	10	0.27785	T	0.31	.	19.9351	0.97137	0.0:0.0:1.0:0.0	.	307;307	B4E0Y4;P22003	.;BMP5_HUMAN	V	307	ENSP00000359866:A307V;ENSP00000391818:A307V	ENSP00000359866:A307V	A	-	2	0	BMP5	55746913	1.000000	0.71417	0.982000	0.44146	0.979000	0.70002	6.321000	0.72881	2.703000	0.92315	0.655000	0.94253	GCG		0.463	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
REV3L	5980	hgsc.bcm.edu	37	6	111696319	111696319	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr6:111696319C>T	ENST00000358835.3	-	14	3693	c.3239G>A	c.(3238-3240)cGg>cAg	p.R1080Q	REV3L_ENST00000435970.1_Missense_Mutation_p.R1002Q|REV3L_ENST00000368802.3_Missense_Mutation_p.R1080Q|REV3L_ENST00000368805.1_Missense_Mutation_p.R1080Q			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1080					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.R1002Q(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AGCATGTGACCGTTTTTTCCT	0.323								DNA polymerases (catalytic subunits)																													p.R1080Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3239A	6						.						111.0	107.0	108.0					6																	111696319		2203	4300	6503	111803012	SO:0001583	missense	5980	exon13			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3239G>A	6.37:g.111696319C>T	ENSP00000351697:p.Arg1080Gln	Somatic		Capture	SOLID	Phase_I	111803012	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	C	17.78	3.472743	0.63737	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01963	4.62;4.62;4.62;4.53	5.53	5.53	0.82687	Ribonuclease H-like (1);	0.254272	0.32753	N	0.005692	T	0.06645	0.0170	L	0.56769	1.78	0.30473	N	0.773142	D	0.89917	1.0	D	0.79108	0.992	T	0.01102	-1.1451	10	0.87932	D	0	.	19.4409	0.94820	0.0:1.0:0.0:0.0	.	1080	O60673	DPOLZ_HUMAN	Q	1080;1080;1080;1002	ENSP00000357792:R1080Q;ENSP00000357795:R1080Q;ENSP00000351697:R1080Q;ENSP00000402003:R1002Q	ENSP00000351697:R1080Q	R	-	2	0	REV3L	111803012	0.994000	0.37717	0.998000	0.56505	0.994000	0.84299	2.385000	0.44371	2.584000	0.87258	0.585000	0.79938	CGG		0.323	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
TP53	7157	hgsc.bcm.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R273C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0	.	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	c.C817T	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343	.						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Somatic		Capture	SOLID	Phase_I	7517846	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP53	7157	hgsc.bcm.edu	37	17	7578230	7578230	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr17:7578230C>T	ENST00000269305.4	-	6	808	c.619G>A	c.(619-621)Gat>Aat	p.D207N	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.D207N|TP53_ENST00000455263.2_Missense_Mutation_p.D207N|TP53_ENST00000359597.4_Missense_Mutation_p.D207N|TP53_ENST00000413465.2_Missense_Mutation_p.D207N|TP53_ENST00000420246.2_Missense_Mutation_p.D207N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	207	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> N (in sporadic cancers; somatic mutation).|D -> V (in a sporadic cancer; somatic mutation).|D -> Y (in a sporadic cancer; somatic mutation).|DD -> EY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(5)|p.D207N(3)|p.D207_R213delDDRNTFR(1)|p.D207fs*6(1)|p.D207_V216del10(1)|p.D207Y(1)|p.D114N(1)|p.E204fs*39(1)|p.D75N(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTTCTGTCATCCAAATACTCC	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.D207N	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	24	Whole gene deletion(8)|Substitution - Missense(6)|Unknown(5)|Deletion - In frame(3)|Deletion - Frameshift(2)	biliary_tract(5)|large_intestine(5)|bone(4)|central_nervous_system(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|pancreas(1)	c.G619A	17						.						142.0	125.0	131.0					17																	7578230		2203	4300	6503	7518955	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.619G>A	17.37:g.7578230C>T	ENSP00000269305:p.Asp207Asn	Somatic		Capture	SOLID	Phase_I	7518955	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777125	0.49786	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99789	-6.75;-6.75;-6.75;-6.75;-6.75;-6.75;-6.75;-6.75	5.41	-0.752	0.11072	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.221508	0.44902	N	0.000411	D	0.98698	0.9563	L	0.56124	1.755	0.24730	N	0.993091	B;B;B;B;B;B;B	0.28082	0.2;0.024;0.005;0.006;0.009;0.03;0.081	B;B;B;B;B;B;B	0.31337	0.116;0.078;0.01;0.016;0.128;0.128;0.041	D	0.99976	1.2198	10	0.87932	D	0	-2.1905	5.5779	0.17233	0.0:0.49:0.139:0.371	.	168;207;207;114;207;207;207	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	207;207;207;207;207;207;196;114;75;114;75	ENSP00000410739:D207N;ENSP00000352610:D207N;ENSP00000269305:D207N;ENSP00000398846:D207N;ENSP00000391127:D207N;ENSP00000391478:D207N;ENSP00000425104:D75N;ENSP00000423862:D114N	ENSP00000269305:D207N	D	-	1	0	TP53	7518955	0.995000	0.38212	0.001000	0.08648	0.120000	0.20174	3.296000	0.51802	0.074000	0.16767	-0.176000	0.13171	GAT		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	hgsc.bcm.edu	37	17	7702505	7702505	+	Missense_Mutation	SNP	G	G	A	rs373084871	byFrequency	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr17:7702505G>A	ENST00000572933.1	+	56	10104	c.8644G>A	c.(8644-8646)Gtg>Atg	p.V2882M	DNAH2_ENST00000389173.2_Missense_Mutation_p.V2882M			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2882	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V2882M(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CATTGAACGCGTGCAGAACAA	0.587													G|||	2	0.000399361	0.0	0.0	5008	,	,		18980	0.0		0.001	False		,,,				2504	0.001				p.V2882M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8644A	17						.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	117.0	91.0	100.0		8644	5.5	1.0	17		100	0,8600		0,0,4300	no	missense	DNAH2	NM_020877.2	21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	2882/4428	7702505	1,13005	2203	4300	6503	7643230	SO:0001583	missense	146754	exon55			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.8644G>A	17.37:g.7702505G>A	ENSP00000458355:p.Val2882Met	Somatic		Capture	SOLID	Phase_I	7643230	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423916	0.83667	2.27E-4	0.0	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.51325	0.71	5.48	5.48	0.80851	Dynein heavy chain, P-loop containing D4 domain (1);	0.070510	0.56097	D	0.000033	T	0.78717	0.4327	H	0.96269	3.795	0.80722	D	1	D	0.71674	0.998	D	0.67231	0.95	D	0.85771	0.1355	10	0.87932	D	0	.	18.1236	0.89579	0.0:0.0:1.0:0.0	.	2882	Q9P225	DYH2_HUMAN	M	2882	ENSP00000373825:V2882M	ENSP00000353818:V2882M	V	+	1	0	DNAH2	7643230	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	8.876000	0.92379	2.576000	0.86940	0.561000	0.74099	GTG		0.587	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
MED24	9862	hgsc.bcm.edu	37	17	38187494	38187494	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr17:38187494C>A	ENST00000394128.2	-	12	1153	c.1072G>T	c.(1072-1074)Gac>Tac	p.D358Y	MED24_ENST00000356271.3_Missense_Mutation_p.D345Y|MED24_ENST00000501516.3_Missense_Mutation_p.D377Y|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000394126.1_Missense_Mutation_p.D383Y|MED24_ENST00000394127.2_Missense_Mutation_p.D345Y	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	358					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.D358Y(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TTTGTACAGTCACAGCTGTGA	0.557																																					p.D345Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1033T	17						.						57.0	45.0	49.0					17																	38187494		2198	4294	6492	35441020	SO:0001583	missense	9862	exon11			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1072G>T	17.37:g.38187494C>A	ENSP00000377686:p.Asp358Tyr	Somatic		Capture	SOLID	Phase_I	35441020	NM_001079518	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.543305	0.45280	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000431269	T;T;T;T	0.54866	0.55;0.66;0.66;0.66	6.11	6.11	0.99139	Mediator complex, subunit Med24, N-terminal (1);	0.051492	0.85682	D	0.000000	T	0.67869	0.2939	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;0.999;1.0	D;D;D;D;D;D	0.72338	0.977;0.919;0.944;0.943;0.966;0.961	T	0.68044	-0.5513	10	0.72032	D	0.01	-31.4763	14.8343	0.70172	0.0:0.93:0.0:0.07	.	299;308;268;345;358;300	B4DSQ6;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;MED24_HUMAN;.	Y	358;358;358;308;345;300;268	ENSP00000377684:D358Y;ENSP00000377686:D358Y;ENSP00000443344:D308Y;ENSP00000377685:D345Y	ENSP00000348610:D358Y	D	-	1	0	MED24	35441020	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.758000	0.47565	2.906000	0.99361	0.655000	0.94253	GAC		0.557	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
USP16	10600	hgsc.bcm.edu	37	21	30409677	30409677	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr21:30409677A>G	ENST00000334352.4	+	7	760	c.529A>G	c.(529-531)Aag>Gag	p.K177E	USP16_ENST00000399976.2_Missense_Mutation_p.K177E|USP16_ENST00000399975.3_Missense_Mutation_p.K176E|USP16_ENST00000535828.1_Intron	NM_001032410.1	NP_001027582.1			ubiquitin specific peptidase 16									p.K177E(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(2)	34						GAGAGAAAAGAAGGAAAACAT	0.318																																					p.K176E	Melanoma(92;625 1444 27493 34101 44971)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A526G	21						.						116.0	122.0	120.0					21																	30409677		2203	4300	6503	29331548	SO:0001583	missense	10600	exon6			AF126736	CCDS13583.1, CCDS42912.1	21q21	2008-04-11	2005-08-08		ENSG00000156256	ENSG00000156256		"""Ubiquitin-specific peptidases"""	12614	protein-coding gene	gene with protein product		604735	"""ubiquitin specific protease 16"""			12838346	Standard	NM_006447		Approved	Ubp-M	uc002ymy.3	Q9Y5T5	OTTHUMG00000078802	ENST00000334352.4:c.529A>G	21.37:g.30409677A>G	ENSP00000334808:p.Lys177Glu	Somatic		Capture	SOLID	Phase_I	29331548	NM_001001992		Missense_Mutation	SNP	ENST00000334352.4	37	CCDS13583.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.040944	0.35989	.	.	ENSG00000156256	ENST00000399975;ENST00000399976;ENST00000334352	T;T;T	0.06142	3.34;3.34;3.34	5.9	4.72	0.59763	.	0.247890	0.46442	D	0.000288	T	0.04815	0.0130	L	0.29908	0.895	0.80722	D	1	P;P;B	0.41232	0.51;0.743;0.44	B;B;B	0.38755	0.107;0.281;0.11	T	0.24799	-1.0150	10	0.05833	T	0.94	.	12.0938	0.53742	0.8675:0.0:0.0:0.1325	.	162;176;177	Q9Y5T5-3;Q9Y5T5-2;Q9Y5T5	.;.;UBP16_HUMAN	E	176;177;177	ENSP00000382857:K176E;ENSP00000382858:K177E;ENSP00000334808:K177E	ENSP00000334808:K177E	K	+	1	0	USP16	29331548	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.719000	0.54926	1.011000	0.39340	0.528000	0.53228	AAG		0.318	USP16-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171847.1		
PRDM15	63977	hgsc.bcm.edu	37	21	43279287	43279287	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr21:43279287C>T	ENST00000269844.3	-	10	1192	c.1082G>A	c.(1081-1083)cGg>cAg	p.R361Q	PRDM15_ENST00000422911.1_Intron|PRDM15_ENST00000398548.1_Intron|PRDM15_ENST00000447207.2_Intron|PRDM15_ENST00000538201.1_Intron	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	361					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R361Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CTCATAACCCCGCATCCCCTG	0.657																																					p.R361Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1082A	21						.						73.0	47.0	56.0					21																	43279287		2203	4300	6503	42152356	SO:0001583	missense	63977	exon10			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.1082G>A	21.37:g.43279287C>T	ENSP00000269844:p.Arg361Gln	Somatic		Capture	SOLID	Phase_I	42152356	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	C	6.568	0.473138	0.12461	.	.	ENSG00000141956	ENST00000269844	T	0.07908	3.15	2.21	-0.4	0.12411	.	.	.	.	.	T	0.02929	0.0087	N	0.08118	0	0.09310	N	0.999999	P	0.39847	0.691	B	0.15870	0.014	T	0.41215	-0.9521	9	0.66056	D	0.02	.	7.6624	0.28410	0.3453:0.6547:0.0:0.0	.	361	P57071	PRD15_HUMAN	Q	361	ENSP00000269844:R361Q	ENSP00000269844:R361Q	R	-	2	0	PRDM15	42152356	0.006000	0.16342	0.004000	0.12327	0.003000	0.03518	0.015000	0.13355	-0.110000	0.12022	-0.274000	0.10170	CGG		0.657	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
KIAA0556	23247	hgsc.bcm.edu	37	16	27689081	27689081	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr16:27689081A>G	ENST00000261588.4	+	7	591	c.572A>G	c.(571-573)aAt>aGt	p.N191S	CTD-2049O4.1_ENST00000564893.1_RNA|KIAA0556_ENST00000567894.1_3'UTR	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	191						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.N191S(2)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CTTAGTGTAAATCTACAAAGG	0.433																																					p.N191S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A572G	16						.						48.0	42.0	44.0					16																	27689081		2197	4300	6497	27596582	SO:0001583	missense	23247	exon7			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.572A>G	16.37:g.27689081A>G	ENSP00000261588:p.Asn191Ser	Somatic		Capture	SOLID	Phase_I	27596582	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	A	12.82	2.053270	0.36181	.	.	ENSG00000047578	ENST00000261588;ENST00000327217	T	0.42900	0.96	5.28	-0.771	0.11002	.	0.593501	0.17197	N	0.183297	T	0.19127	0.0459	N	0.20685	0.6	0.19300	N	0.999979	P;B	0.42827	0.791;0.035	B;B	0.34385	0.181;0.015	T	0.32666	-0.9898	10	0.15066	T	0.55	-4.5828	8.8327	0.35093	0.5137:0.0:0.4863:0.0	.	99;191	Q8N803;O60303	.;K0556_HUMAN	S	191;98	ENSP00000261588:N191S	ENSP00000261588:N191S	N	+	2	0	KIAA0556	27596582	0.000000	0.05858	0.001000	0.08648	0.864000	0.49448	-0.003000	0.12901	-0.445000	0.07159	0.533000	0.62120	AAT		0.433	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
ZNF423	23090	hgsc.bcm.edu	37	16	49670805	49670805	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr16:49670805G>A	ENST00000561648.1	-	4	2311	c.2258C>T	c.(2257-2259)aCg>aTg	p.T753M	ZNF423_ENST00000262383.2_Missense_Mutation_p.T753M|ZNF423_ENST00000535559.1_Missense_Mutation_p.T636M|ZNF423_ENST00000563137.2_Missense_Mutation_p.T693M|ZNF423_ENST00000562520.1_Missense_Mutation_p.T693M|ZNF423_ENST00000567169.1_Missense_Mutation_p.T636M|ZNF423_ENST00000562871.1_Missense_Mutation_p.T693M	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	753					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T753M(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GTTGCAGGCCGTGCAGCGGTA	0.587																																					p.T753M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2258T	16						.						123.0	109.0	113.0					16																	49670805		2198	4300	6498	48228306	SO:0001583	missense	23090	exon5			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2258C>T	16.37:g.49670805G>A	ENSP00000455426:p.Thr753Met	Somatic		Capture	SOLID	Phase_I	48228306	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349910	0.61183	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09723	2.95;2.98	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.28863	0.0716	L	0.50333	1.59	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	T	0.00749	-1.1582	9	.	.	.	.	18.4141	0.90562	0.0:0.0:1.0:0.0	.	753	Q2M1K9	ZN423_HUMAN	M	753;636	ENSP00000262383:T753M;ENSP00000442321:T636M	.	T	-	2	0	ZNF423	48228306	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.352000	0.79861	0.561000	0.74099	ACG		0.587	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
ADAMTS18	170692	hgsc.bcm.edu	37	16	77353782	77353782	+	Silent	SNP	G	G	A	rs141347951		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr16:77353782G>A	ENST00000282849.5	-	16	2914	c.2496C>T	c.(2494-2496)taC>taT	p.Y832Y		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	832	Spacer.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Y832Y(2)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GCCCTGGCGCGTACAGACGTT	0.547													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17349	0.0		0.0	False		,,,				2504	0.0				p.Y832Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C2496T	16						.	G		1,4395	2.1+/-5.4	0,1,2197	62.0	61.0	61.0		2496	-4.9	0.1	16	dbSNP_134	61	0,8600		0,0,4300	no	coding-synonymous	ADAMTS18	NM_199355.2		0,1,6497	AA,AG,GG		0.0,0.0227,0.0077		832/1222	77353782	1,12995	2198	4300	6498	75911283	SO:0001819	synonymous_variant	170692	exon16			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2496C>T	16.37:g.77353782G>A		Somatic		Capture	SOLID	Phase_I	75911283	NM_199355	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																				0.547	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
CCDC178	374864	hgsc.bcm.edu	37	18	30992029	30992029	+	Silent	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr18:30992029G>A	ENST00000383096.3	-	3	206	c.24C>T	c.(22-24)tcC>tcT	p.S8S	CCDC178_ENST00000579916.1_Silent_p.S8S|CCDC178_ENST00000403303.1_Silent_p.S8S|CCDC178_ENST00000406524.2_Silent_p.S8S|CCDC178_ENST00000402325.1_Silent_p.S8S|CCDC178_ENST00000583930.1_Silent_p.S8S|CCDC178_ENST00000579947.1_Silent_p.S8S|CCDC178_ENST00000300227.8_Silent_p.S8S			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	8								p.S8S(1)									TGGAAGAAGAGGAAACTGTCT	0.229																																					p.S8S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C24T	18						.						43.0	45.0	44.0					18																	30992029		2201	4291	6492	29246027	SO:0001819	synonymous_variant	374864	exon3			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.24C>T	18.37:g.30992029G>A		Somatic		Capture	SOLID	Phase_I	29246027	NM_198995	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	ENST00000383096.3	37	CCDS42424.1																																																																																				0.229	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
SMAD2	4087	hgsc.bcm.edu	37	18	45374885	45374885	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr18:45374885T>G	ENST00000402690.2	-	8	1352	c.958A>C	c.(958-960)Aac>Cac	p.N320H	SMAD2_ENST00000586040.1_Missense_Mutation_p.N290H|SMAD2_ENST00000262160.6_Missense_Mutation_p.N320H|SMAD2_ENST00000356825.4_Missense_Mutation_p.N290H|SMAD2_ENST00000591214.1_Missense_Mutation_p.N290H	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	320	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.N320H(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						GCATTTCGGTTAACATTGGAG	0.398																																					p.N290H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A868C	18						.						130.0	121.0	124.0					18																	45374885		2203	4300	6503	43628883	SO:0001583	missense	4087	exon7			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.958A>C	18.37:g.45374885T>G	ENSP00000384449:p.Asn320His	Somatic		Capture	SOLID	Phase_I	43628883	NM_001135937		Missense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.645612	0.87958	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.98901	-5.22;-5.22;-5.22	5.81	5.81	0.92471	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98441	0.9481	L	0.57536	1.79	0.80722	D	1	P;P;P	0.48407	0.887;0.91;0.781	P;P;P	0.55965	0.577;0.605;0.788	D	0.98676	1.0690	10	0.35671	T	0.21	.	16.1773	0.81862	0.0:0.0:0.0:1.0	.	290;290;320	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	H	320;290;320	ENSP00000262160:N320H;ENSP00000349282:N290H;ENSP00000384449:N320H	ENSP00000262160:N320H	N	-	1	0	SMAD2	43628883	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.217000	0.71921	0.482000	0.46254	AAC		0.398	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
SMAD4	4089	hgsc.bcm.edu	37	18	48575096	48575096	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr18:48575096G>A	ENST00000342988.3	+	3	828	c.290G>A	c.(289-291)cGt>cAt	p.R97H	SMAD4_ENST00000588745.1_Missense_Mutation_p.R97H|SMAD4_ENST00000452201.2_Missense_Mutation_p.R97H|SMAD4_ENST00000398417.2_Missense_Mutation_p.R97H|RP11-729L2.2_ENST00000590722.2_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	97	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)|p.R97H(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ATCTATGCCCGTCTCTGGAGG	0.368																																					p.R97H												.	.	41	Whole gene deletion(36)|Unknown(4)|Substitution - Missense(1)	pancreas(26)|large_intestine(4)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	c.G290A	18						.						154.0	142.0	146.0					18																	48575096		2203	4300	6503	46829094	SO:0001583	missense	4089	exon3			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.290G>A	18.37:g.48575096G>A	ENSP00000341551:p.Arg97His	Somatic		Capture	SOLID	Phase_I	46829094	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	33	5.204597	0.95033	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	D;D;D	0.82255	-1.59;-1.59;-1.59	5.32	5.32	0.75619	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.92093	0.7494	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93222	0.6609	10	0.87932	D	0	.	17.7655	0.88476	0.0:0.0:1.0:0.0	.	97	Q13485	SMAD4_HUMAN	H	97	ENSP00000409551:R97H;ENSP00000341551:R97H;ENSP00000381452:R97H	ENSP00000341551:R97H	R	+	2	0	SMAD4	46829094	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.836000	0.99456	2.463000	0.83235	0.585000	0.79938	CGT		0.368	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
C3orf20	84077	hgsc.bcm.edu	37	3	14803104	14803104	+	Missense_Mutation	SNP	C	C	T	rs372038629		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr3:14803104C>T	ENST00000253697.3	+	15	2929	c.2477C>T	c.(2476-2478)cCg>cTg	p.P826L	C3orf20_ENST00000412910.1_Missense_Mutation_p.P704L|C3orf20_ENST00000435614.1_Missense_Mutation_p.P704L	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	826						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.P826L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TACTTCCTGCCGGATGACTAC	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		16917	0.001		0.0	False		,,,				2504	0.0				p.P704L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2111T	3						.						98.0	98.0	98.0					3																	14803104		2203	4300	6503	14778108	SO:0001583	missense	84077	exon15			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.2477C>T	3.37:g.14803104C>T	ENSP00000253697:p.Pro826Leu	Somatic		Capture	SOLID	Phase_I	14778108	NM_001184958	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924422	0.52653	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.49432	1.1;0.78;0.78	4.64	4.64	0.57946	.	0.000000	0.48286	D	0.000185	T	0.53530	0.1802	M	0.76574	2.34	0.53688	D	0.999978	D;D	0.54964	0.969;0.969	P;P	0.45343	0.477;0.477	T	0.64011	-0.6507	10	0.87932	D	0	-13.7454	14.795	0.69870	0.0:1.0:0.0:0.0	.	704;826	Q8ND61-2;Q8ND61	.;CC020_HUMAN	L	826;704;704	ENSP00000253697:P826L;ENSP00000402933:P704L;ENSP00000396081:P704L	ENSP00000253697:P826L	P	+	2	0	C3orf20	14778108	0.989000	0.36119	0.964000	0.40570	0.416000	0.31233	2.851000	0.48302	2.280000	0.76307	0.591000	0.81541	CCG		0.512	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
PLCL2	23228	hgsc.bcm.edu	37	3	17052314	17052314	+	Silent	SNP	T	T	C			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr3:17052314T>C	ENST00000418129.2	+	2	1563	c.1098T>C	c.(1096-1098)tcT>tcC	p.S366S	PLCL2_ENST00000396755.2_Silent_p.S366S|PLCL2_ENST00000432376.1_Silent_p.S366S|PLCL2_ENST00000460467.1_Intron	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	492					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.S366S(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						CCATGACCTCTCAGATAGTTT	0.398																																					p.L486P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1457C	3						.						111.0	101.0	105.0					3																	17052314		2203	4300	6503	17027318	SO:0001819	synonymous_variant	23228	exon3			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1098T>C	3.37:g.17052314T>C		Somatic		Capture	SOLID	Phase_I	17027318	NM_001144382	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Silent	SNP	ENST00000418129.2	37	CCDS33713.1	.	.	.	.	.	.	.	.	.	.	T	5.928	0.355174	0.11239	.	.	ENSG00000154822	ENST00000419842	.	.	.	5.96	0.298	0.15766	.	.	.	.	.	T	0.42359	0.1199	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28681	-1.0036	4	.	.	.	.	1.9518	0.03368	0.2591:0.0755:0.1865:0.4789	.	.	.	.	P	110	.	.	L	+	2	0	PLCL2	17027318	0.170000	0.23016	1.000000	0.80357	0.993000	0.82548	-0.421000	0.07053	0.505000	0.28104	0.533000	0.62120	CTC		0.398	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
AZI2	64343	hgsc.bcm.edu	37	3	28365631	28365631	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr3:28365631C>G	ENST00000479665.1	-	8	1612	c.1081G>C	c.(1081-1083)Gca>Cca	p.A361P	AZI2_ENST00000295748.3_5'UTR|CMC1_ENST00000466830.1_3'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	361					dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)		p.A361P(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						TCCCCAAATGCTGTCTCACTT	0.378																																					p.A361P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1081C	3						.						160.0	161.0	161.0					3																	28365631		2203	4299	6502	28340635	SO:0001583	missense	64343	exon8			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.1081G>C	3.37:g.28365631C>G	ENSP00000419371:p.Ala361Pro	Somatic		Capture	SOLID	Phase_I	28340635	NM_022461	A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Missense_Mutation	SNP	ENST00000479665.1	37	CCDS2647.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616711	0.46736	.	.	ENSG00000163512	ENST00000479665	.	.	.	6.17	2.25	0.28309	.	0.290043	0.43919	N	0.000517	T	0.27559	0.0677	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04128	-1.0975	9	0.48119	T	0.1	-10.5773	5.7568	0.18178	0.0:0.487:0.1308:0.3821	.	361	Q9H6S1	AZI2_HUMAN	P	361	.	ENSP00000419371:A361P	A	-	1	0	AZI2	28340635	0.687000	0.27671	0.972000	0.41901	0.986000	0.74619	-0.188000	0.09642	0.415000	0.25817	0.655000	0.94253	GCA		0.378	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252998.2	NM_203326	
CCR1	1230	hgsc.bcm.edu	37	3	46245694	46245694	+	Silent	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr3:46245694C>T	ENST00000296140.3	-	2	236	c.111G>A	c.(109-111)ctG>ctA	p.L37L	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	37					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.L37L(1)		autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		ACAGAGGGGGCAGCAGTTGGG	0.522																																					p.L37L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G111A	3						.						64.0	57.0	59.0					3																	46245694		2203	4300	6503	46220698	SO:0001819	synonymous_variant	1230	exon2				CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.111G>A	3.37:g.46245694C>T		Somatic		Capture	SOLID	Phase_I	46220698	NM_001295	Q86VA9	Silent	SNP	ENST00000296140.3	37	CCDS2737.1																																																																																				0.522	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257325.2	NM_001295	
TWF2	11344	hgsc.bcm.edu	37	3	52269094	52269094	+	Silent	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr3:52269094G>A	ENST00000305533.5	-	2	297	c.54C>T	c.(52-54)gcC>gcT	p.A18A	TWF2_ENST00000499914.2_Silent_p.A18A|TLR9_ENST00000597542.1_5'UTR	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	18	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)	p.A18A(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CCCGTGCCTTGGCAAAGAATT	0.572																																					p.A18A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C54T	3						.						115.0	101.0	105.0					3																	52269094		2203	4300	6503	52244134	SO:0001819	synonymous_variant	11344	exon2			Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.54C>T	3.37:g.52269094G>A		Somatic		Capture	SOLID	Phase_I	52244134	NM_007284	Q9Y3F5	Silent	SNP	ENST00000305533.5	37	CCDS2849.1																																																																																				0.572	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		
CASC1	55259	hgsc.bcm.edu	37	12	25311485	25311485	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr12:25311485A>G	ENST00000320267.9	-	3	182	c.101T>C	c.(100-102)tTg>tCg	p.L34S	CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000537577.1_Intron|CASC1_ENST00000395987.3_Missense_Mutation_p.L40S|CASC1_ENST00000545133.1_Intron|CASC1_ENST00000354189.5_Missense_Mutation_p.L98S|CASC1_ENST00000395990.2_5'UTR	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	34	Glu-rich.							p.L40S(1)		breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			CTCATATTTCAAACGGGCTTC	0.294																																					p.L98S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T293C	12						.						82.0	79.0	80.0					12																	25311485		2203	4298	6501	25202752	SO:0001583	missense	55259	exon4			AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.101T>C	12.37:g.25311485A>G	ENSP00000313141:p.Leu34Ser	Somatic		Capture	SOLID	Phase_I	25202752	NM_001082972	B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Missense_Mutation	SNP	ENST00000320267.9	37	CCDS41762.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.966493	0.53507	.	.	ENSG00000118307	ENST00000354189;ENST00000395987;ENST00000320267;ENST00000395992	T;T;T	0.37752	2.17;1.25;1.18	5.42	5.42	0.78866	.	0.189500	0.35291	N	0.003301	T	0.45935	0.1367	L	0.59436	1.845	0.80722	D	1	D;P;D	0.55385	0.971;0.952;0.971	P;P;P	0.56042	0.79;0.526;0.718	T	0.32745	-0.9895	10	0.16420	T	0.52	-5.2861	11.8582	0.52451	1.0:0.0:0.0:0.0	.	98;34;40	Q6TDU7-3;Q6TDU7;F8W8F9	.;CASC1_HUMAN;.	S	98;40;34;40	ENSP00000346126:L98S;ENSP00000379310:L40S;ENSP00000313141:L34S	ENSP00000313141:L34S	L	-	2	0	CASC1	25202752	0.992000	0.36948	0.961000	0.40146	0.991000	0.79684	5.137000	0.64789	2.051000	0.60960	0.467000	0.42956	TTG		0.294	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316761.1	NM_018272	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KRT85	3891	hgsc.bcm.edu	37	12	52758840	52758840	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr12:52758840G>T	ENST00000257901.3	-	2	610	c.535C>A	c.(535-537)Ctg>Atg	p.L179M	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	179	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.L179M(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCCGCCGCAGAGTCTCGATG	0.612																																					p.L179M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C535A	12						.						58.0	66.0	63.0					12																	52758840		2202	4299	6501	51045107	SO:0001583	missense	3891	exon2			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.535C>A	12.37:g.52758840G>T	ENSP00000257901:p.Leu179Met	Somatic		Capture	SOLID	Phase_I	51045107	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222208	0.58560	.	.	ENSG00000135443	ENST00000257901	D	0.92249	-3.0	4.51	3.62	0.41486	Filament (1);	0.000000	0.46145	D	0.000312	D	0.96337	0.8805	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96607	0.9449	10	0.72032	D	0.01	.	12.8276	0.57728	0.0794:0.0:0.9206:0.0	.	179	P78386	KRT85_HUMAN	M	179	ENSP00000257901:L179M	ENSP00000257901:L179M	L	-	1	2	KRT85	51045107	0.977000	0.34250	1.000000	0.80357	0.560000	0.35617	1.714000	0.37961	1.127000	0.42034	-0.333000	0.08304	CTG		0.612	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
FAM71C	196472	hgsc.bcm.edu	37	12	100042384	100042384	+	Silent	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr12:100042384G>A	ENST00000324341.1	+	1	854	c.432G>A	c.(430-432)acG>acA	p.T144T	ANKS1B_ENST00000547776.2_Intron|ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000329257.7_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	144								p.T144T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		AGCTTGCCACGGGCCGCTCTT	0.468																																					p.T144T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G432A	12						.						68.0	66.0	67.0					12																	100042384		2203	4300	6503	98566515	SO:0001819	synonymous_variant	196472	exon1				CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.432G>A	12.37:g.100042384G>A		Somatic		Capture	SOLID	Phase_I	98566515	NM_153364	B2R6Y6	Silent	SNP	ENST00000324341.1	37	CCDS9072.1																																																																																				0.468	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
NPAP1	23742	hgsc.bcm.edu	37	15	24921784	24921784	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr15:24921784C>T	ENST00000329468.2	+	1	1244	c.770C>T	c.(769-771)cCg>cTg	p.P257L		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	257					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P257L(1)									AAGCCTGATCCGGATGCAACA	0.647																																					p.P257L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C770T	15						.						32.0	35.0	34.0					15																	24921784		2202	4299	6501	22472877	SO:0001583	missense	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.770C>T	15.37:g.24921784C>T	ENSP00000333735:p.Pro257Leu	Somatic		Capture	SOLID	Phase_I	22472877	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	12.91	2.079822	0.36662	.	.	ENSG00000185823	ENST00000329468	T	0.10960	2.82	2.07	1.08	0.20341	.	.	.	.	.	T	0.19967	0.0480	L	0.42245	1.32	0.09310	N	1	D	0.76494	0.999	D	0.71870	0.975	T	0.08472	-1.0720	9	0.66056	D	0.02	.	6.3522	0.21383	0.0:0.6865:0.3135:0.0	.	257	Q9NZP6	CO002_HUMAN	L	257	ENSP00000333735:P257L	ENSP00000333735:P257L	P	+	2	0	C15orf2	22472877	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.106000	0.10890	0.400000	0.25396	0.436000	0.28706	CCG		0.647	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
SIN3A	25942	hgsc.bcm.edu	37	15	75706642	75706642	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr15:75706642G>A	ENST00000394947.3	-	4	691	c.377C>T	c.(376-378)gCg>gTg	p.A126V	SIN3A_ENST00000394949.4_Missense_Mutation_p.A126V|SIN3A_ENST00000360439.4_Missense_Mutation_p.A126V	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A									p.A126V(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						ATAAGATAGCGCATCCTCCAC	0.353																																					p.A126V												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C377T	15						.						80.0	70.0	74.0					15																	75706642		2197	4294	6491	73493695	SO:0001583	missense	25942	exon4			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.377C>T	15.37:g.75706642G>A	ENSP00000378402:p.Ala126Val	Somatic		Capture	SOLID	Phase_I	73493695	NM_001145358		Missense_Mutation	SNP	ENST00000394947.3	37	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	G	31	5.092524	0.94149	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.77750	-1.12;-1.12;-1.12	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.92964	0.7761	H	0.97962	4.115	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94666	0.7852	10	0.54805	T	0.06	-17.3556	18.7528	0.91821	0.0:0.0:1.0:0.0	.	126	Q96ST3	SIN3A_HUMAN	V	126	ENSP00000378402:A126V;ENSP00000378403:A126V;ENSP00000353622:A126V	ENSP00000353622:A126V	A	-	2	0	SIN3A	73493695	1.000000	0.71417	0.981000	0.43875	0.727000	0.41649	9.775000	0.98995	2.671000	0.90904	0.585000	0.79938	GCG		0.353	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
NDST4	64579	hgsc.bcm.edu	37	4	115767035	115767035	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr4:115767035C>T	ENST00000264363.2	-	10	2737	c.2059G>A	c.(2059-2061)Gcc>Acc	p.A687T		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	687	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.A687T(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		ATGATCTTGGCTTTGGGGACA	0.433																																					p.A687T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2059A	4						.						134.0	125.0	128.0					4																	115767035		2203	4300	6503	115986484	SO:0001583	missense	64579	exon10			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2059G>A	4.37:g.115767035C>T	ENSP00000264363:p.Ala687Thr	Somatic		Capture	SOLID	Phase_I	115986484	NM_022569	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	32	5.121849	0.94429	.	.	ENSG00000138653	ENST00000264363	D	0.83335	-1.71	5.61	5.61	0.85477	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.89255	0.6663	L	0.49778	1.585	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.88492	0.3076	10	0.48119	T	0.1	.	19.6454	0.95775	0.0:1.0:0.0:0.0	.	687	Q9H3R1	NDST4_HUMAN	T	687	ENSP00000264363:A687T	ENSP00000264363:A687T	A	-	1	0	NDST4	115986484	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	5.563000	0.67352	2.629000	0.89072	0.655000	0.94253	GCC		0.433	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
JADE1	79960	hgsc.bcm.edu	37	4	129776881	129776881	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr4:129776881G>T	ENST00000226319.6	+	7	1073	c.793G>T	c.(793-795)Ggt>Tgt	p.G265C	PHF17_ENST00000413543.2_Missense_Mutation_p.G265C|PHF17_ENST00000452328.2_Missense_Mutation_p.G253C|PHF17_ENST00000512960.1_Missense_Mutation_p.G265C|PHF17_ENST00000511647.1_Missense_Mutation_p.G265C	NM_199320.2	NP_955352.1												p.G265C(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TCCGAAGAAGGGTGGAGCTAT	0.542																																					p.G265C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G793T	4						.						115.0	107.0	110.0					4																	129776881		2203	4300	6503	129996331	SO:0001583	missense	79960	exon7																														ENST00000226319.6:c.793G>T	4.37:g.129776881G>T	ENSP00000226319:p.Gly265Cys	Somatic		Capture	SOLID	Phase_I	129996331	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	37	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824647	0.71143	.	.	ENSG00000077684	ENST00000226319;ENST00000511647;ENST00000452328;ENST00000512960;ENST00000535321;ENST00000413543	T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25	4.54	4.54	0.55810	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	H	0.98256	4.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	T	0.77550	-0.2546	9	.	.	.	.	17.8523	0.88751	0.0:0.0:1.0:0.0	.	253;265;265	Q6IE81-2;Q6IE81;Q6IE81-3	.;JADE1_HUMAN;.	C	265;265;253;265;265;265	ENSP00000226319:G265C;ENSP00000423737:G265C;ENSP00000388015:G253C;ENSP00000425730:G265C;ENSP00000404211:G265C	.	G	+	1	0	PHF17	129996331	1.000000	0.71417	0.978000	0.43139	0.348000	0.29142	9.266000	0.95659	2.508000	0.84585	0.655000	0.94253	GGT		0.542	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
RWDD4	201965	hgsc.bcm.edu	37	4	184577060	184577060	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr4:184577060A>C	ENST00000326397.5	-	2	351	c.79T>G	c.(79-81)Tta>Gta	p.L27V	RWDD4_ENST00000512740.1_Intron|RNU6-479P_ENST00000516348.1_RNA|RWDD4_ENST00000327570.9_Missense_Mutation_p.L27V|RWDD4_ENST00000510968.1_Intron	NM_152682.2	NP_689895.2	Q6NW29	RWDD4_HUMAN	RWD domain containing 4	27	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.							p.L27V(1)		large_intestine(2)|lung(4)|ovary(1)|prostate(1)	8						ACTGGACTTAATTCCCGGAAA	0.323																																					p.L27V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T79G	4						.						102.0	114.0	110.0					4																	184577060		2202	4297	6499	184814054	SO:0001583	missense	201965	exon2			BC017472	CCDS34111.1	4q35.1	2012-12-07	2010-09-30	2010-09-30	ENSG00000182552	ENSG00000182552			23750	protein-coding gene	gene with protein product			"""family with sequence similarity 28, member A"", ""RWD domain containing 4A"""	FAM28A, RWDD4A			Standard	NM_152682		Approved	MGC10198	uc003ivt.1	Q6NW29	OTTHUMG00000160632	ENST00000326397.5:c.79T>G	4.37:g.184577060A>C	ENSP00000388920:p.Leu27Val	Somatic		Capture	SOLID	Phase_I	184814054	NM_152682	B2RDE9|B4DDP2|Q75LA9|Q8WVW2	Missense_Mutation	SNP	ENST00000326397.5	37	CCDS34111.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596807	0.46318	.	.	ENSG00000182552	ENST00000326397;ENST00000327570;ENST00000506467	T;T	0.21734	1.99;1.99	5.37	4.18	0.49190	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.062472	0.64402	D	0.000007	T	0.11879	0.0289	N	0.26162	0.8	0.52099	D	0.999941	B	0.20550	0.046	B	0.22152	0.038	T	0.11817	-1.0572	10	0.11794	T	0.64	-12.7891	6.3655	0.21453	0.7276:0.0:0.2724:0.0	.	27	Q6NW29	RWDD4_HUMAN	V	27;27;19	ENSP00000388920:L27V;ENSP00000332177:L27V	ENSP00000388920:L27V	L	-	1	2	RWDD4	184814054	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.349000	0.44054	2.035000	0.60131	0.455000	0.32223	TTA		0.323	RWDD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361499.2	NM_152682	
RGAG1	57529	hgsc.bcm.edu	37	X	109694634	109694634	+	Silent	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:109694634G>A	ENST00000465301.2	+	3	1035	c.789G>A	c.(787-789)acG>acA	p.T263T	RGAG1_ENST00000540313.1_Silent_p.T263T	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	263								p.T263T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TGTCAGGCACGGACTCTGAAG	0.488																																					p.T263T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G789A	X						.						143.0	124.0	131.0					X																	109694634		2203	4300	6503	109581290	SO:0001819	synonymous_variant	57529	exon3			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.789G>A	X.37:g.109694634G>A		Somatic		Capture	SOLID	Phase_I	109581290	NM_020769	Q9P2M8	Silent	SNP	ENST00000465301.2	37	CCDS14552.1																																																																																				0.488	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
CDR1	1038	hgsc.bcm.edu	37	X	139865861	139865861	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:139865861C>T	ENST00000370532.2	-	1	862	c.671G>A	c.(670-672)cGt>cAt	p.R224H		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	224								p.R224H(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				GAAAAATCTACGTCTTCCACC	0.448																																					p.R224H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G671A	X						.						119.0	113.0	115.0					X																	139865861		2203	4300	6503	139693527	SO:0001583	missense	1038	exon1				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.671G>A	X.37:g.139865861C>T	ENSP00000359563:p.Arg224His	Somatic		Capture	SOLID	Phase_I	139693527	NM_004065	Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.997007	0.00435	.	.	ENSG00000184258	ENST00000370532	.	.	.	4.58	-9.15	0.00698	.	.	.	.	.	T	0.19927	0.0479	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52917	-0.8511	7	.	.	.	.	15.7901	0.78350	0.0:0.5526:0.3087:0.1387	.	224	P51861	CDR1_HUMAN	H	224	.	.	R	-	2	0	CDR1	139693527	0.000000	0.05858	0.000000	0.03702	0.144000	0.21451	-13.485000	0.00001	-5.748000	0.00010	-1.800000	0.00619	CGT		0.448	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065	
MXRA5	25878	hgsc.bcm.edu	37	X	3228257	3228257	+	Missense_Mutation	SNP	C	C	T	rs143264543	byFrequency	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:3228257C>T	ENST00000217939.6	-	7	8141	c.7987G>A	c.(7987-7989)Ggg>Agg	p.G2663R		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2663	Ig-like C2-type 11.					extracellular vesicular exosome (GO:0070062)		p.G2663R(4)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGCCCAGCCCCGGGAGGGGTG	0.592																																					p.G2663R												.	.	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	c.G7987A	X						.	C	ARG/GLY	1,3834		0,1,0,1631,571	58.0	56.0	57.0		7987	3.6	0.0	X	dbSNP_134	57	1,6726		0,0,1,2428,1870	no	missense	MXRA5	NM_015419.3	125	0,1,1,4059,2441	TT,TC,T,CC,C		0.0149,0.0261,0.0189	benign	2663/2829	3228257	2,10560	2203	4299	6502	3238257	SO:0001583	missense	25878	exon7			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7987G>A	X.37:g.3228257C>T	ENSP00000217939:p.Gly2663Arg	Somatic		Capture	SOLID	Phase_I	3238257	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	3.724	-0.057000	0.07317	2.61E-4	1.49E-4	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.37752	1.18	4.47	3.6	0.41247	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40818	U	0.001009	T	0.49745	0.1575	H	0.94345	3.525	0.09310	N	1	B	0.31227	0.314	B	0.25140	0.058	T	0.53208	-0.8471	10	0.59425	D	0.04	.	14.3756	0.66874	0.0:0.6168:0.3831:0.0	.	2663	Q9NR99	MXRA5_HUMAN	R	2663	ENSP00000217939:G2663R	ENSP00000217939:G2663R	G	-	1	0	MXRA5	3238257	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	0.390000	0.20768	0.713000	0.32060	0.597000	0.82753	GGG		0.592	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
PPEF1	5475	hgsc.bcm.edu	37	X	18842159	18842159	+	Silent	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:18842159C>T	ENST00000361511.4	+	17	2114	c.1620C>T	c.(1618-1620)taC>taT	p.Y540Y	PPEF1_ENST00000349874.5_Silent_p.Y478Y|PPEF1_ENST00000359763.6_Silent_p.Y487Y|PPEF1_ENST00000544635.1_Silent_p.Y475Y|PPEF1_ENST00000543630.1_3'UTR	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	540					detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.Y540Y(1)		breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					ACGTTGAATACATGTCCAGCT	0.433																																					p.Y478Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1434T	X						.						154.0	129.0	138.0					X																	18842159		2203	4300	6503	18752080	SO:0001819	synonymous_variant	5475	exon16			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1620C>T	X.37:g.18842159C>T		Somatic		Capture	SOLID	Phase_I	18752080	NM_152226	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Silent	SNP	ENST00000361511.4	37	CCDS14188.1																																																																																				0.433	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240	
MAP3K15	389840	hgsc.bcm.edu	37	X	19387306	19387306	+	Silent	SNP	C	C	T	rs373031333		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:19387306C>T	ENST00000338883.4	-	25	3431	c.3432G>A	c.(3430-3432)gaG>gaA	p.E1144E	MAP3K15_ENST00000469203.2_Silent_p.E976E|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Silent_p.E579E	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1144							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.E619E(1)|p.E1191E(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					CCCCTTCAGTCTCACAGGTAG	0.612																																					p.E1144E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3432A	X						.	C		1,3834		0,1,1631,571	76.0	69.0	71.0		3432	-0.6	0.0	X		71	0,6728		0,0,2428,1872	no	coding-synonymous	MAP3K15	NM_001001671.3		0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095		1144/1314	19387306	1,10562	2203	4300	6503	19297227	SO:0001819	synonymous_variant	389840	exon25			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3432G>A	X.37:g.19387306C>T		Somatic		Capture	SOLID	Phase_I	19297227	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	ENST00000338883.4	37																																																																																					0.612	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
CDK16	5127	hgsc.bcm.edu	37	X	47086434	47086434	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:47086434G>A	ENST00000357227.4	+	12	1601	c.1177G>A	c.(1177-1179)Gag>Aag	p.E393K	CDK16_ENST00000276052.6_Missense_Mutation_p.E467K|CDK16_ENST00000518022.1_Missense_Mutation_p.E393K|CDK16_ENST00000457458.2_Missense_Mutation_p.E399K	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	393	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)	p.E393K(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						CCTGTCCAACGAGGAGTTCAA	0.587																																					p.E393K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1177A	X						.						71.0	57.0	62.0					X																	47086434		2203	4300	6503	46971378	SO:0001583	missense	5127	exon12				CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.1177G>A	X.37:g.47086434G>A	ENSP00000349762:p.Glu393Lys	Somatic		Capture	SOLID	Phase_I	46971378	NM_006201	A8K280|B7Z7C8|J3KN74|J3KQP7	Missense_Mutation	SNP	ENST00000357227.4	37	CCDS14276.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336579	0.60963	.	.	ENSG00000102225	ENST00000457458;ENST00000357227;ENST00000540877;ENST00000540311;ENST00000518022;ENST00000276052;ENST00000523344	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.89	5.02	0.67125	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.048798	0.85682	D	0.000000	T	0.37293	0.0998	N	0.02213	-0.635	0.80722	D	1	B;B;B	0.31680	0.128;0.335;0.049	B;B;B	0.26416	0.026;0.069;0.008	T	0.41360	-0.9513	10	0.56958	D	0.05	-14.1452	15.0092	0.71536	0.0:0.1394:0.8606:0.0	.	467;491;393	B7Z7C8;B7Z8T0;Q00536	.;.;CDK16_HUMAN	K	399;393;491;345;393;467;150	ENSP00000405798:E399K;ENSP00000349762:E393K;ENSP00000429751:E393K;ENSP00000276052:E467K;ENSP00000428349:E150K	ENSP00000276052:E467K	E	+	1	0	CDK16	46971378	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	7.826000	0.86716	1.239000	0.43787	0.529000	0.55759	GAG		0.587	CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056406.2	NM_006201	
GAGE12J	729396	hgsc.bcm.edu	37	X	49179755	49179755	+	Splice_Site	SNP	G	G	A	rs7064530		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:49179755G>A	ENST00000442437.2	+	2	179	c.83G>A	c.(82-84)cGg>cAg	p.R28Q		NM_001098406.1	NP_001091876.1	A6NER3	GG12J_HUMAN	G antigen 12J	28			R -> Q (in dbSNP:rs7064530).					p.R28Q(2)		kidney(2)|large_intestine(2)|lung(1)|prostate(1)	6	Ovarian(276;0.236)					GGGCCTATGCGGGTGAGTGCT	0.403													-|||	1385	0.366887	0.0719	0.2781	3775	,	,		14005	0.255		0.4046	False		,,,				2504	0.4427				p.R28Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G83A	X						.	G	GLN/ARG	337,2259		36,202,63,870,317	188.0	147.0	162.0		83	-1.9	0.0	X	dbSNP_116	162	2081,2139		529,477,546,598,466	no	missense-near-splice	GAGE12J	NM_001098406.1	43	565,679,609,1468,783	AA,AG,A,GG,G		49.3128,12.9815,35.4754		28/118	49179755	2418,4398	1488	2616	4104	49066699	SO:0001630	splice_region_variant	729396	exon2				CCDS43939.1	Xp11.23	2008-02-05	2007-07-23	2007-07-23	ENSG00000224659	ENSG00000224659			17778	protein-coding gene	gene with protein product		300733	"""G antigen 11"""	GAGE11			Standard	NM_001098406		Approved	OTTHUMG00000024137		A6NER3	OTTHUMG00000024137	ENST00000442437.2:c.84+1G>A	X.37:g.49179755G>A		Somatic		Capture	SOLID	Phase_I	49066699	NM_001098406		Missense_Mutation	SNP	ENST00000442437.2	37	CCDS43939.1	667	0.40204942736588306	39	0.08369098712446352	94	0.3197278911564626	123	0.25840336134453784	251	0.4169435215946844	.	3.395	-0.123402	0.06795	0.129815	0.493128	ENSG00000224659	ENST00000442437	T	0.09911	2.93	0.955	-1.91	0.07641	.	.	.	.	.	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	P;P;P	0.46621	0.881;0.742;0.742	P;B;B	0.45037	0.467;0.372;0.372	T	0.41466	-0.9507	8	0.24483	T	0.36	.	0.0777	0.00028	0.243:0.2112:0.2498:0.296	rs7064530	28;28;28	A6NER3;P0CL81;P0CL80	GG12J_HUMAN;GG12G_HUMAN;GG12F_HUMAN	Q	28	ENSP00000409832:R28Q	ENSP00000409832:R28Q	R	+	2	0	GAGE12J	49066699	0.001000	0.12720	0.000000	0.03702	0.032000	0.12392	-0.705000	0.05052	-2.328000	0.00635	-1.274000	0.01402	CGG		0.403	GAGE12J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060817.1	NM_001098406	Missense_Mutation
AFF2	2334	hgsc.bcm.edu	37	X	147743459	147743459	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chrX:147743459G>T	ENST00000370460.2	+	3	690	c.211G>T	c.(211-213)Gtc>Ttc	p.V71F	AFF2_ENST00000370458.1_Missense_Mutation_p.V67F|AFF2_ENST00000342251.3_Missense_Mutation_p.V67F|AFF2_ENST00000370457.5_Missense_Mutation_p.V67F	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	71					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.V71F(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGCCAACCGAGTCCAGAACAC	0.393																																					p.V71F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G211T	X						.						114.0	114.0	114.0					X																	147743459		2203	4300	6503	147551151	SO:0001583	missense	2334	exon3			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.211G>T	X.37:g.147743459G>T	ENSP00000359489:p.Val71Phe	Somatic		Capture	SOLID	Phase_I	147551151	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616697	0.66672	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000001	T	0.77170	0.4091	L	0.39898	1.24	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.996;0.996;0.996;0.996;0.998;0.999	T	0.79517	-0.1771	10	0.87932	D	0	.	18.4456	0.90682	0.0:0.0:1.0:0.0	.	71;67;67;67;71;67	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	F	71;67;67;67	ENSP00000359489:V71F;ENSP00000359486:V67F;ENSP00000345459:V67F;ENSP00000359487:V67F	ENSP00000345459:V67F	V	+	1	0	AFF2	147551151	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.700000	0.84556	2.297000	0.77311	0.600000	0.82982	GTC		0.393	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
LRP1B	53353	hgsc.bcm.edu	37	2	141200168	141200168	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:141200168T>G	ENST00000389484.3	-	66	11290	c.10319A>C	c.(10318-10320)tAt>tCt	p.Y3440S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3440	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.Y3440S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACACTGGAAATAGTCTGGAGA	0.403										TSP Lung(27;0.18)																											p.Y3440S	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A10319C	2						.						120.0	118.0	119.0					2																	141200168		2203	4300	6503	140916638	SO:0001583	missense	53353	exon66			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10319A>C	2.37:g.141200168T>G	ENSP00000374135:p.Tyr3440Ser	Somatic		Capture	SOLID	Phase_I	140916638	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634741	0.87660	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95137	-3.62	5.47	5.47	0.80525	.	0.162464	0.42053	U	0.000763	D	0.89815	0.6824	N	0.20807	0.61	0.44798	D	0.997803	B	0.27625	0.183	B	0.28916	0.096	D	0.87342	0.2332	10	0.37606	T	0.19	.	15.5588	0.76223	0.0:0.0:0.0:1.0	.	3440	Q9NZR2	LRP1B_HUMAN	S	3440;3378	ENSP00000374135:Y3440S	ENSP00000374135:Y3440S	Y	-	2	0	LRP1B	140916638	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.040000	0.89188	2.063000	0.61619	0.528000	0.53228	TAT		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ACVR1	90	hgsc.bcm.edu	37	2	158622477	158622477	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:158622477T>A	ENST00000263640.3	-	8	1451	c.1022A>T	c.(1021-1023)aAt>aTt	p.N341I	ACVR1_ENST00000434821.1_Missense_Mutation_p.N341I|ACVR1_ENST00000410057.2_Missense_Mutation_p.N341I|ACVR1_ENST00000409283.2_Missense_Mutation_p.N341I	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	341	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.N341I(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	AACCAGAATATTTTTGCTCTT	0.363																																					p.N341I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1022T	2						.						90.0	90.0	90.0					2																	158622477		2203	4300	6503	158330723	SO:0001583	missense	90	exon8				CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.1022A>T	2.37:g.158622477T>A	ENSP00000263640:p.Asn341Ile	Somatic		Capture	SOLID	Phase_I	158330723	NM_001111067		Missense_Mutation	SNP	ENST00000263640.3	37	CCDS2206.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.723056	0.89298	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057	D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.039204	0.85682	D	0.000000	D	0.98166	0.9394	H	0.99659	4.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99802	1.1036	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	341	Q04771	ACVR1_HUMAN	I	341	ENSP00000263640:N341I;ENSP00000387273:N341I;ENSP00000405004:N341I;ENSP00000387127:N341I	ENSP00000263640:N341I	N	-	2	0	ACVR1	158330723	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.970000	0.88000	2.371000	0.80710	0.533000	0.62120	AAT		0.363	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105	
ACVR1	90	hgsc.bcm.edu	37	2	158622630	158622630	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:158622630G>A	ENST00000263640.3	-	8	1298	c.869C>T	c.(868-870)tCg>tTg	p.S290L	ACVR1_ENST00000434821.1_Missense_Mutation_p.S290L|ACVR1_ENST00000410057.2_Missense_Mutation_p.S290L|ACVR1_ENST00000409283.2_Missense_Mutation_p.S290L	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	290	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.S290L(2)		endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	GTCGTACAACGATCCCATTTC	0.413																																					p.S290L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C869T	2						.						105.0	93.0	97.0					2																	158622630		2203	4300	6503	158330876	SO:0001583	missense	90	exon8				CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.869C>T	2.37:g.158622630G>A	ENSP00000263640:p.Ser290Leu	Somatic		Capture	SOLID	Phase_I	158330876	NM_001111067		Missense_Mutation	SNP	ENST00000263640.3	37	CCDS2206.1	.	.	.	.	.	.	.	.	.	.	G	35	5.549165	0.96488	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057	D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98105	0.9375	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98264	1.0500	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	290	Q04771	ACVR1_HUMAN	L	290	ENSP00000263640:S290L;ENSP00000387273:S290L;ENSP00000405004:S290L;ENSP00000387127:S290L	ENSP00000263640:S290L	S	-	2	0	ACVR1	158330876	1.000000	0.71417	0.967000	0.41034	0.979000	0.70002	7.922000	0.87538	2.941000	0.99782	0.655000	0.94253	TCG		0.413	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105	
TTN	7273	hgsc.bcm.edu	37	2	179641601	179641601	+	Missense_Mutation	SNP	G	G	A	rs147695336	byFrequency	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:179641601G>A	ENST00000591111.1	-	28	5214	c.4990C>T	c.(4990-4992)Cgg>Tgg	p.R1664W	TTN_ENST00000360870.5_Missense_Mutation_p.R1664W|TTN_ENST00000460472.2_Missense_Mutation_p.R1618W|TTN_ENST00000589042.1_Missense_Mutation_p.R1664W|TTN_ENST00000342992.6_Missense_Mutation_p.R1664W|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R1618W|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R1618W			Q8WZ42	TITIN_HUMAN	titin	12510			R -> Q (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R1618W(3)|p.R1664W(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATGTCCCCCGTGGGATGATT	0.463																																					p.R1664W												TTN,ovary,NS,Substitution - Missense,+1	.	5	Substitution - Missense(5)	large_intestine(5)	c.C4990T	2						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	74.0	69.0	71.0		4852,4990,4990,4852,4852	2.5	1.0	2	dbSNP_134	71	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	101,101,101,101,101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1618/26927,1664/33424,1664/5605,1618/27052,1618/27119	179641601	2,13004	2203	4300	6503	179349846	SO:0001583	missense	7273	exon28			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4990C>T	2.37:g.179641601G>A	ENSP00000465570:p.Arg1664Trp	Somatic		Capture	SOLID	Phase_I	179349846	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	3.323	-0.138336	0.06669	4.54E-4	0.0	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67698	-0.28;-0.08;-0.11;-0.08;0.12	5.33	2.46	0.29980	Ribonuclease H-like (1);	.	.	.	.	T	0.66626	0.2808	N	0.08118	0	0.24347	N	0.994932	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	P;P;P;P;D	0.70935	0.857;0.857;0.857;0.857;0.971	T	0.66834	-0.5823	9	0.87932	D	0	.	16.1336	0.81461	0.0:0.0:0.4309:0.5691	.	1618;1618;1618;1664;1664	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	W	1664;1618;1618;1618;1618;1664	ENSP00000343764:R1664W;ENSP00000434586:R1618W;ENSP00000340554:R1618W;ENSP00000352154:R1618W;ENSP00000354117:R1664W	ENSP00000340554:R1618W	R	-	1	2	TTN	179349846	1.000000	0.71417	0.989000	0.46669	0.554000	0.35429	3.323000	0.52014	-0.013000	0.14199	-0.824000	0.03097	CGG		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NRP2	8828	hgsc.bcm.edu	37	2	206562286	206562286	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:206562286G>A	ENST00000357785.5	+	2	123	c.92G>A	c.(91-93)cGt>cAt	p.R31H	NRP2_ENST00000417189.1_Missense_Mutation_p.R31H|NRP2_ENST00000360409.3_Missense_Mutation_p.R31H|NRP2_ENST00000540841.1_Missense_Mutation_p.R31H|NRP2_ENST00000412873.2_Missense_Mutation_p.R31H|NRP2_ENST00000540178.1_Missense_Mutation_p.R31H|NRP2_ENST00000272849.3_Missense_Mutation_p.R31H|NRP2_ENST00000357118.4_Missense_Mutation_p.R31H|NRP2_ENST00000355117.4_Missense_Mutation_p.R31H			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R31H(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						TGCGGAGGTCGTTTGAATTCC	0.517																																					p.R31H												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G92A	2						.						306.0	292.0	296.0					2																	206562286		2203	4300	6503	206270531	SO:0001583	missense	8828	exon2			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.92G>A	2.37:g.206562286G>A	ENSP00000350432:p.Arg31His	Somatic		Capture	SOLID	Phase_I	206270531	NM_201266	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000357785.5	37	CCDS46496.1	.	.	.	.	.	.	.	.	.	.	G	10.64	1.407480	0.25378	.	.	ENSG00000118257	ENST00000340626;ENST00000360409;ENST00000540178;ENST00000540841;ENST00000355117;ENST00000450507;ENST00000417189;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	T;T;T;T;T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2	5.37	3.58	0.41010	CUB (5);	0.396529	0.31268	N	0.007945	T	0.20577	0.0495	N	0.03050	-0.425	0.37990	D	0.933888	B;B;D;B;B;B	0.76494	0.022;0.04;0.999;0.265;0.265;0.05	B;B;D;B;B;B	0.76071	0.007;0.007;0.987;0.022;0.022;0.004	T	0.31779	-0.9931	10	0.40728	T	0.16	-8.3327	11.8798	0.52568	0.142:0.0:0.858:0.0	.	31;31;31;31;31;31	O60462-2;O60462-3;O60462;O60462-4;O60462-5;E9PF66	.;.;NRP2_HUMAN;.;.;.	H	31	ENSP00000353582:R31H;ENSP00000439658:R31H;ENSP00000439261:R31H;ENSP00000347238:R31H;ENSP00000404279:R31H;ENSP00000387519:R31H;ENSP00000349632:R31H;ENSP00000350432:R31H;ENSP00000407626:R31H;ENSP00000272849:R31H	ENSP00000272849:R31H	R	+	2	0	NRP2	206270531	0.120000	0.22244	0.888000	0.34837	0.882000	0.50991	2.630000	0.46494	0.640000	0.30582	-0.136000	0.14681	CGT		0.517	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1		
PTH2R	5746	hgsc.bcm.edu	37	2	209358028	209358028	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:209358028C>A	ENST00000272847.2	+	13	1510	c.1297C>A	c.(1297-1299)Ctc>Atc	p.L433I	AC019185.4_ENST00000424628.1_RNA|PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	433					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.L433I(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	TCGGTGGAACCTCTCCGTGGA	0.572																																					p.L433I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1297A	2						.						59.0	60.0	60.0					2																	209358028		2203	4300	6503	209066273	SO:0001583	missense	5746	exon13			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1297C>A	2.37:g.209358028C>A	ENSP00000272847:p.Leu433Ile	Somatic		Capture	SOLID	Phase_I	209066273	NM_005048	Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.248896	0.59103	.	.	ENSG00000144407	ENST00000272847	T	0.73363	-0.74	5.76	3.84	0.44239	.	0.000000	0.41938	D	0.000797	D	0.83718	0.5315	M	0.86502	2.82	0.37872	D	0.930103	D;D	0.60160	0.987;0.987	P;P	0.54856	0.685;0.762	D	0.88218	0.2895	9	.	.	.	.	14.0402	0.64669	0.0:0.713:0.287:0.0	.	322;433	B4DFN8;P49190	.;PTH2R_HUMAN	I	433	ENSP00000272847:L433I	.	L	+	1	0	PTH2R	209066273	0.973000	0.33851	0.975000	0.42487	0.372000	0.29890	1.227000	0.32576	1.407000	0.46875	0.591000	0.81541	CTC		0.572	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
ADAM17	6868	hgsc.bcm.edu	37	2	9650147	9650147	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:9650147C>T	ENST00000310823.3	-	11	1487	c.1305G>A	c.(1303-1305)atG>atA	p.M435I	RP11-400L8.2_ENST00000480764.1_RNA|RP11-400L8.2_ENST00000472619.1_RNA	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	435	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)	p.M435I(1)		breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		CTATGGGATACATGACATATT	0.423																																					p.M435I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1305A	2						.						219.0	192.0	201.0					2																	9650147		2203	4300	6503	9567598	SO:0001583	missense	6868	exon11			U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.1305G>A	2.37:g.9650147C>T	ENSP00000309968:p.Met435Ile	Somatic		Capture	SOLID	Phase_I	9567598	NM_003183	O60226	Missense_Mutation	SNP	ENST00000310823.3	37	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255913	0.80135	.	.	ENSG00000151694	ENST00000310823	D	0.96265	-3.96	5.56	5.56	0.83823	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.98093	0.9371	M	0.93808	3.46	0.80722	D	1	B;B	0.30584	0.286;0.286	B;B	0.43575	0.424;0.424	D	0.98012	1.0366	10	0.72032	D	0.01	.	19.8984	0.96975	0.0:1.0:0.0:0.0	.	435;435	B2RNB2;P78536	.;ADA17_HUMAN	I	435	ENSP00000309968:M435I	ENSP00000309968:M435I	M	-	3	0	ADAM17	9567598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.780000	0.95670	0.585000	0.79938	ATG		0.423	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
LRRTM1	347730	hgsc.bcm.edu	37	2	80530386	80530386	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:80530386G>T	ENST00000295057.3	-	2	1215	c.559C>A	c.(559-561)Ctc>Atc	p.L187I	CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.L187I|CTNNA2_ENST00000466387.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	187					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.L187I(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						AGAAACTTGAGGCTGCGGCAG	0.597										HNSCC(69;0.2)																											p.L187I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C559A	2						.						60.0	65.0	63.0					2																	80530386		2203	4300	6503	80383897	SO:0001583	missense	347730	exon2			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.559C>A	2.37:g.80530386G>T	ENSP00000295057:p.Leu187Ile	Somatic		Capture	SOLID	Phase_I	80383897	NM_178839	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480344	0.63849	.	.	ENSG00000162951	ENST00000295057;ENST00000409148;ENST00000416268	D;D;T	0.88124	-2.34;-2.34;3.04	4.73	4.73	0.59995	.	0.064020	0.64402	U	0.000008	D	0.92564	0.7638	M	0.85630	2.765	0.54753	D	0.999981	D	0.54047	0.964	P	0.55577	0.779	D	0.93359	0.6725	9	.	.	.	.	17.681	0.88243	0.0:0.0:1.0:0.0	.	187	Q86UE6	LRRT1_HUMAN	I	187	ENSP00000295057:L187I;ENSP00000386646:L187I;ENSP00000415368:L187I	.	L	-	1	0	LRRTM1	80383897	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.821000	0.69257	2.124000	0.65301	0.655000	0.94253	CTC		0.597	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
EPHA4	2043	hgsc.bcm.edu	37	2	222291219	222291219	+	Silent	SNP	A	A	G			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr2:222291219A>G	ENST00000281821.2	-	16	2852	c.2811T>C	c.(2809-2811)taT>taC	p.Y937Y	EPHA4_ENST00000469354.1_5'Flank|EPHA4_ENST00000392071.4_Silent_p.Y886Y|EPHA4_ENST00000409854.1_Silent_p.Y937Y|EPHA4_ENST00000409938.1_Silent_p.Y937Y	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	937	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)	p.Y937Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CTAGTGTGGTATAACCAGCAG	0.438																																					p.Y937Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2811C	2						.						92.0	81.0	84.0					2																	222291219		2203	4300	6503	221999463	SO:0001819	synonymous_variant	2043	exon16			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2811T>C	2.37:g.222291219A>G		Somatic		Capture	SOLID	Phase_I	221999463	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Silent	SNP	ENST00000281821.2	37	CCDS2447.1																																																																																				0.438	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
KIAA1958	158405	hgsc.bcm.edu	37	9	115422005	115422005	+	Missense_Mutation	SNP	C	C	T	rs143507007		TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr9:115422005C>T	ENST00000337530.6	+	4	2103	c.1807C>T	c.(1807-1809)Cgg>Tgg	p.R603W	KIAA1958_ENST00000536272.1_Missense_Mutation_p.R631W	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	603								p.R603W(1)		endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CAGCGTCAAGCGGGAGAGTCG	0.582																																					p.R603W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1807T	9						.	C	TRP/ARG	0,4406		0,0,2203	60.0	59.0	59.0		1807	3.8	1.0	9	dbSNP_134	59	1,8599	1.2+/-3.3	0,1,4299	no	missense	KIAA1958	NM_133465.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	603/717	115422005	1,13005	2203	4300	6503	114461826	SO:0001583	missense	158405	exon4			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1807C>T	9.37:g.115422005C>T	ENSP00000336940:p.Arg603Trp	Somatic		Capture	SOLID	Phase_I	114461826	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	37	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600774	0.66332	0.0	1.16E-4	ENSG00000165185	ENST00000337530;ENST00000536272	.	.	.	5.66	3.8	0.43715	.	.	.	.	.	T	0.48857	0.1523	N	0.19112	0.55	0.22521	N	0.999023	D;D	0.89917	1.0;0.999	D;D	0.66979	0.948;0.918	T	0.48822	-0.9001	8	0.66056	D	0.02	.	14.7136	0.69251	0.265:0.735:0.0:0.0	.	631;603	B7ZKW6;Q8N8K9	.;K1958_HUMAN	W	603;631	.	ENSP00000336940:R603W	R	+	1	2	KIAA1958	114461826	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.898000	0.39809	0.724000	0.32296	0.655000	0.94253	CGG		0.582	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
GAPVD1	26130	hgsc.bcm.edu	37	9	128070039	128070039	+	Silent	SNP	T	T	C			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr9:128070039T>C	ENST00000495955.1	+	8	1611	c.1321T>C	c.(1321-1323)Ttg>Ctg	p.L441L	GAPVD1_ENST00000394105.2_Silent_p.L441L|GAPVD1_ENST00000394084.1_Silent_p.L441L|GAPVD1_ENST00000470056.1_Silent_p.L441L|GAPVD1_ENST00000312123.9_Silent_p.L441L|GAPVD1_ENST00000394104.2_Silent_p.L441L|GAPVD1_ENST00000297933.6_Silent_p.L441L|GAPVD1_ENST00000394083.2_Silent_p.L441L|GAPVD1_ENST00000265956.4_Silent_p.L441L			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	441					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.L441L(1)		central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TGACAATTTATTGGCAAACCT	0.418																																					p.L441L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1321C	9						.						112.0	112.0	112.0					9																	128070039		2203	4300	6503	127109860	SO:0001819	synonymous_variant	26130	exon6				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.1321T>C	9.37:g.128070039T>C		Somatic		Capture	SOLID	Phase_I	127109860	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Silent	SNP	ENST00000495955.1	37		.	.	.	.	.	.	.	.	.	.	T	9.466	1.094287	0.20471	.	.	ENSG00000165219	ENST00000436712	.	.	.	5.62	0.539	0.17156	.	.	.	.	.	T	0.57784	0.2077	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51772	-0.8663	4	.	.	.	.	9.9654	0.41721	0.0:0.4694:0.0:0.5306	.	.	.	.	T	271	.	.	I	+	2	0	GAPVD1	127109860	0.996000	0.38824	0.996000	0.52242	0.994000	0.84299	0.328000	0.19681	0.093000	0.17368	0.460000	0.39030	ATT		0.418	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
TUBA3C	7278	hgsc.bcm.edu	37	13	19752429	19752429	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr13:19752429C>A	ENST00000400113.3	-	3	436	c.332G>T	c.(331-333)gGc>gTc	p.G111V		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	111					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G111V(2)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GATCTCCTTGCCGATGGTGTA	0.542																																					p.G111V												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G332T	13						.						221.0	188.0	199.0					13																	19752429		2203	4300	6503	18650429	SO:0001583	missense	7278	exon3			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.332G>T	13.37:g.19752429C>A	ENSP00000382982:p.Gly111Val	Somatic		Capture	SOLID	Phase_I	18650429	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	37	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	c	14.30	2.494904	0.44352	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.76448	-1.02	1.53	1.53	0.23141	.	0.000000	0.48286	U	0.000197	T	0.80523	0.4639	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.81004	-0.1129	7	0.72032	D	0.01	.	9.0464	0.36349	0.0:1.0:0.0:0.0	.	.	.	.	V	111	ENSP00000382982:G111V	ENSP00000354037:G111V	G	-	2	0	TUBA3C	18650429	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	6.331000	0.72929	1.161000	0.42604	0.423000	0.28283	GGC		0.542	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
CTNNA1	1495	hgsc.bcm.edu	37	5	138163319	138163319	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3520-01A-01W-0831-10	TCGA-AA-3520-10A-01W-0831-10	g.chr5:138163319C>T	ENST00000302763.7	+	7	1064	c.974C>T	c.(973-975)aCg>aTg	p.T325M	CTNNA1_ENST00000355078.5_Missense_Mutation_p.T222M|CTNNA1_ENST00000518825.1_Missense_Mutation_p.T325M	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	325	Interaction with alpha-actinin.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.T325M(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCGTCCTGCACGCGTGATGAC	0.582																																					p.T325M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C974T	5						.						113.0	98.0	103.0					5																	138163319		2203	4300	6503	138191218	SO:0001583	missense	1495	exon7			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.974C>T	5.37:g.138163319C>T	ENSP00000304669:p.Thr325Met	Somatic		Capture	SOLID	Phase_I	138191218	NM_001903	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.034363	0.93575	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825	T;T;T	0.39997	1.05;1.05;1.05	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.68732	0.3033	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.98;0.984;0.984	T	0.70757	-0.4785	10	0.72032	D	0.01	-15.9845	19.8512	0.96741	0.0:1.0:0.0:0.0	.	325;202;325	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	M	222;325;325;310;325	ENSP00000347190:T222M;ENSP00000304669:T325M;ENSP00000427821:T325M	ENSP00000304669:T325M	T	+	2	0	CTNNA1	138191218	1.000000	0.71417	0.972000	0.41901	0.790000	0.44656	7.776000	0.85560	2.797000	0.96272	0.563000	0.77884	ACG		0.582	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
