#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
STK31	56164	hgsc.bcm.edu	37	7	23826466	23826466	+	Missense_Mutation	SNP	A	A	T	rs373913070		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr7:23826466A>T	ENST00000355870.3	+	20	2529	c.2410A>T	c.(2410-2412)Atg>Ttg	p.M804L	STK31_ENST00000428484.1_Missense_Mutation_p.M781L|STK31_ENST00000354639.3_Missense_Mutation_p.M781L|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.M804L	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	804	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.M804L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GTCTGATCCTATGGCTTATCT	0.343																																					p.M781L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2341T	7						.						190.0	171.0	177.0					7																	23826466		2203	4300	6503	23792991	SO:0001583	missense	56164	exon20			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2410A>T	7.37:g.23826466A>T	ENSP00000348132:p.Met804Leu	Somatic		Capture	SOLID	Phase_I	23792991	NM_001122833	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	A	0.669	-0.802528	0.02841	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.17	-2.17	0.07059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.392618	0.25698	N	0.028890	T	0.15998	0.0385	N	0.00493	-1.44	0.23886	N	0.996567	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35748	-0.9776	10	0.02654	T	1	-1.889	1.8363	0.03141	0.2091:0.3697:0.2708:0.1504	.	804;804	B4DZ06;Q9BXU1	.;STK31_HUMAN	L	804;804;781;781	ENSP00000348132:M804L;ENSP00000411852:M804L;ENSP00000346660:M781L;ENSP00000406146:M781L	ENSP00000346660:M781L	M	+	1	0	STK31	23792991	0.504000	0.26123	0.992000	0.48379	0.574000	0.36063	-0.307000	0.08167	-0.204000	0.10235	0.397000	0.26171	ATG		0.343	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
TRIP6	7205	hgsc.bcm.edu	37	7	100469219	100469219	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr7:100469219C>T	ENST00000200457.4	+	7	1414	c.1054C>T	c.(1054-1056)Cgg>Tgg	p.R352W		NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	352	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)	p.R352W(2)		breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCGGATCCTGCGGGCTATGGG	0.642																																					p.R352W												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1054T	7						.						90.0	69.0	76.0					7																	100469219		2203	4300	6503	100307155	SO:0001583	missense	7205	exon7			L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.1054C>T	7.37:g.100469219C>T	ENSP00000200457:p.Arg352Trp	Somatic		Capture	SOLID	Phase_I	100307155	NM_003302	A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Missense_Mutation	SNP	ENST00000200457.4	37	CCDS5708.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.731176	0.69189	.	.	ENSG00000087077	ENST00000200457	D	0.88664	-2.41	4.43	3.51	0.40186	Zinc finger, LIM-type (5);	0.000000	0.64402	D	0.000001	D	0.95255	0.8461	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94641	0.7830	10	0.87932	D	0	.	9.4426	0.38677	0.385:0.615:0.0:0.0	.	352	Q15654	TRIP6_HUMAN	W	352	ENSP00000200457:R352W	ENSP00000200457:R352W	R	+	1	2	TRIP6	100307155	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	1.502000	0.35704	0.785000	0.33685	0.650000	0.86243	CGG		0.642	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347151.2	NM_003302	
SLC23A2	9962	hgsc.bcm.edu	37	20	4866479	4866479	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr20:4866479A>G	ENST00000379333.1	-	7	951	c.559T>C	c.(559-561)Tgt>Cgt	p.C187R	SLC23A2_ENST00000468355.1_5'UTR|SLC23A2_ENST00000338244.1_Missense_Mutation_p.C187R|SLC23A2_ENST00000424750.2_Intron	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	187					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.C187R(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GTGGTGTTACATTTCCATTTA	0.473																																					p.C187R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T559C	20						.						88.0	75.0	80.0					20																	4866479		2203	4300	6503	4814479	SO:0001583	missense	9962	exon7			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.559T>C	20.37:g.4866479A>G	ENSP00000368637:p.Cys187Arg	Somatic		Capture	SOLID	Phase_I	4814479	NM_203327	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	37	CCDS13085.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.022911	0.75275	.	.	ENSG00000089057	ENST00000379333;ENST00000338244	T;T	0.17528	2.27;2.27	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.50274	0.1606	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60367	-0.7277	10	0.87932	D	0	-14.4528	15.012	0.71557	1.0:0.0:0.0:0.0	.	187;187	A0MSJ5;Q9UGH3	.;S23A2_HUMAN	R	187	ENSP00000368637:C187R;ENSP00000344322:C187R	ENSP00000344322:C187R	C	-	1	0	SLC23A2	4814479	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.313000	0.96297	2.216000	0.71823	0.528000	0.53228	TGT		0.473	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
BPIFB4	149954	hgsc.bcm.edu	37	20	31673879	31673879	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr20:31673879C>T	ENST00000375483.3	+	5	835	c.835C>T	c.(835-837)Cgg>Tgg	p.R279W		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	279						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.R240W(1)									AGCCAAGGTCCGGCTGACCAT	0.597																																					p.R279W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C835T	20						.						128.0	108.0	115.0					20																	31673879		2203	4300	6503	31137540	SO:0001583	missense	149954	exon5			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.835C>T	20.37:g.31673879C>T	ENSP00000364632:p.Arg279Trp	Somatic		Capture	SOLID	Phase_I	31137540	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	C	19.59	3.857005	0.71834	.	.	ENSG00000186191	ENST00000375483	T	0.06294	3.32	3.94	3.94	0.45596	.	0.309810	0.26058	N	0.026584	T	0.14313	0.0346	L	0.61218	1.895	0.39108	D	0.961412	D	0.65815	0.995	P	0.53490	0.727	T	0.01456	-1.1350	10	0.62326	D	0.03	-4.2009	11.3408	0.49531	0.0:1.0:0.0:0.0	.	279	P59827	BPIB4_HUMAN	W	279	ENSP00000364632:R279W	ENSP00000364632:R279W	R	+	1	2	BPIFB4	31137540	0.998000	0.40836	1.000000	0.80357	0.942000	0.58702	0.743000	0.26231	2.028000	0.59812	0.491000	0.48974	CGG		0.597	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
SLC8A3	6547	hgsc.bcm.edu	37	14	70633663	70633663	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr14:70633663G>T	ENST00000381269.2	-	2	2230	c.1477C>A	c.(1477-1479)Cag>Aag	p.Q493K	SLC8A3_ENST00000528359.1_Missense_Mutation_p.Q493K|SLC8A3_ENST00000357887.3_Missense_Mutation_p.Q493K|SLC8A3_ENST00000356921.2_Missense_Mutation_p.Q493K|SLC8A3_ENST00000534137.1_Missense_Mutation_p.Q493K	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	493					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.Q493K(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TCCTCTGGCTGCTCCTCCTCT	0.517																																					p.Q493K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1477A	14						.						95.0	98.0	97.0					14																	70633663		2203	4300	6503	69703416	SO:0001583	missense	6547	exon2			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1477C>A	14.37:g.70633663G>T	ENSP00000370669:p.Gln493Lys	Somatic		Capture	SOLID	Phase_I	69703416	NM_033262	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	G	0.154	-1.088271	0.01873	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.54	4.59	0.56863	.	0.000000	0.50627	D	0.000109	T	0.18467	0.0443	N	0.08118	0	0.21762	N	0.999551	B;B;B;B	0.09022	0.001;0.002;0.002;0.002	B;B;B;B	0.16722	0.016;0.01;0.01;0.01	T	0.07520	-1.0768	10	0.06891	T	0.86	.	15.0811	0.72117	0.0:0.2251:0.7749:0.0	.	493;493;493;493	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	K	493	ENSP00000349392:Q493K;ENSP00000370669:Q493K;ENSP00000350560:Q493K;ENSP00000436688:Q493K;ENSP00000433531:Q493K	ENSP00000349392:Q493K	Q	-	1	0	SLC8A3	69703416	0.936000	0.31750	0.853000	0.33588	0.951000	0.60555	2.713000	0.47194	2.592000	0.87571	0.650000	0.86243	CAG		0.517	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
SEZ6L	23544	hgsc.bcm.edu	37	22	26688787	26688787	+	Silent	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr22:26688787G>A	ENST00000248933.6	+	2	605	c.510G>A	c.(508-510)ccG>ccA	p.P170P	SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000360929.3_Silent_p.P170P|SEZ6L_ENST00000404234.3_Silent_p.P170P|SEZ6L_ENST00000343706.4_Silent_p.P170P|SEZ6L_ENST00000529632.2_Silent_p.P170P			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	170					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.P170P(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CGGGGGACCCGGACCCCATCG	0.667																																					p.P170P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G510A	22						.						37.0	39.0	38.0					22																	26688787		2203	4300	6503	25018787	SO:0001819	synonymous_variant	23544	exon2			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.510G>A	22.37:g.26688787G>A		Somatic		Capture	SOLID	Phase_I	25018787	NM_001184776	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	ENST00000248933.6	37	CCDS13833.1																																																																																				0.667	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
SIN3B	23309	hgsc.bcm.edu	37	19	16942330	16942330	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr19:16942330C>T	ENST00000248054.5	+	3	274	c.253C>T	c.(253-255)Cgt>Tgt	p.R85C	SIN3B_ENST00000379803.1_Missense_Mutation_p.R85C|SIN3B_ENST00000596802.1_Missense_Mutation_p.R85C					SIN3 transcription regulator family member B									p.R85C(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						AGTCATCAGACGTGTCTCGCA	0.448																																					p.R85C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C253T	19						.						220.0	210.0	214.0					19																	16942330		2203	4300	6503	16803330	SO:0001583	missense	23309	exon3			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.253C>T	19.37:g.16942330C>T	ENSP00000248054:p.Arg85Cys	Somatic		Capture	SOLID	Phase_I	16803330	NM_015260		Missense_Mutation	SNP	ENST00000248054.5	37		.	.	.	.	.	.	.	.	.	.	C	17.72	3.457959	0.63401	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.57595	0.39;0.4	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.78444	0.4284	H	0.94345	3.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.83937	0.0309	10	0.87932	D	0	-16.1578	11.7829	0.52026	0.1756:0.8244:0.0:0.0	.	85;85;85	O75182-2;O75182;O75182-3	.;SIN3B_HUMAN;.	C	85	ENSP00000369131:R85C;ENSP00000248054:R85C	ENSP00000248054:R85C	R	+	1	0	SIN3B	16803330	0.996000	0.38824	0.627000	0.29227	0.911000	0.54048	1.573000	0.36472	2.136000	0.66102	0.455000	0.32223	CGT		0.448	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
LENG8	114823	hgsc.bcm.edu	37	19	54966191	54966191	+	Silent	SNP	C	C	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr19:54966191C>A	ENST00000326764.5	+	7	1220	c.741C>A	c.(739-741)acC>acA	p.T247T	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	210								p.T247T(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CTGTTACCACCCAGAGCTTTG	0.602																																					p.T247T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C741A	19						.						72.0	68.0	70.0					19																	54966191		2203	4300	6503	59658003	SO:0001819	synonymous_variant	114823	exon7			AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.741C>A	19.37:g.54966191C>A		Somatic		Capture	SOLID	Phase_I	59658003	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	ENST00000326764.5	37	CCDS12894.1																																																																																				0.602	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
EXTL3	2137	hgsc.bcm.edu	37	8	28574278	28574278	+	Silent	SNP	C	C	T	rs367674865		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr8:28574278C>T	ENST00000220562.4	+	3	1604	c.702C>T	c.(700-702)atC>atT	p.I234I	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	234					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.I234I(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		ATGCAGACATCGCCTGCCTTT	0.542																																					p.I234I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C702T	8						.	C		0,4406		0,0,2203	85.0	84.0	84.0		702	-1.4	1.0	8		84	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EXTL3	NM_001440.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		234/920	28574278	1,13005	2203	4300	6503	28630197	SO:0001819	synonymous_variant	2137	exon3			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.702C>T	8.37:g.28574278C>T		Somatic		Capture	SOLID	Phase_I	28630197	NM_001440	D3DST8|O00225|Q53XT3	Silent	SNP	ENST00000220562.4	37	CCDS6070.1																																																																																				0.542	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
UBE4B	10277	hgsc.bcm.edu	37	1	10192508	10192508	+	Missense_Mutation	SNP	G	G	A	rs140051271	byFrequency	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr1:10192508G>A	ENST00000253251.8	+	14	2445	c.1606G>A	c.(1606-1608)Gtc>Atc	p.V536I	UBE4B_ENST00000475795.1_3'UTR|UBE4B_ENST00000377157.3_Missense_Mutation_p.V420I|UBE4B_ENST00000343090.6_Missense_Mutation_p.V665I					ubiquitination factor E4B									p.V536I(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GGCGGCTGTCGTCAATGCCAA	0.398																																					p.V665I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1993A	1						.	G	ILE/VAL,ILE/VAL	4,4402	8.1+/-20.4	0,4,2199	74.0	71.0	72.0		1993,1606	5.9	1.0	1	dbSNP_134	72	0,8600		0,0,4300	no	missense,missense	UBE4B	NM_001105562.2,NM_006048.4	29,29	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign,benign	665/1303,536/1174	10192508	4,13002	2203	4300	6503	10115095	SO:0001583	missense	10277	exon15			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.1606G>A	1.37:g.10192508G>A	ENSP00000253251:p.Val536Ile	Somatic		Capture	SOLID	Phase_I	10115095	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846853	0.91277	9.08E-4	0.0	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.35048	1.33;1.33;1.33	5.92	5.92	0.95590	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	N	0.20685	0.6	0.80722	D	1	B;P;B	0.39665	0.425;0.682;0.371	B;B;B	0.29716	0.106;0.106;0.064	T	0.02991	-1.1085	10	0.27082	T	0.32	-25.6586	20.3206	0.98668	0.0:0.0:1.0:0.0	.	536;665;536	A8K8S9;O95155;O95155-2	.;UBE4B_HUMAN;.	I	536;420;665	ENSP00000253251:V536I;ENSP00000366362:V420I;ENSP00000343001:V665I	ENSP00000253251:V536I	V	+	1	0	UBE4B	10115095	1.000000	0.71417	0.973000	0.42090	0.997000	0.91878	7.986000	0.88173	2.809000	0.96659	0.655000	0.94253	GTC		0.398	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
SPEN	23013	hgsc.bcm.edu	37	1	16260440	16260440	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr1:16260440C>T	ENST00000375759.3	+	11	7909	c.7705C>T	c.(7705-7707)Cat>Tat	p.H2569Y		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2569	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.H2569Y(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCCTTGCCTACATGAGGCCCC	0.522																																					p.H2569Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7705T	1						.						94.0	102.0	99.0					1																	16260440		2203	4300	6503	16133027	SO:0001583	missense	23013	exon11				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7705C>T	1.37:g.16260440C>T	ENSP00000364912:p.His2569Tyr	Somatic		Capture	SOLID	Phase_I	16133027	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	C	8.910	0.958382	0.18507	.	.	ENSG00000065526	ENST00000375759	T	0.08370	3.1	5.38	4.45	0.53987	.	.	.	.	.	T	0.07007	0.0178	L	0.36672	1.1	0.24499	N	0.994266	P	0.38110	0.618	B	0.25759	0.063	T	0.21895	-1.0232	9	0.62326	D	0.03	-11.52	12.536	0.56142	0.0:0.5803:0.4197:0.0	.	2569	Q96T58	MINT_HUMAN	Y	2569	ENSP00000364912:H2569Y	ENSP00000364912:H2569Y	H	+	1	0	SPEN	16133027	1.000000	0.71417	0.909000	0.35828	0.767000	0.43475	3.246000	0.51414	2.537000	0.85549	0.561000	0.74099	CAT		0.522	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SYT6	148281	hgsc.bcm.edu	37	1	114680260	114680260	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr1:114680260G>A	ENST00000610222.1	-	3	1074	c.928C>T	c.(928-930)Cgc>Tgc	p.R310C	SYT6_ENST00000393296.1_Missense_Mutation_p.R310C|SYT6_ENST00000607941.1_Missense_Mutation_p.R225C|SYT6_ENST00000609117.1_Missense_Mutation_p.R225C|SYT6_ENST00000369547.1_Missense_Mutation_p.R225C			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	310	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.R225C(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCAGCTTGCGGTCAGCCAGC	0.572																																					p.R225C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C673T	1						.						116.0	106.0	109.0					1																	114680260		2203	4300	6503	114481783	SO:0001583	missense	148281	exon3				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.928C>T	1.37:g.114680260G>A	ENSP00000476396:p.Arg310Cys	Somatic		Capture	SOLID	Phase_I	114481783	NM_205848	B1AMB8|B3KPK1	Missense_Mutation	SNP	ENST00000610222.1	37		.	.	.	.	.	.	.	.	.	.	G	18.80	3.701927	0.68501	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.08546	3.08;3.08;3.08;3.08	5.46	4.55	0.56014	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.047471	0.85682	N	0.000000	T	0.15003	0.0362	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00885	-1.1527	10	0.72032	D	0.01	.	7.8821	0.29629	0.0803:0.0:0.6587:0.2609	.	310	Q5T7P8	SYT6_HUMAN	C	225;310;225;310	ENSP00000358560:R225C;ENSP00000376974:R310C;ENSP00000358559:R225C;ENSP00000358558:R310C	ENSP00000358558:R310C	R	-	1	0	SYT6	114481783	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.939000	0.56591	1.325000	0.45301	-0.126000	0.14955	CGC		0.572	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848	
CSMD2	114784	hgsc.bcm.edu	37	1	34164425	34164425	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr1:34164425G>A	ENST00000373380.1	-	3	692	c.472C>T	c.(472-474)Cgg>Tgg	p.R158W	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.R1285W			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1245	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R1245W(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCACTACCCCGCAGGCTGTAT	0.602																																					p.R1245W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3733T	1						.						81.0	78.0	79.0					1																	34164425		2203	4300	6503	33937012	SO:0001583	missense	114784	exon24			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.472C>T	1.37:g.34164425G>A	ENSP00000362478:p.Arg158Trp	Somatic		Capture	SOLID	Phase_I	33937012	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		.	.	.	.	.	.	.	.	.	.	G	19.54	3.847745	0.71603	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.65732	-0.17;-0.17	5.76	4.83	0.62350	Complement control module (2);Sushi/SCR/CCP (3);	0.064952	0.64402	D	0.000009	T	0.75398	0.3844	M	0.62266	1.93	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;P;P	0.69307	0.963;0.892;0.892	T	0.78157	-0.2313	10	0.66056	D	0.02	.	14.5371	0.67969	0.0:0.0:0.735:0.265	.	158;1245;1285	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	W	1285;158	ENSP00000362479:R1285W;ENSP00000362478:R158W	ENSP00000241312:R1245W	R	-	1	2	CSMD2	33937012	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.128000	0.42045	1.522000	0.49001	0.650000	0.86243	CGG		0.602	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
DISP1	84976	hgsc.bcm.edu	37	1	223177974	223177974	+	Missense_Mutation	SNP	G	G	A	rs76611705	byFrequency	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr1:223177974G>A	ENST00000284476.6	+	8	3399	c.3235G>A	c.(3235-3237)Gtg>Atg	p.V1079M		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1079					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.V1079M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TCTGAGTCGCGTGGGCTCTGC	0.587													A|||	186	0.0371406	0.0	0.0101	5008	,	,		21025	0.0685		0.0159	False		,,,				2504	0.0961				p.V1079M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3235A	1						.	A	MET/VAL	24,4382	824.2+/-416.5	0,24,2179	73.0	69.0	70.0		3235	5.9	1.0	1	dbSNP_132	70	151,8449	812.5+/-407.1	5,141,4154	yes	missense	DISP1	NM_032890.3	21	5,165,6333	AA,AG,GG		1.7558,0.5447,1.3455	benign	1079/1525	223177974	175,12831	2203	4300	6503	221244597	SO:0001583	missense	84976	exon8			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.3235G>A	1.37:g.223177974G>A	ENSP00000284476:p.Val1079Met	Somatic		Capture	SOLID	Phase_I	221244597	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	CCDS1536.1	46	0.021062271062271064	0	0.0	3	0.008287292817679558	32	0.055944055944055944	11	0.014511873350923483	A	7.955	0.745759	0.15710	0.005447	0.017558	ENSG00000154309	ENST00000284476	D	0.86230	-2.09	5.95	5.95	0.96441	.	0.146747	0.85682	N	0.000000	T	0.13500	0.0327	N	0.00278	-1.715	0.22961	N	0.998502	B	0.02656	0.0	B	0.01281	0.0	T	0.38200	-0.9672	10	0.02654	T	1	-36.681	12.1765	0.54188	0.9336:0.0:0.0664:0.0	.	1079	Q96F81	DISP1_HUMAN	M	1079	ENSP00000284476:V1079M	ENSP00000284476:V1079M	V	+	1	0	DISP1	221244597	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.476000	0.81055	1.082000	0.41137	-0.490000	0.04691	GTG		0.587	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
ATM	472	hgsc.bcm.edu	37	11	108186757	108186757	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr11:108186757G>A	ENST00000452508.2	+	43	6304	c.6115G>A	c.(6115-6117)Gaa>Aaa	p.E2039K	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.E2039K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2039	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.E2039K(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATATGAACACGAAGCAATGTG	0.398			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.E2039K		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6115A	11						.						103.0	93.0	96.0					11																	108186757		2201	4298	6499	107691967	SO:0001583	missense	472	exon42	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6115G>A	11.37:g.108186757G>A	ENSP00000388058:p.Glu2039Lys	Somatic		Capture	SOLID	Phase_I	107691967	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819217	0.71028	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.02015	4.5;4.5	5.24	5.24	0.73138	PIK-related kinase (1);Armadillo-type fold (1);	0.213177	0.48767	D	0.000164	T	0.12987	0.0315	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.67548	0.952	T	0.00376	-1.1779	10	0.49607	T	0.09	.	17.0101	0.86404	0.0:0.0:1.0:0.0	.	2039	Q13315	ATM_HUMAN	K	2039	ENSP00000278616:E2039K;ENSP00000388058:E2039K	ENSP00000278616:E2039K	E	+	1	0	ATM	107691967	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	9.101000	0.94219	2.447000	0.82792	0.305000	0.20034	GAA		0.398	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
VWA5A	4013	hgsc.bcm.edu	37	11	124007918	124007918	+	Missense_Mutation	SNP	G	G	A	rs193166573	byFrequency	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr11:124007918G>A	ENST00000456829.2	+	15	2073	c.1822G>A	c.(1822-1824)Gtc>Atc	p.V608I	VWA5A_ENST00000360334.4_Intron|VWA5A_ENST00000392748.1_Missense_Mutation_p.V608I	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	608								p.V608I(1)		autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						TCATAGGGACGTCCCAAGGCC	0.443													g|||	4	0.000798722	0.003	0.0	5008	,	,		16902	0.0		0.0	False		,,,				2504	0.0				p.V608I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1822A	11						.	A	ILE/VAL,ILE/VAL	2,4400	4.2+/-10.8	0,2,2199	61.0	65.0	64.0		1822,1822	0.4	0.0	11		64	0,8598		0,0,4299	yes	missense,missense	VWA5A	NM_001130142.1,NM_014622.4	29,29	0,2,6498	AA,AG,GG		0.0,0.0454,0.0154	benign,benign	608/787,608/787	124007918	2,12998	2201	4299	6500	123513128	SO:0001583	missense	4013	exon14			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.1822G>A	11.37:g.124007918G>A	ENSP00000407726:p.Val608Ile	Somatic		Capture	SOLID	Phase_I	123513128	NM_014622	Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	ENST00000456829.2	37	CCDS8444.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	g	0.785	-0.761003	0.02996	4.54E-4	0.0	ENSG00000110002	ENST00000456829;ENST00000392748	T;T	0.03745	3.82;3.82	5.28	0.393	0.16294	.	0.326431	0.33023	N	0.005364	T	0.00815	0.0027	N	0.01482	-0.84	0.26106	N	0.980744	B	0.02656	0.0	B	0.04013	0.001	T	0.48246	-0.9052	10	0.02654	T	1	-12.0668	9.4076	0.38471	0.5935:0.0:0.4065:0.0	.	608	O00534	VMA5A_HUMAN	I	608	ENSP00000407726:V608I;ENSP00000376504:V608I	ENSP00000376504:V608I	V	+	1	0	VWA5A	123513128	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.309000	0.08145	-0.207000	0.10187	-0.269000	0.10298	GTC		0.443	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622	
LDHC	3948	hgsc.bcm.edu	37	11	18451362	18451362	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr11:18451362C>A	ENST00000541669.1	+	4	434	c.323C>A	c.(322-324)gCc>gAc	p.A108D	LDHC_ENST00000535809.1_Missense_Mutation_p.A108D|LDHC_ENST00000537486.1_Missense_Mutation_p.A108D|LDHC_ENST00000544105.1_Missense_Mutation_p.A108D|LDHC_ENST00000280704.4_Missense_Mutation_p.A108D|LDHC_ENST00000536880.1_Missense_Mutation_p.A94D|LDHC_ENST00000546146.1_Intron			P07864	LDHC_HUMAN	lactate dehydrogenase C	108					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)	p.A108D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACTCGCCTTGCCCTGGTCCAA	0.403																																					p.A108D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C323A	11						.						135.0	118.0	124.0					11																	18451362		2199	4293	6492	18407938	SO:0001583	missense	3948	exon4			AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.323C>A	11.37:g.18451362C>A	ENSP00000437783:p.Ala108Asp	Somatic		Capture	SOLID	Phase_I	18407938	NM_002301	D3DQY4|Q6GSG8|Q7Z7J4	Missense_Mutation	SNP	ENST00000541669.1	37	CCDS7840.1	.	.	.	.	.	.	.	.	.	.	C	2.725	-0.265699	0.05754	.	.	ENSG00000166796	ENST00000541669;ENST00000280704;ENST00000536880;ENST00000537486;ENST00000544105;ENST00000535809	D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	4.51	-6.71	0.01760	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.836661	0.10477	N	0.670096	T	0.42562	0.1208	N	0.00028	-2.635	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.0;0.003	T	0.53330	-0.8454	10	0.13853	T	0.58	2.0491	20.2437	0.98389	0.7793:0.2207:0.0:0.0	.	108;108	G3XAP5;P07864	.;LDHC_HUMAN	D	108;108;94;108;108;108	ENSP00000437783:A108D;ENSP00000280704:A108D;ENSP00000439555:A94D;ENSP00000441478:A108D;ENSP00000439060:A108D;ENSP00000443997:A108D	ENSP00000280704:A108D	A	+	2	0	LDHC	18407938	0.020000	0.18652	0.000000	0.03702	0.000000	0.00434	1.600000	0.36762	-1.370000	0.02144	-3.073000	0.00066	GCC		0.403	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448	
SERPING1	710	hgsc.bcm.edu	37	11	57373502	57373502	+	Silent	SNP	C	C	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr11:57373502C>A	ENST00000278407.4	+	5	932	c.705C>A	c.(703-705)acC>acA	p.T235T	SERPING1_ENST00000378323.4_Silent_p.T240T|SERPING1_ENST00000340687.6_Silent_p.T235T|SERPING1_ENST00000403558.1_Silent_p.T269T|SERPING1_ENST00000378324.2_Silent_p.T183T|SERPING1_ENST00000531605.1_3'UTR	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	235					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.T235T(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						TAAGGGACACCTTTGTGAATG	0.537																																					p.T235T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C705A	11						.						166.0	157.0	160.0					11																	57373502		2201	4296	6497	57130078	SO:0001819	synonymous_variant	710	exon5			X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.705C>A	11.37:g.57373502C>A		Somatic		Capture	SOLID	Phase_I	57130078	NM_000062	A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Silent	SNP	ENST00000278407.4	37	CCDS7962.1																																																																																				0.537	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317465.1	NM_000062	
NTM	50863	hgsc.bcm.edu	37	11	132204948	132204948	+	Missense_Mutation	SNP	G	G	A	rs376123129		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr11:132204948G>A	ENST00000374786.1	+	7	1422	c.943G>A	c.(943-945)Gcc>Acc	p.A315T	NTM_ENST00000425719.2_Missense_Mutation_p.A326T|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_Missense_Mutation_p.A315T|NTM_ENST00000539799.1_Missense_Mutation_p.A326T|NTM_ENST00000427481.2_Missense_Mutation_p.A317T	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	315					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.A315T(2)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						AGGTCCAGGCGCCGTCAGCGA	0.592																																					p.A326T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G976A	11						.	G	THR/ALA,THR/ALA,THR/ALA	1,4401	2.1+/-5.4	0,1,2200	105.0	108.0	107.0		943,976,943	5.3	0.1	11		107	0,8594		0,0,4297	no	missense,missense,missense	NTM	NM_001048209.1,NM_001144058.1,NM_016522.2	58,58,58	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	315/345,326/356,315/345	132204948	1,12995	2201	4297	6498	131710158	SO:0001583	missense	50863	exon8			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.943G>A	11.37:g.132204948G>A	ENSP00000363918:p.Ala315Thr	Somatic		Capture	SOLID	Phase_I	131710158	NM_001144058	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548487	0.45383	2.27E-4	0.0	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719	T;T;T;T;T	0.60424	0.19;0.26;0.21;0.2;0.24	5.27	5.27	0.74061	.	0.121213	0.56097	D	0.000029	T	0.53546	0.1803	L	0.39020	1.185	0.51482	D	0.999922	P;P;P;D;P;P	0.54601	0.944;0.944;0.909;0.967;0.791;0.938	P;P;B;P;B;B	0.47075	0.536;0.455;0.312;0.473;0.115;0.428	T	0.48305	-0.9047	10	0.22706	T	0.39	-18.7578	16.7173	0.85400	0.0:0.0:1.0:0.0	.	326;317;274;326;315;315	B7Z1Z5;B7Z1I4;B7Z1H3;Q9P121-4;Q9P121;Q9P121-2	.;.;.;.;NTRI_HUMAN;.	T	315;326;317;315;326	ENSP00000363923:A315T;ENSP00000437668:A326T;ENSP00000416320:A317T;ENSP00000363918:A315T;ENSP00000396722:A326T	ENSP00000363918:A315T	A	+	1	0	NTM	131710158	0.981000	0.34729	0.106000	0.21319	0.090000	0.18270	4.185000	0.58330	2.474000	0.83562	0.650000	0.86243	GCC		0.592	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
UTRN	7402	hgsc.bcm.edu	37	6	144801065	144801065	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr6:144801065G>T	ENST00000367545.3	+	25	3454	c.3454G>T	c.(3454-3456)Gat>Tat	p.D1152Y		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1152					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.D1152Y(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTTGGAGCGGGATTTTGAGTA	0.512																																					p.D1152Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3454T	6						.						123.0	122.0	122.0					6																	144801065		2203	4300	6503	144842758	SO:0001583	missense	7402	exon25			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3454G>T	6.37:g.144801065G>T	ENSP00000356515:p.Asp1152Tyr	Somatic		Capture	SOLID	Phase_I	144842758	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829383	0.90955	.	.	ENSG00000152818	ENST00000367545	T	0.39787	1.06	5.63	5.63	0.86233	.	0.000000	0.53938	D	0.000043	T	0.50582	0.1624	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52403	-0.8580	10	0.66056	D	0.02	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	1152	P46939	UTRO_HUMAN	Y	1152	ENSP00000356515:D1152Y	ENSP00000356515:D1152Y	D	+	1	0	UTRN	144842758	1.000000	0.71417	0.998000	0.56505	0.855000	0.48748	9.869000	0.99810	2.652000	0.90054	0.655000	0.94253	GAT		0.512	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152644770	152644770	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr6:152644770G>A	ENST00000367255.5	-	82	16361	c.15760C>T	c.(15760-15762)Cac>Tac	p.H5254Y	SYNE1_ENST00000448038.1_Missense_Mutation_p.H5183Y|SYNE1_ENST00000341594.5_Missense_Mutation_p.H4947Y|SYNE1_ENST00000265368.4_Missense_Mutation_p.H5254Y|SYNE1_ENST00000423061.1_Missense_Mutation_p.H5183Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5254					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.H5254Y(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AACGTGTCGTGGTATTCAAGA	0.527										HNSCC(10;0.0054)																											p.H5183Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C15547T	6						.						99.0	93.0	95.0					6																	152644770		2203	4300	6503	152686463	SO:0001583	missense	23345	exon81			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15760C>T	6.37:g.152644770G>A	ENSP00000356224:p.His5254Tyr	Somatic		Capture	SOLID	Phase_I	152686463	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	7.507	0.653893	0.14580	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.25	5.25	0.73442	.	0.105638	0.41605	D	0.000852	T	0.24431	0.0592	M	0.66939	2.045	0.80722	D	1	B;B;B;B	0.13594	0.008;0.0;0.0;0.004	B;B;B;B	0.17722	0.019;0.0;0.0;0.005	T	0.40365	-0.9567	10	0.02654	T	1	.	18.8651	0.92289	0.0:0.0:1.0:0.0	.	5254;5254;5254;5183	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	Y	5254;5183;5254;5183;4947	ENSP00000356224:H5254Y;ENSP00000396024:H5183Y;ENSP00000265368:H5254Y;ENSP00000390975:H5183Y;ENSP00000341887:H4947Y	ENSP00000265368:H5254Y	H	-	1	0	SYNE1	152686463	1.000000	0.71417	0.107000	0.21349	0.006000	0.05464	6.643000	0.74334	2.445000	0.82738	0.591000	0.81541	CAC		0.527	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
GABRR1	2569	hgsc.bcm.edu	37	6	89890188	89890188	+	Silent	SNP	G	G	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr6:89890188G>T	ENST00000454853.2	-	9	1079	c.969C>A	c.(967-969)acC>acA	p.T323T	GABRR1_ENST00000369451.3_Silent_p.T236T|GABRR1_ENST00000435811.1_Silent_p.T306T	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	323					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T317T(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	TGGTGGACATGGTCAGCACCG	0.502																																					p.T323T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C969A	6						.						147.0	117.0	127.0					6																	89890188		2203	4300	6503	89946907	SO:0001819	synonymous_variant	2569	exon9				CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.969C>A	6.37:g.89890188G>T		Somatic		Capture	SOLID	Phase_I	89946907	NM_002042	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Silent	SNP	ENST00000454853.2	37	CCDS5019.2																																																																																				0.502	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2		
SLC22A1	6580	hgsc.bcm.edu	37	6	160577066	160577066	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr6:160577066G>A	ENST00000366963.4	+	10	1705	c.1558G>A	c.(1558-1560)Gct>Act	p.A520T	SLC22A1_ENST00000324965.4_Missense_Mutation_p.R482H|SLC22A1_ENST00000457470.2_Intron	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	520					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)	p.A520T(1)	SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	CAAGGGGGTCGCTTTGCCAGA	0.582																																					p.A520T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1558A	6						.						153.0	150.0	151.0					6																	160577066		2203	4300	6503	160497056	SO:0001583	missense	6580	exon10			U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1558G>A	6.37:g.160577066G>A	ENSP00000355930:p.Ala520Thr	Somatic		Capture	SOLID	Phase_I	160497056	NM_003057	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Missense_Mutation	SNP	ENST00000366963.4	37	CCDS5274.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.10|17.10	3.304046|3.304046	0.60305|0.60305	.|.	.|.	ENSG00000175003|ENSG00000175003	ENST00000366963|ENST00000324965	T|T	0.71341|0.74842	-0.56|-0.88	4.32|4.32	0.759|0.759	0.18438|0.18438	Major facilitator superfamily domain, general substrate transporter (1);|.	0.302038|.	0.31370|.	N|.	0.007762|.	T|T	0.41534|0.41534	0.1163|0.1163	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B	0.21606|0.12013	0.058|0.005	B|B	0.21917|0.04013	0.037|0.001	T|T	0.41910|0.41910	-0.9482|-0.9482	9|8	0.27785|0.72032	T|D	0.31|0.01	.|.	5.358|5.358	0.16071|0.16071	0.4868:0.0:0.5132:0.0|0.4868:0.0:0.5132:0.0	.|.	520|482	O15245|O15245-2	S22A1_HUMAN|.	T|H	520|482	ENSP00000355930:A520T|ENSP00000318103:R482H	ENSP00000355930:A520T|ENSP00000318103:R482H	A|R	+|+	1|2	0|0	SLC22A1|SLC22A1	160497056|160497056	0.000000|0.000000	0.05858|0.05858	0.011000|0.011000	0.14972|0.14972	0.989000|0.989000	0.77384|0.77384	-0.575000|-0.575000	0.05861|0.05861	0.330000|0.330000	0.23485|0.23485	0.655000|0.655000	0.94253|0.94253	GCT|CGC		0.582	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042938.2		
DNAH9	1770	hgsc.bcm.edu	37	17	11583113	11583113	+	Silent	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr17:11583113C>T	ENST00000262442.4	+	18	3461	c.3393C>T	c.(3391-3393)agC>agT	p.S1131S	DNAH9_ENST00000454412.2_Silent_p.S1131S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1131	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.S1131S(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGAGTGAGAGCGGCTTACTCA	0.433																																					p.S1131S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3393T	17						.						139.0	138.0	138.0					17																	11583113		2203	4300	6503	11523838	SO:0001819	synonymous_variant	1770	exon18			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3393C>T	17.37:g.11583113C>T		Somatic		Capture	SOLID	Phase_I	11523838	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																				0.433	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
TEX2	55852	hgsc.bcm.edu	37	17	62265650	62265650	+	Missense_Mutation	SNP	C	C	T	rs148096884		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr17:62265650C>T	ENST00000583097.1	-	5	2474	c.2302G>A	c.(2302-2304)Gtg>Atg	p.V768M	TEX2_ENST00000258991.3_Missense_Mutation_p.V775M|TEX2_ENST00000584379.1_Missense_Mutation_p.V768M			Q8IWB9	TEX2_HUMAN	testis expressed 2	768					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)		p.V775M(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TTCTGCCGCACGCTGCCTGCC	0.627																																					p.V775M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2323A	17						.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	99.0	79.0	86.0		2323	4.8	1.0	17	dbSNP_134	86	0,8600		0,0,4300	yes	missense	TEX2	NM_018469.3	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	775/1135	62265650	1,13005	2203	4300	6503	59619382	SO:0001583	missense	55852	exon5			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2302G>A	17.37:g.62265650C>T	ENSP00000462665:p.Val768Met	Somatic		Capture	SOLID	Phase_I	59619382	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	37		.	.	.	.	.	.	.	.	.	.	C	9.553	1.116329	0.20795	2.27E-4	0.0	ENSG00000136478	ENST00000258991	T	0.47528	0.84	5.76	4.79	0.61399	.	0.241113	0.41294	D	0.000905	T	0.45276	0.1334	M	0.73598	2.24	0.44188	D	0.997004	P;P	0.41159	0.74;0.622	B;B	0.33890	0.172;0.053	T	0.53041	-0.8494	10	0.66056	D	0.02	-11.0269	11.5644	0.50796	0.0:0.8067:0.1251:0.0681	.	775;768	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	M	775	ENSP00000258991:V775M	ENSP00000258991:V775M	V	-	1	0	TEX2	59619382	0.951000	0.32395	0.974000	0.42286	0.438000	0.31896	1.977000	0.40589	1.448000	0.47680	0.462000	0.41574	GTG		0.627	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
EIF4A3	9775	hgsc.bcm.edu	37	17	78115124	78115124	+	Silent	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr17:78115124G>A	ENST00000269349.3	-	4	587	c.366C>T	c.(364-366)atC>atT	p.I122I		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	122	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)	p.I122I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			TCACCTTCTGGATCTGCACAG	0.393																																					p.I122I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C366T	17						.						127.0	118.0	121.0					17																	78115124		2203	4300	6503	75729719	SO:0001819	synonymous_variant	9775	exon4			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.366C>T	17.37:g.78115124G>A		Somatic		Capture	SOLID	Phase_I	75729719	NM_014740	Q15033|Q6IBQ2|Q96A18	Silent	SNP	ENST00000269349.3	37	CCDS11767.1																																																																																				0.393	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437446.1	NM_014740	
ADAMTS1	9510	hgsc.bcm.edu	37	21	28210225	28210225	+	Silent	SNP	G	G	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr21:28210225G>T	ENST00000284984.3	-	9	3031	c.2577C>A	c.(2575-2577)gtC>gtA	p.V859V		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	859	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V859V(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		ACTCTTCAATGACCCATGCTG	0.443																																					p.V859V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2577A	21						.						97.0	97.0	97.0					21																	28210225		2203	4300	6503	27132096	SO:0001819	synonymous_variant	9510	exon9			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.2577C>A	21.37:g.28210225G>T		Somatic		Capture	SOLID	Phase_I	27132096	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Silent	SNP	ENST00000284984.3	37	CCDS33524.1																																																																																				0.443	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
ADAMTS5	11096	hgsc.bcm.edu	37	21	28296688	28296688	+	Missense_Mutation	SNP	G	G	A	rs150380425		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr21:28296688G>A	ENST00000284987.5	-	8	2598	c.2477C>T	c.(2476-2478)aCg>aTg	p.T826M	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	826	Spacer.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T826M(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						AATTTCCTTCGTGGCAGAGTA	0.443																																					p.T826M	Esophageal Squamous(53;683 1080 10100 14424 45938)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2477T	21						.	G	MET/THR	0,4406		0,0,2203	143.0	144.0	144.0		2477	5.8	1.0	21	dbSNP_134	144	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ADAMTS5	NM_007038.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	826/931	28296688	1,13005	2203	4300	6503	27218559	SO:0001583	missense	11096	exon8			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2477C>T	21.37:g.28296688G>A	ENSP00000284987:p.Thr826Met	Somatic		Capture	SOLID	Phase_I	27218559	NM_007038	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938111	0.73557	0.0	1.16E-4	ENSG00000154736	ENST00000284987	T	0.55760	0.5	5.83	5.83	0.93111	ADAM-TS Spacer 1 (1);	0.104930	0.64402	D	0.000003	T	0.70281	0.3206	M	0.67397	2.05	0.47905	D	0.999548	D	0.71674	0.998	P	0.60473	0.875	T	0.70828	-0.4766	10	0.62326	D	0.03	.	20.1184	0.97949	0.0:0.0:1.0:0.0	.	826	Q9UNA0	ATS5_HUMAN	M	826	ENSP00000284987:T826M	ENSP00000284987:T826M	T	-	2	0	ADAMTS5	27218559	1.000000	0.71417	0.966000	0.40874	0.997000	0.91878	6.913000	0.75759	2.769000	0.95229	0.655000	0.94253	ACG		0.443	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
SMAD4	4089	hgsc.bcm.edu	37	18	48591906	48591906	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr18:48591906T>C	ENST00000342988.3	+	9	1607	c.1069T>C	c.(1069-1071)Tct>Cct	p.S357P	SMAD4_ENST00000588745.1_Missense_Mutation_p.S261P|SMAD4_ENST00000398417.2_Missense_Mutation_p.S357P	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	357	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.S357P(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CGTGGACCCTTCTGGAGGAGA	0.428																																					p.S357P												.	.	39	Whole gene deletion(36)|Unknown(2)|Substitution - Missense(1)	pancreas(26)|large_intestine(4)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.T1069C	18						.						202.0	169.0	180.0					18																	48591906		2203	4300	6503	46845904	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1069T>C	18.37:g.48591906T>C	ENSP00000341551:p.Ser357Pro	Somatic		Capture	SOLID	Phase_I	46845904	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	T	31	5.073791	0.94000	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.97378	-4.36;-4.36	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.97971	0.9332	L	0.61036	1.89	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98956	1.0796	10	0.87932	D	0	.	15.2431	0.73485	0.0:0.0:0.0:1.0	.	357	Q13485	SMAD4_HUMAN	P	357	ENSP00000341551:S357P;ENSP00000381452:S357P	ENSP00000341551:S357P	S	+	1	0	SMAD4	46845904	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.890000	0.87313	2.237000	0.73441	0.460000	0.39030	TCT		0.428	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
GTF2E1	2960	hgsc.bcm.edu	37	3	120500231	120500231	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr3:120500231C>T	ENST00000283875.5	+	5	1327	c.1234C>T	c.(1234-1236)Cca>Tca	p.P412S		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	412					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P412S(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		GAGCCAACGGCCAGAGCTAGT	0.493																																					p.P412S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1234T	3						.						151.0	149.0	150.0					3																	120500231		2203	4300	6503	121982921	SO:0001583	missense	2960	exon5			S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.1234C>T	3.37:g.120500231C>T	ENSP00000283875:p.Pro412Ser	Somatic		Capture	SOLID	Phase_I	121982921	NM_005513	Q16103	Missense_Mutation	SNP	ENST00000283875.5	37	CCDS3002.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890519	0.91889	.	.	ENSG00000153767	ENST00000283875	T	0.51817	0.69	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.70868	0.3273	M	0.81497	2.545	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.73069	-0.4099	10	0.59425	D	0.04	-29.2539	18.3168	0.90224	0.0:1.0:0.0:0.0	.	412	P29083	T2EA_HUMAN	S	412	ENSP00000283875:P412S	ENSP00000283875:P412S	P	+	1	0	GTF2E1	121982921	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.228000	0.78079	2.814000	0.96858	0.650000	0.86243	CCA		0.493	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513	
DNAJC13	23317	hgsc.bcm.edu	37	3	132235592	132235592	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr3:132235592C>T	ENST00000260818.6	+	48	5853	c.5605C>T	c.(5605-5607)Cca>Tca	p.P1869S		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1869					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.P1869S(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTCAACACATCCACAGGTTCG	0.348																																					p.P1869S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5605T	3						.						86.0	82.0	83.0					3																	132235592		2203	4300	6503	133718282	SO:0001583	missense	23317	exon48			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.5605C>T	3.37:g.132235592C>T	ENSP00000260818:p.Pro1869Ser	Somatic		Capture	SOLID	Phase_I	133718282	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328441	0.60743	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.50548	0.74	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.061993	0.64402	D	0.000003	T	0.40372	0.1114	L	0.44542	1.39	0.80722	D	1	B	0.33883	0.43	B	0.27170	0.077	T	0.21449	-1.0245	10	0.15499	T	0.54	.	19.8594	0.96778	0.0:1.0:0.0:0.0	.	1869	O75165	DJC13_HUMAN	S	1869;516	ENSP00000260818:P1869S	ENSP00000260818:P1869S	P	+	1	0	DNAJC13	133718282	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.496000	0.81526	2.691000	0.91804	0.650000	0.86243	CCA		0.348	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
STAG1	10274	hgsc.bcm.edu	37	3	136183753	136183753	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr3:136183753G>A	ENST00000383202.2	-	13	1539	c.1283C>T	c.(1282-1284)gCt>gTt	p.A428V	STAG1_ENST00000536929.1_Intron|STAG1_ENST00000434713.2_Missense_Mutation_p.A202V|STAG1_ENST00000236698.5_Missense_Mutation_p.A428V	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	428					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.A428V(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AGCTGCCACAGCAACAGGGCG	0.388																																					p.A428V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1283T	3						.						69.0	64.0	66.0					3																	136183753		2203	4300	6503	137666443	SO:0001583	missense	10274	exon13			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1283C>T	3.37:g.136183753G>A	ENSP00000372689:p.Ala428Val	Somatic		Capture	SOLID	Phase_I	137666443	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	G	36	5.629568	0.96671	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713	T;T;T	0.32988	1.43;1.43;1.43	5.51	5.51	0.81932	Armadillo-type fold (1);	0.050210	0.85682	D	0.000000	T	0.60792	0.2296	M	0.88775	2.98	0.80722	D	1	D;D;D	0.63880	0.993;0.985;0.993	P;P;P	0.61070	0.883;0.818;0.883	T	0.65340	-0.6192	10	0.45353	T	0.12	.	19.4107	0.94671	0.0:0.0:1.0:0.0	.	445;428;428	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	V	428;428;202	ENSP00000372689:A428V;ENSP00000236698:A428V;ENSP00000404396:A202V	ENSP00000236698:A428V	A	-	2	0	STAG1	137666443	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.864000	0.99589	2.588000	0.87417	0.585000	0.79938	GCT		0.388	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
EPHA3	2042	hgsc.bcm.edu	37	3	89391218	89391218	+	Silent	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr3:89391218C>T	ENST00000336596.2	+	5	1509	c.1284C>T	c.(1282-1284)gtC>gtT	p.V428V	EPHA3_ENST00000452448.2_Silent_p.V428V|EPHA3_ENST00000494014.1_Silent_p.V428V	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	428	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.V428V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TTGCTGCGGTCAGCATCACAA	0.468										TSP Lung(6;0.00050)																											p.V428V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1284T	3						.						64.0	53.0	57.0					3																	89391218		2203	4300	6503	89473908	SO:0001819	synonymous_variant	2042	exon5			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1284C>T	3.37:g.89391218C>T		Somatic		Capture	SOLID	Phase_I	89473908	NM_005233	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1																																																																																				0.468	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
SERPINI2	5276	hgsc.bcm.edu	37	3	167170743	167170743	+	Silent	SNP	G	G	A	rs147599618		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr3:167170743G>A	ENST00000476257.1	-	7	1243	c.945C>T	c.(943-945)tgC>tgT	p.C315C	SERPINI2_ENST00000461846.1_Silent_p.C315C|SERPINI2_ENST00000264677.4_Silent_p.C315C|SERPINI2_ENST00000471111.1_Silent_p.C315C			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	315					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.C315C(1)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CAGAAAGGTCGCAGCCACCAC	0.284																																					p.C315C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C945T	3						.	G		5,4401	8.1+/-20.4	0,5,2198	59.0	58.0	58.0		945	1.9	1.0	3	dbSNP_134	58	0,8592		0,0,4296	no	coding-synonymous	SERPINI2	NM_006217.3		0,5,6494	AA,AG,GG		0.0,0.1135,0.0385		315/406	167170743	5,12993	2203	4296	6499	168653437	SO:0001819	synonymous_variant	5276	exon6			AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.945C>T	3.37:g.167170743G>A		Somatic		Capture	SOLID	Phase_I	168653437	NM_006217		Silent	SNP	ENST00000476257.1	37	CCDS3200.1																																																																																				0.284	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
SOX5	6660	hgsc.bcm.edu	37	12	23887636	23887636	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr12:23887636C>A	ENST00000451604.2	-	6	893	c.792G>T	c.(790-792)ttG>ttT	p.L264F	SOX5_ENST00000545921.1_Missense_Mutation_p.L254F|SOX5_ENST00000546136.1_Missense_Mutation_p.L251F|SOX5_ENST00000381381.2_Missense_Mutation_p.L251F|SOX5_ENST00000541536.1_Missense_Mutation_p.L251F|SOX5_ENST00000309359.1_Missense_Mutation_p.L251F|SOX5_ENST00000537393.1_Missense_Mutation_p.L229F			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	264					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L264F(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						GTTGCTGGAGCAAATTGATTT	0.328																																					p.L251F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G753T	12						.						147.0	139.0	142.0					12																	23887636		2203	4300	6503	23778903	SO:0001583	missense	6660	exon9			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.792G>T	12.37:g.23887636C>A	ENSP00000398273:p.Leu264Phe	Somatic		Capture	SOLID	Phase_I	23778903	NM_152989	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109080	0.56398	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	D;D;D;D;D;D;D	0.98400	-4.58;-4.58;-4.91;-4.58;-4.58;-4.91;-4.58	5.11	4.16	0.48862	.	0.000000	0.64402	D	0.000001	D	0.98460	0.9487	M	0.82323	2.585	0.50313	D	0.999864	D;P;D	0.67145	0.996;0.632;0.984	D;P;P	0.65684	0.937;0.451;0.811	D	0.98052	1.0388	10	0.52906	T	0.07	.	7.7888	0.29108	0.2114:0.5364:0.2523:0.0	.	229;251;264	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	F	251;251;251;264;216;229;251;254	ENSP00000437487:L251F;ENSP00000308927:L251F;ENSP00000370788:L251F;ENSP00000398273:L264F;ENSP00000439832:L229F;ENSP00000441973:L251F;ENSP00000443520:L254F	ENSP00000308927:L251F	L	-	3	2	SOX5	23778903	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.958000	0.29227	2.390000	0.81377	0.563000	0.77884	TTG		0.328	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
KRAS	3845	hgsc.bcm.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12C	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34T	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	Somatic		Capture	SOLID	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
R3HDM2	22864	hgsc.bcm.edu	37	12	57651849	57651849	+	Silent	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr12:57651849G>A	ENST00000347140.3	-	21	2721	c.2331C>T	c.(2329-2331)agC>agT	p.S777S	R3HDM2_ENST00000403821.2_Silent_p.S811S|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000441731.2_Silent_p.S472S|R3HDM2_ENST00000358907.2_Silent_p.S777S|R3HDM2_ENST00000413953.2_Silent_p.S504S|R3HDM2_ENST00000546843.1_5'Flank|R3HDM2_ENST00000402412.1_Silent_p.S791S			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	777						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S438S(1)|p.S777S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CACTGCTGAGGCTGGTGACAG	0.592																																					p.S777S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2331T	12						.						100.0	61.0	74.0					12																	57651849		2203	4300	6503	55938116	SO:0001819	synonymous_variant	22864	exon19			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2331C>T	12.37:g.57651849G>A		Somatic		Capture	SOLID	Phase_I	55938116	NM_014925	Q2M1T9|Q3ZCT5	Silent	SNP	ENST00000347140.3	37	CCDS8937.2																																																																																				0.592	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
BTBD1	53339	hgsc.bcm.edu	37	15	83710639	83710639	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr15:83710639T>A	ENST00000261721.4	-	4	905	c.703A>T	c.(703-705)Att>Ttt	p.I235F	BTBD1_ENST00000379403.2_Missense_Mutation_p.I235F|BTBD1_ENST00000560015.1_5'Flank|RP11-382A20.7_ENST00000570202.1_RNA|RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.6_ENST00000568441.1_RNA	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	235					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)		p.I235F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		CTTTCTCGAATACTGAGTGTG	0.373																																					p.I235F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A703T	15						.						114.0	107.0	109.0					15																	83710639		2203	4300	6503	81501643	SO:0001583	missense	53339	exon4			AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.703A>T	15.37:g.83710639T>A	ENSP00000261721:p.Ile235Phe	Somatic		Capture	SOLID	Phase_I	81501643	NM_025238	A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	ENST00000261721.4	37	CCDS10322.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200358	0.79015	.	.	ENSG00000064726	ENST00000261721;ENST00000379403	T;T	0.68624	-0.34;-0.34	5.62	5.62	0.85841	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.83202	0.5203	M	0.86420	2.815	0.80722	D	1	P;P	0.49447	0.924;0.924	D;P	0.63283	0.913;0.885	D	0.86107	0.1560	10	0.72032	D	0.01	-26.6694	15.8173	0.78612	0.0:0.0:0.0:1.0	.	235;235	A6NMI8;Q9H0C5	.;BTBD1_HUMAN	F	235	ENSP00000261721:I235F;ENSP00000368713:I235F	ENSP00000261721:I235F	I	-	1	0	BTBD1	81501643	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	3.782000	0.55401	2.151000	0.67156	0.533000	0.62120	ATT		0.373	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304008.1		
BANK1	55024	hgsc.bcm.edu	37	4	102951189	102951189	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr4:102951189A>T	ENST00000322953.4	+	10	1941	c.1667A>T	c.(1666-1668)gAt>gTt	p.D556V	BANK1_ENST00000508653.1_Missense_Mutation_p.D423V|BANK1_ENST00000510950.1_3'UTR|BANK1_ENST00000428908.1_Missense_Mutation_p.D423V|RP11-498M5.2_ENST00000505091.1_RNA|BANK1_ENST00000444316.2_Missense_Mutation_p.D526V|BANK1_ENST00000504592.1_Missense_Mutation_p.D541V	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	556					B cell activation (GO:0042113)			p.D556V(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GAAACAGGAGATGAACCCAaa	0.403																																					p.D556V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1667T	4						.						70.0	74.0	73.0					4																	102951189		2203	4300	6503	103170212	SO:0001583	missense	55024	exon10			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1667A>T	4.37:g.102951189A>T	ENSP00000320509:p.Asp556Val	Somatic		Capture	SOLID	Phase_I	103170212	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	A	7.864	0.726658	0.15439	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.95	1.42	0.22433	.	1.479070	0.03884	N	0.277554	T	0.27169	0.0666	N	0.08118	0	0.09310	N	1	B;B;B	0.33583	0.418;0.418;0.418	B;B;B	0.30943	0.122;0.122;0.122	T	0.19943	-1.0290	10	0.44086	T	0.13	.	4.8121	0.13349	0.5767:0.1981:0.2252:0.0	.	423;556;541	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	V	541;556;423;423;526	ENSP00000421443:D541V;ENSP00000320509:D556V;ENSP00000412748:D423V;ENSP00000422314:D423V;ENSP00000388817:D526V	ENSP00000320509:D556V	D	+	2	0	BANK1	103170212	0.047000	0.20315	0.001000	0.08648	0.136000	0.21042	0.009000	0.13219	0.165000	0.19558	0.533000	0.62120	GAT		0.403	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
CYTL1	54360	hgsc.bcm.edu	37	4	5016903	5016903	+	Missense_Mutation	SNP	G	G	A	rs200085707	byFrequency	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr4:5016903G>A	ENST00000307746.4	-	4	412	c.386C>T	c.(385-387)aCg>aTg	p.T129M		NM_018659.2	NP_061129.1	Q9NRR1	CYTL1_HUMAN	cytokine-like 1	129					cartilage homeostasis (GO:1990079)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|inner ear development (GO:0048839)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)	p.T129M(1)		breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		TGGCAGGACCGTAGTCACTGG	0.483													G|||	2	0.000399361	0.0008	0.0	5008	,	,		21785	0.0		0.001	False		,,,				2504	0.0				p.T129M	Colon(15;457 478 29696 43408 47165)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C386T	4						.						132.0	115.0	121.0					4																	5016903		2203	4300	6503	5067804	SO:0001583	missense	54360	exon4			AF193766	CCDS3379.1	4p16-p15	2007-08-01			ENSG00000170891	ENSG00000170891			24435	protein-coding gene	gene with protein product		607930				10857752	Standard	NM_018659		Approved	C17, C4orf4	uc003gig.3	Q9NRR1	OTTHUMG00000125479	ENST00000307746.4:c.386C>T	4.37:g.5016903G>A	ENSP00000303550:p.Thr129Met	Somatic		Capture	SOLID	Phase_I	5067804	NM_018659		Missense_Mutation	SNP	ENST00000307746.4	37	CCDS3379.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	15.32|15.32	2.798676|2.798676	0.50208|0.50208	.|.	.|.	ENSG00000170891|ENSG00000170891	ENST00000509419|ENST00000307746	.|T	.|0.32753	.|1.44	4.4|4.4	4.4|4.4	0.53042|0.53042	.|.	.|0.340710	.|0.27976	.|N	.|0.017094	T|T	0.49558|0.49558	0.1564|0.1564	M|M	0.67953|0.67953	2.075|2.075	0.09310|0.09310	N|N	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.64144	.|0.922	T|T	0.41142|0.41142	-0.9525|-0.9525	5|10	.|0.66056	.|D	.|0.02	-13.5678|-13.5678	12.4815|12.4815	0.55844|0.55844	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|129	.|Q9NRR1	.|CYTL1_HUMAN	W|M	85|129	.|ENSP00000303550:T129M	.|ENSP00000303550:T129M	R|T	-|-	1|2	2|0	CYTL1|CYTL1	5067804|5067804	0.623000|0.623000	0.27094|0.27094	0.014000|0.014000	0.15608|0.15608	0.007000|0.007000	0.05969|0.05969	0.983000|0.983000	0.29552|0.29552	1.987000|1.987000	0.57996|0.57996	0.511000|0.511000	0.50034|0.50034	CGG|ACG		0.483	CYTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246802.1	NM_018659	
AFAP1	60312	hgsc.bcm.edu	37	4	7780553	7780553	+	Silent	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr4:7780553C>T	ENST00000360265.4	-	12	1815	c.1581G>A	c.(1579-1581)ggG>ggA	p.G527G	AFAP1_ENST00000358461.2_Silent_p.G527G|AFAP1-AS1_ENST00000608442.1_RNA|AFAP1_ENST00000382543.3_Silent_p.G611G|AFAP1_ENST00000420658.1_Silent_p.G611G|AFAP1_ENST00000513842.1_5'UTR			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	527						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.G527G(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TCAGAGTCTTCCCTTTTCCTG	0.458																																					p.G611G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1833A	4						.						114.0	119.0	117.0					4																	7780553		2203	4300	6503	7831453	SO:0001819	synonymous_variant	60312	exon14			AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1581G>A	4.37:g.7780553C>T		Somatic		Capture	SOLID	Phase_I	7831453	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Silent	SNP	ENST00000360265.4	37	CCDS3397.1																																																																																				0.458	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
RUFY3	22902	hgsc.bcm.edu	37	4	71660515	71660515	+	IGR	SNP	C	C	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr4:71660515C>A	ENST00000226328.4	+	0	4233				RUFY3_ENST00000381006.3_Missense_Mutation_p.N487K|RUFY3_ENST00000502653.1_Missense_Mutation_p.N434K	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			ACCTCAGGAACCAGCTTGAGT	0.393																																					p.N487K												.	.	0			c.C1461A	4						.						75.0	77.0	77.0					4																	71660515		2203	4300	6503	71879379	SO:0001628	intergenic_variant	22902	exon14			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910		4.37:g.71660515C>A		Somatic		Capture	SOLID	Phase_I	71879379	NM_001037442	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.407115	0.25378	.	.	ENSG00000018189	ENST00000381006;ENST00000502653	T;T	0.08008	3.15;3.14	5.61	2.94	0.34122	.	0.975752	0.08494	N	0.937604	T	0.04272	0.0118	.	.	.	0.80722	D	1	B	0.12630	0.006	B	0.15870	0.014	T	0.31586	-0.9938	9	0.06625	T	0.88	-3.0499	7.5403	0.27733	0.0:0.734:0.0:0.266	.	487	Q7L099-3	.	K	487;434	ENSP00000370394:N487K;ENSP00000425400:N434K	ENSP00000370394:N487K	N	+	3	2	RUFY3	71879379	0.997000	0.39634	1.000000	0.80357	0.955000	0.61496	0.341000	0.19909	0.402000	0.25451	0.650000	0.86243	AAC		0.393	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
GALNT7	51809	hgsc.bcm.edu	37	4	174235211	174235211	+	Silent	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr4:174235211C>T	ENST00000265000.4	+	9	1575	c.1492C>T	c.(1492-1494)Ctg>Ttg	p.L498L		NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	498					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L498L(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TATATCGGAGCTGAAAAAATT	0.393																																					p.L498L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1492T	4						.						96.0	96.0	96.0					4																	174235211		2203	4300	6503	174471786	SO:0001819	synonymous_variant	51809	exon9			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1492C>T	4.37:g.174235211C>T		Somatic		Capture	SOLID	Phase_I	174471786	NM_017423	B3KQU3|Q7Z5W7|Q9UJ28	Silent	SNP	ENST00000265000.4	37	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	C	9.972	1.225751	0.22542	.	.	ENSG00000109586	ENST00000503213	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	T	0.76278	0.3965	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74352	-0.3693	4	.	.	.	.	19.605	0.95577	0.0:1.0:0.0:0.0	.	.	.	.	V	68	.	.	A	+	2	0	GALNT7	174471786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.052000	0.71080	2.635000	0.89317	0.655000	0.94253	GCT		0.393	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423	
CT83	203413	hgsc.bcm.edu	37	X	115593070	115593070	+	Silent	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chrX:115593070G>A	ENST00000371894.4	-	2	326	c.180C>T	c.(178-180)taC>taT	p.Y60Y		NM_001017978.2	NP_001017978.1	Q5H943	KKLC1_HUMAN		60						integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Y60Y(1)		breast(1)|large_intestine(3)|lung(8)	12						GAGAGAGGTCGTAGACTGCAA	0.418																																					p.Y60Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C180T	X						.						150.0	132.0	138.0					X																	115593070		2203	4300	6503	115507098	SO:0001819	synonymous_variant	203413	exon2																														ENST00000371894.4:c.180C>T	X.37:g.115593070G>A		Somatic		Capture	SOLID	Phase_I	115507098	NM_001017978		Silent	SNP	ENST00000371894.4	37	CCDS35372.1																																																																																				0.418	CXorf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057985.1		
RAB33A	9363	hgsc.bcm.edu	37	X	129318595	129318595	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chrX:129318595G>T	ENST00000257017.4	+	2	1009	c.595G>T	c.(595-597)Gct>Tct	p.A199S		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	199					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A199S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11						CATGTGCTTGGCTTGCCGATT	0.517																																					p.A199S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G595T	X						.						97.0	84.0	89.0					X																	129318595		2203	4300	6503	129146276	SO:0001583	missense	9363	exon2			D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594		"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333				7688322, 9512502	Standard	NM_004794		Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.595G>T	X.37:g.129318595G>T	ENSP00000257017:p.Ala199Ser	Somatic		Capture	SOLID	Phase_I	129146276	NM_004794	Q5JUZ6|Q92465	Missense_Mutation	SNP	ENST00000257017.4	37	CCDS14621.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677632	0.88445	.	.	ENSG00000134594	ENST00000257017	T	0.80824	-1.42	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.87712	0.6246	M	0.73217	2.22	0.80722	D	1	P	0.35982	0.531	P	0.51833	0.681	D	0.87792	0.2619	10	0.54805	T	0.06	-4.3572	18.0244	0.89264	0.0:0.0:1.0:0.0	.	199	Q14088	RB33A_HUMAN	S	199	ENSP00000257017:A199S	ENSP00000257017:A199S	A	+	1	0	RAB33A	129146276	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.869000	0.99810	2.191000	0.70037	0.436000	0.28706	GCT		0.517	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058246.1	NM_004794	
ACKR3	57007	hgsc.bcm.edu	37	2	237489384	237489384	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr2:237489384G>T	ENST00000272928.3	+	2	586	c.276G>T	c.(274-276)tgG>tgT	p.W92C		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	92					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.W92L(1)|p.W92C(1)									CCGACCTGTGGGTTGTCCTCA	0.567																																					p.W92C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G276T	2						.						165.0	145.0	152.0					2																	237489384		2203	4300	6503	237154123	SO:0001583	missense	57007	exon2			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.276G>T	2.37:g.237489384G>T	ENSP00000272928:p.Trp92Cys	Somatic		Capture	SOLID	Phase_I	237154123	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	37	CCDS2516.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.523000	0.27211	.	.	ENSG00000144476	ENST00000447924;ENST00000272928	T;T	0.34859	1.34;1.34	5.57	1.06	0.20224	GPCR, rhodopsin-like superfamily (1);	0.104708	0.64402	N	0.000003	T	0.06416	0.0165	N	0.00032	-2.585	0.58432	D	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.15896	-1.0421	10	0.32370	T	0.25	.	9.8901	0.41285	0.0:0.4642:0.2083:0.3275	.	92	P25106	CXCR7_HUMAN	C	92	ENSP00000405945:W92C;ENSP00000272928:W92C	ENSP00000272928:W92C	W	+	3	0	CXCR7	237154123	0.905000	0.30787	1.000000	0.80357	0.991000	0.79684	0.040000	0.13905	0.643000	0.30638	0.563000	0.77884	TGG		0.567	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
GALNT14	79623	hgsc.bcm.edu	37	2	31178531	31178531	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr2:31178531C>T	ENST00000349752.5	-	6	1246	c.607G>A	c.(607-609)Gag>Aag	p.E203K	GALNT14_ENST00000406653.1_Missense_Mutation_p.E183K|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000324589.5_Missense_Mutation_p.E208K|GALNT14_ENST00000356174.3_Missense_Mutation_p.E170K|GALNT14_ENST00000420311.2_Missense_Mutation_p.E168K	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	203	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.E203K(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CTGTTCACCTCACAGTGGCTG	0.622																																					p.E203K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G607A	2						.						56.0	55.0	55.0					2																	31178531		2203	4300	6503	31032035	SO:0001583	missense	79623	exon6			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.607G>A	2.37:g.31178531C>T	ENSP00000288988:p.Glu203Lys	Somatic		Capture	SOLID	Phase_I	31032035	NM_024572	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	C	37	6.007914	0.97195	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.6	5.6	0.85130	Glycosyl transferase, family 2 (1);	0.111037	0.64402	D	0.000005	D	0.85805	0.5782	H	0.94503	3.545	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.994;1.0;1.0;1.0	D	0.89308	0.3631	10	0.87932	D	0	.	19.6113	0.95607	0.0:1.0:0.0:0.0	.	168;168;170;208;203;183	F5H263;B7Z5C5;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;.;GLT14_HUMAN;.	K	203;208;183;170;168;170	ENSP00000288988:E203K;ENSP00000314500:E208K;ENSP00000385435:E183K;ENSP00000348497:E170K;ENSP00000415514:E168K;ENSP00000406399:E170K	ENSP00000314500:E208K	E	-	1	0	GALNT14	31032035	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.421000	0.80204	2.647000	0.89833	0.549000	0.68633	GAG		0.622	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
ABCG8	64241	hgsc.bcm.edu	37	2	44078890	44078890	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr2:44078890C>T	ENST00000272286.2	+	4	580	c.490C>T	c.(490-492)Cga>Tga	p.R164*		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	164	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.R164*(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CTTGACTGTGCGAGAGACCTT	0.617																																					p.R164X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C490T	2	GRCh37	CM012310	ABCG8	M		.						121.0	118.0	119.0					2																	44078890		2203	4300	6503	43932394	SO:0001587	stop_gained	64241	exon4			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.490C>T	2.37:g.44078890C>T	ENSP00000272286:p.Arg164*	Somatic		Capture	SOLID	Phase_I	43932394	NM_022437	Q53QN8	Nonsense_Mutation	SNP	ENST00000272286.2	37	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049678	0.75846	.	.	ENSG00000143921	ENST00000272286	.	.	.	4.92	2.45	0.29901	.	0.061558	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.12	0.30965	0.3975:0.5131:0.0:0.0894	.	.	.	.	X	164	.	ENSP00000272286:R164X	R	+	1	2	ABCG8	43932394	0.990000	0.36364	0.424000	0.26647	0.287000	0.27160	1.322000	0.33689	0.854000	0.35336	0.655000	0.94253	CGA		0.617	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437	
PPP1R21	129285	hgsc.bcm.edu	37	2	48707144	48707144	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr2:48707144A>T	ENST00000294952.8	+	13	1464	c.1307A>T	c.(1306-1308)gAc>gTc	p.D436V	PPP1R21_ENST00000281394.4_Missense_Mutation_p.D436V|PPP1R21_ENST00000449090.2_Missense_Mutation_p.D436V	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	436						membrane (GO:0016020)	phosphatase binding (GO:0019902)	p.D436V(1)		endometrium(2)|kidney(4)|lung(9)	15						GGATTTCATGACGTTATGAAA	0.418																																					p.D436V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1307T	2						.						166.0	152.0	157.0					2																	48707144		2203	4300	6503	48560648	SO:0001583	missense	129285	exon13			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1307A>T	2.37:g.48707144A>T	ENSP00000294952:p.Asp436Val	Somatic		Capture	SOLID	Phase_I	48560648	NM_001135629	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	ENST00000294952.8	37	CCDS46278.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.861840	0.32884	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.76	4.62	0.57501	.	0.096565	0.64402	D	0.000002	T	0.70649	0.3248	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.91635	0.999;0.999;0.999;0.943	T	0.71695	-0.4515	9	0.62326	D	0.03	-12.6712	11.4747	0.50291	0.9302:0.0:0.0698:0.0	.	436;436;436;436	E1B6W7;Q6ZMI0;Q6ZMI0-2;Q6ZMI0-3	.;PPR21_HUMAN;.;.	V	436	.	ENSP00000281394:D436V	D	+	2	0	KLRAQ1	48560648	1.000000	0.71417	0.995000	0.50966	0.914000	0.54420	5.644000	0.67902	1.026000	0.39733	0.533000	0.62120	GAC		0.418	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994	
MGAT4A	11320	hgsc.bcm.edu	37	2	99279538	99279538	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr2:99279538C>A	ENST00000264968.3	-	4	871	c.508G>T	c.(508-510)Gac>Tac	p.D170Y	MGAT4A_ENST00000409391.1_Missense_Mutation_p.D170Y|MGAT4A_ENST00000393487.1_Missense_Mutation_p.D170Y|MGAT4A_ENST00000461884.1_5'UTR|MGAT4A_ENST00000414521.2_Missense_Mutation_p.D42Y			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	170					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.D170Y(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						ATAACACAGTCCAACTTCTCT	0.323																																					p.D170Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G508T	2						.						117.0	129.0	125.0					2																	99279538		2203	4294	6497	98645970	SO:0001583	missense	11320	exon5			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.508G>T	2.37:g.99279538C>A	ENSP00000264968:p.Asp170Tyr	Somatic		Capture	SOLID	Phase_I	98645970	NM_012214	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Missense_Mutation	SNP	ENST00000264968.3	37	CCDS2036.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944575	0.92593	.	.	ENSG00000071073	ENST00000393487;ENST00000414521;ENST00000264968;ENST00000409391	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.71	5.71	0.89125	.	0.042147	0.85682	D	0.000000	T	0.73249	0.3563	M	0.86864	2.845	0.80722	D	1	P;D;D	0.76494	0.934;0.999;0.999	P;D;D	0.69479	0.787;0.964;0.964	T	0.74393	-0.3680	10	0.46703	T	0.11	.	19.2094	0.93748	0.0:1.0:0.0:0.0	.	42;42;170	E9PEN2;B4E2R6;Q9UM21	.;.;MGT4A_HUMAN	Y	170;42;170;170	ENSP00000377127:D170Y;ENSP00000404889:D42Y;ENSP00000264968:D170Y;ENSP00000386841:D170Y	ENSP00000264968:D170Y	D	-	1	0	MGAT4A	98645970	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.860000	0.98153	0.655000	0.94253	GAC		0.323	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252988.2	NM_012214	
COL6A3	1293	hgsc.bcm.edu	37	2	238253261	238253261	+	Missense_Mutation	SNP	G	G	A	rs111803773	byFrequency	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr2:238253261G>A	ENST00000295550.4	-	36	7852	c.7400C>T	c.(7399-7401)tCg>tTg	p.S2467L	COL6A3_ENST00000353578.4_Missense_Mutation_p.S2261L|COL6A3_ENST00000472056.1_Missense_Mutation_p.S1860L|COL6A3_ENST00000347401.3_Missense_Mutation_p.S2266L|COL6A3_ENST00000409809.1_Missense_Mutation_p.S2261L|COL6A3_ENST00000346358.4_Missense_Mutation_p.S2267L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2467	Nonhelical region.|VWFA 11. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S2467L(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGGAGGACCGACTTCCTCTT	0.552													G|||	9	0.00179712	0.0068	0.0	5008	,	,		19204	0.0		0.0	False		,,,				2504	0.0				p.S1860L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5579T	2						.	G	LEU/SER,LEU/SER,LEU/SER	35,4371	40.0+/-72.8	0,35,2168	64.0	61.0	62.0		7400,5579,6782	5.1	0.9	2	dbSNP_132	62	0,8600		0,0,4300	yes	missense,missense,missense	COL6A3	NM_004369.3,NM_057166.4,NM_057167.3	145,145,145	0,35,6468	AA,AG,GG		0.0,0.7944,0.2691	probably-damaging,probably-damaging,probably-damaging	2467/3178,1860/2571,2261/2972	238253261	35,12971	2203	4300	6503	237918000	SO:0001583	missense	1293	exon33			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7400C>T	2.37:g.238253261G>A	ENSP00000295550:p.Ser2467Leu	Somatic		Capture	SOLID	Phase_I	237918000	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	10.22	1.290668	0.23564	0.007944	0.0	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47;2.47	5.07	5.07	0.68467	von Willebrand factor, type A (3);	0.266238	0.26769	N	0.022590	T	0.26521	0.0648	L	0.50333	1.59	0.33856	D	0.633212	P;P;P;D	0.76494	0.859;0.604;0.733;0.999	B;B;B;D	0.67725	0.207;0.102;0.131;0.953	T	0.39354	-0.9618	10	0.54805	T	0.06	.	14.2375	0.65937	0.0:0.0:0.8503:0.1497	.	1860;1860;2261;2467	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	L	2467;2266;2261;1860;2261;2267	ENSP00000295550:S2467L;ENSP00000315609:S2266L;ENSP00000315873:S2261L;ENSP00000418285:S1860L;ENSP00000386844:S2261L;ENSP00000295546:S2267L	ENSP00000295550:S2467L	S	-	2	0	COL6A3	237918000	0.991000	0.36638	0.950000	0.38849	0.533000	0.34776	2.426000	0.44731	2.339000	0.79563	0.655000	0.94253	TCG		0.552	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
PTGR1	22949	hgsc.bcm.edu	37	9	114348382	114348382	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr9:114348382C>T	ENST00000407693.2	-	5	535	c.273G>A	c.(271-273)tgG>tgA	p.W91*	PTGR1_ENST00000238248.3_5'UTR|PTGR1_ENST00000309195.5_Nonsense_Mutation_p.W91*|PTGR1_ENST00000538962.1_Nonsense_Mutation_p.W91*	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	91					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)	p.W91*(1)		endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						AGTGCGTTGTCCAGCCTGGAG	0.463																																					p.W91X	Ovarian(200;132 2151 7551 19220 46064)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G273A	9						.						164.0	131.0	142.0					9																	114348382		2203	4300	6503	113388203	SO:0001587	stop_gained	22949	exon5			D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.273G>A	9.37:g.114348382C>T	ENSP00000385763:p.Trp91*	Somatic		Capture	SOLID	Phase_I	113388203	NM_001146109	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Nonsense_Mutation	SNP	ENST00000407693.2	37	CCDS6779.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163117	0.78226	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000333580;ENST00000422125	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.7178	17.3817	0.87406	0.0:1.0:0.0:0.0	.	.	.	.	X	91;91;91;72;72	.	ENSP00000311572:W91X	W	-	3	0	PTGR1	113388203	1.000000	0.71417	1.000000	0.80357	0.058000	0.15608	5.169000	0.64984	2.573000	0.86826	0.561000	0.74099	TGG		0.463	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
TRIM32	22954	hgsc.bcm.edu	37	9	119461168	119461168	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr9:119461168G>T	ENST00000450136.1	+	2	1308	c.1147G>T	c.(1147-1149)Ggt>Tgt	p.G383C	ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|TRIM32_ENST00000373983.2_Missense_Mutation_p.G383C|ASTN2_ENST00000373996.3_Intron|ASTN2_ENST00000361209.2_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	383					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G383C(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						GACCAGTCAAGGTGAAGTACT	0.498																																					p.G383C	Esophageal Squamous(92;212 1916 19711 26951)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1147T	9						.						80.0	80.0	80.0					9																	119461168		2203	4300	6503	118500989	SO:0001583	missense	22954	exon2			U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.1147G>T	9.37:g.119461168G>T	ENSP00000408292:p.Gly383Cys	Somatic		Capture	SOLID	Phase_I	118500989	NM_001099679	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	37	CCDS6817.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.838041	0.50951	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	D;D	0.84223	-1.82;-1.82	5.47	4.56	0.56223	Six-bladed beta-propeller, TolB-like (1);	0.064498	0.64402	D	0.000011	D	0.93119	0.7809	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93948	0.7229	9	.	.	.	-11.8273	13.3638	0.60671	0.0772:0.0:0.9228:0.0	.	383	Q13049	TRI32_HUMAN	C	383	ENSP00000408292:G383C;ENSP00000363095:G383C	.	G	+	1	0	TRIM32	118500989	1.000000	0.71417	0.993000	0.49108	0.756000	0.42949	7.572000	0.82409	1.265000	0.44215	0.650000	0.86243	GGT		0.498	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055466.2	NM_012210	
PCCA	5095	hgsc.bcm.edu	37	13	101180006	101180006	+	Splice_Site	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr13:101180006G>A	ENST00000376285.1	+	23	2156	c.2118G>A	c.(2116-2118)acG>acA	p.T706T	PCCA_ENST00000376286.4_Splice_Site_p.T680T|PCCA_ENST00000376279.3_Splice_Site_p.T659T	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	706	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)	p.T706T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	AAACTGGCACGGTGAGTCCCT	0.522																																					p.T659T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1977A	13						.						77.0	78.0	78.0					13																	101180006		2203	4300	6503	99978007	SO:0001630	splice_region_variant	5095	exon22			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.2118+1G>A	13.37:g.101180006G>A		Somatic		Capture	SOLID	Phase_I	99978007	NM_001178004	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Silent	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	G	9.435	1.086434	0.20390	.	.	ENSG00000175198	ENST00000458283	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	T	0.75466	0.3853	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73414	-0.3990	4	.	.	.	.	19.4921	0.95054	0.0:0.0:1.0:0.0	.	.	.	.	S	112	.	.	G	+	1	0	PCCA	99978007	1.000000	0.71417	1.000000	0.80357	0.275000	0.26752	7.467000	0.80930	2.624000	0.88883	0.561000	0.74099	GGT		0.522	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		Silent
NRAP	4892	hgsc.bcm.edu	37	10	115391316	115391316	+	Silent	SNP	G	G	A	rs147401897		TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr10:115391316G>A	ENST00000359988.3	-	18	2038	c.1794C>T	c.(1792-1794)gcC>gcT	p.A598A	NRAP_ENST00000360478.3_Silent_p.A563A|NRAP_ENST00000369358.4_Silent_p.A606A|NRAP_ENST00000369360.3_Silent_p.A571A	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.A598A(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCCTAGAGTCGGCTGTTCCCA	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17580	0.0		0.0	False		,,,				2504	0.0				p.A598A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1794T	10						.	G	,	1,4405	2.1+/-5.4	0,1,2202	157.0	163.0	161.0		1689,1794	-12.0	0.0	10	dbSNP_134	161	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	NRAP	NM_006175.3,NM_198060.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	563/1696,598/1731	115391316	1,13005	2203	4300	6503	115381306	SO:0001819	synonymous_variant	4892	exon18				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.1794C>T	10.37:g.115391316G>A		Somatic		Capture	SOLID	Phase_I	115381306	NM_198060		Silent	SNP	ENST00000359988.3	37	CCDS7579.1																																																																																				0.403	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
PAM	5066	hgsc.bcm.edu	37	5	102343266	102343266	+	Missense_Mutation	SNP	G	G	A	rs186632214	byFrequency	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr5:102343266G>A	ENST00000438793.3	+	19	2590	c.2120G>A	c.(2119-2121)cGg>cAg	p.R707Q	PAM_ENST00000379787.4_Missense_Mutation_p.R87Q|PAM_ENST00000455264.2_Missense_Mutation_p.R707Q|PAM_ENST00000274392.9_Missense_Mutation_p.R610Q|PAM_ENST00000348126.2_Missense_Mutation_p.R600Q|PAM_ENST00000346918.2_Missense_Mutation_p.R707Q|PAM_ENST00000304400.7_Missense_Mutation_p.R707Q	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	707	Peptidyl-alpha-hydroxyglycine alpha- amidating lyase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)	p.R707Q(2)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GAAAATGGTCGGATCCAGTGT	0.433													g|||	3	0.000599042	0.0008	0.0029	5008	,	,		16240	0.0		0.0	False		,,,				2504	0.0				p.R707Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2120A	5						.						116.0	115.0	116.0					5																	102343266		2203	4300	6503	102371165	SO:0001583	missense	5066	exon19			AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.2120G>A	5.37:g.102343266G>A	ENSP00000396493:p.Arg707Gln	Somatic		Capture	SOLID	Phase_I	102371165	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	2|2	0.0055248618784530384|0.0055248618784530384	0|0	0.0|0.0	0|0	0.0|0.0	g|g	20.8|20.8	4.049808|4.049808	0.75846|0.75846	.|.	.|.	ENSG00000145730|ENSG00000145730	ENST00000504691|ENST00000438793;ENST00000346918;ENST00000348126;ENST00000379787;ENST00000304400;ENST00000274392;ENST00000455264	.|T;T;T;T;T;T;T	.|0.77620	.|-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.17|5.17	4.31|4.31	0.51392|0.51392	.|Six-bladed beta-propeller, TolB-like (1);	.|0.113719	.|0.64402	.|N	.|0.000009	D|D	0.86522|0.86522	0.5953|0.5953	M|M	0.89534|0.89534	3.04|3.04	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.91635	.|0.992;0.995;0.995;0.999;0.992;0.997	D|D	0.89850|0.89850	0.4009|0.4009	5|10	.|0.72032	.|D	.|0.01	.|.	14.0646|14.0646	0.64821|0.64821	0.0725:0.0:0.9275:0.0|0.0725:0.0:0.9275:0.0	.|.	.|610;707;707;707;707;600	.|F8WE90;P19021;P19021-4;P19021-3;P19021-5;P19021-2	.|.;AMD_HUMAN;.;.;.;.	R|Q	2|707;707;600;87;707;610;707	.|ENSP00000396493:R707Q;ENSP00000282992:R707Q;ENSP00000314638:R600Q;ENSP00000369113:R87Q;ENSP00000306100:R707Q;ENSP00000274392:R610Q;ENSP00000403461:R707Q	.|ENSP00000274392:R610Q	G|R	+|+	1|2	0|0	PAM|PAM	102371165|102371165	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.451000|0.451000	0.32288|0.32288	7.106000|7.106000	0.77039|0.77039	1.419000|1.419000	0.47118|0.47118	-0.119000|-0.119000	0.15052|0.15052	GGA|CGG		0.433	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
DNAH5	1767	hgsc.bcm.edu	37	5	13701414	13701414	+	Silent	SNP	T	T	C			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr5:13701414T>C	ENST00000265104.4	-	77	13574	c.13470A>G	c.(13468-13470)ggA>ggG	p.G4490G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4490					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G4490G(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAGTTAAAAATCCCTGGGGGT	0.408									Kartagener syndrome																												p.G4490G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A13470G	5						.						76.0	83.0	81.0					5																	13701414		2203	4300	6503	13754414	SO:0001819	synonymous_variant	1767	exon77	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13470A>G	5.37:g.13701414T>C		Somatic		Capture	SOLID	Phase_I	13754414	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																				0.408	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
UGT3A1	133688	hgsc.bcm.edu	37	5	35954311	35954311	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr5:35954311T>G	ENST00000274278.3	-	7	1922	c.1565A>C	c.(1564-1566)aAg>aCg	p.K522T	UGT3A1_ENST00000513233.1_5'Flank	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	522						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.K522T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCCTCATGTCTTCTTCACCTT	0.597																																					p.K522T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1565C	5						.						84.0	74.0	77.0					5																	35954311		2203	4300	6503	35990068	SO:0001583	missense	133688	exon7				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.1565A>C	5.37:g.35954311T>G	ENSP00000274278:p.Lys522Thr	Somatic		Capture	SOLID	Phase_I	35990068	NM_152404	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	ENST00000274278.3	37	CCDS3913.1	.	.	.	.	.	.	.	.	.	.	.	13.29	2.194345	0.38806	.	.	ENSG00000145626	ENST00000274278	T	0.62788	-0.0	3.35	0.676	0.17958	.	2.779510	0.02771	U	0.119702	T	0.39963	0.1098	N	0.08118	0	0.09310	N	0.999999	P	0.41313	0.745	B	0.35550	0.205	T	0.39165	-0.9627	10	0.87932	D	0	.	4.7603	0.13104	0.1661:0.1014:0.0:0.7325	.	522	Q6NUS8	UD3A1_HUMAN	T	522	ENSP00000274278:K522T	ENSP00000274278:K522T	K	-	2	0	UGT3A1	35990068	0.002000	0.14202	0.000000	0.03702	0.021000	0.10359	0.871000	0.28023	0.017000	0.15025	0.172000	0.16884	AAG		0.597	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	NM_152404	
NIM1K	167359	hgsc.bcm.edu	37	5	43245942	43245942	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr5:43245942G>A	ENST00000512796.1	+	2	1564	c.65G>A	c.(64-66)cGc>cAc	p.R22H	NIM1_ENST00000326035.2_Missense_Mutation_p.R22H			Q8IY84	NIM1_HUMAN		22					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R22H(1)									TGGGATCGGCGCGACAGTGTA	0.597																																					p.R22H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G65A	5						.						118.0	111.0	113.0					5																	43245942		2203	4300	6503	43281699	SO:0001583	missense	167359	exon2																														ENST00000512796.1:c.65G>A	5.37:g.43245942G>A	ENSP00000420849:p.Arg22His	Somatic		Capture	SOLID	Phase_I	43281699	NM_153361	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.512983	0.64522	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.72505	-0.66;-0.66	5.38	4.51	0.55191	.	0.269330	0.30714	N	0.009024	T	0.53610	0.1807	L	0.34521	1.04	0.36473	D	0.867396	D	0.54601	0.967	B	0.39660	0.306	T	0.59705	-0.7404	9	.	.	.	.	6.7077	0.23260	0.3032:0.0:0.6968:0.0	.	22	Q8IY84	NIM1_HUMAN	H	22	ENSP00000313572:R22H;ENSP00000420849:R22H	.	R	+	2	0	AC114947.1	43281699	1.000000	0.71417	0.971000	0.41717	0.953000	0.61014	5.503000	0.66962	1.277000	0.44412	0.650000	0.86243	CGC		0.597	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1		
APC	324	hgsc.bcm.edu	37	5	112175521	112175521	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3522-01A-01W-0831-10	TCGA-AA-3522-10A-01W-0831-10	g.chr5:112175521C>A	ENST00000457016.1	+	16	4610	c.4230C>A	c.(4228-4230)tgC>tgA	p.C1410*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.C1410*|APC_ENST00000508376.2_Nonsense_Mutation_p.C1410*			P25054	APC_HUMAN	adenomatous polyposis coli	1410	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.C1410*(2)|p.Y1376fs*41(1)|p.K1192fs*3(1)|p.?(1)|p.P1409fs*6(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTGAACCATGCAGTGGAATGG	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.C1392X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	6	Deletion - Frameshift(3)|Substitution - Nonsense(2)|Unknown(1)	large_intestine(4)|soft_tissue(1)|skin(1)	c.C4176A	5						.						116.0	107.0	110.0					5																	112175521		2202	4300	6502	112203420	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4230C>A	5.37:g.112175521C>A	ENSP00000413133:p.Cys1410*	Somatic		Capture	SOLID	Phase_I	112203420	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.071343	0.98640	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.07	2.86	0.33363	.	0.087975	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.2962	9.2491	0.37545	0.0:0.6039:0.0:0.3961	.	.	.	.	X	1410	.	.	C	+	3	2	APC	112203420	0.984000	0.35163	1.000000	0.80357	0.997000	0.91878	0.250000	0.18235	0.261000	0.21753	0.655000	0.94253	TGC		0.483	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
