#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GUSB	2990	hgsc.bcm.edu	37	7	65444760	65444761	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:65444760_65444761insG	ENST00000304895.4	-	3	664_665	c.534_535insC	c.(532-537)cccaccfs	p.T179fs	GUSB_ENST00000421103.1_Intron|GUSB_ENST00000345660.6_Frame_Shift_Ins_p.T179fs|GUSB_ENST00000476486.1_Intron	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	179					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)	p.T179fs*13(1)		breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						GGCAGGGTGGTGGGGGTGAGTG	0.629																																					p.T179fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.535_536insC	7						.																																			65082196	SO:0001589	frameshift_variant	2990	exon3			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.535dupC	7.37:g.65444765_65444765dupG	ENSP00000302728:p.Thr179fs	Somatic		Capture	SOLID	Phase_I	65082195	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Frame_Shift_Ins	INS	ENST00000304895.4	37	CCDS5530.1																																																																																				0.629	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
ABCB4	5244	hgsc.bcm.edu	37	7	87051451	87051452	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:87051451_87051452insA	ENST00000265723.4	-	18	2412_2413	c.2301_2302insT	c.(2299-2304)tttactfs	p.T768fs	ABCB4_ENST00000358400.3_Frame_Shift_Ins_p.T768fs|ABCB4_ENST00000359206.3_Frame_Shift_Ins_p.T768fs|ABCB4_ENST00000545634.1_Frame_Shift_Ins_p.T768fs|ABCB4_ENST00000453593.1_Frame_Shift_Ins_p.T768fs	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	768	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.T768fs*26(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	AGGAAGAAAGTAAAAAAAGAAA	0.322																																					p.T768fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2302_2303insT	7						.																																			86889388	SO:0001589	frameshift_variant	5244	exon18			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2302dupT	7.37:g.87051458_87051458dupA	ENSP00000265723:p.Thr768fs	Somatic		Capture	SOLID	Phase_I	86889387	NM_000443	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Frame_Shift_Ins	INS	ENST00000265723.4	37	CCDS5606.1																																																																																				0.322	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
CNIH1	10175	hgsc.bcm.edu	37	14	54896991	54896992	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:54896991_54896992insA	ENST00000216416.4	-	4	497_498	c.394_395insT	c.(394-396)tacfs	p.Y132fs	CNIH1_ENST00000553660.1_Frame_Shift_Ins_p.Y109fs|CNIH1_ENST00000556113.1_Frame_Shift_Ins_p.Y132fs|CNIH1_ENST00000395573.4_Intron|CNIH1_ENST00000557690.1_Frame_Shift_Ins_p.Y148fs	NM_005776.2	NP_005767.1	O95406	CNIH1_HUMAN	cornichon family AMPA receptor auxiliary protein 1	132					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.Y132fs*>14(1)									ATATAGGTAGTAAAAAAATGCT	0.347																																					p.Y132fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.395_396insT	14						.																																			53966742	SO:0001589	frameshift_variant	10175	exon4			AF031379	CCDS9717.1	14q22.1	2013-08-28	2013-08-28	2013-08-28	ENSG00000100528	ENSG00000100528			19431	protein-coding gene	gene with protein product		611287	"""cornichon homolog (Drosophila)"""	CNIH		10209299	Standard	NM_005776		Approved	TGAM77, CNIL	uc001xat.1	O95406	OTTHUMG00000152335	ENST00000216416.4:c.395dupT	14.37:g.54896998_54896998dupA	ENSP00000216416:p.Tyr132fs	Somatic		Capture	SOLID	Phase_I	53966741	NM_005776	Q3SYM7	Frame_Shift_Ins	INS	ENST00000216416.4	37	CCDS9717.1																																																																																				0.347	CNIH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276896.2	NM_005776	
KIAA0196	9897	hgsc.bcm.edu	37	8	126067880	126067881	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:126067880_126067881insA	ENST00000318410.7	-	17	2398_2399	c.2049_2050insT	c.(2047-2052)tttactfs	p.T684fs	KIAA0196_ENST00000517845.1_Frame_Shift_Ins_p.T536fs	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	684					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.T684fs*2(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ATGCCTTCAGTAAAAATGGAAA	0.391																																					p.T684fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2050_2051insT	8						.																																			126137063	SO:0001589	frameshift_variant	9897	exon17				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.2050dupT	8.37:g.126067885_126067885dupA	ENSP00000318016:p.Thr684fs	Somatic		Capture	SOLID	Phase_I	126137062	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Frame_Shift_Ins	INS	ENST00000318410.7	37	CCDS6355.1																																																																																				0.391	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
EMR3	84658	hgsc.bcm.edu	37	19	14758112	14758113	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:14758112_14758113insA	ENST00000253673.5	-	8	862_863	c.762_763insT	c.(760-765)tttgaafs	p.E255fs	EMR3_ENST00000599900.1_Frame_Shift_Ins_p.E40fs|EMR3_ENST00000344373.4_Frame_Shift_Ins_p.E203fs|EMR3_ENST00000443157.2_Frame_Shift_Ins_p.E129fs	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	255					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.E255fs*1(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						TCCATCTCTTCAAAAAAAGTTG	0.401																																					p.E255_E256delinsX												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.763_764insT	19						.																																			14619113	SO:0001589	frameshift_variant	84658	exon8			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.763dupT	19.37:g.14758119_14758119dupA	ENSP00000253673:p.Glu255fs	Somatic		Capture	SOLID	Phase_I	14619112	NM_032571		Frame_Shift_Ins	INS	ENST00000253673.5	37	CCDS12315.1																																																																																				0.401	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571	
PLD3	23646	hgsc.bcm.edu	37	19	40882630	40882631	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:40882630_40882631insCT	ENST00000409587.1	+	11	1531_1532	c.1134_1135insCT	c.(1135-1137)ctcfs	p.L379fs	PLD3_ENST00000409735.4_Frame_Shift_Ins_p.L379fs|PLD3_ENST00000356508.5_Frame_Shift_Ins_p.L379fs|PLD3_ENST00000409281.1_Frame_Shift_Ins_p.L379fs|PLD3_ENST00000409419.1_Frame_Shift_Ins_p.L379fs			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	379					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)	p.A329fs*15(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			GGGCCTTCCTGCTCTCTCTGGC	0.644																																					p.L378fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1134_1135insCT	19						.																																			45574471	SO:0001589	frameshift_variant	23646	exon11			BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.1141_1142dupCT	19.37:g.40882637_40882638dupCT	ENSP00000387050:p.Leu379fs	Somatic		Capture	SOLID	Phase_I	45574470	NM_001031696	Q92853|Q9BW87	Frame_Shift_Ins	INS	ENST00000409587.1	37	CCDS33027.1																																																																																				0.644	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327721.1	NM_012268	
SORT1	6272	hgsc.bcm.edu	37	1	109878871	109878872	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:109878871_109878872insT	ENST00000256637.6	-	11	1419_1420	c.1361_1362insA	c.(1360-1362)aacfs	p.N454fs	SORT1_ENST00000538502.1_Frame_Shift_Ins_p.N317fs	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	454					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)	p.N454fs*4(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		CCTCATTCTTGTTTTTTGCTGT	0.436																																					p.N454fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1362_1363insA	1						.																																			109680395	SO:0001589	frameshift_variant	6272	exon11			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1362dupA	1.37:g.109878877_109878877dupT	ENSP00000256637:p.Asn454fs	Somatic		Capture	SOLID	Phase_I	109680394	NM_002959	B4DWI3|C0JYZ0|Q8IZ49	Frame_Shift_Ins	INS	ENST00000256637.6	37	CCDS798.1																																																																																				0.436	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
RGS4	5999	hgsc.bcm.edu	37	1	163042222	163042223	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:163042222_163042223insA	ENST00000367909.6	+	2	422_423	c.82_83insA	c.(82-84)caafs	p.Q28fs	RGS4_ENST00000421743.2_Frame_Shift_Ins_p.Q125fs|RGS4_ENST00000527809.1_Frame_Shift_Ins_p.Q10fs|RGS4_ENST00000367908.4_Frame_Shift_Ins_p.Q28fs|RGS4_ENST00000367906.3_Frame_Shift_Ins_p.Q10fs|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000531057.1_Frame_Shift_Ins_p.Q28fs	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	28					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.S30fs*2(1)|p.S127fs*2(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TTTCCTGCTGCAAAAATCTGAT	0.366																																					p.Q125fs	Ovarian(76;1257 1738 3039 6086)											.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.373_374insA	1						.																																			161308847	SO:0001589	frameshift_variant	5999	exon3			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.87dupA	1.37:g.163042227_163042227dupA	ENSP00000356885:p.Gln28fs	Somatic		Capture	SOLID	Phase_I	161308846	NM_001102445	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Frame_Shift_Ins	INS	ENST00000367909.6	37	CCDS1243.1																																																																																				0.366	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613	
CDCP2	200008	hgsc.bcm.edu	37	1	54605670	54605671	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:54605670_54605671insG	ENST00000371330.1	-	4	1719_1720	c.872_873insC	c.(871-873)ccgfs	p.P291fs	CDCP2_ENST00000530059.1_5'Flank|RP11-446E24.4_ENST00000525949.1_5'Flank	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	291	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)		p.Y293fs*23(1)		kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						CCTGGTAGCCCGGGGGCAGGCG	0.619																																					p.P291fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.873_874insC	1						.																																			54378259	SO:0001589	frameshift_variant	200008	exon4				CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.873dupC	1.37:g.54605675_54605675dupG	ENSP00000360381:p.Pro291fs	Somatic		Capture	SOLID	Phase_I	54378258	NM_201546	Q6ZWJ3	Frame_Shift_Ins	INS	ENST00000371330.1	37	CCDS588.2																																																																																				0.619	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000022209.2	NM_201546	
BTG3	10950	hgsc.bcm.edu	37	21	18966594	18966595	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr21:18966594_18966595insT	ENST00000348354.6	-	5	831_832	c.575_576insA	c.(574-576)aagfs	p.K192fs	BTG3_ENST00000339775.6_Frame_Shift_Ins_p.K236fs	NM_006806.4	NP_006797.3	Q14201	BTG3_HUMAN	BTG family, member 3	192					negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)	cytoplasm (GO:0005737)		p.P193fs*29(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	8				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		ACATTCCTGGCTTTTTTCTGGG	0.396																																					p.K192fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.576_577insA	21						.																																			17888466	SO:0001589	frameshift_variant	10950	exon5			D64110	CCDS13569.1, CCDS46636.1	21q21.1	2006-12-16			ENSG00000154640	ENSG00000154640			1132	protein-coding gene	gene with protein product		605674				9632145	Standard	NM_006806		Approved	ANA, tob55	uc002ykk.3	Q14201	OTTHUMG00000074501	ENST00000348354.6:c.576dupA	21.37:g.18966600_18966600dupT	ENSP00000284879:p.Lys192fs	Somatic		Capture	SOLID	Phase_I	17888465	NM_006806	D3DSC4|Q53XV1|Q96ET7	Frame_Shift_Ins	INS	ENST00000348354.6	37	CCDS13569.1																																																																																				0.396	BTG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158196.1	NM_006806	
PPL	5493	hgsc.bcm.edu	37	16	4944499	4944500	+	Frame_Shift_Ins	INS	-	-	G	rs147027769|rs552407353		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:4944499_4944500insG	ENST00000345988.2	-	12	1451_1452	c.1362_1363insC	c.(1360-1365)cccacafs	p.T455fs	PPL_ENST00000590782.2_Frame_Shift_Ins_p.T453fs	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	455					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.T455fs*4(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCAGGGTCTGTGGGGGGGATCA	0.609																																					p.T455fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1363_1364insC	16						.			16,4248		0,16,2116						5.2	1.0			76	3,8251		0,3,4124	no	frameshift	PPL	NM_002705.4		0,19,6240	A1A1,A1R,RR		0.0363,0.3752,0.1518				19,12499				4884501	SO:0001589	frameshift_variant	5493	exon12			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1363dupC	16.37:g.4944506_4944506dupG	ENSP00000340510:p.Thr455fs	Somatic		Capture	SOLID	Phase_I	4884500	NM_002705	O60314|O60454|Q14C98	Frame_Shift_Ins	INS	ENST00000345988.2	37	CCDS10526.1																																																																																				0.609	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
NPY1R	4886	hgsc.bcm.edu	37	4	164246459	164246460	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:164246459_164246460insT	ENST00000296533.2	-	3	1681_1682	c.1150_1151insA	c.(1150-1152)atcfs	p.I384fs	NPY1R_ENST00000509586.1_Frame_Shift_Ins_p.I141fs	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	384					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.I384fs*>2(1)		breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GTAGTTTCAGATTTTTTCATTA	0.391																																					p.I384fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1151_1152insA	4						.																																			164465910	SO:0001589	frameshift_variant	4886	exon3				CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.1151dupA	4.37:g.164246465_164246465dupT	ENSP00000354652:p.Ile384fs	Somatic		Capture	SOLID	Phase_I	164465909	NM_000909	B2R6H5	Frame_Shift_Ins	INS	ENST00000296533.2	37	CCDS34089.1																																																																																				0.391	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364685.1		
DPP10	57628	hgsc.bcm.edu	37	2	116520174	116520175	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:116520174_116520175insCT	ENST00000410059.1	+	12	1581_1582	c.1101_1102insCT	c.(1102-1104)ctcfs	p.L368fs	DPP10_ENST00000393147.2_Frame_Shift_Ins_p.L372fs|DPP10_ENST00000409163.1_Frame_Shift_Ins_p.L318fs|DPP10_ENST00000310323.8_Frame_Shift_Ins_p.L361fs	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	368						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.Q363fs*18(1)|p.Q370fs*18(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CAGATACGTGGCTCTCTCAGCA	0.342																																					p.W317fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.951_952insCT	2						.																																			116236645	SO:0001589	frameshift_variant	57628	exon13			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1106_1107dupCT	2.37:g.116520179_116520180dupCT	ENSP00000386565:p.Leu368fs	Somatic		Capture	SOLID	Phase_I	116236644	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Frame_Shift_Ins	INS	ENST00000410059.1	37	CCDS46400.1																																																																																				0.342	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
SEPT2	4735	hgsc.bcm.edu	37	2	242274556	242274557	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:242274556_242274557insA	ENST00000391973.2	+	4	674_675	c.146_147insA	c.(145-150)ggaaaafs	p.GK49fs	SEPT2_ENST00000391971.2_Frame_Shift_Ins_p.GK49fs|SEPT2_ENST00000360051.3_Frame_Shift_Ins_p.GK49fs|SEPT2_ENST00000401990.1_Frame_Shift_Ins_p.GK49fs|SEPT2_ENST00000407971.1_Frame_Shift_Ins_p.GK9fs|SEPT2_ENST00000402092.2_Frame_Shift_Ins_p.GK49fs	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	49	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)	p.S51fs*11(1)		central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		TCAGGTCTAGGAAAATCGACTC	0.371																																					p.G49fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.146_147insA	2						.																																			241923230	SO:0001589	frameshift_variant	4735	exon4			D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.150dupA	2.37:g.242274560_242274560dupA	ENSP00000375834:p.Gly49fs	Somatic		Capture	SOLID	Phase_I	241923229	NM_006155	B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Frame_Shift_Ins	INS	ENST00000391973.2	37	CCDS2548.1																																																																																				0.371	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155	
MLLT10	8028	hgsc.bcm.edu	37	10	21962451	21962452	+	Frame_Shift_Ins	INS	-	-	G	rs573639267	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:21962451_21962452insG	ENST00000307729.7	+	11	1402_1403	c.1224_1225insG	c.(1225-1227)gggfs	p.G409fs	MLLT10_ENST00000377072.3_Frame_Shift_Ins_p.G409fs|MLLT10_ENST00000446906.2_Frame_Shift_Ins_p.G409fs|MLLT10_ENST00000377059.3_Frame_Shift_Ins_p.G409fs			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	409	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.V411fs*3(1)		NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GAAGCCAGGAAGGGGGGGTAAA	0.436			T	"""MLL, PICALM, CDK6"""	AL																																p.E408fs			Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1224_1225insG	10						.																																			22002458	SO:0001589	frameshift_variant	8028	exon11			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1231dupG	10.37:g.21962458_21962458dupG	ENSP00000307411:p.Gly409fs	Somatic		Capture	SOLID	Phase_I	22002457	NM_004641	B1ANA8|Q5JT37|Q5VX90|Q66K63	Frame_Shift_Ins	INS	ENST00000307729.7	37	CCDS55708.1																																																																																				0.436	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1		
CNOT6	57472	hgsc.bcm.edu	37	5	179996170	179996171	+	Frame_Shift_Ins	INS	-	-	T	rs202095631	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:179996170_179996171insT	ENST00000393356.1	+	12	1512_1513	c.1088_1089insT	c.(1087-1092)cattggfs	p.W364fs	CNOT6_ENST00000261951.4_Frame_Shift_Ins_p.W364fs			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	364	Nuclease domain. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)	p.W364fs*4(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		GCCCACATGCATTGGGACCCTG	0.401																																					p.H363fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1088_1089insT	5						.																																			179928777	SO:0001589	frameshift_variant	57472	exon10			AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.1090dupT	5.37:g.179996172_179996172dupT	ENSP00000377024:p.Trp364fs	Somatic		Capture	SOLID	Phase_I	179928776	NM_015455	A7MD46|D3DWR0	Frame_Shift_Ins	INS	ENST00000393356.1	37	CCDS4455.1																																																																																				0.401	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253532.1	NM_015455	
PDZD2	23037	hgsc.bcm.edu	37	5	32089075	32089076	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:32089075_32089076insA	ENST00000438447.1	+	20	5909_5910	c.5521_5522insA	c.(5521-5523)caafs	p.Q1841fs	PDZD2_ENST00000282493.3_Frame_Shift_Ins_p.Q1841fs			O15018	PDZD2_HUMAN	PDZ domain containing 2	1841					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.V1845fs*6(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GAGTTCAAGCCAAAAAAAGGGC	0.475																																					p.Q1841fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.5521_5522insA	5						.																																			32124833	SO:0001589	frameshift_variant	23037	exon19			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5528dupA	5.37:g.32089082_32089082dupA	ENSP00000402033:p.Gln1841fs	Somatic		Capture	SOLID	Phase_I	32124832	NM_178140	Q9BXD4	Frame_Shift_Ins	INS	ENST00000438447.1	37	CCDS34137.1																																																																																				0.475	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
FBXO24	26261	hgsc.bcm.edu	37	7	100187845	100187845	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:100187845G>A	ENST00000241071.6	+	3	509	c.187G>A	c.(187-189)Ggc>Agc	p.G63S	PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000465843.1_Missense_Mutation_p.G63S|FBXO24_ENST00000360609.2_Missense_Mutation_p.G63S|FBXO24_ENST00000468962.1_Missense_Mutation_p.G51S|FBXO24_ENST00000427939.2_Missense_Mutation_p.G101S|PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000498195.1_3'UTR	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	63	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.G63S(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TGTTGCCCTCGGCCAGACCTG	0.607																																					p.G51S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G151A	7						.						59.0	44.0	49.0					7																	100187845		2203	4300	6503	100025781	SO:0001583	missense	26261	exon3			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.187G>A	7.37:g.100187845G>A	ENSP00000241071:p.Gly63Ser	Somatic		Capture	SOLID	Phase_I	100025781	NM_001163499	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334480	0.60853	.	.	ENSG00000106336	ENST00000461079;ENST00000241071;ENST00000360609;ENST00000465843;ENST00000466053;ENST00000468962;ENST00000427939	T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29	4.69	4.69	0.59074	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.000000	0.64402	D	0.000015	T	0.13756	0.0333	N	0.01277	-0.915	0.46356	D	0.999	B;B;B;B	0.34061	0.17;0.383;0.17;0.436	B;B;B;B	0.27715	0.03;0.082;0.03;0.048	T	0.19484	-1.0304	10	0.35671	T	0.21	-22.5301	15.207	0.73186	0.0:0.0:1.0:0.0	.	51;101;63;63	B4DY42;B4DX91;O75426;O75426-2	.;.;FBX24_HUMAN;.	S	86;63;63;63;68;51;101	ENSP00000419587:G86S;ENSP00000241071:G63S;ENSP00000353821:G63S;ENSP00000419602:G63S;ENSP00000417179:G68S;ENSP00000420239:G51S;ENSP00000416558:G101S	ENSP00000241071:G63S	G	+	1	0	FBXO24	100025781	1.000000	0.71417	0.946000	0.38457	0.719000	0.41307	4.530000	0.60595	2.439000	0.82584	0.555000	0.69702	GGC		0.607	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
RELN	5649	hgsc.bcm.edu	37	7	103341409	103341409	+	Missense_Mutation	SNP	C	C	T	rs149397714		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:103341409C>T	ENST00000428762.1	-	9	1009	c.850G>A	c.(850-852)Gtg>Atg	p.V284M	RELN_ENST00000424685.2_Missense_Mutation_p.V284M|RELN_ENST00000343529.5_Missense_Mutation_p.V284M	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	284					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.V284M(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCATATAACACGATGATGCTG	0.333																																					p.V284M	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G850A	7						.	C	MET/VAL,MET/VAL	0,4406		0,0,2203	116.0	115.0	115.0		850,850	4.9	0.7	7	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RELN	NM_005045.3,NM_173054.2	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	284/3461,284/3459	103341409	1,13005	2203	4300	6503	103128645	SO:0001583	missense	5649	exon9				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.850G>A	7.37:g.103341409C>T	ENSP00000392423:p.Val284Met	Somatic		Capture	SOLID	Phase_I	103128645	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382745	0.61845	0.0	1.16E-4	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.33865	1.39;1.39;1.39	5.79	4.91	0.64330	.	0.128473	0.52532	N	0.000071	T	0.52597	0.1744	M	0.64997	1.995	0.50632	D	0.999883	D;D	0.69078	0.997;0.995	P;P	0.58780	0.845;0.705	T	0.56329	-0.7997	10	0.59425	D	0.04	.	15.0002	0.71466	0.0:0.9315:0.0:0.0685	.	284;284	P78509-2;P78509	.;RELN_HUMAN	M	284	ENSP00000392423:V284M;ENSP00000345694:V284M;ENSP00000388446:V284M	ENSP00000345694:V284M	V	-	1	0	RELN	103128645	1.000000	0.71417	0.708000	0.30435	0.688000	0.40055	5.394000	0.66285	1.455000	0.47813	0.585000	0.79938	GTG		0.333	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
KMT2E	55904	hgsc.bcm.edu	37	7	104746307	104746307	+	Splice_Site	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:104746307G>A	ENST00000311117.3	+	19	2998	c.2453G>A	c.(2452-2454)cGa>cAa	p.R818Q	KMT2E_ENST00000334914.7_De_novo_Start_OutOfFrame|CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000257745.4_Splice_Site_p.R818Q|KMT2E_ENST00000334877.4_Splice_Site_p.R818Q	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	818					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R818Q(1)									TTTATTCAGCGATGGTTGAAA	0.368																																					p.R818Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2453A	7						.						67.0	70.0	69.0					7																	104746307		2203	4300	6503	104533543	SO:0001630	splice_region_variant	55904	exon19			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2452-1G>A	7.37:g.104746307G>A		Somatic		Capture	SOLID	Phase_I	104533543	NM_182931	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193941	0.78902	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.97016	-4.21;-3.56;-4.21	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000001	D	0.97704	0.9247	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98102	1.0415	10	0.72032	D	0.01	.	20.0804	0.97772	0.0:0.0:1.0:0.0	.	818	Q8IZD2	MLL5_HUMAN	Q	818;818;818;738;818	ENSP00000312379:R818Q;ENSP00000335599:R818Q;ENSP00000257745:R818Q	ENSP00000257745:R818Q	R	+	2	0	MLL5	104533543	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.198000	0.94994	2.738000	0.93877	0.655000	0.94253	CGA		0.368	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		Missense_Mutation
RINT1	60561	hgsc.bcm.edu	37	7	105195523	105195523	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:105195523A>G	ENST00000257700.2	+	11	1751	c.1520A>G	c.(1519-1521)gAg>gGg	p.E507G		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	507	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.E507G(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CAGTTCCTGGAGTTACAGAAG	0.378																																					p.E507G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1520G	7						.						127.0	129.0	128.0					7																	105195523		2203	4300	6503	104982759	SO:0001583	missense	60561	exon11			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.1520A>G	7.37:g.105195523A>G	ENSP00000257700:p.Glu507Gly	Somatic		Capture	SOLID	Phase_I	104982759	NM_021930	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	ENST00000257700.2	37	CCDS34726.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.487954	0.44249	.	.	ENSG00000135249	ENST00000257700	T	0.32023	1.47	6.02	6.02	0.97574	.	0.193946	0.53938	D	0.000042	T	0.22085	0.0532	N	0.25647	0.755	0.43953	D	0.996625	B	0.13145	0.007	B	0.14578	0.011	T	0.06110	-1.0845	10	0.31617	T	0.26	-21.2115	11.105	0.48197	0.9234:0.0:0.0766:0.0	.	507	Q6NUQ1	RINT1_HUMAN	G	507	ENSP00000257700:E507G	ENSP00000257700:E507G	E	+	2	0	RINT1	104982759	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.089000	0.50183	2.304000	0.77564	0.528000	0.53228	GAG		0.378	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
ATXN7L1	222255	hgsc.bcm.edu	37	7	105516883	105516883	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:105516883G>A	ENST00000419735.3	-	1	167	c.122C>T	c.(121-123)gCg>gTg	p.A41V	ATXN7L1_ENST00000478915.1_Missense_Mutation_p.A13V|ATXN7L1_ENST00000318724.4_Missense_Mutation_p.A41V	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	41								p.A41V(1)		endometrium(1)|large_intestine(4)|lung(5)	10						GCCCAGAAACGCCTCCGGACT	0.552																																					p.A41V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C122T	7						.						109.0	101.0	104.0					7																	105516883		2203	4300	6503	105304119	SO:0001583	missense	222255	exon1			AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.122C>T	7.37:g.105516883G>A	ENSP00000410759:p.Ala41Val	Somatic		Capture	SOLID	Phase_I	105304119	NM_020725	A4D0Q2|B4DTS1|Q8N2T0	Missense_Mutation	SNP	ENST00000419735.3	37	CCDS47682.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068939	0.36470	.	.	ENSG00000146776	ENST00000419735;ENST00000318724;ENST00000478915	T;T	0.33865	1.39;1.39	5.34	5.34	0.76211	.	0.105505	0.36134	N	0.002768	T	0.39358	0.1075	L	0.34521	1.04	0.80722	D	1	D;D	0.65815	0.994;0.995	P;P	0.55260	0.734;0.772	T	0.09100	-1.0690	10	0.02654	T	1	.	19.0242	0.92926	0.0:0.0:1.0:0.0	.	41;41	A4D0Q2;Q9ULK2	.;AT7L1_HUMAN	V	41;41;13	ENSP00000410759:A41V;ENSP00000326344:A41V	ENSP00000326344:A41V	A	-	2	0	ATXN7L1	105304119	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.022000	0.70839	2.481000	0.83766	0.555000	0.69702	GCG		0.552	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349037.2		
PIK3CG	5294	hgsc.bcm.edu	37	7	106509639	106509639	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:106509639G>A	ENST00000359195.3	+	2	1943	c.1633G>A	c.(1633-1635)Gca>Aca	p.A545T	PIK3CG_ENST00000440650.2_Missense_Mutation_p.A545T|PIK3CG_ENST00000496166.1_Missense_Mutation_p.A545T	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A545T(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						CCGGGTTCGAGCAGAAATGCC	0.532																																					p.A545T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1633A	7						.						82.0	79.0	80.0					7																	106509639		2203	4300	6503	106296875	SO:0001583	missense	5294	exon2				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1633G>A	7.37:g.106509639G>A	ENSP00000352121:p.Ala545Thr	Somatic		Capture	SOLID	Phase_I	106296875	NM_002649	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	G	8.633	0.894146	0.17613	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.64085	-0.08;-0.08;-0.08	5.81	5.81	0.92471	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.298412	0.37437	N	0.002088	T	0.34019	0.0883	N	0.02011	-0.69	0.41036	D	0.985194	B	0.06786	0.001	B	0.13407	0.009	T	0.35076	-0.9803	10	0.13470	T	0.59	-15.9474	13.2992	0.60315	0.0719:0.0:0.9281:0.0	.	545	P48736	PK3CG_HUMAN	T	545	ENSP00000392258:A545T;ENSP00000419260:A545T;ENSP00000352121:A545T	ENSP00000352121:A545T	A	+	1	0	PIK3CG	106296875	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	3.245000	0.51407	2.756000	0.94617	0.655000	0.94253	GCA		0.532	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
PPP1R3A	5506	hgsc.bcm.edu	37	7	113558686	113558686	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:113558686T>C	ENST00000284601.3	-	1	434	c.366A>G	c.(364-366)caA>caG	p.Q122Q		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	122	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.Q122Q(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GTATTTGGAGTTGTTGCATAA	0.383																																					p.Q122Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A366G	7						.						103.0	102.0	103.0					7																	113558686		2203	4300	6503	113345922	SO:0001819	synonymous_variant	5506	exon1			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.366A>G	7.37:g.113558686T>C		Somatic		Capture	SOLID	Phase_I	113345922	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	37	CCDS5759.1																																																																																				0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
CALD1	800	hgsc.bcm.edu	37	7	134613646	134613646	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:134613646G>T	ENST00000361675.2	+	4	442	c.213G>T	c.(211-213)caG>caT	p.Q71H	CALD1_ENST00000393118.2_Missense_Mutation_p.Q65H|CALD1_ENST00000543443.1_Missense_Mutation_p.Q76H|CALD1_ENST00000417172.1_Missense_Mutation_p.Q71H|CALD1_ENST00000422748.1_Missense_Mutation_p.Q71H|CALD1_ENST00000495522.1_Missense_Mutation_p.Q65H|CALD1_ENST00000361901.2_Missense_Mutation_p.Q71H|CALD1_ENST00000424922.1_Missense_Mutation_p.Q65H|CALD1_ENST00000361388.2_Missense_Mutation_p.Q71H			Q05682	CALD1_HUMAN	caldesmon 1	71	Myosin and calmodulin-binding. {ECO:0000250}.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.Q71H(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						TGAATGCCCAGAACAGGTACT	0.577																																					p.Q71H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G213T	7						.						73.0	63.0	66.0					7																	134613646		2203	4300	6503	134264186	SO:0001583	missense	800	exon4			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.213G>T	7.37:g.134613646G>T	ENSP00000354826:p.Gln71His	Somatic		Capture	SOLID	Phase_I	134264186	NM_033157	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	37	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397441	0.42512	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000454108;ENST00000361675;ENST00000361901;ENST00000445569;ENST00000435928;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.46	4.58	0.56647	.	0.000000	0.42172	D	0.000748	T	0.66973	0.2844	M	0.75264	2.295	0.22811	N	0.998703	D;D;D;D;D;D;D;D	0.71674	0.997;0.995;0.994;0.994;0.994;0.994;0.998;0.995	D;D;D;D;D;D;D;D	0.79108	0.987;0.982;0.969;0.969;0.969;0.969;0.992;0.982	T	0.61836	-0.6981	10	0.87932	D	0	-31.2784	12.6767	0.56897	0.0769:0.0:0.9231:0.0	.	76;71;65;65;71;71;71;71	F5H1Z9;A8K0X1;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;CALD1_HUMAN;.	H	71;71;71;71;71;71;71;85;71;65;65;65;76	ENSP00000398826:Q71H;ENSP00000411476:Q71H;ENSP00000355000:Q71H;ENSP00000395710:Q71H;ENSP00000401988:Q71H;ENSP00000354826:Q71H;ENSP00000354513:Q71H;ENSP00000390926:Q85H;ENSP00000416611:Q71H;ENSP00000376826:Q65H;ENSP00000393621:Q65H;ENSP00000419673:Q65H;ENSP00000445641:Q76H	ENSP00000355000:Q71H	Q	+	3	2	CALD1	134264186	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.480000	0.35464	1.295000	0.44724	0.491000	0.48974	CAG		0.577	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	
BRAF	673	hgsc.bcm.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu	Somatic		Capture	SOLID	Phase_I	140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
KEL	3792	hgsc.bcm.edu	37	7	142650950	142650950	+	Missense_Mutation	SNP	C	C	T	rs201473860		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:142650950C>T	ENST00000355265.2	-	9	1492	c.1018G>A	c.(1018-1020)Gtg>Atg	p.V340M	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	340					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.V340M(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					AAATATTCCACGTCATGGACC	0.537													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19328	0.0		0.0	False		,,,				2504	0.0				p.V340M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1018A	7						.						201.0	200.0	201.0					7																	142650950		2203	4300	6503	142361072	SO:0001583	missense	3792	exon9			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1018G>A	7.37:g.142650950C>T	ENSP00000347409:p.Val340Met	Somatic		Capture	SOLID	Phase_I	142361072	NM_000420	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	10.37	1.332013	0.24167	.	.	ENSG00000197993	ENST00000355265	T	0.74315	-0.83	5.78	3.65	0.41850	Peptidase M13 (1);	0.485377	0.17179	N	0.183979	T	0.45397	0.1340	N	0.02011	-0.69	0.21473	N	0.999674	B	0.12013	0.005	B	0.01281	0.0	T	0.31861	-0.9928	10	0.30078	T	0.28	-6.9519	8.2204	0.31539	0.0951:0.1661:0.7388:0.0	.	340	P23276	KELL_HUMAN	M	340	ENSP00000347409:V340M	ENSP00000347409:V340M	V	-	1	0	KEL	142361072	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	1.407000	0.34657	1.467000	0.48044	-0.610000	0.04054	GTG		0.537	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
CUL1	8454	hgsc.bcm.edu	37	7	148494941	148494941	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:148494941C>T	ENST00000325222.4	+	18	2216	c.1937C>T	c.(1936-1938)tCg>tTg	p.S646L	CUL1_ENST00000602748.1_Missense_Mutation_p.S646L|CUL1_ENST00000409469.1_Missense_Mutation_p.S646L	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	646					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.S646L(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TTATTAAAGTCGAAGCTATTG	0.358																																					p.S646L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1937T	7						.						105.0	104.0	104.0					7																	148494941		2203	4300	6503	148125874	SO:0001583	missense	8454	exon18			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1937C>T	7.37:g.148494941C>T	ENSP00000326804:p.Ser646Leu	Somatic		Capture	SOLID	Phase_I	148125874	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	.	14.22	2.470693	0.43942	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	T;T	0.74421	-0.84;-0.84	4.89	4.89	0.63831	Cullin, N-terminal (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin homology (1);	0.059071	0.64402	D	0.000001	T	0.68155	0.2970	L	0.46947	1.48	0.80722	D	1	B;B	0.29162	0.067;0.235	B;B	0.17722	0.009;0.019	T	0.68655	-0.5351	10	0.51188	T	0.08	-11.0023	17.0586	0.86541	0.0:1.0:0.0:0.0	.	573;646	E7EWR0;Q13616	.;CUL1_HUMAN	L	646;646;604;573	ENSP00000387160:S646L;ENSP00000326804:S646L	ENSP00000326804:S646L	S	+	2	0	CUL1	148125874	1.000000	0.71417	0.929000	0.37066	0.090000	0.18270	7.481000	0.81124	2.263000	0.75096	0.313000	0.20887	TCG		0.358	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
KMT2C	58508	hgsc.bcm.edu	37	7	151845390	151845390	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:151845390C>T	ENST00000262189.6	-	52	13840	c.13622G>A	c.(13621-13623)cGa>cAa	p.R4541Q	KMT2C_ENST00000355193.2_Missense_Mutation_p.R4598Q	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4541					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R4598Q(1)|p.R4541Q(1)									CCGTTCTCCTCGTTGCACGAT	0.488																																					p.R4541Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G13622A	7						.						131.0	99.0	110.0					7																	151845390		2203	4300	6503	151476323	SO:0001583	missense	58508	exon52			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13622G>A	7.37:g.151845390C>T	ENSP00000262189:p.Arg4541Gln	Somatic		Capture	SOLID	Phase_I	151476323	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765252	0.69878	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.88277	-1.71;-1.7;-2.36	4.87	4.87	0.63330	.	0.000000	0.35525	U	0.003158	D	0.91092	0.7196	L	0.31065	0.9	0.80722	D	1	D;P;P	0.89917	1.0;0.939;0.939	D;B;B	0.79108	0.992;0.314;0.314	D	0.91653	0.5336	10	0.48119	T	0.1	.	18.0248	0.89265	0.0:1.0:0.0:0.0	.	4541;3659;4598	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	Q	4541;4598;1158	ENSP00000262189:R4541Q;ENSP00000347325:R4598Q;ENSP00000410411:R1158Q	ENSP00000262189:R4541Q	R	-	2	0	MLL3	151476323	1.000000	0.71417	0.944000	0.38274	0.982000	0.71751	6.011000	0.70760	2.245000	0.73994	0.460000	0.39030	CGA		0.488	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
XRCC2	7516	hgsc.bcm.edu	37	7	152345797	152345797	+	Missense_Mutation	SNP	C	C	T	rs149186933		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:152345797C>T	ENST00000359321.1	-	3	858	c.773G>A	c.(772-774)cGt>cAt	p.R258H	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	258					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.R258H(1)		NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		TTTTAAACAACGTGAAACTAA	0.333								Homologous recombination																													p.R258H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773A	7						.	C	HIS/ARG	0,4406		0,0,2203	85.0	90.0	89.0		773	1.5	0.9	7	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	missense	XRCC2	NM_005431.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	258/281	152345797	1,13005	2203	4300	6503	151976730	SO:0001583	missense	7516	exon3			Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.773G>A	7.37:g.152345797C>T	ENSP00000352271:p.Arg258His	Somatic		Capture	SOLID	Phase_I	151976730	NM_005431	B2R925	Missense_Mutation	SNP	ENST00000359321.1	37	CCDS5933.1	.	.	.	.	.	.	.	.	.	.	C	6.232	0.410989	0.11812	0.0	1.16E-4	ENSG00000196584	ENST00000359321	T	0.66099	-0.19	5.29	1.47	0.22746	.	0.634660	0.16755	N	0.200854	T	0.53334	0.1790	L	0.57536	1.79	0.24281	N	0.995205	B	0.12630	0.006	B	0.06405	0.002	T	0.41770	-0.9490	10	0.28530	T	0.3	-13.3511	9.4934	0.38974	0.0:0.7092:0.0:0.2908	.	258	O43543	XRCC2_HUMAN	H	258	ENSP00000352271:R258H	ENSP00000352271:R258H	R	-	2	0	XRCC2	151976730	0.978000	0.34361	0.943000	0.38184	0.129000	0.20672	0.387000	0.20718	0.248000	0.21435	-0.262000	0.10625	CGT		0.333	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322783.1	NM_005431	
SHH	6469	hgsc.bcm.edu	37	7	155604646	155604646	+	Silent	SNP	G	G	A	rs374679410		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:155604646G>A	ENST00000297261.2	-	1	321	c.171C>T	c.(169-171)ggC>ggT	p.G57G		NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	57					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)	p.G57G(1)		central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTCCGCTGGCGCCTAGGGTCT	0.532																																					p.G57G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C171T	7						.						163.0	178.0	173.0					7																	155604646		2203	4300	6503	155297407	SO:0001819	synonymous_variant	6469	exon1				CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.171C>T	7.37:g.155604646G>A		Somatic		Capture	SOLID	Phase_I	155297407	NM_000193	A4D247|Q75MC9	Silent	SNP	ENST00000297261.2	37	CCDS5942.1																																																																																				0.532	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322327.1	NM_000193	
RBAK	57786	hgsc.bcm.edu	37	7	5103337	5103337	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:5103337G>A	ENST00000353796.3	+	6	574	c.250G>A	c.(250-252)Gtt>Att	p.V84I	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.V84I|RBAK-RBAKDN_ENST00000407184.1_Missense_Mutation_p.V84I	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	84					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V84I(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		AGCCTGGAGAGTTGATGACCT	0.398																																					p.V84I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G250A	7						.						44.0	42.0	43.0					7																	5103337		2203	4300	6503	5069863	SO:0001583	missense	57786	exon5			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.250G>A	7.37:g.5103337G>A	ENSP00000275423:p.Val84Ile	Somatic		Capture	SOLID	Phase_I	5069863	NM_021163	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	G	1.285	-0.609221	0.03690	.	.	ENSG00000146587	ENST00000407184;ENST00000353796;ENST00000396912	T;T;T	0.07114	5.78;3.22;3.22	3.47	0.624	0.17659	.	1.128370	0.06783	N	0.785632	T	0.05090	0.0136	N	0.16368	0.405	0.21220	N	0.999752	B	0.06786	0.001	B	0.04013	0.001	T	0.46105	-0.9215	9	0.21540	T	0.41	.	4.8762	0.13656	0.2132:0.0:0.6144:0.1723	.	84	Q9NYW8	RBAK_HUMAN	I	84	ENSP00000385560:V84I;ENSP00000275423:V84I;ENSP00000380120:V84I	ENSP00000275423:V84I	V	+	1	0	RBAK	5069863	0.000000	0.05858	0.004000	0.12327	0.367000	0.29736	-0.380000	0.07427	-0.107000	0.12088	-1.471000	0.01009	GTT		0.398	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
CRHR2	1395	hgsc.bcm.edu	37	7	30702339	30702339	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:30702339C>T	ENST00000471646.1	-	6	1085	c.668G>A	c.(667-669)cGc>cAc	p.R223H	CRHR2_ENST00000506074.2_Missense_Mutation_p.R223H|CRHR2_ENST00000341843.4_Missense_Mutation_p.R209H|CRHR2_ENST00000348438.4_Missense_Mutation_p.R250H	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	223					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)	p.R223H(1)		breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GAGGCACTTGCGCAGGCGCTC	0.562																																					p.R223H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G668A	7						.						101.0	87.0	92.0					7																	30702339		2203	4300	6503	30668864	SO:0001583	missense	1395	exon6				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.668G>A	7.37:g.30702339C>T	ENSP00000418722:p.Arg223His	Somatic		Capture	SOLID	Phase_I	30668864	NM_001883	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	ENST00000471646.1	37	CCDS5429.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030319	0.54790	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.4	2.59	0.31030	GPCR, family 2-like (1);	0.100367	0.64402	D	0.000008	T	0.30198	0.0757	L	0.39085	1.19	0.58432	D	0.999991	B;B;B;B;B	0.31599	0.224;0.224;0.33;0.209;0.224	B;B;B;B;B	0.36186	0.219;0.117;0.139;0.099;0.219	T	0.03807	-1.1002	10	0.21014	T	0.42	.	6.8914	0.24232	0.0:0.6768:0.1595:0.1638	.	222;223;250;209;223	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	H	223;250;209;223	ENSP00000418722:R223H;ENSP00000340943:R250H;ENSP00000344304:R209H;ENSP00000426498:R223H	ENSP00000344304:R209H	R	-	2	0	CRHR2	30668864	0.175000	0.23083	1.000000	0.80357	0.981000	0.71138	2.675000	0.46875	0.773000	0.33404	-1.114000	0.02060	CGC		0.562	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250448.3		
GHRHR	2692	hgsc.bcm.edu	37	7	31018816	31018816	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:31018816C>T	ENST00000326139.2	+	13	1275	c.1229C>T	c.(1228-1230)aCg>aTg	p.T410M	GHRHR_ENST00000409316.1_3'UTR|GHRHR_ENST00000461424.1_Intron|GHRHR_ENST00000409904.3_Missense_Mutation_p.T346M	NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	410					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)	p.T410M(1)		biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	AAGTGGACCACGCCTTCCCGC	0.592																																					p.T410M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1229T	7						.						122.0	89.0	100.0					7																	31018816		2203	4300	6503	30985341	SO:0001583	missense	2692	exon13				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.1229C>T	7.37:g.31018816C>T	ENSP00000320180:p.Thr410Met	Somatic		Capture	SOLID	Phase_I	30985341	NM_000823	Q99863	Missense_Mutation	SNP	ENST00000326139.2	37	CCDS5432.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576833	0.28092	.	.	ENSG00000106128	ENST00000326139;ENST00000409904	T;T	0.52983	0.64;0.82	4.94	-3.92	0.04155	.	.	.	.	.	T	0.29914	0.0748	L	0.31065	0.9	0.09310	N	0.999999	B;B	0.17852	0.024;0.024	B;B	0.14023	0.01;0.005	T	0.29971	-0.9994	9	0.56958	D	0.05	.	5.8845	0.18874	0.0:0.3885:0.321:0.2905	.	346;410	Q9HB45;Q02643	.;GHRHR_HUMAN	M	410;346	ENSP00000320180:T410M;ENSP00000387113:T346M	ENSP00000320180:T410M	T	+	2	0	GHRHR	30985341	0.001000	0.12720	0.004000	0.12327	0.321000	0.28281	-0.427000	0.06999	-0.426000	0.07360	-0.950000	0.02660	ACG		0.592	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327967.2		
NME8	51314	hgsc.bcm.edu	37	7	37905129	37905129	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:37905129T>G	ENST00000199447.4	+	10	903	c.531T>G	c.(529-531)atT>atG	p.I177M	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Missense_Mutation_p.I177M	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	177	NDK 1.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.I177M(1)									AATTGAAGATTACCAAAGCTG	0.378																																					p.I177M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T531G	7						.						76.0	75.0	75.0					7																	37905129		2203	4300	6503	37871654	SO:0001583	missense	51314	exon10			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.531T>G	7.37:g.37905129T>G	ENSP00000199447:p.Ile177Met	Somatic		Capture	SOLID	Phase_I	37871654	NM_016616	Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	T	15.65	2.895527	0.52121	.	.	ENSG00000086288	ENST00000199447;ENST00000444718;ENST00000440017	T;T;T	0.58358	0.53;0.34;0.53	4.45	0.728	0.18260	.	0.106602	0.41938	D	0.000786	T	0.68293	0.2985	M	0.88105	2.93	0.22050	N	0.999397	D	0.65815	0.995	D	0.72338	0.977	T	0.58177	-0.7682	10	0.87932	D	0	-12.9879	2.8289	0.05494	0.1951:0.2065:0.0:0.5984	.	177	Q8N427	TXND3_HUMAN	M	177;122;177	ENSP00000199447:I177M;ENSP00000390596:I122M;ENSP00000397063:I177M	ENSP00000199447:I177M	I	+	3	3	TXNDC3	37871654	0.016000	0.18221	0.189000	0.23252	0.313000	0.28021	-0.252000	0.08806	0.119000	0.18210	0.533000	0.62120	ATT		0.378	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
NME8	51314	hgsc.bcm.edu	37	7	37907401	37907401	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:37907401C>T	ENST00000199447.4	+	11	1091	c.719C>T	c.(718-720)aCc>aTc	p.T240I	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Missense_Mutation_p.T240I	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	240	NDK 1.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.T240I(1)									TCTGAAGAAACCGAACCACAG	0.438																																					p.T240I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C719T	7						.						140.0	122.0	128.0					7																	37907401		2203	4300	6503	37873926	SO:0001583	missense	51314	exon11			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.719C>T	7.37:g.37907401C>T	ENSP00000199447:p.Thr240Ile	Somatic		Capture	SOLID	Phase_I	37873926	NM_016616	Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	C	6.615	0.481957	0.12581	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.42131	0.98;0.98	5.1	-2.85	0.05734	.	2.631500	0.01165	N	0.006723	T	0.19565	0.0470	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.05257	-1.0896	10	0.19590	T	0.45	0.8442	2.1427	0.03779	0.2289:0.2482:0.3694:0.1535	.	240	Q8N427	TXND3_HUMAN	I	240	ENSP00000199447:T240I;ENSP00000397063:T240I	ENSP00000199447:T240I	T	+	2	0	TXNDC3	37873926	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.856000	0.01662	-0.706000	0.05028	-0.251000	0.11542	ACC		0.438	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
C7orf25	79020	hgsc.bcm.edu	37	7	42950320	42950320	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:42950320T>C	ENST00000350427.4	-	2	455	c.180A>G	c.(178-180)aaA>aaG	p.K60K	PSMA2_ENST00000442788.1_3'UTR|C7orf25_ENST00000431882.2_Silent_p.K118K|C7orf25_ENST00000447342.1_Silent_p.K60K|C7orf25_ENST00000438029.1_Silent_p.K60K			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	60								p.K60K(1)		endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						AATGAGACTCTTTAATAGCTA	0.408																																					p.K60K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A180G	7						.						171.0	166.0	168.0					7																	42950320		2203	4300	6503	42916845	SO:0001819	synonymous_variant	79020	exon2			BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.180A>G	7.37:g.42950320T>C		Somatic		Capture	SOLID	Phase_I	42916845	NM_024054	A4D1V2|J3KR36|Q9H779	Silent	SNP	ENST00000350427.4	37	CCDS5466.1																																																																																				0.408	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250814.2	NM_024054	
POLD2	5425	hgsc.bcm.edu	37	7	44155452	44155452	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:44155452G>A	ENST00000406581.2	-	10	1709	c.1060C>T	c.(1060-1062)Cga>Tga	p.R354*	POLD2_ENST00000223361.3_Nonsense_Mutation_p.R354*|POLD2_ENST00000452185.1_Nonsense_Mutation_p.R354*	NM_001256879.1	NP_001243808.1	P49005	DPOD2_HUMAN	polymerase (DNA directed), delta 2, accessory subunit	354					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.R354*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	12						CTGCTGTATCGGAAAATGTCA	0.557																																					p.R354X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1060T	7						.						165.0	148.0	154.0					7																	44155452		2203	4300	6503	44121977	SO:0001587	stop_gained	5425	exon9				CCDS5477.1, CCDS75586.1	7p13	2012-05-18	2012-05-18		ENSG00000106628	ENSG00000106628		"""DNA polymerases"""	9176	protein-coding gene	gene with protein product	"""Pol delta B subunit (p50)"", ""DNA polymerase delta subunit p50"""	600815	"""polymerase (DNA directed), delta 2, regulatory subunit (50kD)"", ""polymerase (DNA directed), delta 2, regulatory subunit 50kDa"""			8530069	Standard	NM_001127218		Approved		uc003tkf.5	P49005	OTTHUMG00000022909	ENST00000406581.2:c.1060C>T	7.37:g.44155452G>A	ENSP00000386105:p.Arg354*	Somatic		Capture	SOLID	Phase_I	44121977	NM_001127218	A4D2J4|B2R5S4	Nonsense_Mutation	SNP	ENST00000406581.2	37	CCDS5477.1	.	.	.	.	.	.	.	.	.	.	G	43	10.417690	0.99401	.	.	ENSG00000106628	ENST00000406581;ENST00000223361;ENST00000452185;ENST00000436400	.	.	.	5.64	4.74	0.60224	.	0.116078	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-8.8244	12.9158	0.58205	0.0:0.0:0.5673:0.4327	.	.	.	.	X	354;354;354;73	.	ENSP00000223361:R354X	R	-	1	2	POLD2	44121977	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.221000	0.58574	1.471000	0.48121	0.650000	0.86243	CGA		0.557	POLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250994.2	NM_001127218	
OGDH	4967	hgsc.bcm.edu	37	7	44746970	44746970	+	Missense_Mutation	SNP	A	A	G	rs186750221		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:44746970A>G	ENST00000222673.5	+	21	2821	c.2779A>G	c.(2779-2781)Atc>Gtc	p.I927V	OGDH_ENST00000444676.1_Missense_Mutation_p.I942V|OGDH_ENST00000449767.1_Missense_Mutation_p.I923V|OGDH_ENST00000439616.2_Missense_Mutation_p.I777V|OGDH_ENST00000543843.1_Missense_Mutation_p.I878V|OGDH_ENST00000447398.1_Missense_Mutation_p.I938V	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	927					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.I927V(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	GCAGGTGGCCATCACAAGGAT	0.592													A|||	1	0.000199681	0.0	0.0014	5008	,	,		20494	0.0		0.0	False		,,,				2504	0.0				p.I927V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2779G	7						.						52.0	44.0	47.0					7																	44746970		2203	4300	6503	44713495	SO:0001583	missense	4967	exon21			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2779A>G	7.37:g.44746970A>G	ENSP00000222673:p.Ile927Val	Somatic		Capture	SOLID	Phase_I	44713495	NM_002541	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	37	CCDS34627.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	17.48	3.400053	0.62177	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.21468	0.0517	M	0.70108	2.13	0.80722	D	1	B;B;B;B;B	0.23735	0.09;0.09;0.025;0.045;0.045	B;B;B;B;B	0.27608	0.049;0.081;0.053;0.053;0.053	T	0.01715	-1.1289	10	0.66056	D	0.02	-31.9098	15.5186	0.75846	1.0:0.0:0.0:0.0	.	722;777;923;938;927	B4E3E9;E9PFG7;E9PBM1;E9PDF2;Q02218	.;.;.;.;ODO1_HUMAN	V	777;923;938;942;927;878	ENSP00000398576:I777V;ENSP00000392878:I923V;ENSP00000388183:I938V;ENSP00000414662:I942V;ENSP00000222673:I927V;ENSP00000443821:I878V	ENSP00000222673:I927V	I	+	1	0	OGDH	44713495	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	6.281000	0.72632	2.150000	0.67090	0.402000	0.26972	ATC		0.592	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
WBSCR17	64409	hgsc.bcm.edu	37	7	70885995	70885995	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:70885995A>G	ENST00000333538.5	+	5	1500	c.866A>G	c.(865-867)gAg>gGg	p.E289G	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	289					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.E289G(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CAGCGGTACGAGAACTCGGCC	0.582																																					p.E289G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A866G	7						.						138.0	127.0	130.0					7																	70885995		2203	4300	6503	70523931	SO:0001583	missense	64409	exon5			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.866A>G	7.37:g.70885995A>G	ENSP00000329654:p.Glu289Gly	Somatic		Capture	SOLID	Phase_I	70523931	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981528	0.74474	.	.	ENSG00000185274	ENST00000333538	T	0.57595	0.39	5.32	5.32	0.75619	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.48409	0.1498	L	0.31476	0.935	0.80722	D	1	P	0.42871	0.792	P	0.47251	0.542	T	0.39057	-0.9632	10	0.25751	T	0.34	.	14.4767	0.67551	1.0:0.0:0.0:0.0	.	289	Q6IS24	GLTL3_HUMAN	G	289	ENSP00000329654:E289G	ENSP00000329654:E289G	E	+	2	0	WBSCR17	70523931	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	8.962000	0.93254	2.015000	0.59207	0.455000	0.32223	GAG		0.582	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
YWHAG	7532	hgsc.bcm.edu	37	7	75958909	75958909	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:75958909G>A	ENST00000307630.3	-	2	951	c.729C>T	c.(727-729)ggC>ggT	p.G243G		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	243					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)	p.G243G(1)		endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						TGTTGCCTTCGCCGCCATCGT	0.597																																					p.G243G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C729T	7						.						51.0	42.0	45.0					7																	75958909		2203	4300	6503	75796845	SO:0001819	synonymous_variant	7532	exon2			AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.729C>T	7.37:g.75958909G>A		Somatic		Capture	SOLID	Phase_I	75796845	NM_012479	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Silent	SNP	ENST00000307630.3	37	CCDS5584.1																																																																																				0.597	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253002.1	NM_012479	
DTX2	113878	hgsc.bcm.edu	37	7	76134787	76134787	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:76134787G>A	ENST00000324432.5	+	12	2248	c.1738G>A	c.(1738-1740)Gag>Aag	p.E580K	DTX2_ENST00000413936.2_Missense_Mutation_p.E580K|DTX2_ENST00000446820.2_Missense_Mutation_p.E533K|DTX2_ENST00000446600.1_Missense_Mutation_p.E489K|DTX2_ENST00000307569.8_Missense_Mutation_p.E533K|DTX2_ENST00000430490.2_Missense_Mutation_p.E580K	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	580					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.E580K(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GGTATGGAACGAGATCCACCA	0.617																																					p.E580K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1738A	7						.						161.0	98.0	119.0					7																	76134787		2202	4299	6501	75972723	SO:0001583	missense	113878	exon10				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1738G>A	7.37:g.76134787G>A	ENSP00000322885:p.Glu580Lys	Somatic		Capture	SOLID	Phase_I	75972723	NM_001102595	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	ENST00000324432.5	37	CCDS5587.1	.	.	.	.	.	.	.	.	.	.	.	27.2	4.806268	0.90623	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000430490;ENST00000446820	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.12	5.12	0.69794	.	0.169717	0.50627	D	0.000111	T	0.64483	0.2602	M	0.62723	1.935	0.58432	D	0.999998	D;P;D;P	0.69078	0.994;0.926;0.997;0.624	P;B;P;P	0.62014	0.897;0.271;0.897;0.475	T	0.65792	-0.6082	10	0.56958	D	0.05	-37.7131	17.726	0.88365	0.0:0.0:1.0:0.0	.	489;211;533;580	F5GX89;Q6P2H0;Q86UW9-2;Q86UW9	.;.;.;DTX2_HUMAN	K	580;533;489;489;580;580;533	ENSP00000322885:E580K;ENSP00000305242:E533K;ENSP00000397648:E489K;ENSP00000390218:E580K;ENSP00000411986:E580K;ENSP00000392545:E533K	ENSP00000305242:E533K	E	+	1	0	AC005522.1	75972723	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.716000	0.84723	2.663000	0.90544	0.651000	0.88453	GAG		0.617	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
PTPN12	5782	hgsc.bcm.edu	37	7	77256503	77256503	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:77256503T>A	ENST00000248594.6	+	13	1779	c.1507T>A	c.(1507-1509)Tca>Aca	p.S503T	PTPN12_ENST00000415482.2_Missense_Mutation_p.S384T|PTPN12_ENST00000435495.2_Missense_Mutation_p.S373T	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	503					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.S503T(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						TGTAACACAATCAAACAAAGT	0.423																																					p.S373T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1117A	7						.						73.0	68.0	70.0					7																	77256503		2203	4300	6503	77094439	SO:0001583	missense	5782	exon12				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1507T>A	7.37:g.77256503T>A	ENSP00000248594:p.Ser503Thr	Somatic		Capture	SOLID	Phase_I	77094439	NM_001131009	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	37	CCDS5592.1	.	.	.	.	.	.	.	.	.	.	T	1.740	-0.492051	0.04322	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495;ENST00000407343	T;T;T;T	0.34275	3.79;3.2;3.2;1.37	5.83	5.83	0.93111	.	0.613015	0.17443	N	0.174056	T	0.35740	0.0942	M	0.61703	1.905	0.09310	N	0.999999	B	0.27013	0.166	B	0.30782	0.12	T	0.31110	-0.9955	10	0.13853	T	0.58	.	11.2784	0.49180	0.0:0.0705:0.0:0.9295	.	503	Q05209	PTN12_HUMAN	T	503;384;384;373;11	ENSP00000248594:S503T;ENSP00000392429:S384T;ENSP00000397991:S373T;ENSP00000385079:S11T	ENSP00000248594:S503T	S	+	1	0	PTPN12	77094439	0.004000	0.15560	0.112000	0.21494	0.224000	0.24922	1.280000	0.33202	2.235000	0.73313	0.533000	0.62120	TCA		0.423	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
MAGI2	9863	hgsc.bcm.edu	37	7	77756707	77756707	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:77756707T>C	ENST00000354212.4	-	19	3483	c.3230A>G	c.(3229-3231)cAa>cGa	p.Q1077R	MAGI2_ENST00000419488.1_Missense_Mutation_p.Q1063R|MAGI2_ENST00000522391.1_Missense_Mutation_p.Q1077R	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1077	Pro-rich.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.Q1077R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TTTCACATCTTGCCTTGCTTT	0.517																																					p.Q1077R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3230G	7						.						114.0	95.0	102.0					7																	77756707		2203	4300	6503	77594643	SO:0001583	missense	9863	exon19			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3230A>G	7.37:g.77756707T>C	ENSP00000346151:p.Gln1077Arg	Somatic		Capture	SOLID	Phase_I	77594643	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.220805	0.79464	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.10763	2.92;2.93;2.84	5.29	5.29	0.74685	.	0.000000	0.35235	U	0.003355	T	0.19248	0.0462	N	0.20986	0.625	0.80722	D	1	D;D;D	0.63046	0.967;0.992;0.987	D;D;D	0.72982	0.932;0.979;0.953	T	0.08889	-1.0700	10	0.25106	T	0.35	.	15.5147	0.75815	0.0:0.0:0.0:1.0	.	1077;1063;1077	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	R	1063;1077;1077;1077	ENSP00000405766:Q1063R;ENSP00000346151:Q1077R;ENSP00000428389:Q1077R	ENSP00000346151:Q1077R	Q	-	2	0	MAGI2	77594643	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.655000	0.83696	2.112000	0.64535	0.533000	0.62120	CAA		0.517	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
CACNA2D1	781	hgsc.bcm.edu	37	7	81589056	81589056	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:81589056A>C	ENST00000356253.5	-	37	3347	c.3092T>G	c.(3091-3093)cTc>cGc	p.L1031R	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.L1019R|CACNA2D1_ENST00000535308.1_Missense_Mutation_p.L231R			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	1031					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.L1019R(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CGCTTGTATGAGCAGTCGTGT	0.368																																					p.L1019R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3056G	7						.						93.0	81.0	85.0					7																	81589056		2202	4300	6502	81426992	SO:0001583	missense	781	exon37			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.3092T>G	7.37:g.81589056A>C	ENSP00000348589:p.Leu1031Arg	Somatic		Capture	SOLID	Phase_I	81426992	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	A	23.8	4.453868	0.84209	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.59638	0.25;0.25;0.25	5.55	5.55	0.83447	.	0.360029	0.28784	N	0.014156	T	0.77552	0.4147	M	0.81497	2.545	0.53688	D	0.999974	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.988	T	0.81044	-0.1111	10	0.87932	D	0	-10.5276	15.691	0.77453	1.0:0.0:0.0:0.0	.	231;1019	B7Z658;P54289-2	.;.	R	1019;1038;1031;231	ENSP00000349320:L1019R;ENSP00000348589:L1031R;ENSP00000443124:L231R	ENSP00000284088:L1038R	L	-	2	0	CACNA2D1	81426992	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	8.730000	0.91510	2.106000	0.64143	0.455000	0.32223	CTC		0.368	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
SEMA3D	223117	hgsc.bcm.edu	37	7	84642151	84642151	+	Missense_Mutation	SNP	C	C	T	rs150646719	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:84642151C>T	ENST00000284136.6	-	15	1758	c.1715G>A	c.(1714-1716)cGc>cAc	p.R572H	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	572	PSI.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.R572H(2)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TACATCTTGGCGTCTAGCTCT	0.408																																					p.R572H	Ovarian(63;442 1191 17318 29975 31528)											.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1715A	7						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	115.0	106.0	109.0		1715	5.9	1.0	7	dbSNP_134	109	1,8597	1.2+/-3.3	0,1,4298	yes	missense	SEMA3D	NM_152754.2	29	0,2,6500	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	572/778	84642151	2,13002	2203	4299	6502	84480087	SO:0001583	missense	223117	exon15			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1715G>A	7.37:g.84642151C>T	ENSP00000284136:p.Arg572His	Somatic		Capture	SOLID	Phase_I	84480087	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	35	5.574782	0.96553	2.27E-4	1.16E-4	ENSG00000153993	ENST00000284136	T	0.22945	1.93	5.93	5.93	0.95920	.	0.005751	0.85682	D	0.000000	T	0.58524	0.2128	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.62300	-0.6883	10	0.87932	D	0	.	20.3507	0.98813	0.0:1.0:0.0:0.0	.	572	O95025	SEM3D_HUMAN	H	572	ENSP00000284136:R572H	ENSP00000284136:R572H	R	-	2	0	SEMA3D	84480087	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.818000	0.86416	2.808000	0.96608	0.655000	0.94253	CGC		0.408	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
ZNF804B	219578	hgsc.bcm.edu	37	7	88965869	88965869	+	Silent	SNP	G	G	A	rs139896198	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:88965869G>A	ENST00000333190.4	+	4	4182	c.3573G>A	c.(3571-3573)ccG>ccA	p.P1191P		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1191							metal ion binding (GO:0046872)	p.P1191P(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CCTTCTCTCCGGCCTCAACCG	0.498										HNSCC(36;0.09)																											p.P1191P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3573A	7						.	G		0,4406		0,0,2203	123.0	102.0	109.0		3573	-10.0	0.0	7	dbSNP_134	109	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous	ZNF804B	NM_181646.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		1191/1350	88965869	2,13004	2203	4300	6503	88803805	SO:0001819	synonymous_variant	219578	exon4			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3573G>A	7.37:g.88965869G>A		Somatic		Capture	SOLID	Phase_I	88803805	NM_181646	B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	CCDS5613.1																																																																																				0.498	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
BET1	10282	hgsc.bcm.edu	37	7	93623626	93623626	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:93623626C>T	ENST00000222547.3	-	4	431	c.273G>A	c.(271-273)ggG>ggA	p.G91G	BET1_ENST00000471446.1_Intron|AC006378.2_ENST00000426634.1_RNA|BET1_ENST00000433727.1_Intron|AC006378.2_ENST00000426193.2_RNA	NM_005868.4	NP_005859.1	O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein	91					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.G91G(1)		large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			TTGTTTGGCTCCCTCTGGATA	0.328																																					p.G91G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G273A	7						.						87.0	89.0	88.0					7																	93623626		2203	4300	6503	93461562	SO:0001819	synonymous_variant	10282	exon4			AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000222547.3:c.273G>A	7.37:g.93623626C>T		Somatic		Capture	SOLID	Phase_I	93461562	NM_005868	Q96EA0	Silent	SNP	ENST00000222547.3	37	CCDS5635.1	.	.	.	.	.	.	.	.	.	.	C	8.113	0.779128	0.16120	.	.	ENSG00000105829	ENST00000457139	.	.	.	4.17	-1.05	0.10036	.	.	.	.	.	T	0.51669	0.1688	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41645	-0.9497	4	.	.	.	.	6.9011	0.24283	0.0:0.3262:0.1274:0.5464	.	.	.	.	K	106	.	.	E	-	1	0	BET1	93461562	0.595000	0.26857	0.994000	0.49952	0.949000	0.60115	-0.190000	0.09615	-0.210000	0.10140	-0.142000	0.14014	GAG		0.328	BET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255181.2	NM_005868	
TRRAP	8295	hgsc.bcm.edu	37	7	98524889	98524889	+	Silent	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:98524889C>A	ENST00000359863.4	+	23	3284	c.3075C>A	c.(3073-3075)gcC>gcA	p.A1025A	TRRAP_ENST00000446306.3_Silent_p.A1024A|TRRAP_ENST00000355540.3_Silent_p.A1025A	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1025					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.A1025A(2)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGACAGGCGCCTTCATGTCTG	0.567																																					p.A1025A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3075A	7						.						62.0	63.0	62.0					7																	98524889		2203	4300	6503	98362825	SO:0001819	synonymous_variant	8295	exon23			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3075C>A	7.37:g.98524889C>A		Somatic		Capture	SOLID	Phase_I	98362825	NM_003496	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	3.535	-0.094932	0.07010	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.51	-11.0	0.00169	.	.	.	.	.	T	0.42607	0.1210	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51482	-0.8700	4	.	.	.	.	6.3023	0.21119	0.3075:0.3237:0.3104:0.0584	.	.	.	.	H	740	.	.	P	+	2	0	TRRAP	98362825	0.000000	0.05858	0.633000	0.29310	0.255000	0.26057	-2.813000	0.00753	-1.725000	0.01371	0.585000	0.79938	CCT		0.567	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
UBE3C	9690	hgsc.bcm.edu	37	7	156963054	156963054	+	Silent	SNP	C	C	T	rs144846986		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr7:156963054C>T	ENST00000348165.5	+	4	612	c.252C>T	c.(250-252)ggC>ggT	p.G84G	UBE3C_ENST00000389103.4_Silent_p.G41G	NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	84					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G84G(1)		central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGTCCGGGGGCGCTTTTCCCA	0.403													C|||	1	0.000199681	0.0	0.0	5008	,	,		18082	0.0		0.001	False		,,,				2504	0.0				p.G84G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C252T	7						.	C		0,4406		0,0,2203	152.0	147.0	148.0		252	1.6	0.1	7	dbSNP_134	148	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	UBE3C	NM_014671.2		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		84/1084	156963054	3,13003	2203	4300	6503	156655815	SO:0001819	synonymous_variant	9690	exon4			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.252C>T	7.37:g.156963054C>T		Somatic		Capture	SOLID	Phase_I	156655815	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Silent	SNP	ENST00000348165.5	37	CCDS34789.1																																																																																				0.403	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
NSFL1C	55968	hgsc.bcm.edu	37	20	1445031	1445031	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:1445031T>A	ENST00000216879.4	-	2	1013	c.146A>T	c.(145-147)gAc>gTc	p.D49V	NSFL1C_ENST00000381658.4_Intron|NSFL1C_ENST00000353088.2_Missense_Mutation_p.D49V|NSFL1C_ENST00000476071.1_Missense_Mutation_p.D49V|NSFL1C_ENST00000350991.4_Missense_Mutation_p.D49V	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	49						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.D49V(1)		breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						GGTCACAATGTCTTCATCCCC	0.527																																					p.D49V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A146T	20						.						181.0	164.0	170.0					20																	1445031		2203	4300	6503	1393031	SO:0001583	missense	55968	exon2			AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.146A>T	20.37:g.1445031T>A	ENSP00000216879:p.Asp49Val	Somatic		Capture	SOLID	Phase_I	1393031	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	ENST00000216879.4	37	CCDS13015.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097974	0.76870	.	.	ENSG00000088833	ENST00000353088;ENST00000476071;ENST00000216879;ENST00000350991	T;T;T;T	0.49139	0.79;0.81;0.81;0.81	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.60353	0.2262	L	0.43923	1.385	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.994;0.996	T	0.61686	-0.7012	10	0.54805	T	0.06	-15.3898	13.6308	0.62193	0.0:0.0:0.0:1.0	.	49;49	Q9UNZ2-4;Q9UNZ2	.;NSF1C_HUMAN	V	49	ENSP00000338643:D49V;ENSP00000418529:D49V;ENSP00000216879:D49V;ENSP00000202584:D49V	ENSP00000216879:D49V	D	-	2	0	NSFL1C	1393031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.291000	0.72719	2.134000	0.65973	0.482000	0.46254	GAC		0.527	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	
DUSP15	128853	hgsc.bcm.edu	37	20	30450421	30450421	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:30450421C>A	ENST00000278979.3	-	6	455	c.379G>T	c.(379-381)Ggc>Tgc	p.G127C	DUSP15_ENST00000486996.1_Missense_Mutation_p.G27C|DUSP15_ENST00000493115.1_5'Flank|DUSP15_ENST00000375966.4_Missense_Mutation_p.G127C|DUSP15_ENST00000339738.5_Missense_Mutation_p.G130C|DUSP15_ENST00000398084.2_Missense_Mutation_p.G27C|DUSP15_ENST00000398083.1_Missense_Mutation_p.G27C			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	127	Tyrosine-protein phosphatase.				positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.G130C(1)		large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGCCTAAAGCCTGGGTTGGGG	0.607																																					p.G27C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G79T	20						.						116.0	100.0	106.0					20																	30450421		2203	4300	6503	29914082	SO:0001583	missense	128853	exon6				CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.379G>T	20.37:g.30450421C>A	ENSP00000278979:p.Gly127Cys	Somatic		Capture	SOLID	Phase_I	29914082	NM_177991	A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	ENST00000278979.3	37		.	.	.	.	.	.	.	.	.	.	C	26.5	4.748383	0.89663	.	.	ENSG00000149599	ENST00000278979;ENST00000398084;ENST00000339738;ENST00000486996;ENST00000375966;ENST00000398083	D;T;D;T;D;T	0.86694	-2.16;1.15;-2.16;1.15;-2.16;1.15	4.77	4.77	0.60923	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.051473	0.85682	D	0.000000	D	0.96626	0.8899	H	0.99712	4.72	0.49798	D	0.999824	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.99;1.0	D	0.98198	1.0466	10	0.87932	D	0	.	14.5333	0.67942	0.0:1.0:0.0:0.0	.	130;27;127	Q9H1R2-3;A8MVC8;Q9H1R2	.;.;DUS15_HUMAN	C	127;27;130;27;127;27	ENSP00000278979:G127C;ENSP00000381158:G27C;ENSP00000341658:G130C;ENSP00000419818:G27C;ENSP00000365133:G127C;ENSP00000381157:G27C	ENSP00000278979:G127C	G	-	1	0	DUSP15	29914082	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.438000	0.73426	2.204000	0.70986	0.561000	0.74099	GGC		0.607	DUSP15-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078555.3	NM_080611	
NCOA6	23054	hgsc.bcm.edu	37	20	33320390	33320390	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:33320390A>G	ENST00000374796.2	-	14	8542	c.5972T>C	c.(5971-5973)gTa>gCa	p.V1991A	NCOA6_ENST00000359003.2_Missense_Mutation_p.V1991A			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1991	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.V1991A(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GGCAGCATTTACCTCCAGCTC	0.418																																					p.V1991A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5972C	20						.						81.0	72.0	75.0					20																	33320390		2203	4300	6503	32784051	SO:0001583	missense	23054	exon13			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.5972T>C	20.37:g.33320390A>G	ENSP00000363929:p.Val1991Ala	Somatic		Capture	SOLID	Phase_I	32784051	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	A	0.254	-1.004402	0.02112	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.20598	2.06;2.06	5.18	1.12	0.20585	.	0.421653	0.22676	N	0.057011	T	0.06735	0.0172	N	0.02539	-0.55	0.25628	N	0.986335	B	0.02656	0.0	B	0.01281	0.0	T	0.39187	-0.9626	10	0.16420	T	0.52	0.6256	7.605	0.28097	0.3415:0.0:0.6585:0.0	.	1991	Q14686	NCOA6_HUMAN	A	1991	ENSP00000363929:V1991A;ENSP00000351894:V1991A	ENSP00000351894:V1991A	V	-	2	0	NCOA6	32784051	1.000000	0.71417	0.999000	0.59377	0.384000	0.30261	1.221000	0.32503	0.077000	0.16863	-0.472000	0.04984	GTA		0.418	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
PROCR	10544	hgsc.bcm.edu	37	20	33764134	33764134	+	Silent	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:33764134C>A	ENST00000216968.4	+	3	568	c.486C>A	c.(484-486)acC>acA	p.T162T	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	162					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.T162T(1)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	GAGTGGTCACCTTCACCCTGC	0.557																																					p.T162T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C486A	20						.						106.0	91.0	96.0					20																	33764134		2203	4300	6503	33227795	SO:0001819	synonymous_variant	10544	exon3			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.486C>A	20.37:g.33764134C>A		Somatic		Capture	SOLID	Phase_I	33227795	NM_006404	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Silent	SNP	ENST00000216968.4	37	CCDS13248.1																																																																																				0.557	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078843.3		
GDF5	8200	hgsc.bcm.edu	37	20	34021859	34021859	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:34021859G>T	ENST00000374372.1	-	4	1857	c.1354C>A	c.(1354-1356)Ctg>Atg	p.L452M	GDF5_ENST00000374369.3_Missense_Mutation_p.L452M|GDF5OS_ENST00000374375.1_5'UTR			P43026	GDF5_HUMAN	growth differentiation factor 5	452					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)	p.L452M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GAGTTCATCAGGGTCTGGATG	0.597																																					p.L452M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1354A	20						.						130.0	121.0	124.0					20																	34021859		2203	4300	6503	33485273	SO:0001583	missense	8200	exon2			X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1354C>A	20.37:g.34021859G>T	ENSP00000363492:p.Leu452Met	Somatic		Capture	SOLID	Phase_I	33485273	NM_000557	E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359832	0.41801	.	.	ENSG00000125965	ENST00000374369;ENST00000374372	D;D	0.90444	-2.67;-2.67	4.41	2.46	0.29980	Transforming growth factor-beta, C-terminal (3);	0.000000	0.64402	D	0.000009	D	0.93061	0.7791	M	0.71871	2.18	0.52099	D	0.999946	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90991	0.4835	10	0.87932	D	0	.	5.7499	0.18140	0.466:0.0:0.534:0.0	.	452;452	F1T0J1;P43026	.;GDF5_HUMAN	M	452	ENSP00000363489:L452M;ENSP00000363492:L452M	ENSP00000363489:L452M	L	-	1	2	GDF5	33485273	0.989000	0.36119	0.998000	0.56505	0.885000	0.51271	2.036000	0.41165	0.486000	0.27676	-0.266000	0.10368	CTG		0.597	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
CTNNBL1	56259	hgsc.bcm.edu	37	20	36374940	36374940	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:36374940C>A	ENST00000361383.6	+	4	514	c.397C>A	c.(397-399)Ctg>Atg	p.L133M	CTNNBL1_ENST00000405275.2_Missense_Mutation_p.L106M|CTNNBL1_ENST00000373473.1_5'UTR	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	133	Nuclear export signal (NES). {ECO:0000305}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)	p.L133M(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CATGCCAGACCTGTACCACCT	0.493																																					p.L133M	Ovarian(184;582 2038 3273 4106 42608)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C397A	20						.						137.0	125.0	129.0					20																	36374940		2203	4300	6503	35808354	SO:0001583	missense	56259	exon4			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.397C>A	20.37:g.36374940C>A	ENSP00000355050:p.Leu133Met	Somatic		Capture	SOLID	Phase_I	35808354	NM_030877	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	ENST00000361383.6	37	CCDS13298.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117177	0.77323	.	.	ENSG00000132792	ENST00000361383;ENST00000447935;ENST00000405275	T;T;T	0.52526	0.71;0.66;0.71	5.15	4.21	0.49690	Armadillo-type fold (1);Domain of unknown function DUF1716, eukaryotic (1);	0.000000	0.85682	D	0.000000	T	0.65354	0.2683	M	0.87381	2.88	0.80722	D	1	P;P	0.46859	0.885;0.804	P;P	0.53760	0.734;0.718	T	0.72184	-0.4367	10	0.66056	D	0.02	-13.6559	12.7789	0.57466	0.0:0.9214:0.0:0.0786	.	133;106	Q8WYA6;A2A2P1	CTBL1_HUMAN;.	M	133;106;106	ENSP00000355050:L133M;ENSP00000394464:L106M;ENSP00000384355:L106M	ENSP00000355050:L133M	L	+	1	2	CTNNBL1	35808354	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.878000	0.56130	1.411000	0.46957	0.591000	0.81541	CTG		0.493	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
DHX35	60625	hgsc.bcm.edu	37	20	37650519	37650519	+	Missense_Mutation	SNP	G	G	A	rs74949991	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:37650519G>A	ENST00000252011.3	+	16	1567	c.1534G>A	c.(1534-1536)Gct>Act	p.A512T	DHX35_ENST00000373323.4_Missense_Mutation_p.A481T|DHX35_ENST00000373325.2_Missense_Mutation_p.A512T	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	512					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.A512T(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TCTAAGCATCGCTGCCATGAT	0.443													G|||	15	0.00299521	0.0	0.0	5008	,	,		15299	0.0149		0.0	False		,,,				2504	0.0				p.A481T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1441A	20						.						175.0	171.0	172.0					20																	37650519		2203	4300	6503	37083933	SO:0001583	missense	60625	exon15			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1534G>A	20.37:g.37650519G>A	ENSP00000252011:p.Ala512Thr	Somatic		Capture	SOLID	Phase_I	37083933	NM_001190809	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	37	CCDS13310.1	11	0.005036630036630037	0	0.0	0	0.0	11	0.019230769230769232	0	0.0	G	22.2	4.260911	0.80246	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000373321;ENST00000449559	T;T;T;T	0.34072	4.19;4.19;4.19;1.38	6.07	6.07	0.98685	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.24084	0.0583	M	0.67517	2.055	0.80722	D	1	B;P	0.35872	0.209;0.525	B;B	0.30716	0.065;0.119	T	0.07809	-1.0753	10	0.35671	T	0.21	.	20.239	0.98366	0.0:0.0:1.0:0.0	.	481;512	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	T	512;512;481;18;2	ENSP00000362422:A512T;ENSP00000252011:A512T;ENSP00000362420:A481T;ENSP00000397997:A2T	ENSP00000252011:A512T	A	+	1	0	DHX35	37083933	1.000000	0.71417	0.721000	0.30653	0.927000	0.56198	8.922000	0.92789	2.884000	0.98904	0.655000	0.94253	GCT		0.443	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
TTPAL	79183	hgsc.bcm.edu	37	20	43108738	43108738	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:43108738C>A	ENST00000372904.3	+	3	242	c.99C>A	c.(97-99)tgC>tgA	p.C33*	TTPAL_ENST00000372906.2_Nonsense_Mutation_p.C33*|TTPAL_ENST00000262605.4_Nonsense_Mutation_p.C33*	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	33						intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)	p.C33*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						GCTATGTGTGCTCACTGACAG	0.557																																					p.C33X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C99A	20						.						75.0	67.0	70.0					20																	43108738		2203	4300	6503	42542152	SO:0001587	stop_gained	79183	exon2			BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.99C>A	20.37:g.43108738C>A	ENSP00000361995:p.Cys33*	Somatic		Capture	SOLID	Phase_I	42542152	NM_001039199	E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Nonsense_Mutation	SNP	ENST00000372904.3	37	CCDS13332.2	.	.	.	.	.	.	.	.	.	.	C	37	5.996561	0.97184	.	.	ENSG00000124120	ENST00000262605;ENST00000372904;ENST00000372906;ENST00000456317	.	.	.	5.7	4.76	0.60689	.	0.047165	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-23.7725	12.2924	0.54825	0.0:0.8605:0.0:0.1395	.	.	.	.	X	33	.	ENSP00000262605:C33X	C	+	3	2	TTPAL	42542152	1.000000	0.71417	0.985000	0.45067	0.945000	0.59286	3.420000	0.52735	1.405000	0.46838	0.655000	0.94253	TGC		0.557	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106886.2	NM_024331	
SLC13A3	64849	hgsc.bcm.edu	37	20	45221159	45221159	+	Silent	SNP	C	C	T	rs139819116	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:45221159C>T	ENST00000279027.4	-	6	822	c.804G>A	c.(802-804)ccG>ccA	p.P268P	SLC13A3_ENST00000472148.1_Silent_p.P221P|SLC13A3_ENST00000290317.5_Silent_p.P221P|SLC13A3_ENST00000413164.2_Intron|SLC13A3_ENST00000396360.1_Silent_p.P221P|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000372121.1_Intron|SLC13A3_ENST00000495082.1_Silent_p.P221P	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	268					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.P268P(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	CGTCACACTGCGGAAAGAAAC	0.557																																					p.P268P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G804A	20						.	C	,,,,	2,4404	4.2+/-10.8	0,2,2201	107.0	82.0	91.0		663,,663,510,804	-10.6	0.1	20	dbSNP_134	91	0,8600		0,0,4300	no	coding-synonymous,intron,coding-synonymous,coding-synonymous,coding-synonymous	SLC13A3	NM_001011554.2,NM_001193339.1,NM_001193340.1,NM_001193342.1,NM_022829.5	,,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,,	221/556,,221/521,170/505,268/603	45221159	2,13004	2203	4300	6503	44654566	SO:0001819	synonymous_variant	64849	exon6			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.804G>A	20.37:g.45221159C>T		Somatic		Capture	SOLID	Phase_I	44654566	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	C	8.703	0.910273	0.17833	4.54E-4	0.0	ENSG00000158296	ENST00000450298	.	.	.	5.31	-10.6	0.00265	.	.	.	.	.	T	0.44519	0.1297	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57254	-0.7843	4	.	.	.	-18.1154	7.2427	0.26106	0.0707:0.1582:0.1419:0.6291	.	.	.	.	T	98	.	.	A	-	1	0	SLC13A3	44654566	0.026000	0.19158	0.104000	0.21259	0.961000	0.63080	-0.581000	0.05820	-3.351000	0.00181	-0.940000	0.02684	GCA		0.557	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
SULF2	55959	hgsc.bcm.edu	37	20	46318972	46318972	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:46318972G>T	ENST00000359930.4	-	5	1486	c.635C>A	c.(634-636)cCg>cAg	p.P212Q	SULF2_ENST00000484875.1_Missense_Mutation_p.P212Q|SULF2_ENST00000361612.4_Missense_Mutation_p.P212Q|SULF2_ENST00000467815.1_Missense_Mutation_p.P212Q	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	212					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.P212Q(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TGGCCTGTGCGGGTACATCTT	0.577																																					p.P212Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C635A	20						.						155.0	125.0	135.0					20																	46318972		2203	4300	6503	45752379	SO:0001583	missense	55959	exon5			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.635C>A	20.37:g.46318972G>T	ENSP00000353007:p.Pro212Gln	Somatic		Capture	SOLID	Phase_I	45752379	NM_198596	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.142074	0.57044	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815	D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01	4.53	4.53	0.55603	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.052853	0.85682	D	0.000000	D	0.97483	0.9176	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	0.968;1.0;1.0	P;D;D	0.87578	0.852;0.998;0.998	D	0.97060	0.9770	10	0.36615	T	0.2	-19.0801	17.4357	0.87552	0.0:0.0:1.0:0.0	.	212;212;212	G3XAE6;Q8IWU5-2;Q8IWU5	.;.;SULF2_HUMAN	Q	212	ENSP00000353007:P212Q;ENSP00000418290:P212Q;ENSP00000354662:P212Q;ENSP00000418442:P212Q	ENSP00000353007:P212Q	P	-	2	0	SULF2	45752379	1.000000	0.71417	0.974000	0.42286	0.023000	0.10783	9.654000	0.98509	2.341000	0.79615	0.543000	0.68304	CCG		0.577	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
CDS2	8760	hgsc.bcm.edu	37	20	5170828	5170828	+	Missense_Mutation	SNP	G	G	A	rs143859713		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:5170828G>A	ENST00000460006.1	+	13	1593	c.1286G>A	c.(1285-1287)cGg>cAg	p.R429Q	CDS2_ENST00000535100.1_Missense_Mutation_p.R199Q|CDS2_ENST00000379070.3_3'UTR|CDS2_ENST00000379062.4_Missense_Mutation_p.R309Q	NM_003818.3	NP_003809.1	O95674	CDS2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2	429					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	phosphatidate cytidylyltransferase activity (GO:0004605)	p.R429Q(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|stomach(1)	14						AACACGCTGCGGTCTCATCTG	0.547																																					p.R429Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1286A	20						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	76.0	62.0	67.0		1286	-1.3	0.7	20	dbSNP_134	67	0,8600		0,0,4300	no	missense	CDS2	NM_003818.3	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	429/446	5170828	1,13005	2203	4300	6503	5118828	SO:0001583	missense	8760	exon13			AF069532	CCDS13088.1	20p13	2006-03-28			ENSG00000101290	ENSG00000101290	2.7.7.41		1801	protein-coding gene	gene with protein product		603549				9806839, 9889000	Standard	NM_003818		Approved		uc002wls.3	O95674	OTTHUMG00000031801	ENST00000460006.1:c.1286G>A	20.37:g.5170828G>A	ENSP00000419879:p.Arg429Gln	Somatic		Capture	SOLID	Phase_I	5118828	NM_003818	B2RDC6|D3DW04|Q5TDY2|Q5TDY3|Q5TDY4|Q5TDY5|Q9BYK5|Q9NTT2	Missense_Mutation	SNP	ENST00000460006.1	37	CCDS13088.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.703713	0.30232	2.27E-4	0.0	ENSG00000101290	ENST00000460006;ENST00000379062;ENST00000535100	T	0.41400	1.0	5.07	-1.31	0.09230	.	0.172968	0.50627	D	0.000117	T	0.19248	0.0462	N	0.12182	0.205	0.25877	N	0.983635	B;B;B	0.12013	0.0;0.005;0.005	B;B;B	0.06405	0.002;0.002;0.001	T	0.22521	-1.0214	10	0.15952	T	0.53	-12.5258	9.8488	0.41043	0.6169:0.0:0.3831:0.0	.	199;309;429	F6VWC5;E7EQ83;O95674	.;.;CDS2_HUMAN	Q	429;309;199	ENSP00000419879:R429Q	ENSP00000368352:R309Q	R	+	2	0	CDS2	5118828	0.998000	0.40836	0.744000	0.31058	0.851000	0.48451	1.245000	0.32790	-0.438000	0.07232	-0.263000	0.10527	CGG		0.547	CDS2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077858.2		
PLCB4	5332	hgsc.bcm.edu	37	20	9404561	9404561	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:9404561A>G	ENST00000378493.1	+	24	2465	c.2450A>G	c.(2449-2451)aAt>aGt	p.N817S	PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Missense_Mutation_p.N817S|PLCB4_ENST00000378473.3_Missense_Mutation_p.N829S|PLCB4_ENST00000334005.3_Missense_Mutation_p.N817S|PLCB4_ENST00000278655.4_Missense_Mutation_p.N817S|PLCB4_ENST00000414679.2_Missense_Mutation_p.N829S			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	817					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.N817S(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						ATTTTCTGCAATATTGTTCTT	0.383																																					p.N817S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2450G	20						.						78.0	71.0	74.0					20																	9404561		2203	4300	6503	9352561	SO:0001583	missense	5332	exon24				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.2450A>G	20.37:g.9404561A>G	ENSP00000367754:p.Asn817Ser	Somatic		Capture	SOLID	Phase_I	9352561	NM_000933	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.527992	0.64860	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71	5.72	5.72	0.89469	C2 calcium/lipid-binding domain, CaLB (1);	0.146855	0.64402	D	0.000009	T	0.15565	0.0375	L	0.52573	1.65	0.58432	D	0.999999	B;B;B;B	0.33512	0.415;0.352;0.39;0.151	B;B;B;B	0.32465	0.146;0.138;0.079;0.096	T	0.03555	-1.1025	10	0.27785	T	0.31	.	16.0205	0.80486	1.0:0.0:0.0:0.0	.	829;664;817;817	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	S	817;829;817;817;817;665	ENSP00000334105:N817S;ENSP00000367734:N829S;ENSP00000278655:N817S;ENSP00000367754:N817S;ENSP00000367762:N817S;ENSP00000390616:N665S	ENSP00000278655:N817S	N	+	2	0	PLCB4	9352561	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.085000	0.94083	2.194000	0.70268	0.533000	0.62120	AAT		0.383	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
NCOA6	23054	hgsc.bcm.edu	37	20	33329715	33329717	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	CTT	CTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:33329715_33329717delCTT	ENST00000374796.2	-	12	6913_6915	c.4343_4345delAAG	c.(4342-4347)gaagtt>gtt	p.E1448del	NCOA6_ENST00000359003.2_In_Frame_Del_p.E1448del			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1448					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.E1448delE(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ACCATTTTAACTTCTTGGGCAGG	0.453																																					p.1448_1449del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.4343_4345del	20						.																																			32793378	SO:0001651	inframe_deletion	23054	exon11			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4343_4345delAAG	20.37:g.33329718_33329720delCTT	ENSP00000363929:p.Glu1448del	Somatic		Capture	SOLID	Phase_I	32793376	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	In_Frame_Del	DEL	ENST00000374796.2	37	CCDS13241.1																																																																																				0.453	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
ZFP64	55734	hgsc.bcm.edu	37	20	50776804	50776804	+	Silent	SNP	C	C	T	rs150124970		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr20:50776804C>T	ENST00000216923.4	-	5	970	c.621G>A	c.(619-621)acG>acA	p.T207T	ZFP64_ENST00000371515.4_Silent_p.T205T|ZFP64_ENST00000361387.2_Silent_p.T207T|ZFP64_ENST00000346617.4_Silent_p.T153T|ZFP64_ENST00000477786.1_5'UTR|ZFP64_ENST00000371518.2_Silent_p.T207T	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	207					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T207T(3)		breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CGTAGTCACACGTCTTACACT	0.577																																					p.T207T												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G621A	20						.	C	,,,	2,4404	4.2+/-10.8	0,2,2201	161.0	148.0	153.0		621,459,615,621	-7.4	0.2	20	dbSNP_134	153	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZFP64	NM_018197.2,NM_022088.4,NM_199426.1,NM_199427.2	,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,	207/682,153/628,205/680,207/646	50776804	2,13004	2203	4300	6503	50210211	SO:0001819	synonymous_variant	55734	exon5			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.621G>A	20.37:g.50776804C>T		Somatic		Capture	SOLID	Phase_I	50210211	NM_018197	Q9NTS7|Q9NVH4	Silent	SNP	ENST00000216923.4	37	CCDS13440.1																																																																																				0.577	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
ARHGEF40	55701	hgsc.bcm.edu	37	14	21557021	21557021	+	Silent	SNP	G	G	A	rs74584322	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:21557021G>A	ENST00000298694.4	+	23	4678	c.4551G>A	c.(4549-4551)acG>acA	p.T1517T	ARHGEF40_ENST00000298693.3_Silent_p.T1469T|RP11-998D10.7_ENST00000554733.2_lincRNA			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1517						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T1517T(1)		large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						ACCCCACCACGCCTCTGTGAC	0.522													G|||	194	0.038738	0.0061	0.0216	5008	,	,		18513	0.0327		0.0477	False		,,,				2504	0.092				p.T1517T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4551A	14						.	G		71,4335	64.7+/-102.0	0,71,2132	123.0	105.0	111.0		4551	-10.7	0.2	14	dbSNP_132	111	418,8182	130.2+/-188.1	14,390,3896	no	coding-synonymous	ARHGEF40	NM_018071.3		14,461,6028	AA,AG,GG		4.8605,1.6114,3.7598		1517/1520	21557021	489,12517	2203	4300	6503	20626861	SO:0001819	synonymous_variant	55701	exon23				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.4551G>A	14.37:g.21557021G>A		Somatic		Capture	SOLID	Phase_I	20626861	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	ENST00000298694.4	37	CCDS32041.1																																																																																				0.522	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
SALL2	6297	hgsc.bcm.edu	37	14	21991589	21991589	+	Missense_Mutation	SNP	G	G	A	rs372214185	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:21991589G>A	ENST00000327430.3	-	2	2567	c.2273C>T	c.(2272-2274)cCg>cTg	p.P758L	AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000450879.2_Missense_Mutation_p.P621L	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	758					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P758L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CTCCTCTTCCGGTGATGGCTG	0.577																																					p.P758L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2273T	14						.						52.0	49.0	50.0					14																	21991589		2203	4300	6503	21061429	SO:0001583	missense	6297	exon2			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2273C>T	14.37:g.21991589G>A	ENSP00000333537:p.Pro758Leu	Somatic		Capture	SOLID	Phase_I	21061429	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.040|9.040	0.989525|0.989525	0.18966|0.18966	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000327430;ENST00000450879|ENST00000546363	T;T|.	0.04758|.	3.65;3.56|.	4.76|4.76	2.95|2.95	0.34219|0.34219	.|.	0.260152|.	0.20493|.	N|.	0.091250|.	T|T	0.24005|0.24005	0.0581|0.0581	L|L	0.27053|0.27053	0.805|0.805	0.20403|0.20403	N|N	0.9999|0.9999	B;B;B;B|.	0.16166|.	0.016;0.016;0.006;0.006|.	B;B;B;B|.	0.09377|.	0.004;0.004;0.003;0.002|.	T|T	0.19877|0.19877	-1.0292|-1.0292	10|5	0.18276|.	T|.	0.48|.	-4.7548|-4.7548	4.35|4.35	0.11151|0.11151	0.1875:0.0:0.6343:0.1781|0.1875:0.0:0.6343:0.1781	.|.	621;621;519;758|.	B4DK65;E7EW59;B4DFD9;Q9Y467|.	.;.;.;SALL2_HUMAN|.	L|W	758;621|617	ENSP00000333537:P758L;ENSP00000396773:P621L|.	ENSP00000333537:P758L|.	P|R	-|-	2|1	0|2	SALL2|SALL2	21061429|21061429	0.001000|0.001000	0.12720|0.12720	0.244000|0.244000	0.24202|0.24202	0.792000|0.792000	0.44763|0.44763	0.615000|0.615000	0.24329|0.24329	0.624000|0.624000	0.30286|0.30286	-0.244000|-0.244000	0.11960|0.11960	CCG|CGG		0.577	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
PSMB5	5693	hgsc.bcm.edu	37	14	23502760	23502760	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:23502760C>T	ENST00000361611.6	-	2	585	c.322G>A	c.(322-324)Gca>Aca	p.A108T	PSMB5_ENST00000493471.2_Missense_Mutation_p.A108T|PSMB5_ENST00000460922.2_Intron|PSMB5_ENST00000425762.2_Missense_Mutation_p.A5T|AL132780.1_ENST00000385031.1_RNA	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	108					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.A108T(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	CAATCCGCTGCGCCCCCAGCC	0.552																																					p.A108T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322A	14						.						67.0	63.0	65.0					14																	23502760		2203	4300	6503	22572600	SO:0001583	missense	5693	exon2			D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.322G>A	14.37:g.23502760C>T	ENSP00000355325:p.Ala108Thr	Somatic		Capture	SOLID	Phase_I	22572600	NM_001144932	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	ENST00000361611.6	37	CCDS9584.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749066	0.89753	.	.	ENSG00000100804	ENST00000361611;ENST00000493471;ENST00000425762	T;T;T	0.36699	1.24;1.24;1.24	4.88	4.88	0.63580	Proteasome, beta-type subunit, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.75517	0.3860	H	0.99590	4.645	0.80722	D	1	P;D	0.76494	0.92;0.999	B;P	0.62014	0.109;0.897	D	0.87643	0.2523	10	0.87932	D	0	-1.9348	16.8115	0.85722	0.0:1.0:0.0:0.0	.	108;108	P28074-2;P28074	.;PSB5_HUMAN	T	108;108;5	ENSP00000355325:A108T;ENSP00000452424:A108T;ENSP00000395206:A5T	ENSP00000334973:A108T	A	-	1	0	PSMB5	22572600	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.476000	0.60216	2.237000	0.73441	0.561000	0.74099	GCA		0.552	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4	NM_002797	
DHRS1	115817	hgsc.bcm.edu	37	14	24766024	24766024	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:24766024G>A	ENST00000288111.7	-	3	490	c.214C>T	c.(214-216)Cga>Tga	p.R72*	DHRS1_ENST00000396813.1_Nonsense_Mutation_p.R72*	NM_001136050.2	NP_001129522.1	Q96LJ7	DHRS1_HUMAN	dehydrogenase/reductase (SDR family) member 1	72						endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)	oxidoreductase activity (GO:0016491)	p.R72*(2)		cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6				GBM - Glioblastoma multiforme(265;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(311;0.0442)		AACAGGCTTCGCACTTCACTC	0.537											OREG0022622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R72X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|endometrium(1)	c.C214T	14						.						146.0	115.0	126.0					14																	24766024		2203	4300	6503	23835864	SO:0001587	stop_gained	115817	exon3			AK058159	CCDS9623.1	14q11.2	2011-09-14			ENSG00000157379	ENSG00000157379	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16445	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 19C, member 1"""	610410				12153138, 19027726	Standard	NM_138452		Approved	FLJ25430, MGC20204, SDR19C1	uc001wok.3	Q96LJ7	OTTHUMG00000029333	ENST00000288111.7:c.214C>T	14.37:g.24766024G>A	ENSP00000288111:p.Arg72*	Somatic	773	Capture	SOLID	Phase_I	23835864	NM_138452	D3DS71|Q8NDG3|Q96B59|Q96CQ5	Nonsense_Mutation	SNP	ENST00000288111.7	37	CCDS9623.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.832004	0.91036	.	.	ENSG00000157379	ENST00000288111;ENST00000396813	.	.	.	4.99	1.8	0.24995	.	0.793753	0.11664	N	0.541483	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-20.4236	5.6525	0.17625	0.0947:0.0:0.461:0.4443	.	.	.	.	X	72	.	ENSP00000288111:R72X	R	-	1	2	DHRS1	23835864	0.001000	0.12720	0.004000	0.12327	0.880000	0.50808	0.462000	0.21956	0.148000	0.19059	-0.302000	0.09304	CGA		0.537	DHRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073168.4	NM_138452	
NPAS3	64067	hgsc.bcm.edu	37	14	33408528	33408528	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:33408528G>A	ENST00000356141.4	+	1	6	c.6G>A	c.(4-6)gcG>gcA	p.A2A	NPAS3_ENST00000551492.1_Intron|NPAS3_ENST00000346562.2_Silent_p.A2A|NPAS3_ENST00000548645.1_Silent_p.A2A|NPAS3_ENST00000357798.5_Silent_p.A2A|NPAS3_ENST00000341321.4_Silent_p.A2A			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	2					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.A2A(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GGAAGATGGCGCCCACCAAGC	0.632																																					p.A2A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6A	14						.						47.0	43.0	45.0					14																	33408528		2203	4300	6503	32478279	SO:0001819	synonymous_variant	64067	exon1			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.6G>A	14.37:g.33408528G>A		Somatic		Capture	SOLID	Phase_I	32478279	NM_022123	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	37	CCDS53891.1																																																																																				0.632	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
PAX9	5083	hgsc.bcm.edu	37	14	37145638	37145638	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:37145638T>A	ENST00000361487.6	+	4	1232	c.1007T>A	c.(1006-1008)gTc>gAc	p.V336D	PAX9_ENST00000402703.2_Missense_Mutation_p.V336D			P55771	PAX9_HUMAN	paired box 9	336					cellular response to growth factor stimulus (GO:0071363)|endoderm development (GO:0007492)|face morphogenesis (GO:0060325)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|regulation of odontogenesis (GO:0042481)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.V336D(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(3)	12	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		AGTCATTCTGTCACGGCTTCC	0.587																																					p.V336D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1007A	14						.						74.0	63.0	67.0					14																	37145638		2203	4300	6503	36215389	SO:0001583	missense	5083	exon5			AJ238381	CCDS9662.1	14q13.3	2007-07-12	2007-07-12		ENSG00000198807	ENSG00000198807		"""Paired boxes"""	8623	protein-coding gene	gene with protein product		167416	"""paired box gene 9"""			7981748	Standard	NM_006194		Approved		uc001wty.4	P55771	OTTHUMG00000140251	ENST00000361487.6:c.1007T>A	14.37:g.37145638T>A	ENSP00000355245:p.Val336Asp	Somatic		Capture	SOLID	Phase_I	36215389	NM_006194	Q99582|Q9UQR4	Missense_Mutation	SNP	ENST00000361487.6	37	CCDS9662.1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852159	0.71719	.	.	ENSG00000198807	ENST00000402703;ENST00000361487	D;D	0.99129	-5.46;-5.46	6.16	6.16	0.99307	.	0.603699	0.18128	N	0.150821	D	0.97967	0.9331	L	0.44542	1.39	0.80722	D	1	D	0.55385	0.971	P	0.47299	0.543	D	0.98208	1.0471	10	0.62326	D	0.03	.	15.3771	0.74615	0.0:0.0:0.0:1.0	.	336	P55771	PAX9_HUMAN	D	336	ENSP00000384817:V336D;ENSP00000355245:V336D	ENSP00000355245:V336D	V	+	2	0	PAX9	36215389	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	6.987000	0.76206	2.367000	0.80283	0.528000	0.53228	GTC		0.587	PAX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276733.2		
NIN	51199	hgsc.bcm.edu	37	14	51219334	51219334	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:51219334G>A	ENST00000382041.3	-	21	5042	c.4852C>T	c.(4852-4854)Cta>Tta	p.L1618L	NIN_ENST00000324330.9_Silent_p.L1618L|NIN_ENST00000245441.5_Silent_p.L1618L|NIN_ENST00000530997.2_Silent_p.L1618L|NIN_ENST00000382043.4_Silent_p.L905L|NIN_ENST00000389868.3_Silent_p.L905L|NIN_ENST00000453196.1_Silent_p.L1618L	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1618					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.L1624L(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TTCTGGCATAGCATTTCTGTT	0.388			T	PDGFRB	MPD																																p.L1618L			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4852T	14						.						326.0	315.0	318.0					14																	51219334		2203	4300	6503	50289084	SO:0001819	synonymous_variant	51199	exon21			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4852C>T	14.37:g.51219334G>A		Somatic		Capture	SOLID	Phase_I	50289084	NM_182944	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Silent	SNP	ENST00000382041.3	37	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	G	7.490	0.650448	0.14516	.	.	ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853	.	.	.	5.74	4.84	0.62591	.	.	.	.	.	T	0.69735	0.3144	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68804	-0.5312	4	.	.	.	-1.5214	13.7157	0.62695	0.0738:0.0:0.9262:0.0	.	.	.	.	V	1108	.	.	A	-	2	0	NIN	50289084	0.944000	0.32072	0.642000	0.29436	0.830000	0.47004	2.510000	0.45468	1.416000	0.47057	0.655000	0.94253	GCT		0.388	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
RTN1	6252	hgsc.bcm.edu	37	14	60212707	60212707	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:60212707A>T	ENST00000267484.5	-	2	1069	c.734T>A	c.(733-735)gTg>gAg	p.V245E		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	245					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.V245E(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TTTTCCCTCCACAGGAGCTGG	0.448																																					p.V245E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T734A	14						.						186.0	186.0	186.0					14																	60212707		2203	4300	6503	59282460	SO:0001583	missense	6252	exon2			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.734T>A	14.37:g.60212707A>T	ENSP00000267484:p.Val245Glu	Somatic		Capture	SOLID	Phase_I	59282460	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	37	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	A	9.834	1.189125	0.21954	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.24908	1.83	5.16	4.02	0.46733	.	0.800851	0.11607	N	0.547212	T	0.17577	0.0422	L	0.50919	1.6	0.39901	D	0.973909	P	0.44734	0.842	B	0.37601	0.254	T	0.19418	-1.0306	10	0.23891	T	0.37	.	1.4716	0.02417	0.4977:0.1415:0.0875:0.2733	.	245	Q16799	RTN1_HUMAN	E	245;171	ENSP00000267484:V245E	ENSP00000267484:V245E	V	-	2	0	RTN1	59282460	0.994000	0.37717	1.000000	0.80357	0.754000	0.42855	2.033000	0.41136	1.943000	0.56356	0.455000	0.32223	GTG		0.448	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
MAP3K9	4293	hgsc.bcm.edu	37	14	71227816	71227816	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:71227816G>A	ENST00000554752.2	-	3	903	c.904C>T	c.(904-906)Cac>Tac	p.H302Y	MAP3K9_ENST00000555993.2_Missense_Mutation_p.H302Y|MAP3K9_ENST00000553414.1_5'UTR|MAP3K9_ENST00000554146.1_Missense_Mutation_p.H39Y|MAP3K9_ENST00000381250.4_Missense_Mutation_p.H302Y	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	302	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.H302Y(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GTGGTTCGGTGCCATTCCCGA	0.517																																					p.H302Y	GBM(114;411 1587 13539 28235 50070)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C904T	14						.						147.0	129.0	135.0					14																	71227816		2203	4300	6503	70297569	SO:0001583	missense	4293	exon3			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.904C>T	14.37:g.71227816G>A	ENSP00000451612:p.His302Tyr	Somatic		Capture	SOLID	Phase_I	70297569	NM_033141	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	37		.	.	.	.	.	.	.	.	.	.	G	17.52	3.410586	0.62399	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000381250;ENST00000554146;ENST00000542284	D;D;D	0.81499	-1.5;-1.5;-1.5	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	N	0.04959	-0.14	0.54753	D	0.999989	B;B;B	0.14438	0.008;0.01;0.001	B;B;B	0.20384	0.029;0.029;0.011	T	0.58601	-0.7608	10	0.25751	T	0.34	.	13.1079	0.59257	0.0763:0.0:0.9237:0.0	.	39;302;302	G3V4P9;P80192;P80192-4	.;M3K9_HUMAN;.	Y	302;302;302;39;30	ENSP00000451612:H302Y;ENSP00000370649:H302Y;ENSP00000451921:H39Y	ENSP00000005198:H302Y	H	-	1	0	MAP3K9	70297569	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.539000	0.73856	2.685000	0.91497	0.455000	0.32223	CAC		0.517	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		
NOXRED1	122945	hgsc.bcm.edu	37	14	77873850	77873850	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:77873850G>A	ENST00000380835.2	-	3	654	c.488C>T	c.(487-489)gCc>gTc	p.A163V	NOXRED1_ENST00000298358.3_Missense_Mutation_p.A163V	NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	163					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)	p.A163V(2)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						CACAATGCTGGCCTTCTCAAG	0.498																																					p.A163V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C488T	14						.						142.0	130.0	134.0					14																	77873850		2203	4300	6503	76943603	SO:0001583	missense	122945	exon3			AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.488C>T	14.37:g.77873850G>A	ENSP00000370215:p.Ala163Val	Somatic		Capture	SOLID	Phase_I	76943603	NM_138791	B3KQ47|O95435	Missense_Mutation	SNP	ENST00000380835.2	37	CCDS45142.1	.	.	.	.	.	.	.	.	.	.	G	7.566	0.665786	0.14710	.	.	ENSG00000165555	ENST00000380835;ENST00000298358;ENST00000555603	T;T;T	0.63744	-0.06;-0.06;-0.06	5.77	-0.227	0.13102	.	1.335390	0.04483	N	0.378079	T	0.52500	0.1738	L	0.34521	1.04	0.09310	N	1	B;B	0.26002	0.139;0.032	B;B	0.24394	0.031;0.053	T	0.38156	-0.9674	10	0.30078	T	0.28	0.6284	12.0654	0.53586	0.0:0.1102:0.2867:0.6032	.	163;163	Q6NXP6-2;Q6NXP6	.;NXRD1_HUMAN	V	163	ENSP00000370215:A163V;ENSP00000298358:A163V;ENSP00000450597:A163V	ENSP00000298358:A163V	A	-	2	0	C14orf148	76943603	0.009000	0.17119	0.006000	0.13384	0.173000	0.22820	-0.060000	0.11712	-0.358000	0.08162	0.650000	0.86243	GCC		0.498	NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414103.1	NM_138791	
NRXN3	9369	hgsc.bcm.edu	37	14	80328160	80328160	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:80328160G>T	ENST00000557594.1	+	6	2720	c.1767G>T	c.(1765-1767)agG>agT	p.R589S	NRXN3_ENST00000556003.1_3'UTR|NRXN3_ENST00000554719.1_Missense_Mutation_p.R1013S|NRXN3_ENST00000428277.2_Missense_Mutation_p.R411S|NRXN3_ENST00000335750.5_Missense_Mutation_p.R1013S|NRXN3_ENST00000281127.7_Missense_Mutation_p.R384S	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	589					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.R1013S(1)|p.R411S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ACAGGAACAGGGACGAGGGGT	0.582																																					p.R384S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1152T	14						.						84.0	75.0	78.0					14																	80328160		2203	4300	6503	79397913	SO:0001583	missense	9369	exon6			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1767G>T	14.37:g.80328160G>T	ENSP00000451672:p.Arg589Ser	Somatic		Capture	SOLID	Phase_I	79397913	NM_138970	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	37		.	.	.	.	.	.	.	.	.	.	G	13.52	2.261871	0.39995	.	.	ENSG00000021645	ENST00000330071;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	D;D;T;T;T	0.82711	-1.64;-1.64;-0.19;-0.01;-0.17	6.16	5.28	0.74379	Neurexin/syndecan/glycophorin C (1);	0.000000	0.85682	D	0.000000	D	0.90369	0.6986	M	0.80183	2.485	0.32591	N	0.527211	D;D;D;D	0.89917	0.996;0.996;0.99;1.0	D;D;D;D	0.91635	0.99;0.99;0.992;0.999	D	0.92572	0.6067	9	.	.	.	.	11.3708	0.49697	0.1367:0.0:0.8633:0.0	.	411;384;589;1013	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	S	1595;1013;1013;589;384;411	ENSP00000451648:R1013S;ENSP00000338349:R1013S;ENSP00000451672:R589S;ENSP00000281127:R384S;ENSP00000394426:R411S	.	R	+	3	2	NRXN3	79397913	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.845000	0.62853	1.627000	0.50400	0.650000	0.86243	AGG		0.582	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
SEL1L	6400	hgsc.bcm.edu	37	14	82000058	82000058	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:82000058G>A	ENST00000336735.4	-	1	147	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L	SEL1L_ENST00000555824.1_Silent_p.L11L	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	11					Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.L11L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ACCGCACACAGCAGCAGCGTC	0.701																																					p.L11L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C31T	14						.						45.0	37.0	40.0					14																	82000058		2202	4297	6499	81069811	SO:0001819	synonymous_variant	6400	exon1				CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.31C>T	14.37:g.82000058G>A		Somatic		Capture	SOLID	Phase_I	81069811	NM_005065	Q6UWT6|Q9P1T9|Q9UHK7	Silent	SNP	ENST00000336735.4	37	CCDS9876.1																																																																																				0.701	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
TTC7B	145567	hgsc.bcm.edu	37	14	91196435	91196435	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:91196435G>T	ENST00000328459.6	-	5	803	c.682C>A	c.(682-684)Ctc>Atc	p.L228I	TTC7B_ENST00000357056.2_Missense_Mutation_p.L228I	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	228								p.L228I(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				TTGAAATAGAGGACATGGGCT	0.393																																					p.L228I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C682A	14						.						91.0	102.0	98.0					14																	91196435		2203	4300	6503	90266188	SO:0001583	missense	145567	exon5			BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.682C>A	14.37:g.91196435G>T	ENSP00000336127:p.Leu228Ile	Somatic		Capture	SOLID	Phase_I	90266188	NM_001010854	Q86U24|Q86VT3	Missense_Mutation	SNP	ENST00000328459.6	37	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611749	0.28712	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000557766	T;T	0.37752	1.85;1.18	5.24	5.24	0.73138	.	0.059349	0.64402	D	0.000004	T	0.23611	0.0571	N	0.20530	0.585	0.42698	D	0.993601	B	0.12013	0.005	B	0.10450	0.005	T	0.06391	-1.0829	10	0.24483	T	0.36	-7.0243	12.1556	0.54074	0.0831:0.0:0.9169:0.0	.	228	Q86TV6	TTC7B_HUMAN	I	126;228;228;126	ENSP00000349564:L228I;ENSP00000336127:L228I	ENSP00000336127:L228I	L	-	1	0	TTC7B	90266188	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.740000	0.55082	2.613000	0.88420	0.650000	0.86243	CTC		0.393	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2		
UNC79	57578	hgsc.bcm.edu	37	14	93990333	93990333	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:93990333C>A	ENST00000393151.2	+	8	908	c.908C>A	c.(907-909)cCc>cAc	p.P303H	UNC79_ENST00000553484.1_Missense_Mutation_p.P303H|UNC79_ENST00000256339.4_Missense_Mutation_p.P126H|UNC79_ENST00000555664.1_Missense_Mutation_p.P303H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	303					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P126H(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GCTTGGAATCCCATCCACTGC	0.368																																					p.P126H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C377A	14						.						144.0	125.0	131.0					14																	93990333		2203	4300	6503	93060086	SO:0001583	missense	57578	exon8			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.908C>A	14.37:g.93990333C>A	ENSP00000376858:p.Pro303His	Somatic		Capture	SOLID	Phase_I	93060086	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	23.5	4.427171	0.83667	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.22743	1.95;1.95;1.94;1.95	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.43831	0.1265	L	0.49126	1.545	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.22661	-1.0210	10	0.87932	D	0	-20.0881	18.5499	0.91060	0.0:1.0:0.0:0.0	.	303;303	C9JQL1;Q9P2D8	.;UNC79_HUMAN	H	126;303;303;303;303	ENSP00000256339:P126H;ENSP00000450868:P303H;ENSP00000451360:P303H;ENSP00000376858:P303H	ENSP00000256339:P126H	P	+	2	0	KIAA1409	93060086	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.661000	0.74422	2.658000	0.90341	0.591000	0.81541	CCC		0.368	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
WDR25	79446	hgsc.bcm.edu	37	14	100847786	100847786	+	Silent	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:100847786C>A	ENST00000335290.6	+	2	751	c.525C>A	c.(523-525)ccC>ccA	p.P175P	WDR25_ENST00000554998.1_Silent_p.P175P|WDR25_ENST00000402312.3_Silent_p.P175P|WDR25_ENST00000554175.1_Silent_p.P175P|WDR25_ENST00000542471.2_5'Flank	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	175								p.P175P(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				GTGTGGTACCCTATACTCCCA	0.517																																					p.P175P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525A	14						.						81.0	91.0	88.0					14																	100847786		2203	4300	6503	99917539	SO:0001819	synonymous_variant	79446	exon2			BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.525C>A	14.37:g.100847786C>A		Somatic		Capture	SOLID	Phase_I	99917539	NM_001161476	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Silent	SNP	ENST00000335290.6	37	CCDS32157.1																																																																																				0.517	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102500377	102500377	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr14:102500377G>C	ENST00000360184.4	+	55	10642	c.10478G>C	c.(10477-10479)aGt>aCt	p.S3493T	DYNC1H1_ENST00000556791.1_3'UTR|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3493	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAAAAAACAAGTGAAACTTTC	0.483																																					p.S3493T												.	.	0			c.G10478C	14						.						148.0	150.0	149.0					14																	102500377		2203	4300	6503	101570130	SO:0001583	missense	1778	exon55			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10478G>C	14.37:g.102500377G>C	ENSP00000348965:p.Ser3493Thr	Somatic		Capture	SOLID	Phase_I	101570130	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728293	0.69074	.	.	ENSG00000197102	ENST00000360184	T	0.74002	-0.8	5.72	4.83	0.62350	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.75774	0.3895	M	0.68952	2.095	0.80722	D	1	P	0.39717	0.684	B	0.43508	0.422	T	0.74287	-0.3714	10	0.29301	T	0.29	.	15.2431	0.73485	0.0677:0.0:0.9323:0.0	.	3493	Q14204	DYHC1_HUMAN	T	3493	ENSP00000348965:S3493T	ENSP00000348965:S3493T	S	+	2	0	DYNC1H1	101570130	1.000000	0.71417	0.339000	0.25562	0.962000	0.63368	9.755000	0.98912	1.561000	0.49584	0.655000	0.94253	AGT		0.483	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
TUBA8	51807	hgsc.bcm.edu	37	22	18604400	18604400	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:18604400T>C	ENST00000330423.3	+	2	231	c.158T>C	c.(157-159)tTc>tCc	p.F53S	TUBA8_ENST00000316027.6_5'UTR	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	53					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.F53S(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						ACCACCTTTTTCAGCGAGACT	0.562																																					p.F53S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T158C	22						.																																			16984400	SO:0001583	missense	51807	exon2			AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.158T>C	22.37:g.18604400T>C	ENSP00000333326:p.Phe53Ser	Somatic		Capture	SOLID	Phase_I	16984400	NM_018943	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	ENST00000330423.3	37	CCDS13751.1	.	.	.	.	.	.	.	.	.	.	T	18.20	3.571570	0.65765	.	.	ENSG00000183785	ENST00000330423;ENST00000416740	D;D	0.82526	-1.62;-1.62	5.06	5.06	0.68205	Tubulin/FtsZ, GTPase domain (4);	0.048395	0.85682	D	0.000000	D	0.95130	0.8422	H	0.99435	4.565	0.54753	D	0.999986	P;D;D	0.89917	0.951;1.0;1.0	P;D;D	0.97110	0.858;1.0;1.0	D	0.97010	0.9735	10	0.72032	D	0.01	.	14.2915	0.66281	0.0:0.0:0.0:1.0	.	77;53;52	C9J2C0;Q9NY65;Q7Z3M3	.;TBA8_HUMAN;.	S	53;77	ENSP00000333326:F53S;ENSP00000412646:F77S	ENSP00000333326:F53S	F	+	2	0	TUBA8	16984400	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	8.040000	0.89188	2.030000	0.59900	0.459000	0.35465	TTC		0.562	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	NM_018943	
ZNF280B	140883	hgsc.bcm.edu	37	22	22842527	22842527	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:22842527G>A	ENST00000406426.1	-	4	1939	c.1197C>T	c.(1195-1197)ggC>ggT	p.G399G	ZNF280B_ENST00000360412.2_Silent_p.G399G			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	399					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G399G(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		AGGGCATTTCGCCAGGCTTAT	0.433																																					p.G399G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1197T	22						.						116.0	110.0	112.0					22																	22842527		2203	4300	6503	21172527	SO:0001819	synonymous_variant	140883	exon4			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1197C>T	22.37:g.22842527G>A		Somatic		Capture	SOLID	Phase_I	21172527	NM_080764		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																				0.433	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
MTMR3	8897	hgsc.bcm.edu	37	22	30416812	30416812	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:30416812G>A	ENST00000401950.2	+	17	3506	c.3164G>A	c.(3163-3165)cGc>cAc	p.R1055H	MTMR3_ENST00000333027.3_Missense_Mutation_p.R1055H|MTMR3_ENST00000406629.1_Missense_Mutation_p.R1055H|MTMR3_ENST00000351488.3_Missense_Mutation_p.R1055H|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000323630.5_Missense_Mutation_p.R919H|CTA-85E5.10_ENST00000429350.1_RNA	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	1055					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.R1055H(2)		breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CTGAAGAGTCGCCTGGAGAGC	0.527																																					p.R1055H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3164A	22						.						66.0	63.0	64.0					22																	30416812		2203	4300	6503	28746812	SO:0001583	missense	8897	exon17			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.3164G>A	22.37:g.30416812G>A	ENSP00000384651:p.Arg1055His	Somatic		Capture	SOLID	Phase_I	28746812	NM_153050	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	ENST00000401950.2	37	CCDS13870.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617347	0.87359	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.94000	-3.13;-3.25;-3.33;-3.24;-3.25	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.94574	0.8252	L	0.32530	0.975	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.991;0.996	D	0.95046	0.8182	10	0.62326	D	0.03	.	17.3154	0.87222	0.0:0.0:1.0:0.0	.	1055;1055;1055	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	H	1055;1055;919;1055;1055	ENSP00000384651:R1055H;ENSP00000331649:R1055H;ENSP00000318070:R919H;ENSP00000307271:R1055H;ENSP00000384077:R1055H	ENSP00000318070:R919H	R	+	2	0	MTMR3	28746812	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.969000	0.93411	2.625000	0.88918	0.655000	0.94253	CGC		0.527	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
SEC14L4	284904	hgsc.bcm.edu	37	22	30891618	30891618	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:30891618G>T	ENST00000255858.7	-	4	269	c.186C>A	c.(184-186)ttC>ttA	p.F62L	SEC14L4_ENST00000392772.2_Missense_Mutation_p.F8L|SEC14L4_ENST00000381982.3_Missense_Mutation_p.F62L|SEC14L4_ENST00000540456.1_Missense_Mutation_p.F47L|RP4-539M6.14_ENST00000610156.1_RNA|RP4-539M6.14_ENST00000442126.1_RNA	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	62						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.F62L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	GTTGCTTCCGGAACTCCATGT	0.597																																					p.F62L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C186A	22						.						95.0	91.0	92.0					22																	30891618		2203	4300	6503	29221618	SO:0001583	missense	284904	exon4			AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.186C>A	22.37:g.30891618G>T	ENSP00000255858:p.Phe62Leu	Somatic		Capture	SOLID	Phase_I	29221618	NM_001161368	A5D6W7|A6NCV4	Missense_Mutation	SNP	ENST00000255858.7	37	CCDS13878.1	.	.	.	.	.	.	.	.	.	.	g	15.89	2.966293	0.53507	.	.	ENSG00000133488	ENST00000255858;ENST00000540456;ENST00000392772;ENST00000381982	T;T;T;T	0.68903	1.57;-0.36;-0.29;1.57	5.18	4.16	0.48862	Phosphatidylinositol transfer protein-like, N-terminal (1);	0.055854	0.64402	D	0.000001	T	0.75503	0.3858	M	0.84683	2.71	0.80722	D	1	P;D;P	0.58268	0.776;0.982;0.721	B;P;B	0.52454	0.174;0.699;0.107	T	0.78259	-0.2273	10	0.59425	D	0.04	-10.2128	9.5301	0.39189	0.1666:0.0:0.8334:0.0	.	8;47;62	B3KSF0;G3V1L4;Q9UDX3	.;.;S14L4_HUMAN	L	62;47;8;62	ENSP00000255858:F62L;ENSP00000440848:F47L;ENSP00000376525:F8L;ENSP00000371412:F62L	ENSP00000255858:F62L	F	-	3	2	SEC14L4	29221618	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	1.260000	0.32968	1.304000	0.44892	0.655000	0.94253	TTC		0.597	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977	
PES1	23481	hgsc.bcm.edu	37	22	30985243	30985243	+	Silent	SNP	C	C	T	rs202113383		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:30985243C>T	ENST00000354694.7	-	2	145	c.39G>A	c.(37-39)tcG>tcA	p.S13S	PES1_ENST00000405677.1_5'UTR|PES1_ENST00000402281.1_5'UTR|PES1_ENST00000335214.6_Silent_p.S13S|PES1_ENST00000402284.3_Silent_p.S13S	NM_001243225.1|NM_014303.3	NP_001230154.1|NP_055118.1			pescadillo ribosomal biogenesis factor 1									p.S13S(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						AGTTGGTGGCCGAGCCTCGTT	0.512																																					p.S13S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G39A	22						.						72.0	60.0	64.0					22																	30985243		2203	4300	6503	29315243	SO:0001819	synonymous_variant	23481	exon2			U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000354694.7:c.39G>A	22.37:g.30985243C>T		Somatic		Capture	SOLID	Phase_I	29315243	NM_014303		Silent	SNP	ENST00000354694.7	37	CCDS13880.1																																																																																				0.512	PES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321188.3	NM_014303	
LIMK2	3985	hgsc.bcm.edu	37	22	31672976	31672976	+	Intron	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:31672976T>C	ENST00000331728.4	+	16	1886				LIMK2_ENST00000340552.4_Silent_p.D637D|LIMK2_ENST00000333611.4_Intron|LIMK2_ENST00000467301.1_Intron|LIMK2_ENST00000406516.1_Silent_p.D580D|LIMK2_ENST00000444929.2_Intron	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2						phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						TTGACGTGGATGAGCTCCTGG	0.562																																					p.D637D												.	.	0			c.T1911C	22						.						115.0	91.0	99.0					22																	31672976		2203	4300	6503	30002976	SO:0001627	intron_variant	3985	exon15			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1773-1307T>C	22.37:g.31672976T>C		Somatic		Capture	SOLID	Phase_I	30002976	NM_001031801	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Silent	SNP	ENST00000331728.4	37	CCDS13891.1																																																																																				0.562	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
MCM5	4174	hgsc.bcm.edu	37	22	35804414	35804414	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:35804414C>T	ENST00000216122.4	+	6	764	c.610C>T	c.(610-612)Cgc>Tgc	p.R204C	MCM5_ENST00000382011.5_Missense_Mutation_p.R161C	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	204					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.R204C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						TCAGGCTGGGCGCCCCAAATG	0.552																																					p.R204C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C610T	22						.						71.0	64.0	67.0					22																	35804414		2203	4300	6503	34134414	SO:0001583	missense	4174	exon6				CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.610C>T	22.37:g.35804414C>T	ENSP00000216122:p.Arg204Cys	Somatic		Capture	SOLID	Phase_I	34134414	NM_006739	O60785|Q14578|Q9BTJ4|Q9BWL8	Missense_Mutation	SNP	ENST00000216122.4	37	CCDS13915.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112446	0.77210	.	.	ENSG00000100297	ENST00000216122;ENST00000382011;ENST00000444582;ENST00000444778	T;T;T	0.08807	3.05;3.05;3.05	4.35	4.35	0.52113	Nucleic acid-binding, OB-fold-like (1);	0.135501	0.48286	D	0.000185	T	0.19846	0.0477	M	0.67953	2.075	0.80722	D	1	D;D;D	0.61080	0.989;0.989;0.989	P;P;P	0.51701	0.677;0.677;0.677	T	0.01587	-1.1318	10	0.66056	D	0.02	-22.3921	17.4517	0.87594	0.0:1.0:0.0:0.0	.	204;161;204	B1AHB0;B1AHB1;P33992	.;.;MCM5_HUMAN	C	204;161;113;61	ENSP00000216122:R204C;ENSP00000371441:R161C;ENSP00000408705:R61C	ENSP00000216122:R204C	R	+	1	0	MCM5	34134414	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.372000	0.59530	2.418000	0.82041	0.655000	0.94253	CGC		0.552	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3		
MYH9	4627	hgsc.bcm.edu	37	22	36716896	36716896	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:36716896C>T	ENST00000216181.5	-	8	1045	c.815G>A	c.(814-816)cGg>cAg	p.R272Q		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	272	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.R272Q(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GTGGAAGGTCCGTTCTTCCTT	0.537			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.R272Q			Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G815A	22						.						84.0	77.0	80.0					22																	36716896		2203	4300	6503	35046842	SO:0001583	missense	4627	exon8	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.815G>A	22.37:g.36716896C>T	ENSP00000216181:p.Arg272Gln	Somatic		Capture	SOLID	Phase_I	35046842	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	C	36	5.721154	0.96839	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.93906	-3.31	5.13	5.13	0.70059	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.98245	0.9419	H	0.98525	4.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99737	1.1014	10	0.87932	D	0	.	18.5517	0.91068	0.0:1.0:0.0:0.0	.	272	P35579	MYH9_HUMAN	Q	136;272	ENSP00000216181:R272Q	ENSP00000216181:R272Q	R	-	2	0	MYH9	35046842	1.000000	0.71417	0.960000	0.40013	0.997000	0.91878	7.705000	0.84606	2.539000	0.85634	0.591000	0.81541	CGG		0.537	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
C22orf23	84645	hgsc.bcm.edu	37	22	38340482	38340482	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:38340482A>G	ENST00000249079.2	-	6	780	c.524T>C	c.(523-525)aTg>aCg	p.M175T	C22orf23_ENST00000403305.1_Missense_Mutation_p.M175T|C22orf23_ENST00000403026.1_Missense_Mutation_p.M175T			Q9BZE7	EVG1_HUMAN	chromosome 22 open reading frame 23	175								p.M175T(1)		endometrium(3)|kidney(2)|large_intestine(7)	12	Melanoma(58;0.045)					CAGGGCCTCCATGTCAGCCAG	0.572																																					p.M175T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T524C	22						.						96.0	88.0	91.0					22																	38340482		2203	4300	6503	36670428	SO:0001583	missense	84645	exon6			AF324466	CCDS13962.1, CCDS74860.1	22q13.1	2013-10-11			ENSG00000128346	ENSG00000128346			18589	protein-coding gene	gene with protein product						11237012	Standard	NM_032561		Approved	FLJ32787, EVG1, LOC84645	uc003auj.2	Q9BZE7	OTTHUMG00000150672	ENST00000249079.2:c.524T>C	22.37:g.38340482A>G	ENSP00000249079:p.Met175Thr	Somatic		Capture	SOLID	Phase_I	36670428	NM_032561	Q5JYU9|Q96M68	Missense_Mutation	SNP	ENST00000249079.2	37	CCDS13962.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399695	0.62177	.	.	ENSG00000128346	ENST00000403305;ENST00000249079;ENST00000403026	T;T;T	0.59364	0.27;0.27;0.27	5.42	5.42	0.78866	.	0.045636	0.85682	D	0.000000	T	0.78685	0.4322	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82733	-0.0311	10	0.87932	D	0	-22.915	15.4653	0.75394	1.0:0.0:0.0:0.0	.	175	Q9BZE7	EVG1_HUMAN	T	175	ENSP00000384667:M175T;ENSP00000249079:M175T;ENSP00000384618:M175T	ENSP00000249079:M175T	M	-	2	0	C22orf23	36670428	1.000000	0.71417	0.993000	0.49108	0.415000	0.31203	8.158000	0.89649	2.064000	0.61679	0.533000	0.62120	ATG		0.572	C22orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319564.1	NM_032561	
PICK1	9463	hgsc.bcm.edu	37	22	38469007	38469007	+	Splice_Site	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:38469007A>G	ENST00000404072.3	+	10	1038	c.691A>G	c.(691-693)Atg>Gtg	p.M231V	RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000356976.3_Splice_Site_p.M231V	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	231	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)	p.M231V(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					CCTCTTCCAGATGCTGACGGA	0.552																																					p.M231V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A691G	22						.						265.0	208.0	227.0					22																	38469007		2203	4300	6503	36798953	SO:0001630	splice_region_variant	9463	exon10			AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.691-1A>G	22.37:g.38469007A>G		Somatic		Capture	SOLID	Phase_I	36798953	NM_001039584	B3KS52|O95906	Missense_Mutation	SNP	ENST00000404072.3	37	CCDS13965.1	.	.	.	.	.	.	.	.	.	.	A	8.814	0.935939	0.18206	.	.	ENSG00000100151	ENST00000404072;ENST00000356976	T;T	0.76060	-0.99;-0.99	5.53	5.53	0.82687	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	L	0.36672	1.1	0.80722	D	1	B	0.26547	0.152	B	0.23018	0.043	T	0.61058	-0.7139	9	.	.	.	-48.1717	15.9692	0.79998	1.0:0.0:0.0:0.0	.	231	Q9NRD5	PICK1_HUMAN	V	231	ENSP00000385205:M231V;ENSP00000349465:M231V	.	M	+	1	0	PICK1	36798953	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	8.702000	0.91338	2.232000	0.73038	0.533000	0.62120	ATG		0.552	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	NM_012407	Missense_Mutation
DMC1	11144	hgsc.bcm.edu	37	22	38962738	38962738	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:38962738C>T	ENST00000216024.2	-	4	376	c.100G>A	c.(100-102)Gtg>Atg	p.V34M	DMC1_ENST00000428462.2_Missense_Mutation_p.V34M|DMC1_ENST00000464842.1_5'Flank	NM_007068.2	NP_008999.2	Q14565	DMC1_HUMAN	DNA meiotic recombinase 1	34					female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome (GO:0005694)|chromosome, telomeric region (GO:0000781)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.V34M(2)		large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11	Melanoma(58;0.0286)					ATGTCAGCCACGTTCTGTAAA	0.428								Homologous recombination																													p.V34M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G100A	22						.						101.0	83.0	89.0					22																	38962738		2203	4300	6503	37292684	SO:0001583	missense	11144	exon4			D63882	CCDS13973.1, CCDS63477.1	22q13.1	2013-05-02	2013-05-02		ENSG00000100206	ENSG00000100206			2927	protein-coding gene	gene with protein product		602721	"""DMC1 (dosage suppressor of mck1, yeast homolog) meiosis-specific homologous recombination"", ""DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)"""			8602360, 8590282, 17541404	Standard	NM_007068		Approved	LIM15	uc003avz.2	Q14565	OTTHUMG00000151088	ENST00000216024.2:c.100G>A	22.37:g.38962738C>T	ENSP00000216024:p.Val34Met	Somatic		Capture	SOLID	Phase_I	37292684	NM_007068	A8K9A2|B4DMW6|Q08AI1|Q99498|Q9UH11	Missense_Mutation	SNP	ENST00000216024.2	37	CCDS13973.1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.351895	0.24512	.	.	ENSG00000100206	ENST00000216024;ENST00000428462;ENST00000439567;ENST00000366173;ENST00000415483	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.55	3.48	0.39840	DNA repair Rad51/transcription factor NusA, alpha-helical (1);	0.228444	0.47455	N	0.000240	T	0.31918	0.0812	L	0.33753	1.03	0.43214	D	0.995088	B;B;B	0.15473	0.013;0.002;0.013	B;B;B	0.15052	0.012;0.002;0.012	T	0.09530	-1.0670	10	0.48119	T	0.1	-15.9562	11.5963	0.50975	0.0:0.8552:0.0:0.1448	.	34;34;34	B4DMW6;Q8IYL1;Q14565	.;.;DMC1_HUMAN	M	34	ENSP00000216024:V34M;ENSP00000412703:V34M;ENSP00000391385:V34M;ENSP00000410808:V34M	ENSP00000216024:V34M	V	-	1	0	DMC1	37292684	0.821000	0.29204	0.889000	0.34880	0.874000	0.50279	1.464000	0.35288	0.891000	0.36235	-0.137000	0.14449	GTG		0.428	DMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321246.2	NM_007068	
ADSL	158	hgsc.bcm.edu	37	22	40761043	40761043	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:40761043G>A	ENST00000216194.7	+	12	1407	c.1351G>A	c.(1351-1353)Ggt>Agt	p.G451S	ADSL_ENST00000342312.6_Intron|ADSL_ENST00000454266.2_Missense_Mutation_p.G465S	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	451					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)	p.G451S(2)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						TTCTTTCACTGGTCGTGCCTC	0.488																																					p.G451S	Colon(4;65 130 1097 1516)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1351A	22						.						174.0	139.0	151.0					22																	40761043		2203	4300	6503	39090989	SO:0001583	missense	158	exon12			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.1351G>A	22.37:g.40761043G>A	ENSP00000216194:p.Gly451Ser	Somatic		Capture	SOLID	Phase_I	39090989	NM_000026	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	37	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135138	0.94517	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028	D;D	0.96716	-4.1;-4.1	5.35	5.35	0.76521	Adenylosuccinate lyase C-terminal metazoa/fungi (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.99118	0.9696	H	0.99357	4.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98844	1.0756	10	0.87932	D	0	-23.5446	19.444	0.94840	0.0:0.0:1.0:0.0	.	465;451;451	E7ERF4;Q71UA4;P30566	.;.;PUR8_HUMAN	S	451;465;271	ENSP00000216194:G451S;ENSP00000390107:G465S	ENSP00000216194:G451S	G	+	1	0	ADSL	39090989	1.000000	0.71417	0.926000	0.36857	0.955000	0.61496	8.693000	0.91288	2.687000	0.91594	0.563000	0.77884	GGT		0.488	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321386.1	NM_000026	
ZC3H7B	23264	hgsc.bcm.edu	37	22	41751551	41751551	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:41751551C>T	ENST00000352645.4	+	18	2370	c.2113C>T	c.(2113-2115)Cag>Tag	p.Q705*	ZC3H7B_ENST00000351589.4_Nonsense_Mutation_p.Q705*	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	721					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.Q705*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GAGAAACGGGCAGGTGGTGGA	0.637																																					p.Q705X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2113T	22						.						122.0	104.0	110.0					22																	41751551		2203	4300	6503	40081497	SO:0001587	stop_gained	23264	exon18				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2113C>T	22.37:g.41751551C>T	ENSP00000345793:p.Gln705*	Somatic		Capture	SOLID	Phase_I	40081497	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Nonsense_Mutation	SNP	ENST00000352645.4	37	CCDS14013.1	.	.	.	.	.	.	.	.	.	.	C	41	8.579889	0.98872	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	.	.	.	5.08	5.08	0.68730	.	0.191606	0.47455	D	0.000235	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-11.7361	18.5253	0.90969	0.0:1.0:0.0:0.0	.	.	.	.	X	705	.	ENSP00000263243:Q705X	Q	+	1	0	ZC3H7B	40081497	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.736000	0.84948	2.359000	0.80004	0.456000	0.33151	CAG		0.637	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
ATXN10	25814	hgsc.bcm.edu	37	22	46238953	46238953	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr22:46238953G>T	ENST00000252934.5	+	11	1585	c.1320G>T	c.(1318-1320)gaG>gaT	p.E440D	ATXN10_ENST00000402380.3_Missense_Mutation_p.E91D|ATXN10_ENST00000381061.4_Missense_Mutation_p.E376D	NM_013236.3	NP_037368.1	Q9UBB4	ATX10_HUMAN	ataxin 10	440					cell death (GO:0008219)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.E440D(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	10		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		CAAAGATGGAGGAACAGGGGC	0.458																																					p.E376D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1128T	22						.						107.0	109.0	109.0					22																	46238953		2203	4300	6503	44617617	SO:0001583	missense	25814	exon10			AK095309	CCDS14070.1, CCDS54540.1	22q13	2013-02-15	2004-08-12	2004-08-12	ENSG00000130638	ENSG00000130638		"""Ataxins"""	10549	protein-coding gene	gene with protein product		611150	"""spinocerebellar ataxia 10"""	SCA10		9973298	Standard	NM_013236		Approved	E46L, FLJ37990	uc003bgm.2	Q9UBB4	OTTHUMG00000150451	ENST00000252934.5:c.1320G>T	22.37:g.46238953G>T	ENSP00000252934:p.Glu440Asp	Somatic		Capture	SOLID	Phase_I	44617617	NM_001167621	A6NLC4|B4DG05|O14998|O15009|Q6I9X4	Missense_Mutation	SNP	ENST00000252934.5	37	CCDS14070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.35|18.35	3.603818|3.603818	0.66445|0.66445	.|.	.|.	ENSG00000130638|ENSG00000130638	ENST00000381061;ENST00000252934;ENST00000402380|ENST00000396011	.|.	.|.	.|.	5.81|5.81	-0.0185|-0.0185	0.13964|0.13964	Ataxin-10 domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61664|.	0.2365|.	M|M	0.61703|0.61703	1.905|1.905	0.37205|0.37205	D|D	0.904556|0.904556	D;D|.	0.54397|.	0.959;0.966|.	P;P|.	0.60117|.	0.496;0.869|.	T|.	0.65520|.	-0.6148|.	9|.	0.45353|0.56958	T|D	0.12|0.05	-2.9757|-2.9757	9.6366|9.6366	0.39811|0.39811	0.3636:0.0:0.6364:0.0|0.3636:0.0:0.6364:0.0	.|.	376;440|.	A6NLC4;Q9UBB4|.	.;ATX10_HUMAN|.	D|X	376;440;91|444	.|.	ENSP00000252934:E440D|ENSP00000379332:G444X	E|G	+|+	3|1	2|0	ATXN10|ATXN10	44617617|44617617	0.987000|0.987000	0.35691|0.35691	0.967000|0.967000	0.41034|0.41034	0.901000|0.901000	0.52897|0.52897	1.230000|1.230000	0.32612|0.32612	0.071000|0.071000	0.16664|0.16664	-0.140000|-0.140000	0.14226|0.14226	GAG|GGA		0.458	ATXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318142.2	NM_013236	
ZNF69	7620	hgsc.bcm.edu	37	19	12015604	12015604	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:12015604G>A	ENST00000429654.2	+	4	532	c.392G>A	c.(391-393)tGt>tAt	p.C131Y	ZNF69_ENST00000340180.5_Missense_Mutation_p.C117Y			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	131					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C117Y(1)		endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		AGCTTTGTGTGTGGAGAAGTT	0.428																																					p.C117Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G350A	19						.						187.0	183.0	185.0					19																	12015604		2203	4300	6503	11876604	SO:0001583	missense	7620	exon4			X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.392G>A	19.37:g.12015604G>A	ENSP00000402985:p.Cys131Tyr	Somatic		Capture	SOLID	Phase_I	11876604	NM_021915	Q86VA7	Missense_Mutation	SNP	ENST00000429654.2	37		.	.	.	.	.	.	.	.	.	.	g	6.789	0.514513	0.12944	.	.	ENSG00000198429	ENST00000429654;ENST00000445911;ENST00000340180	T;T;T	0.08193	3.12;3.99;4.06	1.05	-0.0399	0.13874	.	.	.	.	.	T	0.10208	0.0250	M	0.70903	2.155	0.24110	N	0.995841	B	0.06786	0.001	B	0.06405	0.002	T	0.25984	-1.0116	9	0.49607	T	0.09	.	6.49	0.22109	0.1851:0.0:0.8149:0.0	.	117	C9JR48	.	Y	131;117;117	ENSP00000402985:C131Y;ENSP00000388784:C117Y;ENSP00000345333:C117Y	ENSP00000345333:C117Y	C	+	2	0	ZNF69	11876604	0.892000	0.30473	0.004000	0.12327	0.030000	0.12068	0.744000	0.26245	0.035000	0.15519	0.405000	0.27470	TGT		0.428	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000344082.1	NM_021915	
ZNF791	163049	hgsc.bcm.edu	37	19	12739573	12739573	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:12739573A>C	ENST00000343325.4	+	4	1392	c.1230A>C	c.(1228-1230)aaA>aaC	p.K410N	ZNF791_ENST00000458122.3_Missense_Mutation_p.K378N|ZNF791_ENST00000540038.1_Missense_Mutation_p.K301N|AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000446165.1_3'UTR|ZNF490_ENST00000465656.1_Intron	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K410N(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						CTGGAGAAAAACCCTATGAGT	0.393																																					p.K410N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1230C	19						.						97.0	105.0	102.0					19																	12739573		2203	4300	6503	12600573	SO:0001583	missense	163049	exon4			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1230A>C	19.37:g.12739573A>C	ENSP00000342974:p.Lys410Asn	Somatic		Capture	SOLID	Phase_I	12600573	NM_153358	B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	A	14.32	2.499610	0.44455	.	.	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.26067	1.76;1.76;1.76	1.83	-0.609	0.11608	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48995	0.1531	M	0.87900	2.915	0.26074	N	0.981182	D	0.89917	1.0	D	0.91635	0.999	T	0.35051	-0.9804	9	0.87932	D	0	.	5.1232	0.14871	0.6575:0.0:0.3425:0.0	.	410	Q3KP31	ZN791_HUMAN	N	410;392;378;301	ENSP00000342974:K410N;ENSP00000441761:K378N;ENSP00000441038:K301N	ENSP00000342974:K410N	K	+	3	2	ZNF791	12600573	0.005000	0.15991	0.986000	0.45419	0.986000	0.74619	-0.332000	0.07904	-0.417000	0.07461	-0.415000	0.06103	AAA		0.393	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
SLC35E1	79939	hgsc.bcm.edu	37	19	16664645	16664645	+	Missense_Mutation	SNP	G	G	A	rs372456978		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:16664645G>A	ENST00000595753.1	-	6	1095	c.1078C>T	c.(1078-1080)Cgt>Tgt	p.R360C	CTD-3222D19.2_ENST00000409035.1_3'UTR|CTD-3222D19.11_ENST00000597357.1_RNA|SLC35E1_ENST00000593812.1_5'Flank	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	360					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.R216C(1)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						CTCCGGTGACGCTCCTTGCTG	0.582																																					p.R360C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1078T	19						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	102.0	91.0	95.0		1078	1.4	0.1	19		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC35E1	NM_024881.4	180	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging	360/411	16664645	2,13004	2203	4300	6503	16525645	SO:0001583	missense	79939	exon6			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.1078C>T	19.37:g.16664645G>A	ENSP00000470652:p.Arg360Cys	Somatic		Capture	SOLID	Phase_I	16525645	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	37	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	G	13.14	2.148937	0.37923	2.27E-4	1.16E-4	ENSG00000127526	ENST00000409648;ENST00000421082	.	.	.	4.53	1.43	0.22495	.	0.908635	0.09654	N	0.773261	T	0.18718	0.0449	N	0.14661	0.345	0.24045	N	0.996066	D	0.56968	0.978	B	0.41299	0.353	T	0.14035	-1.0487	9	0.52906	T	0.07	-5.8998	10.0098	0.41979	0.1486:0.0:0.8514:0.0	.	360	Q96K37	S35E1_HUMAN	C	360;111	.	ENSP00000387152:R360C	R	-	1	0	SLC35E1	16525645	0.714000	0.27936	0.065000	0.19835	0.598000	0.36846	2.276000	0.43408	0.131000	0.18576	0.561000	0.74099	CGT		0.582	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
SLC35E1	79939	hgsc.bcm.edu	37	19	16666010	16666010	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:16666010C>T	ENST00000595753.1	-	5	972	c.955G>A	c.(955-957)Gtc>Atc	p.V319I	CTD-3222D19.2_ENST00000409035.1_Intron|CTD-3222D19.11_ENST00000597357.1_RNA|SLC35E1_ENST00000593812.1_5'Flank	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	319					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.V175I(2)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						ATGCCCAGGACGTTGGTGCTG	0.597																																					p.V319I												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G955A	19						.						114.0	86.0	95.0					19																	16666010		2203	4300	6503	16527010	SO:0001583	missense	79939	exon5			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.955G>A	19.37:g.16666010C>T	ENSP00000470652:p.Val319Ile	Somatic		Capture	SOLID	Phase_I	16527010	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	37	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575858	0.45902	.	.	ENSG00000127526	ENST00000409648;ENST00000421082	T	0.67865	-0.29	5.32	5.32	0.75619	Domain of unknown function DUF250 (1);	0.056482	0.64402	D	0.000001	T	0.46425	0.1392	N	0.10916	0.065	0.80722	D	1	B	0.33000	0.393	B	0.22601	0.04	T	0.45804	-0.9236	10	0.27082	T	0.32	-40.5166	17.9986	0.89192	0.0:1.0:0.0:0.0	.	319	Q96K37	S35E1_HUMAN	I	319;70	ENSP00000394092:V70I	ENSP00000387152:V319I	V	-	1	0	SLC35E1	16527010	0.996000	0.38824	0.960000	0.40013	0.776000	0.43924	3.222000	0.51223	2.487000	0.83934	0.655000	0.94253	GTC		0.597	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
RAB3A	5864	hgsc.bcm.edu	37	19	18309556	18309556	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:18309556G>A	ENST00000222256.4	-	4	629	c.451C>T	c.(451-453)Cgg>Tgg	p.R151W	RAB3A_ENST00000464076.3_Missense_Mutation_p.R56W	NM_002866.4	NP_002857.1	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	151					axonogenesis (GO:0007409)|constitutive secretory pathway (GO:0045054)|glutamate secretion (GO:0014047)|GTP catabolic process (GO:0006184)|lung development (GO:0030324)|maintenance of presynaptic active zone structure (GO:0048790)|mitochondrion organization (GO:0007005)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|positive regulation of exocytosis (GO:0045921)|post-embryonic development (GO:0009791)|protein transport (GO:0015031)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|respiratory system process (GO:0003016)|response to electrical stimulus (GO:0051602)|sensory perception of touch (GO:0050975)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle recycling (GO:0036465)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.R151W(1)		NS(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	8						GCTAGCTGCCGGCCACGTTCT	0.567																																					p.R151W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C451T	19						.						122.0	95.0	104.0					19																	18309556		2203	4300	6503	18170556	SO:0001583	missense	5864	exon4				CCDS12372.1	19p13.2	2008-07-17			ENSG00000105649	ENSG00000105649		"""RAB, member RAS oncogene"""	9777	protein-coding gene	gene with protein product	"""RAS-associated protein RAB3A"""	179490				2687157, 7532276	Standard	NM_002866		Approved		uc002nie.2	P20336	OTTHUMG00000137378	ENST00000222256.4:c.451C>T	19.37:g.18309556G>A	ENSP00000222256:p.Arg151Trp	Somatic		Capture	SOLID	Phase_I	18170556	NM_002866	A8K0J4|Q9NYE1	Missense_Mutation	SNP	ENST00000222256.4	37	CCDS12372.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072069	0.55646	.	.	ENSG00000105649	ENST00000222256	T	0.78003	-1.14	5.07	5.07	0.68467	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.74038	0.3664	M	0.62088	1.915	0.80722	D	1	B	0.17038	0.02	B	0.12837	0.008	T	0.73341	-0.4013	10	0.87932	D	0	-39.2481	11.0916	0.48119	0.0:0.0:0.8148:0.1852	.	151	P20336	RAB3A_HUMAN	W	151	ENSP00000222256:R151W	ENSP00000222256:R151W	R	-	1	2	RAB3A	18170556	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	1.669000	0.37492	2.351000	0.79841	0.561000	0.74099	CGG		0.567	RAB3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268056.2	NM_002866	
TMEM161A	54929	hgsc.bcm.edu	37	19	19243550	19243550	+	Missense_Mutation	SNP	G	G	T	rs5827432		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:19243550G>T	ENST00000162044.9	-	4	266	c.202C>A	c.(202-204)Ctt>Att	p.L68I	TMEM161A_ENST00000450333.2_Missense_Mutation_p.L68I|TMEM161A_ENST00000587583.2_Missense_Mutation_p.L68I|TMEM161A_ENST00000592147.1_5'UTR	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	68					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)		p.L68I(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			TCCTCACTAAGGCCATTGGCC	0.637																																					p.L68I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C202A	19						.						72.0	48.0	56.0					19																	19243550		2203	4300	6503	19104550	SO:0001583	missense	54929	exon4			BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.202C>A	19.37:g.19243550G>T	ENSP00000162044:p.Leu68Ile	Somatic		Capture	SOLID	Phase_I	19104550	NM_017814	B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	ENST00000162044.9	37	CCDS12393.1	.	.	.	.	.	.	.	.	.	.	G	6.384	0.438949	0.12104	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	3.86	0.129	0.14739	.	1.474560	0.04117	N	0.315709	T	0.30510	0.0767	L	0.36672	1.1	0.09310	N	1	B;B;B	0.16396	0.013;0.017;0.017	B;B;B	0.19391	0.006;0.01;0.025	T	0.15549	-1.0433	9	0.18710	T	0.47	.	4.0593	0.09831	0.2432:0.37:0.3868:0.0	.	68;68;68	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	I	68	.	ENSP00000162044:L68I	L	-	1	0	TMEM161A	19104550	0.000000	0.05858	0.551000	0.28230	0.700000	0.40528	0.056000	0.14256	0.521000	0.28445	0.462000	0.41574	CTT		0.637	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460089.2	NM_017814	
PIP5K1C	23396	hgsc.bcm.edu	37	19	3661029	3661029	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:3661029T>C	ENST00000335312.3	-	5	491	c.403A>G	c.(403-405)Acc>Gcc	p.T135A	PIP5K1C_ENST00000587482.1_5'UTR|PIP5K1C_ENST00000537021.1_Missense_Mutation_p.T135A|PIP5K1C_ENST00000589578.1_Missense_Mutation_p.T135A|PIP5K1C_ENST00000539785.1_Missense_Mutation_p.T135A	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	135	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.T135A(1)		large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		GGTGCATAGGTCTTGAAGCGG	0.587																																					p.T135A	Esophageal Squamous(135;99 1744 12852 27186 39851)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A403G	19						.						145.0	137.0	139.0					19																	3661029		2203	4300	6503	3612029	SO:0001583	missense	23396	exon5			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.403A>G	19.37:g.3661029T>C	ENSP00000335333:p.Thr135Ala	Somatic		Capture	SOLID	Phase_I	3612029	NM_001195733	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	ENST00000335312.3	37	CCDS32872.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.444395	0.63178	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.29917	1.55;1.55;1.55	4.62	4.62	0.57501	Phosphatidylinositol-4-phosphate 5-kinase, core (1);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.31513	0.0799	L	0.58810	1.83	0.54753	D	0.999987	B;B	0.28082	0.2;0.127	B;B	0.25506	0.061;0.041	T	0.18493	-1.0335	10	0.66056	D	0.02	-44.9301	13.4911	0.61395	0.0:0.0:0.0:1.0	.	135;135	O60331-3;O60331	.;PI51C_HUMAN	A	135	ENSP00000335333:T135A;ENSP00000445992:T135A;ENSP00000444779:T135A	ENSP00000335333:T135A	T	-	1	0	PIP5K1C	3612029	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.938000	0.87678	1.847000	0.53656	0.459000	0.35465	ACC		0.587	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	
ZNF101	94039	hgsc.bcm.edu	37	19	19790215	19790215	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:19790215G>A	ENST00000592502.1	+	4	527	c.417G>A	c.(415-417)acG>acA	p.T139T	ZNF101_ENST00000415784.2_Silent_p.T19T|ZNF101_ENST00000444249.2_3'UTR			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T139T(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						GGAGAGAGACGCCCCGTAAAC	0.517																																					p.T139T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G417A	19						.						94.0	82.0	86.0					19																	19790215		2203	4300	6503	19651215	SO:0001819	synonymous_variant	94039	exon4			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.417G>A	19.37:g.19790215G>A		Somatic		Capture	SOLID	Phase_I	19651215	NM_033204	C9JU83|Q0VDG9	Silent	SNP	ENST00000592502.1	37	CCDS32971.1																																																																																				0.517	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460559.1	NM_033204	
UPK1A	11045	hgsc.bcm.edu	37	19	36157730	36157730	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:36157730G>A	ENST00000222275.2	+	1	16	c.16G>A	c.(16-18)Gca>Aca	p.A6T	UPK1A-AS1_ENST00000443196.1_RNA|UPK1A_ENST00000379013.2_Missense_Mutation_p.A6T|RN7SL765P_ENST00000580260.1_RNA	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	6					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)	p.A6T(1)		breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTCTGCGGCAGCAGCGGAGGC	0.622																																					p.A6T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G16A	19						.						132.0	123.0	126.0					19																	36157730		2203	4300	6503	40849570	SO:0001583	missense	11045	exon1			AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.16G>A	19.37:g.36157730G>A	ENSP00000222275:p.Ala6Thr	Somatic		Capture	SOLID	Phase_I	40849570	NM_007000	Q3KNU5|Q3KNU6	Missense_Mutation	SNP	ENST00000222275.2	37	CCDS12470.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965198	0.34659	.	.	ENSG00000105668	ENST00000222275;ENST00000379013	T;T	0.08193	3.35;3.12	4.33	-0.33	0.12683	.	0.842544	0.10347	N	0.685634	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.47661	-0.9100	10	0.10902	T	0.67	-0.0277	3.8382	0.08903	0.3188:0.182:0.4992:0.0	.	6;6	O00322-2;O00322	.;UPK1A_HUMAN	T	6	ENSP00000222275:A6T;ENSP00000368298:A6T	ENSP00000222275:A6T	A	+	1	0	UPK1A	40849570	0.038000	0.19896	0.001000	0.08648	0.007000	0.05969	2.293000	0.43558	-0.048000	0.13401	-0.844000	0.03045	GCA		0.622	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109486.3		
APLP1	333	hgsc.bcm.edu	37	19	36363492	36363492	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:36363492C>T	ENST00000221891.4	+	7	1150	c.958C>T	c.(958-960)Cgt>Tgt	p.R320C	APLP1_ENST00000537454.2_Missense_Mutation_p.R281C|APLP1_ENST00000586861.1_Missense_Mutation_p.R314C	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	320	Heparin-binding. {ECO:0000250}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.R320C(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTGGAGGAGCGTAGGATGCG	0.552																																					p.R320C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958T	19						.						121.0	118.0	119.0					19																	36363492		2203	4300	6503	41055332	SO:0001583	missense	333	exon7			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.958C>T	19.37:g.36363492C>T	ENSP00000221891:p.Arg320Cys	Somatic		Capture	SOLID	Phase_I	41055332	NM_001024807	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.824244	0.71143	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	T;T	0.46819	0.86;0.86	4.89	2.45	0.29901	Amyloidogenic glycoprotein, E2 domain (2);	0.000000	0.41500	D	0.000878	T	0.64821	0.2633	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.992;0.993;0.996;0.998	T	0.67711	-0.5600	10	0.54805	T	0.06	-9.1428	12.66	0.56809	0.3089:0.6911:0.0:0.0	.	314;281;320;320	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	C	281;320	ENSP00000441501:R281C;ENSP00000221891:R320C	ENSP00000221891:R320C	R	+	1	0	APLP1	41055332	1.000000	0.71417	0.941000	0.38009	0.991000	0.79684	2.785000	0.47782	1.024000	0.39682	0.462000	0.41574	CGT		0.552	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ZNF585A	199704	hgsc.bcm.edu	37	19	37642889	37642889	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:37642889C>T	ENST00000356958.4	-	5	2170	c.1912G>A	c.(1912-1914)Gag>Aag	p.E638K	ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.E583K|ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000292841.5_Missense_Mutation_p.E583K			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	638					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E583K(2)		breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCCCGCACTCGGCACACACA	0.498																																					p.E583K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1747A	19						.						61.0	59.0	60.0					19																	37642889		2203	4300	6503	42334729	SO:0001583	missense	199704	exon6			AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1912G>A	19.37:g.37642889C>T	ENSP00000349440:p.Glu638Lys	Somatic		Capture	SOLID	Phase_I	42334729	NM_199126	Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	37		.	.	.	.	.	.	.	.	.	.	C	15.14	2.746497	0.49257	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157	T;T;T	0.35605	1.3;1.3;1.3	3.21	2.15	0.27550	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.257891	0.21159	N	0.079196	T	0.22627	0.0546	.	.	.	0.09310	N	1	P	0.42620	0.785	B	0.36030	0.216	T	0.11397	-1.0589	9	0.52906	T	0.07	.	6.0379	0.19718	0.0:0.6948:0.192:0.1131	.	638	Q6P3V2	Z585A_HUMAN	K	638;583;583	ENSP00000349440:E638K;ENSP00000292841:E583K;ENSP00000375998:E583K	ENSP00000292841:E583K	E	-	1	0	ZNF585A	42334729	0.000000	0.05858	0.215000	0.23724	0.992000	0.81027	0.106000	0.15354	0.670000	0.31165	0.655000	0.94253	GAG		0.498	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	NM_152655	
RYR1	6261	hgsc.bcm.edu	37	19	39005696	39005696	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:39005696C>T	ENST00000359596.3	+	64	9503	c.9503C>T	c.(9502-9504)aCg>aTg	p.T3168M	RYR1_ENST00000360985.3_Missense_Mutation_p.T3168M|RYR1_ENST00000355481.4_Missense_Mutation_p.T3168M			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3168					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.T3168M(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGCTACCGAACGCTGTGCAGT	0.607											OREG0025449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T3168M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9503T	19						.						68.0	56.0	60.0					19																	39005696		2203	4300	6503	43697536	SO:0001583	missense	6261	exon64			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.9503C>T	19.37:g.39005696C>T	ENSP00000352608:p.Thr3168Met	Somatic	882	Capture	SOLID	Phase_I	43697536	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949318	0.53186	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	T;T;T	0.68903	-0.36;-0.36;-0.36	4.67	4.67	0.58626	.	0.233267	0.29948	U	0.010781	T	0.59742	0.2216	L	0.34521	1.04	0.33453	D	0.583896	D;D;D	0.59357	0.985;0.985;0.974	P;P;B	0.46629	0.522;0.522;0.323	T	0.72597	-0.4245	10	0.59425	D	0.04	.	12.2217	0.54437	0.0:0.9148:0.0:0.0852	.	3168;3168;3168	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	M	3168;3168;3168;88	ENSP00000352608:T3168M;ENSP00000347667:T3168M;ENSP00000354254:T3168M	ENSP00000347667:T3168M	T	+	2	0	RYR1	43697536	0.958000	0.32768	0.990000	0.47175	0.994000	0.84299	2.273000	0.43381	2.400000	0.81607	0.655000	0.94253	ACG		0.607	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PAPL	390928	hgsc.bcm.edu	37	19	39591240	39591240	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:39591240C>T	ENST00000331256.5	+	6	924	c.650C>T	c.(649-651)gCt>gTt	p.A217V	PAPL_ENST00000594229.1_Missense_Mutation_p.L176F	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		217						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)	p.A217V(1)									AACTACAAGGCTCGCTTCAGC	0.557																																					p.A217V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C650T	19						.						122.0	126.0	125.0					19																	39591240		2203	4300	6503	44283080	SO:0001583	missense	390928	exon6																														ENST00000331256.5:c.650C>T	19.37:g.39591240C>T	ENSP00000327557:p.Ala217Val	Somatic		Capture	SOLID	Phase_I	44283080	NM_001004318	B2RN68	Missense_Mutation	SNP	ENST00000331256.5	37	CCDS33018.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643098	0.67244	.	.	ENSG00000183760	ENST00000331256	D	0.85484	-1.99	5.24	5.24	0.73138	Metallophosphoesterase domain (1);	0.199412	0.43747	D	0.000521	D	0.87989	0.6317	M	0.63428	1.95	0.43485	D	0.995713	D	0.59357	0.985	P	0.60345	0.873	D	0.84281	0.0494	10	0.16896	T	0.51	-16.2886	11.7401	0.51788	0.1763:0.8237:0.0:0.0	.	217	Q6ZNF0	PAPL_HUMAN	V	217	ENSP00000327557:A217V	ENSP00000327557:A217V	A	+	2	0	AC011443.1	44283080	0.997000	0.39634	0.999000	0.59377	0.995000	0.86356	2.452000	0.44961	2.585000	0.87301	0.563000	0.77884	GCT		0.557	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463810.1		
SUPT5H	6829	hgsc.bcm.edu	37	19	39964737	39964737	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:39964737C>T	ENST00000599117.1	+	27	2994	c.2627C>T	c.(2626-2628)cCg>cTg	p.P876L	SUPT5H_ENST00000598725.1_Missense_Mutation_p.P876L|SUPT5H_ENST00000402194.2_Missense_Mutation_p.P872L|SUPT5H_ENST00000359191.6_Missense_Mutation_p.P872L|SUPT5H_ENST00000432763.2_Missense_Mutation_p.P876L			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	876	10 X 8 AA approximate tandem repeats of P-[TS]-P-S-P-[QA]-[SG]-Y, motif CTR2.|Pro-rich.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.P876L(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CAATACAACCCGCAGACGCCA	0.662											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P876L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2627T	19						.						82.0	88.0	86.0					19																	39964737		2203	4299	6502	44656577	SO:0001583	missense	6829	exon25			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.2627C>T	19.37:g.39964737C>T	ENSP00000470252:p.Pro876Leu	Somatic	889	Capture	SOLID	Phase_I	44656577	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324224	0.81580	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.79118	0.4392	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.995;0.997	T	0.79671	-0.1706	8	.	.	.	-9.7637	17.4052	0.87471	0.0:1.0:0.0:0.0	.	668;872;876	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	L	876;872;854;876	.	.	P	+	2	0	SUPT5H	44656577	1.000000	0.71417	0.992000	0.48379	0.676000	0.39594	7.543000	0.82106	2.409000	0.81822	0.462000	0.41574	CCG		0.662	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
EGLN2	112398	hgsc.bcm.edu	37	19	41313418	41313418	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:41313418C>A	ENST00000593726.1	+	4	2158	c.1130C>A	c.(1129-1131)gCc>gAc	p.A377D	EGLN2_ENST00000594140.1_Missense_Mutation_p.A95D|RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000303961.4_Missense_Mutation_p.A377D|EGLN2_ENST00000406058.2_Missense_Mutation_p.A377D|CTC-490E21.12_ENST00000601627.1_Intron			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	377					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.A377D(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	TATTTTGATGCCAAGGAGCGG	0.542											OREG0025478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A377D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1130A	19						.						171.0	145.0	153.0					19																	41313418		2203	4300	6503	46005258	SO:0001583	missense	112398	exon5			AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.1130C>A	19.37:g.41313418C>A	ENSP00000469686:p.Ala377Asp	Somatic	900	Capture	SOLID	Phase_I	46005258	NM_080732	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684963	0.88639	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	D;D	0.85955	-2.05;-2.05	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.90150	0.6922	L	0.61218	1.895	0.80722	D	1	D	0.65815	0.995	P	0.60117	0.869	D	0.91051	0.4878	10	0.66056	D	0.02	-12.2833	17.4723	0.87649	0.0:1.0:0.0:0.0	.	377	Q96KS0	EGLN2_HUMAN	D	377	ENSP00000307080:A377D;ENSP00000385253:A377D	ENSP00000307080:A377D	A	+	2	0	EGLN2	46005258	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.322000	0.79097	2.404000	0.81709	0.561000	0.74099	GCC		0.542	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1		
CEACAM1	634	hgsc.bcm.edu	37	19	43031393	43031393	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:43031393C>T	ENST00000161559.6	-	2	358	c.224G>A	c.(223-225)gGc>gAc	p.G75D	CEACAM1_ENST00000403461.1_Missense_Mutation_p.G75D|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000358394.3_Missense_Mutation_p.G75D|CEACAM1_ENST00000351134.3_Missense_Mutation_p.G75D|CEACAM1_ENST00000403444.3_Missense_Mutation_p.G75D|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000599389.1_Missense_Mutation_p.G75D|CEACAM1_ENST00000308072.4_Missense_Mutation_p.G35D|CEACAM1_ENST00000352591.5_Missense_Mutation_p.G75D	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	75	Ig-like V-type.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.G75D(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	TTGACGGTTGCCATCCACTCT	0.507																																					p.G75D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G224A	19						.						272.0	214.0	234.0					19																	43031393		2203	4300	6503	47723233	SO:0001583	missense	634	exon2			M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.224G>A	19.37:g.43031393C>T	ENSP00000161559:p.Gly75Asp	Somatic		Capture	SOLID	Phase_I	47723233	NM_001712	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Missense_Mutation	SNP	ENST00000161559.6	37	CCDS12609.1	.	.	.	.	.	.	.	.	.	.	c	0.044	-1.273041	0.01421	.	.	ENSG00000079385	ENST00000161559;ENST00000358394;ENST00000351134;ENST00000446434;ENST00000378065;ENST00000352591;ENST00000403444;ENST00000403461;ENST00000308072;ENST00000377806;ENST00000344391;ENST00000403136	T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	3.76	-7.51	0.01346	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.53706	0.1813	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B;B;B;B;B;B	0.27910	0.025;0.001;0.05;0.119;0.0;0.193;0.088;0.01;0.001;0.001	B;B;B;B;B;B;B;B;B;B	0.40444	0.018;0.005;0.112;0.329;0.012;0.166;0.172;0.02;0.007;0.007	T	0.58679	-0.7594	9	0.29301	T	0.29	.	11.2513	0.49028	0.0:0.3232:0.5474:0.1294	.	75;75;75;75;75;75;75;75;75;75	P13688-7;P13688-10;P13688-3;P13688-4;P13688-2;P13688-11;P13688-6;P13688-5;P13688-8;P13688	.;.;.;.;.;.;.;.;.;CEAM1_HUMAN	D	75;75;75;102;35;75;75;75;35;75;75;75	ENSP00000161559:G75D;ENSP00000351165:G75D;ENSP00000325946:G75D;ENSP00000244291:G75D;ENSP00000384709:G75D;ENSP00000384083:G75D;ENSP00000312184:G35D	ENSP00000161559:G75D	G	-	2	0	CEACAM1	47723233	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.761000	0.00189	-3.677000	0.00122	-2.700000	0.00136	GGC		0.507	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
FOSB	2354	hgsc.bcm.edu	37	19	45973893	45973893	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:45973893G>A	ENST00000353609.3	+	2	725	c.133G>A	c.(133-135)Gcc>Acc	p.A45T	FOSB_ENST00000443841.2_Intron|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000592436.1_Missense_Mutation_p.A45T|FOSB_ENST00000586615.1_5'UTR|FOSB_ENST00000590335.1_Missense_Mutation_p.A45T|FOSB_ENST00000585836.1_Intron|FOSB_ENST00000591858.1_Intron|FOSB_ENST00000592811.1_5'UTR|FOSB_ENST00000417353.2_Missense_Mutation_p.A45T	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	45					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.A45T(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		GTAGGAGTGCGCCGGTCTCGG	0.587																																					p.A45T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G133A	19						.						113.0	117.0	116.0					19																	45973893		2203	4300	6503	50665733	SO:0001583	missense	2354	exon2				CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.133G>A	19.37:g.45973893G>A	ENSP00000245919:p.Ala45Thr	Somatic		Capture	SOLID	Phase_I	50665733	NM_001114171	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Missense_Mutation	SNP	ENST00000353609.3	37	CCDS12664.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955926	0.34471	.	.	ENSG00000125740	ENST00000353609;ENST00000417353;ENST00000455928	T;T	0.39406	1.08;1.08	4.61	4.61	0.57282	.	0.126767	0.53938	D	0.000055	T	0.28067	0.0692	N	0.05199	-0.095	0.80722	D	1	P;P;D	0.64830	0.933;0.799;0.994	B;B;P	0.53035	0.388;0.129;0.716	T	0.10683	-1.0619	10	0.02654	T	1	-5.5911	12.8155	0.57663	0.0:0.0:1.0:0.0	.	45;45;45	E9PHJ3;P53539;A8VJE1	.;FOSB_HUMAN;.	T	45	ENSP00000245919:A45T;ENSP00000407207:A45T	ENSP00000245919:A45T	A	+	1	0	FOSB	50665733	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.703000	0.37846	2.405000	0.81733	0.561000	0.74099	GCC		0.587	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459561.1	NM_006732	
RSPH6A	81492	hgsc.bcm.edu	37	19	46303792	46303792	+	Missense_Mutation	SNP	G	G	A	rs368970645		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:46303792G>A	ENST00000221538.3	-	5	1970	c.1828C>T	c.(1828-1830)Cgc>Tgc	p.R610C	RSPH6A_ENST00000597055.1_Missense_Mutation_p.R610C|RSPH6A_ENST00000600188.1_Missense_Mutation_p.R346C	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	610	Glu-rich.					intracellular (GO:0005622)		p.R610C(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CAGGACAGGCGGGTGGTCCAG	0.662																																					p.R610C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1828T	19						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	50.0	46.0	47.0		1828	4.0	1.0	19		47	1,8597	1.2+/-3.3	0,1,4298	no	missense	RSPH6A	NM_030785.3	180	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	610/718	46303792	2,13002	2203	4299	6502	50995632	SO:0001583	missense	81492	exon5			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1828C>T	19.37:g.46303792G>A	ENSP00000221538:p.Arg610Cys	Somatic		Capture	SOLID	Phase_I	50995632	NM_030785	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	37	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620753	0.46736	2.27E-4	1.16E-4	ENSG00000104941	ENST00000221538	T	0.22336	1.96	5.03	4.0	0.46444	.	0.729939	0.13936	N	0.352549	T	0.44371	0.1290	M	0.78049	2.395	0.42219	D	0.991846	D	0.89917	1.0	D	0.69307	0.963	T	0.38436	-0.9661	10	0.66056	D	0.02	-16.4794	9.4544	0.38745	0.0959:0.0:0.9041:0.0	.	610	Q9H0K4	RSH6A_HUMAN	C	610	ENSP00000221538:R610C	ENSP00000221538:R610C	R	-	1	0	RSPH6A	50995632	0.998000	0.40836	0.988000	0.46212	0.098000	0.18820	6.028000	0.70889	1.514000	0.48869	0.555000	0.69702	CGC		0.662	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
PRKD2	25865	hgsc.bcm.edu	37	19	47207569	47207569	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:47207569C>T	ENST00000291281.4	-	5	971	c.746G>A	c.(745-747)cGc>cAc	p.R249H	PRKD2_ENST00000595515.1_Missense_Mutation_p.R249H|PRKD2_ENST00000600194.1_Missense_Mutation_p.R92H|PRKD2_ENST00000433867.1_Missense_Mutation_p.R249H|PRKD2_ENST00000601806.1_Missense_Mutation_p.R92H			Q9BZL6	KPCD2_HUMAN	protein kinase D2	249					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.R249H(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CTCAATGGGGCGGCCCGTATA	0.597											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R249H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G746A	19						.						189.0	160.0	170.0					19																	47207569		2203	4300	6503	51899409	SO:0001583	missense	25865	exon6			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.746G>A	19.37:g.47207569C>T	ENSP00000291281:p.Arg249His	Somatic	945	Capture	SOLID	Phase_I	51899409	NM_001079881	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	33	5.253857	0.95336	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.69685	-0.42;-0.42	5.18	5.18	0.71444	.	0.086033	0.47093	D	0.000247	T	0.78830	0.4345	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	P;P	0.62885	0.908;0.908	T	0.80783	-0.1228	10	0.72032	D	0.01	-46.2965	17.8348	0.88693	0.0:1.0:0.0:0.0	.	249;249	E7ER94;Q9BZL6	.;KPCD2_HUMAN	H	249	ENSP00000291281:R249H;ENSP00000393978:R249H	ENSP00000291281:R249H	R	-	2	0	PRKD2	51899409	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	7.426000	0.80270	2.579000	0.87056	0.448000	0.29417	CGC		0.597	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
PPP1R15A	23645	hgsc.bcm.edu	37	19	49378018	49378018	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:49378018G>A	ENST00000200453.5	+	2	1797	c.1528G>A	c.(1528-1530)Gcc>Acc	p.A510T		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	510	4 X 34 AA approximate repeats.|Interaction with KMT2A/MLL1.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)	p.A510T(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CTTCCGAGTGGCCATCTATGT	0.622																																					p.A510T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1528A	19						.						57.0	54.0	55.0					19																	49378018		2203	4300	6503	54069830	SO:0001583	missense	23645	exon2			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1528G>A	19.37:g.49378018G>A	ENSP00000200453:p.Ala510Thr	Somatic		Capture	SOLID	Phase_I	54069830	NM_014330	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	ENST00000200453.5	37	CCDS12738.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143581	0.77888	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.11169	2.8	4.43	3.39	0.38822	.	0.347798	0.23204	N	0.050744	T	0.09512	0.0234	L	0.41824	1.3	0.35685	D	0.814386	P	0.48503	0.911	B	0.42282	0.382	T	0.32428	-0.9907	10	0.30854	T	0.27	-13.2136	9.0217	0.36204	0.1054:0.0:0.8945:0.0	.	510	O75807	PR15A_HUMAN	T	510;350;468	ENSP00000200453:A510T	ENSP00000200453:A510T	A	+	1	0	PPP1R15A	54069830	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.118000	0.41949	1.186000	0.42985	-0.145000	0.13849	GCC		0.622	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
VRK3	51231	hgsc.bcm.edu	37	19	50498493	50498493	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:50498493G>A	ENST00000599538.1	-	8	1383	c.719C>T	c.(718-720)gCc>gTc	p.A240V	VRK3_ENST00000593919.1_Missense_Mutation_p.A240V|VRK3_ENST00000316763.3_Missense_Mutation_p.A240V|VRK3_ENST00000424804.2_5'UTR|VRK3_ENST00000601912.1_Missense_Mutation_p.A190V|VRK3_ENST00000594092.1_Missense_Mutation_p.A240V|VRK3_ENST00000443401.2_Intron|VRK3_ENST00000594948.1_Missense_Mutation_p.A240V|VRK3_ENST00000377011.2_Missense_Mutation_p.A190V|VRK3_ENST00000601341.1_Missense_Mutation_p.A190V			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.A240V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GGTAGGGATGGCCAGCAGTGG	0.557																																					p.A190V	Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C569T	19						.						125.0	93.0	104.0					19																	50498493		2203	4300	6503	55190305	SO:0001583	missense	51231	exon7			AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.719C>T	19.37:g.50498493G>A	ENSP00000469880:p.Ala240Val	Somatic		Capture	SOLID	Phase_I	55190305	NM_001025778	A6NEG5|A8KA53|Q502Y2|Q9P2V8	Missense_Mutation	SNP	ENST00000599538.1	37	CCDS12791.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.35|17.35	3.366322|3.366322	0.61513|0.61513	.|.	.|.	ENSG00000105053|ENSG00000105053	ENST00000316763;ENST00000377011|ENST00000424804	T;T|.	0.19669|.	2.13;2.13|.	5.32|5.32	5.32|5.32	0.75619|0.75619	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.051490|.	0.85682|.	D|.	0.000000|.	T|T	0.48352|0.48352	0.1495|0.1495	L|L	0.49350|0.49350	1.555|1.555	0.28485|0.28485	N|N	0.91477|0.91477	D;D;D|D	0.89917|0.59767	1.0;1.0;1.0|0.986	D;D;D|P	0.78314|0.51582	0.985;0.987;0.991|0.674	T|T	0.46317|0.46317	-0.9200|-0.9200	10|8	0.72032|0.59425	D|D	0.01|0.04	-29.9162|-29.9162	12.4194|12.4194	0.55512|0.55512	0.0:0.1685:0.8315:0.0|0.0:0.1685:0.8315:0.0	.|.	240;190;240|218	Q8IV63-2;A6NEG5;Q8IV63|E7EMG6	.;.;VRK3_HUMAN|.	V|S	240;190|218	ENSP00000324636:A240V;ENSP00000366210:A190V|.	ENSP00000324636:A240V|ENSP00000402958:P218S	A|P	-|-	2|1	0|0	VRK3|VRK3	55190305|55190305	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.193000|0.193000	0.23685|0.23685	4.504000|4.504000	0.60414|0.60414	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|CCA		0.557	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464815.1	NM_016440	
ZNF528	84436	hgsc.bcm.edu	37	19	52918504	52918504	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:52918504G>A	ENST00000360465.3	+	7	825	c.399G>A	c.(397-399)aaG>aaA	p.K133K	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	133					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K133K(1)		breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		CTGGGTGTAAGCATTTTGAAA	0.343																																					p.K133K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G399A	19						.						45.0	46.0	46.0					19																	52918504		2203	4300	6503	57610316	SO:0001819	synonymous_variant	84436	exon7			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.399G>A	19.37:g.52918504G>A		Somatic		Capture	SOLID	Phase_I	57610316	NM_032423	B3KPN4|Q86T88|Q96JK0	Silent	SNP	ENST00000360465.3	37	CCDS33091.1																																																																																				0.343	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
ZNF83	55769	hgsc.bcm.edu	37	19	53116412	53116412	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:53116412C>T	ENST00000597597.1	-	2	3659	c.1406G>A	c.(1405-1407)cGt>cAt	p.R469H	ZNF83_ENST00000391789.4_Missense_Mutation_p.R441H|ZNF83_ENST00000536937.1_Missense_Mutation_p.R469H|ZNF83_ENST00000301096.3_Missense_Mutation_p.R469H|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000541777.2_Missense_Mutation_p.R469H|ZNF83_ENST00000545872.1_Missense_Mutation_p.R469H|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000544146.1_Missense_Mutation_p.R469H			P51522	ZNF83_HUMAN	zinc finger protein 83	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R469H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		GAGGCTTGAACGCATACTAAA	0.403																																					p.R469H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1406A	19						.						141.0	131.0	134.0					19																	53116412		2203	4300	6503	57808224	SO:0001583	missense	55769	exon4			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.1406G>A	19.37:g.53116412C>T	ENSP00000472619:p.Arg469His	Somatic		Capture	SOLID	Phase_I	57808224	NM_001105552	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	37	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	-	0.454	-0.892439	0.02491	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57	1.97	-2.12	0.07165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14830	0.0358	L	0.45228	1.405	0.09310	N	1	B;P	0.48294	0.002;0.908	B;B	0.31614	0.0;0.133	T	0.24476	-1.0159	9	0.21014	T	0.42	.	3.9996	0.09574	0.0:0.4418:0.1819:0.3763	.	441;469	P51522-2;P51522	.;ZNF83_HUMAN	H	469;469;469;441;469;469;441	ENSP00000445993:R469H;ENSP00000301096:R469H;ENSP00000445470:R469H;ENSP00000440713:R469H;ENSP00000439681:R469H;ENSP00000375666:R441H	ENSP00000301096:R469H	R	-	2	0	ZNF83	57808224	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.758000	0.00787	-0.660000	0.05352	-1.299000	0.01334	CGT		0.403	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
ZNF28	7576	hgsc.bcm.edu	37	19	53303463	53303463	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:53303463A>G	ENST00000457749.2	-	4	1754	c.1635T>C	c.(1633-1635)caT>caC	p.H545H	ZNF28_ENST00000414252.2_Silent_p.H492H|ZNF28_ENST00000360272.4_Silent_p.H492H|ZNF28_ENST00000438150.2_Silent_p.H492H	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H492H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TCTCTGCAGTATGAAGTTTAT	0.383																																					p.H545H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1635C	19						.						96.0	90.0	92.0					19																	53303463		2203	4300	6503	57995275	SO:0001819	synonymous_variant	7576	exon4			X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1635T>C	19.37:g.53303463A>G		Somatic		Capture	SOLID	Phase_I	57995275	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Silent	SNP	ENST00000457749.2	37	CCDS33093.2																																																																																				0.383	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF331	55422	hgsc.bcm.edu	37	19	54080795	54080795	+	Silent	SNP	C	C	T	rs149071213	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:54080795C>T	ENST00000253144.9	+	7	2314	c.981C>T	c.(979-981)caC>caT	p.H327H	ZNF331_ENST00000512387.1_Silent_p.H327H|ZNF331_ENST00000513265.1_3'UTR|ZNF331_ENST00000411977.2_Silent_p.H327H|ZNF331_ENST00000511154.1_Silent_p.H327H|ZNF331_ENST00000513999.1_Silent_p.H327H|ZNF331_ENST00000449416.1_Silent_p.H327H|ZNF331_ENST00000511593.2_Silent_p.H327H	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.H327H(1)		NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		AGAAGCCTCACGAATGTAAGG	0.507			T	?	follicular thyroid adenoma								C|||	3	0.000599042	0.0023	0.0	5008	,	,		20436	0.0		0.0	False		,,,				2504	0.0				p.H327H			Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C981T	19						.	C	,,	17,4389	26.2+/-53.5	0,17,2186	94.0	83.0	87.0		981,981,981	-4.0	0.7	19	dbSNP_134	87	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF331	NM_001079906.1,NM_001079907.1,NM_018555.5	,,	0,17,6486	TT,TC,CC		0.0,0.3858,0.1307	,,	327/464,327/464,327/464	54080795	17,12989	2203	4300	6503	58772607	SO:0001819	synonymous_variant	55422	exon6			AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.981C>T	19.37:g.54080795C>T		Somatic		Capture	SOLID	Phase_I	58772607	NM_001079906	Q96GJ4	Silent	SNP	ENST00000253144.9	37	CCDS33102.1																																																																																				0.507	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371366.1	NM_018555	
KIR3DL3	115653	hgsc.bcm.edu	37	19	55239238	55239238	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:55239238G>A	ENST00000291860.1	+	4	535	c.517G>A	c.(517-519)Gat>Aat	p.D173N	CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	173	Ig-like C2-type 2. {ECO:0000305}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D173N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		ACAGCTCCACGATGCGGGTTC	0.547																																					p.D173N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G517A	19						.						115.0	95.0	102.0					19																	55239238		1981	3451	5432	59931050	SO:0001583	missense	115653	exon4			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.517G>A	19.37:g.55239238G>A	ENSP00000291860:p.Asp173Asn	Somatic		Capture	SOLID	Phase_I	59931050	NM_153443	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	ENST00000291860.1	37	CCDS12903.1	.	.	.	.	.	.	.	.	.	.	N	3.357	-0.131289	0.06753	.	.	ENSG00000242019	ENST00000291860	T	0.00711	5.8	1.38	-2.75	0.05914	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	4.457220	0.01305	U	0.010402	T	0.02047	0.0064	L	0.46670	1.46	0.09310	N	1	D	0.76494	0.999	D	0.66351	0.943	T	0.38200	-0.9672	10	0.62326	D	0.03	.	0.474	0.00536	0.1776:0.1905:0.2705:0.3614	.	173	Q8N743	KI3L3_HUMAN	N	173	ENSP00000291860:D173N	ENSP00000291860:D173N	D	+	1	0	KIR3DL3	59931050	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.333000	0.07894	-2.066000	0.00886	0.205000	0.17691	GAT		0.547	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443	
NLRP9	338321	hgsc.bcm.edu	37	19	56244542	56244542	+	Nonsense_Mutation	SNP	G	G	A	rs557573298		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:56244542G>A	ENST00000332836.2	-	2	682	c.655C>T	c.(655-657)Cag>Tag	p.Q219*		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	219	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.Q219*(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CTCTCTGGCTGGGAAAAAATG	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		19547	0.0		0.001	False		,,,				2504	0.0				p.Q219X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C655T	19						.						31.0	32.0	32.0					19																	56244542		2203	4300	6503	60936354	SO:0001587	stop_gained	338321	exon2			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.655C>T	19.37:g.56244542G>A	ENSP00000331857:p.Gln219*	Somatic		Capture	SOLID	Phase_I	60936354	NM_176820	B2RN12|Q86W27	Nonsense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735223	0.48939	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	.	.	.	2.46	0.167	0.15006	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	5.7951	0.18381	0.0:0.4118:0.3783:0.2098	.	.	.	.	X	219	.	ENSP00000331857:Q219X	Q	-	1	0	NLRP9	60936354	0.000000	0.05858	0.052000	0.19188	0.005000	0.04900	-0.104000	0.10923	0.143000	0.18926	-0.138000	0.14375	CAG		0.483	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
NLRP4	147945	hgsc.bcm.edu	37	19	56372790	56372790	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:56372790C>T	ENST00000301295.6	+	4	2317	c.1895C>T	c.(1894-1896)tCt>tTt	p.S632F	NLRP4_ENST00000346986.5_Missense_Mutation_p.S632F|NLRP4_ENST00000587891.1_Missense_Mutation_p.S557F	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	632					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.S632F(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CACATCTGCTCTGTGCTCACC	0.577																																					p.S632F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1895T	19						.						117.0	93.0	101.0					19																	56372790		2203	4300	6503	61064602	SO:0001583	missense	147945	exon4			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1895C>T	19.37:g.56372790C>T	ENSP00000301295:p.Ser632Phe	Somatic		Capture	SOLID	Phase_I	61064602	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731562	0.30684	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.90788	-2.73;-2.73	4.49	2.33	0.28932	.	.	.	.	.	D	0.92996	0.7771	M	0.65677	2.01	0.31278	N	0.690925	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.99;1.0;0.999	D	0.88567	0.3127	9	0.49607	T	0.09	.	6.2509	0.20845	0.0:0.711:0.1879:0.1011	.	632;557;632	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	F	632	ENSP00000301295:S632F;ENSP00000344787:S632F	ENSP00000301295:S632F	S	+	2	0	NLRP4	61064602	0.088000	0.21588	0.534000	0.28014	0.005000	0.04900	0.893000	0.28336	0.620000	0.30215	-0.878000	0.02970	TCT		0.577	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
NLRP13	126204	hgsc.bcm.edu	37	19	56422071	56422071	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:56422071C>T	ENST00000342929.3	-	6	2139	c.2140G>A	c.(2140-2142)Gca>Aca	p.A714T	NLRP13_ENST00000588751.1_Missense_Mutation_p.A714T	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	714							ATP binding (GO:0005524)	p.A714T(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CTGTTCCATGCGTGCATCCTG	0.463																																					p.A714T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2140A	19						.						173.0	150.0	158.0					19																	56422071		2203	4300	6503	61113883	SO:0001583	missense	126204	exon6			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2140G>A	19.37:g.56422071C>T	ENSP00000343891:p.Ala714Thr	Somatic		Capture	SOLID	Phase_I	61113883	NM_176810	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	C	3.314	-0.140130	0.06669	.	.	ENSG00000173572	ENST00000342929	D	0.89617	-2.54	1.9	-0.53	0.11898	.	.	.	.	.	T	0.68403	0.2997	N	0.12746	0.255	0.09310	N	1	P	0.42584	0.784	B	0.27076	0.076	T	0.62397	-0.6863	9	0.23302	T	0.38	.	3.9599	0.09405	0.0:0.2736:0.466:0.2603	.	714	Q86W25	NAL13_HUMAN	T	714	ENSP00000343891:A714T	ENSP00000343891:A714T	A	-	1	0	NLRP13	61113883	0.021000	0.18746	0.001000	0.08648	0.000000	0.00434	0.652000	0.24888	-0.038000	0.13624	-1.238000	0.01547	GCA		0.463	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
NLRP8	126205	hgsc.bcm.edu	37	19	56466996	56466996	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:56466996A>G	ENST00000291971.3	+	3	1643	c.1572A>G	c.(1570-1572)ccA>ccG	p.P524P	NLRP8_ENST00000590542.1_Silent_p.P524P	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	524	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.P524P(2)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCTGTTTCCCACAAAGACTCA	0.438																																					p.P524P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1572G	19						.						154.0	153.0	153.0					19																	56466996		2203	4300	6503	61158808	SO:0001819	synonymous_variant	126205	exon3			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1572A>G	19.37:g.56466996A>G		Somatic		Capture	SOLID	Phase_I	61158808	NM_176811	Q7RTR4	Silent	SNP	ENST00000291971.3	37	CCDS12937.1																																																																																				0.438	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
MISP	126353	hgsc.bcm.edu	37	19	758324	758324	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:758324T>A	ENST00000215582.6	+	2	1481	c.1378T>A	c.(1378-1380)Tca>Aca	p.S460T		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	460					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.S460T(1)									GGCTGCGACTTCACCAAAGGC	0.622																																					p.S460T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1378A	19						.						50.0	42.0	44.0					19																	758324		2203	4300	6503	709324	SO:0001583	missense	126353	exon2			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1378T>A	19.37:g.758324T>A	ENSP00000215582:p.Ser460Thr	Somatic		Capture	SOLID	Phase_I	709324	NM_173481		Missense_Mutation	SNP	ENST00000215582.6	37	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	T	4.808	0.150318	0.09185	.	.	ENSG00000099812	ENST00000215582	T	0.33216	1.42	3.37	-0.0175	0.13967	.	5.344990	0.00890	N	0.002221	T	0.16854	0.0405	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.14578	0.011	T	0.09037	-1.0693	10	0.08599	T	0.76	-1.6063	2.1433	0.03780	0.2305:0.271:0.0:0.4985	.	460	Q8IVT2	CS021_HUMAN	T	460	ENSP00000215582:S460T	ENSP00000215582:S460T	S	+	1	0	C19orf21	709324	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.076000	0.11412	0.024000	0.15214	-0.723000	0.03601	TCA		0.622	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
ZNF57	126295	hgsc.bcm.edu	37	19	2916945	2916948	+	Frame_Shift_Del	DEL	GTAC	GTAC	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	GTAC	GTAC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:2916945_2916948delGTAC	ENST00000306908.5	+	4	474_477	c.326_329delGTAC	c.(325-330)tgtacafs	p.CT109fs	ZNF57_ENST00000523428.1_Frame_Shift_Del_p.CT77fs|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C109fs*106(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		GACAGATTCTGTACACATAATGAA	0.343																																					p.109_110del	NSCLC(150;910 1964 4303 10464 26498)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.326_329del	19						.																																			2867948	SO:0001589	frameshift_variant	126295	exon4			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.326_329delGTAC	19.37:g.2916945_2916948delGTAC	ENSP00000303696:p.Cys109fs	Somatic		Capture	SOLID	Phase_I	2867945	NM_173480	Q8N6R9	Frame_Shift_Del	DEL	ENST00000306908.5	37	CCDS12098.1																																																																																				0.343	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
VAV1	7409	hgsc.bcm.edu	37	19	6857116	6857116	+	Nonstop_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:6857116T>C	ENST00000602142.1	+	27	2618	c.2536T>C	c.(2536-2538)Tga>Cga	p.*846R	VAV1_ENST00000304076.2_Nonstop_Mutation_p.*824R|VAV1_ENST00000599806.1_Nonstop_Mutation_p.*791R|VAV1_ENST00000539284.1_Nonstop_Mutation_p.*749R|VAV1_ENST00000596764.1_Nonstop_Mutation_p.*814R	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	0					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.*846R(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						TGAATACTGCTGAGCCCTGGT	0.597																																					p.X846R												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T2536C	19						.						145.0	110.0	122.0					19																	6857116		2203	4300	6503	6808116	SO:0001578	stop_lost	7409	exon27				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.2536T>C	19.37:g.6857116T>C	ENSP00000472929:p.*846Argext*?	Somatic		Capture	SOLID	Phase_I	6808116	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	t	15.56	2.870891	0.51695	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	.	.	.	3.76	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5057	0.44832	0.0:0.0:0.0:1.0	.	.	.	.	R	846;749	.	.	X	+	1	0	VAV1	6808116	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	6.515000	0.73751	1.595000	0.50050	0.443000	0.29094	TGA		0.597	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
LRRC8E	80131	hgsc.bcm.edu	37	19	7964497	7964497	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:7964497G>A	ENST00000306708.6	+	3	1191	c.1090G>A	c.(1090-1092)Gcc>Acc	p.A364T	RN7SL115P_ENST00000392196.5_RNA|AC010336.1_ENST00000539278.1_3'UTR	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	364					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A364T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						GAATGACTTCGCCTTCATGCT	0.577																																					p.A364T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1090A	19						.						106.0	79.0	88.0					19																	7964497		2203	4300	6503	7870497	SO:0001583	missense	80131	exon3				CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.1090G>A	19.37:g.7964497G>A	ENSP00000306524:p.Ala364Thr	Somatic		Capture	SOLID	Phase_I	7870497	NM_025061	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Missense_Mutation	SNP	ENST00000306708.6	37	CCDS12189.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240763	0.79912	.	.	ENSG00000171017	ENST00000306708	T	0.28069	1.63	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.59183	0.2175	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64943	-0.6288	10	0.72032	D	0.01	.	15.601	0.76626	0.0:0.0:1.0:0.0	.	364	Q6NSJ5	LRC8E_HUMAN	T	364	ENSP00000306524:A364T	ENSP00000306524:A364T	A	+	1	0	LRRC8E	7870497	1.000000	0.71417	0.984000	0.44739	0.774000	0.43823	9.650000	0.98490	2.546000	0.85860	0.555000	0.69702	GCC		0.577	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061	
ZNF560	147741	hgsc.bcm.edu	37	19	9584952	9584952	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:9584952C>T	ENST00000301480.4	-	4	293	c.80G>A	c.(79-81)tGg>tAg	p.W27*		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	27	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W27*(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						CAGTAAAATCCACTCCTCCTG	0.433																																					p.W27X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G80A	19						.						132.0	125.0	127.0					19																	9584952		2203	4300	6503	9445952	SO:0001587	stop_gained	147741	exon4			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.80G>A	19.37:g.9584952C>T	ENSP00000301480:p.Trp27*	Somatic		Capture	SOLID	Phase_I	9445952	NM_152476	Q495S9|Q495T1	Nonsense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.797384	0.50208	.	.	ENSG00000198028	ENST00000301480	.	.	.	1.85	0.793	0.18632	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.1397	0.10188	0.0:0.7837:0.0:0.2163	.	.	.	.	X	27	.	ENSP00000301480:W27X	W	-	2	0	ZNF560	9445952	0.078000	0.21339	0.007000	0.13788	0.050000	0.14768	1.386000	0.34419	0.349000	0.23975	0.455000	0.32223	TGG		0.433	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
ZNF549	256051	hgsc.bcm.edu	37	19	58048914	58048914	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr19:58048914T>G	ENST00000376233.3	+	4	723	c.542T>G	c.(541-543)cTt>cGt	p.L181R	ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000240719.3_Missense_Mutation_p.L168R	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L168R(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCAGACAATCTTTTCCCATGC	0.483																																					p.L181R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T542G	19						.						59.0	58.0	58.0					19																	58048914		2203	4300	6503	62740726	SO:0001583	missense	256051	exon4			AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.542T>G	19.37:g.58048914T>G	ENSP00000365407:p.Leu181Arg	Somatic		Capture	SOLID	Phase_I	62740726	NM_001199295	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	ENST00000376233.3	37	CCDS56106.1	.	.	.	.	.	.	.	.	.	.	T	5.645	0.303686	0.10678	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.06294	3.34;3.32	2.76	-2.33	0.06724	.	.	.	.	.	T	0.07098	0.0180	N	0.21194	0.64	0.09310	N	1	B;D	0.56968	0.022;0.978	B;P	0.58013	0.01;0.831	T	0.23119	-1.0197	9	0.66056	D	0.02	.	0.6448	0.00816	0.1693:0.2366:0.1724:0.4216	.	181;168	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	R	168;181	ENSP00000240719:L168R;ENSP00000365407:L181R	ENSP00000240719:L168R	L	+	2	0	ZNF549	62740726	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.933000	0.03959	-0.476000	0.06842	-0.336000	0.08194	CTT		0.483	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	
CSMD3	114788	hgsc.bcm.edu	37	8	113317111	113317111	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:113317111A>T	ENST00000297405.5	-	52	8349	c.8105T>A	c.(8104-8106)tTg>tAg	p.L2702*	CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.L2662*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.L2632*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2702	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L2702*(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCATGTTCCAAGATAAAGGA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.L2702X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T8105A	8						.						78.0	66.0	70.0					8																	113317111		2203	4300	6503	113386287	SO:0001587	stop_gained	114788	exon52			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8105T>A	8.37:g.113317111A>T	ENSP00000297405:p.Leu2702*	Somatic		Capture	SOLID	Phase_I	113386287	NM_198123	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	50	16.633187	0.99868	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000352409	.	.	.	5.18	5.18	0.71444	.	0.000000	0.51477	D	0.000097	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	15.3362	0.74255	1.0:0.0:0.0:0.0	.	.	.	.	X	2662;2702;1972;2632	.	ENSP00000297405:L2702X	L	-	2	0	CSMD3	113386287	1.000000	0.71417	0.977000	0.42913	0.997000	0.91878	7.493000	0.81493	2.060000	0.61445	0.533000	0.62120	TTG		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu	37	8	113516097	113516097	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:113516097T>C	ENST00000297405.5	-	30	5249	c.5005A>G	c.(5005-5007)Agc>Ggc	p.S1669G	CSMD3_ENST00000455883.2_Missense_Mutation_p.S1565G|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1629G|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1669G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1669	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1669G(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTTGAGCTGCTTTCTATTCTC	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1669G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5005G	8						.						175.0	160.0	165.0					8																	113516097		2203	4300	6503	113585273	SO:0001583	missense	114788	exon30			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5005A>G	8.37:g.113516097T>C	ENSP00000297405:p.Ser1669Gly	Somatic		Capture	SOLID	Phase_I	113585273	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.592305	0.86953	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.08	5.08	0.68730	CUB (5);	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	M	0.90145	3.09	0.40089	D	0.976239	D;D;D	0.71674	0.995;0.996;0.998	P;P;D	0.69307	0.851;0.908;0.963	T	0.71374	-0.4612	10	0.59425	D	0.04	.	15.0111	0.71550	0.0:0.0:0.0:1.0	.	1565;1669;1629	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	G	1629;1669;1009;1565;1669	ENSP00000345799:S1629G;ENSP00000297405:S1669G;ENSP00000341558:S1009G;ENSP00000412263:S1565G;ENSP00000343124:S1669G	ENSP00000297405:S1669G	S	-	1	0	CSMD3	113585273	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.774000	0.85478	2.123000	0.65237	0.528000	0.53228	AGC		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu	37	8	113694818	113694818	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:113694818G>A	ENST00000297405.5	-	16	2774	c.2530C>T	c.(2530-2532)Cgg>Tgg	p.R844W	CSMD3_ENST00000455883.2_Missense_Mutation_p.R740W|CSMD3_ENST00000343508.3_Missense_Mutation_p.R804W|CSMD3_ENST00000352409.3_Missense_Mutation_p.R844W	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	844	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R844W(2)|p.R804W(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCAAACCGCCGTGCATTGATT	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.R844W												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.C2530T	8						.						99.0	98.0	99.0					8																	113694818		2203	4300	6503	113763994	SO:0001583	missense	114788	exon16			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2530C>T	8.37:g.113694818G>A	ENSP00000297405:p.Arg844Trp	Somatic		Capture	SOLID	Phase_I	113763994	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365030	0.61513	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16	5.58	2.68	0.31781	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000007	T	0.74824	0.3767	M	0.65320	2	0.35099	D	0.765076	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.99;0.994;0.994	T	0.79804	-0.1649	10	0.45353	T	0.12	.	14.6998	0.69147	0.0:0.0:0.5806:0.4194	.	740;844;804	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	W	804;844;184;740;844	ENSP00000345799:R804W;ENSP00000297405:R844W;ENSP00000341558:R184W;ENSP00000412263:R740W;ENSP00000343124:R844W	ENSP00000297405:R844W	R	-	1	2	CSMD3	113763994	1.000000	0.71417	0.954000	0.39281	0.993000	0.82548	2.219000	0.42899	0.242000	0.21303	-0.284000	0.09977	CGG		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MTMR7	9108	hgsc.bcm.edu	37	8	17206548	17206548	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:17206548C>T	ENST00000180173.5	-	5	545	c.511G>A	c.(511-513)Gcc>Acc	p.A171T	MTMR7_ENST00000523571.1_5'UTR|MTMR7_ENST00000521857.1_Missense_Mutation_p.A171T	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	171	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)	p.A171T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		TGTGCCGTGGCCGATTTGGGA	0.458																																					p.A171T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G511A	8						.						128.0	122.0	124.0					8																	17206548		2203	4300	6503	17250919	SO:0001583	missense	9108	exon5			AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.511G>A	8.37:g.17206548C>T	ENSP00000180173:p.Ala171Thr	Somatic		Capture	SOLID	Phase_I	17250919	NM_004686	A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782109	0.90282	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.92595	-3.07;-3.07	5.24	4.29	0.51040	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.047943	0.85682	D	0.000000	D	0.94578	0.8253	M	0.80746	2.51	0.80722	D	1	P	0.38617	0.64	P	0.51266	0.664	D	0.93638	0.6962	10	0.41790	T	0.15	.	15.4167	0.74974	0.1398:0.8602:0.0:0.0	.	171	Q9Y216	MTMR7_HUMAN	T	171	ENSP00000180173:A171T;ENSP00000429733:A171T	ENSP00000180173:A171T	A	-	1	0	MTMR7	17250919	1.000000	0.71417	0.950000	0.38849	0.748000	0.42578	5.571000	0.67404	2.828000	0.97474	0.655000	0.94253	GCC		0.458	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686	
CDCA2	157313	hgsc.bcm.edu	37	8	25317975	25317975	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:25317975G>A	ENST00000330560.3	+	3	614	c.137G>A	c.(136-138)tGc>tAc	p.C46Y	KCTD9_ENST00000518067.1_5'Flank|CDCA2_ENST00000380665.3_Missense_Mutation_p.C31Y|KCTD9_ENST00000221200.4_5'Flank	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	46					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.C46Y(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		CCTAATCCTTGCACACCAGAT	0.428																																					p.C46Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G137A	8						.						204.0	200.0	201.0					8																	25317975		2203	4300	6503	25373892	SO:0001583	missense	157313	exon3			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.137G>A	8.37:g.25317975G>A	ENSP00000328228:p.Cys46Tyr	Somatic		Capture	SOLID	Phase_I	25373892	NM_152562	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	ENST00000330560.3	37	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	G	7.939	0.742404	0.15642	.	.	ENSG00000184661	ENST00000330560;ENST00000380665;ENST00000435898	T;T	0.33654	1.4;1.4	4.67	2.83	0.33086	.	0.296027	0.28209	N	0.016190	T	0.28732	0.0712	L	0.45581	1.43	0.09310	N	1	B;B;B	0.24882	0.113;0.113;0.113	B;B;B	0.29176	0.06;0.099;0.099	T	0.14615	-1.0466	10	0.27785	T	0.31	-0.467	7.4333	0.27141	0.2044:0.0:0.7956:0.0	.	46;31;46	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	Y	46;31;46	ENSP00000328228:C46Y;ENSP00000370040:C31Y	ENSP00000328228:C46Y	C	+	2	0	CDCA2	25373892	0.006000	0.16342	0.024000	0.17045	0.032000	0.12392	0.919000	0.28692	1.176000	0.42840	0.555000	0.69702	TGC		0.428	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562	
ELP3	55140	hgsc.bcm.edu	37	8	27970591	27970591	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:27970591C>T	ENST00000256398.8	+	7	895	c.518C>T	c.(517-519)aCg>aTg	p.T173M	ELP3_ENST00000537665.1_Missense_Mutation_p.T54M|ELP3_ENST00000380353.4_Missense_Mutation_p.T81M|ELP3_ENST00000521015.1_Missense_Mutation_p.T159M|ELP3_ENST00000523760.1_3'UTR|ELP3_ENST00000542181.1_Missense_Mutation_p.T44M|ELP3_ENST00000524103.1_Missense_Mutation_p.T101M	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3	173					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)	p.T173M(1)		kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		ATGGGTGGAACGTTTATGGCC	0.353																																					p.T173M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C518T	8						.						174.0	168.0	170.0					8																	27970591		2203	4300	6503	28026510	SO:0001583	missense	55140	exon7				CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.518C>T	8.37:g.27970591C>T	ENSP00000256398:p.Thr173Met	Somatic		Capture	SOLID	Phase_I	28026510	NM_018091	B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Missense_Mutation	SNP	ENST00000256398.8	37	CCDS6065.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037508	0.93630	.	.	ENSG00000134014	ENST00000521015;ENST00000521570;ENST00000256398;ENST00000542181;ENST00000524103;ENST00000524024;ENST00000537665;ENST00000380353	T;T;T;T;T;T	0.81163	-1.46;-1.46;1.37;-1.46;1.37;-1.46	5.93	5.93	0.95920	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	D	0.94178	0.8132	H	0.98525	4.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.95905	0.8918	10	0.87932	D	0	-16.5698	17.8306	0.88682	0.0:1.0:0.0:0.0	.	54;173	B4DE19;Q9H9T3	.;ELP3_HUMAN	M	159;159;173;44;101;116;54;81	ENSP00000428449:T159M;ENSP00000256398:T173M;ENSP00000439242:T44M;ENSP00000429180:T101M;ENSP00000445558:T54M;ENSP00000369711:T81M	ENSP00000256398:T173M	T	+	2	0	ELP3	28026510	1.000000	0.71417	0.979000	0.43373	0.996000	0.88848	7.322000	0.79097	2.805000	0.96524	0.655000	0.94253	ACG		0.353	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219963.2	NM_018091	
NRG1	3084	hgsc.bcm.edu	37	8	32621621	32621621	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:32621621G>A	ENST00000405005.3	+	12	1624	c.1624G>A	c.(1624-1626)Gcc>Acc	p.A542T	NRG1_ENST00000539990.1_Missense_Mutation_p.A385T|NRG1_ENST00000356819.4_Missense_Mutation_p.A547T|NRG1_ENST00000519301.1_Missense_Mutation_p.A492T|NRG1_ENST00000338921.4_Missense_Mutation_p.A550T|NRG1_ENST00000341377.5_3'UTR|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000287842.3_Missense_Mutation_p.A539T|NRG1_ENST00000287845.5_Missense_Mutation_p.A513T			Q02297	NRG1_HUMAN	neuregulin 1	542					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.A547T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TAAGAAACTCGCCAATAGCCG	0.532																																					p.A539T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1615A	8						.						56.0	54.0	55.0					8																	32621621		2203	4300	6503	32741163	SO:0001583	missense	3084	exon12			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1624G>A	8.37:g.32621621G>A	ENSP00000384620:p.Ala542Thr	Somatic		Capture	SOLID	Phase_I	32741163	NM_013957	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	G	2.740	-0.262350	0.05791	.	.	ENSG00000157168	ENST00000519301;ENST00000523534;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000539990	T;T;T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.75	2.28	0.28536	Neuregulin 1-related, C-terminal (1);	2.213810	0.01592	N	0.021609	T	0.32436	0.0829	N	0.12182	0.205	0.21355	N	0.999715	B;B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.09377	0.004;0.002;0.004;0.0;0.002;0.004;0.002	T	0.19844	-1.0293	9	.	.	.	0.2565	8.7766	0.34765	0.4217:0.0:0.5783:0.0	.	385;513;547;550;539;542;547	B7Z1E3;F8W9E3;Q7RTW4;Q02297-2;Q02297-7;Q02297;Q02297-6	.;.;.;.;.;NRG1_HUMAN;.	T	492;615;550;547;542;513;539;542;385	ENSP00000429582:A492T;ENSP00000429067:A615T;ENSP00000343395:A550T;ENSP00000349275:A547T;ENSP00000287840:A542T;ENSP00000287845:A513T;ENSP00000287842:A539T;ENSP00000384620:A542T;ENSP00000439276:A385T	.	A	+	1	0	NRG1	32741163	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	1.753000	0.38359	0.117000	0.18138	0.455000	0.32223	GCC		0.532	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
PROSC	11212	hgsc.bcm.edu	37	8	37635587	37635587	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:37635587G>A	ENST00000328195.3	+	8	860	c.793G>A	c.(793-795)Gtg>Atg	p.V265M		NM_007198.3	NP_009129.1	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog (bacterial)	265					alpha-amino acid metabolic process (GO:1901605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)	pyridoxal phosphate binding (GO:0030170)	p.V265M(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)	CGCAGCAGACGTGAAGGCCCC	0.498																																					p.V265M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G793A	8						.						68.0	70.0	69.0					8																	37635587		2203	4300	6503	37754745	SO:0001583	missense	11212	exon8			AB018566	CCDS6096.1	8p11.2	2008-01-07	2001-12-04		ENSG00000147471	ENSG00000147471			9457	protein-coding gene	gene with protein product		604436	"""proline synthetase co-transcribed (bacterial homolog)"""				Standard	NM_007198		Approved		uc003xkh.3	O94903	OTTHUMG00000164024	ENST00000328195.3:c.793G>A	8.37:g.37635587G>A	ENSP00000333551:p.Val265Met	Somatic		Capture	SOLID	Phase_I	37754745	NM_007198	Q6FI94	Missense_Mutation	SNP	ENST00000328195.3	37	CCDS6096.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.272288	0.23221	.	.	ENSG00000147471	ENST00000328195;ENST00000517377	T	0.47528	0.84	5.54	-0.0935	0.13649	.	0.910093	0.09417	N	0.805035	T	0.17450	0.0419	N	0.02011	-0.69	0.09310	N	1	B	0.18461	0.028	B	0.06405	0.002	T	0.15350	-1.0440	10	0.40728	T	0.16	-16.1474	2.2705	0.04089	0.1766:0.4585:0.1993:0.1656	.	265	O94903	PROSC_HUMAN	M	265;43	ENSP00000333551:V265M	ENSP00000333551:V265M	V	+	1	0	PROSC	37754745	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.042000	0.13949	0.036000	0.15547	-0.867000	0.03001	GTG		0.498	PROSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376796.1	NM_007198	
RAB11FIP1	80223	hgsc.bcm.edu	37	8	37729815	37729815	+	Silent	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:37729815G>T	ENST00000330843.4	-	4	2517	c.2505C>A	c.(2503-2505)ccC>ccA	p.P835P	RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	835					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)		p.P835P(1)		NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TCAGCTCCTGGGGACAACTGC	0.572																																					p.P835P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2505A	8						.						57.0	59.0	58.0					8																	37729815		2203	4300	6503	37848973	SO:0001819	synonymous_variant	80223	exon4			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.2505C>A	8.37:g.37729815G>T		Somatic		Capture	SOLID	Phase_I	37848973	NM_001002814	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Silent	SNP	ENST00000330843.4	37	CCDS34882.1																																																																																				0.572	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
KAT6A	7994	hgsc.bcm.edu	37	8	41798469	41798469	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:41798469T>C	ENST00000396930.3	-	16	3473	c.2930A>G	c.(2929-2931)gAc>gGc	p.D977G	KAT6A_ENST00000406337.1_Missense_Mutation_p.D977G|KAT6A_ENST00000265713.2_Missense_Mutation_p.D977G	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	977					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.D977G(1)									GACAGCCCTGTCACCCTCACT	0.597																																					p.D977G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2930G	8						.						101.0	102.0	101.0					8																	41798469		2203	4300	6503	41917626	SO:0001583	missense	7994	exon16			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2930A>G	8.37:g.41798469T>C	ENSP00000380136:p.Asp977Gly	Somatic		Capture	SOLID	Phase_I	41917626	NM_001099413	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	9.638	1.138126	0.21123	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.59364	0.27;0.27;0.27	5.56	5.56	0.83823	.	0.166448	0.40640	N	0.001057	T	0.47266	0.1436	L	0.27053	0.805	0.41837	D	0.990101	B	0.32573	0.376	B	0.32149	0.141	T	0.51980	-0.8636	10	0.62326	D	0.03	-20.1698	15.7046	0.77569	0.0:0.0:0.0:1.0	.	977	Q92794	KAT6A_HUMAN	G	977;977;977;557	ENSP00000265713:D977G;ENSP00000385888:D977G;ENSP00000380136:D977G	ENSP00000265713:D977G	D	-	2	0	KAT6A	41917626	0.974000	0.33945	0.712000	0.30502	0.009000	0.06853	2.368000	0.44222	2.105000	0.64084	0.528000	0.53228	GAC		0.597	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
KAT6A	7994	hgsc.bcm.edu	37	8	41906365	41906365	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:41906365C>T	ENST00000396930.3	-	3	674	c.131G>A	c.(130-132)cGt>cAt	p.R44H	KAT6A_ENST00000406337.1_Missense_Mutation_p.R44H|KAT6A_ENST00000265713.2_Missense_Mutation_p.R44H|KAT6A_ENST00000485568.1_Missense_Mutation_p.R44H	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	44	Required for activation of RUNX1-1.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R44H(1)									AACAGTTTTACGATCCAAGCC	0.368																																					p.R44H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G131A	8						.						202.0	193.0	196.0					8																	41906365		2203	4300	6503	42025522	SO:0001583	missense	7994	exon3			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.131G>A	8.37:g.41906365C>T	ENSP00000380136:p.Arg44His	Somatic		Capture	SOLID	Phase_I	42025522	NM_001099413	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.994506	0.35226	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000485568	T;T;T;D	0.84223	0.19;0.19;0.19;-1.82	5.66	4.79	0.61399	.	0.000000	0.64402	D	0.000001	D	0.89234	0.6657	L	0.46157	1.445	0.48395	D	0.999645	D;D	0.89917	1.0;1.0	D;D	0.68621	0.95;0.959	D	0.90163	0.4229	10	0.72032	D	0.01	-13.3018	14.8189	0.70055	0.0:0.9306:0.0:0.0694	.	44;44	A5PLL3;Q92794	.;KAT6A_HUMAN	H	44	ENSP00000265713:R44H;ENSP00000385888:R44H;ENSP00000380136:R44H;ENSP00000430606:R44H	ENSP00000265713:R44H	R	-	2	0	KAT6A	42025522	1.000000	0.71417	0.961000	0.40146	0.988000	0.76386	5.663000	0.68038	1.400000	0.46741	-0.137000	0.14449	CGT		0.368	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
PLAT	5327	hgsc.bcm.edu	37	8	42038056	42038056	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:42038056A>G	ENST00000220809.4	-	10	1293	c.1037T>C	c.(1036-1038)cTc>cCc	p.L346P	PLAT_ENST00000429089.2_Missense_Mutation_p.L346P|PLAT_ENST00000352041.3_Missense_Mutation_p.L300P|PLAT_ENST00000270189.6_Intron|PLAT_ENST00000524009.1_Missense_Mutation_p.L257P|PLAT_ENST00000519510.1_Missense_Mutation_p.L283P|PLAT_ENST00000429710.2_Missense_Mutation_p.L220P	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	346	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)	p.L346P(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	GGAGCTGATGAGTATGCCCCC	0.622																																					p.L300P												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.T899C	8						.						66.0	72.0	70.0					8																	42038056		2203	4300	6503	42157213	SO:0001583	missense	5327	exon9				CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.1037T>C	8.37:g.42038056A>G	ENSP00000220809:p.Leu346Pro	Somatic		Capture	SOLID	Phase_I	42157213	NM_033011	A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	ENST00000220809.4	37	CCDS6126.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096937	0.56075	.	.	ENSG00000104368	ENST00000429089;ENST00000220809;ENST00000352041;ENST00000519510;ENST00000429710;ENST00000524009	D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	5.52	5.52	0.82312	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.130748	0.52532	D	0.000066	D	0.97901	0.9310	H	0.96916	3.905	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.99364	1.0918	10	0.87932	D	0	.	15.6482	0.77070	1.0:0.0:0.0:0.0	.	220;257;283;346;300;346	B4DNJ1;B4DN26;B4DV92;B8ZX62;P00750-3;P00750	.;.;.;.;.;TPA_HUMAN	P	346;346;300;283;220;257	ENSP00000392045:L346P;ENSP00000220809:L346P;ENSP00000270188:L300P;ENSP00000428886:L283P;ENSP00000407861:L220P;ENSP00000429401:L257P	ENSP00000220809:L346P	L	-	2	0	PLAT	42157213	1.000000	0.71417	0.131000	0.22000	0.010000	0.07245	9.288000	0.96055	2.098000	0.63641	0.528000	0.53228	CTC		0.622	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377100.1	NM_000930	
IKBKB	3551	hgsc.bcm.edu	37	8	42129645	42129645	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:42129645G>A	ENST00000520810.1	+	2	213	c.27G>A	c.(25-27)acG>acA	p.T9T	IKBKB_ENST00000519735.1_Silent_p.T9T|RP11-231D20.2_ENST00000518213.1_RNA|RP11-231D20.2_ENST00000520890.1_RNA|IKBKB_ENST00000522147.1_Silent_p.T9T|RP11-231D20.2_ENST00000518994.1_RNA|IKBKB_ENST00000520835.1_Intron|RP11-231D20.2_ENST00000523459.1_RNA|IKBKB_ENST00000379708.3_5'UTR|IKBKB_ENST00000416505.2_5'UTR|IKBKB_ENST00000518983.1_Silent_p.T9T	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	9					B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)	p.T9T(1)		breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CCCTGACAACGCAGACATGTG	0.493											OREG0018746	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T9T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G27A	8						.						122.0	121.0	122.0					8																	42129645		2203	4300	6503	42248802	SO:0001819	synonymous_variant	3551	exon2			AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.27G>A	8.37:g.42129645G>A		Somatic	906	Capture	SOLID	Phase_I	42248802	NM_001190722	B4DZ30|B4E0U4|O75327	Silent	SNP	ENST00000520810.1	37	CCDS6128.1																																																																																				0.493	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
ARFGEF1	10565	hgsc.bcm.edu	37	8	68179452	68179452	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:68179452T>C	ENST00000262215.3	-	12	2075	c.1686A>G	c.(1684-1686)gtA>gtG	p.V562V	ARFGEF1_ENST00000520381.1_Silent_p.V16V	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	562	HUS; DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.V562V(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AAATATCCACTACACTCTGAG	0.308																																					p.V562V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1686G	8						.						61.0	63.0	62.0					8																	68179452		2202	4292	6494	68342006	SO:0001819	synonymous_variant	10565	exon12			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1686A>G	8.37:g.68179452T>C		Somatic		Capture	SOLID	Phase_I	68342006	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	37	CCDS6199.1																																																																																				0.308	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
IMPA1	3612	hgsc.bcm.edu	37	8	82572755	82572755	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:82572755A>G	ENST00000256108.5	-	8	1179	c.714T>C	c.(712-714)gtT>gtC	p.V238V	IMPA1_ENST00000523710.1_5'Flank|IMPA1_ENST00000449740.2_Silent_p.V297V|IMPA1_ENST00000311489.4_3'UTR	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1	238					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)	p.V238V(1)		NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	TTTTACCTGTAACATCCATTA	0.398																																					p.V238V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T714C	8						.						89.0	81.0	84.0					8																	82572755		2203	4299	6502	82735310	SO:0001819	synonymous_variant	3612	exon8				CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.714T>C	8.37:g.82572755A>G		Somatic		Capture	SOLID	Phase_I	82735310	NM_005536	B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Silent	SNP	ENST00000256108.5	37	CCDS6231.1	.	.	.	.	.	.	.	.	.	.	A	1.424	-0.572188	0.03882	.	.	ENSG00000133731	ENST00000523942	.	.	.	4.23	-8.46	0.00942	.	.	.	.	.	T	0.28928	0.0718	.	.	.	0.32304	N	0.564571	.	.	.	.	.	.	T	0.17077	-1.0381	4	.	.	.	-12.5469	4.5794	0.12252	0.1007:0.254:0.453:0.1924	.	.	.	.	H	263	.	.	Y	-	1	0	IMPA1	82735310	0.006000	0.16342	0.220000	0.23810	0.398000	0.30690	-0.733000	0.04898	-3.358000	0.00179	-0.398000	0.06409	TAC		0.398	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379723.1		
RIPK2	8767	hgsc.bcm.edu	37	8	90782027	90782027	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:90782027C>T	ENST00000220751.4	+	4	825	c.511C>T	c.(511-513)Cgc>Tgc	p.R171C	RIPK2_ENST00000540020.1_Missense_Mutation_p.R34C	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	171	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.R171C(1)		kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			ATCAAAGTGGCGCATGATGTC	0.373																																					p.R171C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C511T	8						.						155.0	159.0	158.0					8																	90782027		2203	4299	6502	90851164	SO:0001583	missense	8767	exon4			AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.511C>T	8.37:g.90782027C>T	ENSP00000220751:p.Arg171Cys	Somatic		Capture	SOLID	Phase_I	90851164	NM_003821	B7Z748|Q6UWF0	Missense_Mutation	SNP	ENST00000220751.4	37	CCDS6247.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022629	0.93462	.	.	ENSG00000104312	ENST00000220751;ENST00000540020	T;T	0.65178	-0.14;-0.14	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43579	D	0.000541	T	0.72382	0.3453	L	0.35542	1.07	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.74466	-0.3656	10	0.87932	D	0	-13.847	19.3887	0.94570	0.0:1.0:0.0:0.0	.	171	O43353	RIPK2_HUMAN	C	171;34	ENSP00000220751:R171C;ENSP00000441623:R34C	ENSP00000220751:R171C	R	+	1	0	RIPK2	90851164	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.620000	0.67736	2.826000	0.97356	0.655000	0.94253	CGC		0.373	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375686.1		
COL14A1	7373	hgsc.bcm.edu	37	8	121292248	121292248	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr8:121292248G>A	ENST00000297848.3	+	29	3826	c.3556G>A	c.(3556-3558)Gca>Aca	p.A1186T	COL14A1_ENST00000309791.4_Missense_Mutation_p.A1186T|COL14A1_ENST00000247781.3_Missense_Mutation_p.A1091T	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.A1186T(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TAAGCCCAGCGCACGCCATGT	0.443																																					p.A1186T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3556A	8						.						138.0	122.0	128.0					8																	121292248		2203	4300	6503	121361429	SO:0001583	missense	7373	exon29				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3556G>A	8.37:g.121292248G>A	ENSP00000297848:p.Ala1186Thr	Somatic		Capture	SOLID	Phase_I	121361429	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.940027	0.52972	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.83837	-1.77;-1.77;-1.77	5.42	1.38	0.22167	von Willebrand factor, type A (3);	0.418351	0.26903	N	0.021915	T	0.66733	0.2819	N	0.16862	0.45	0.48830	D	0.999716	B	0.11235	0.004	B	0.08055	0.003	T	0.51092	-0.8749	10	0.27785	T	0.31	.	8.9643	0.35867	0.0677:0.0:0.5463:0.386	.	1186	Q05707	COEA1_HUMAN	T	1186;1186;1091	ENSP00000311809:A1186T;ENSP00000297848:A1186T;ENSP00000247781:A1091T	ENSP00000247781:A1091T	A	+	1	0	COL14A1	121361429	1.000000	0.71417	0.026000	0.17262	0.893000	0.52053	4.588000	0.60999	-0.034000	0.13713	0.655000	0.94253	GCA		0.443	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
USP9Y	8287	hgsc.bcm.edu	37	Y	14922748	14922748	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrY:14922748A>G	ENST00000338981.3	+	29	5179	c.4234A>G	c.(4234-4236)Att>Gtt	p.I1412V	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	1412					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.I1412V(2)		kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GCTCAAAAGGATTAGGGTAAG	0.323																																					p.I1412V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4234G	Y						.						48.0	49.0	49.0					Y																	14922748		598	1916	2514	13432142	SO:0001583	missense	8287	exon29			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.4234A>G	Y.37:g.14922748A>G	ENSP00000342812:p.Ile1412Val	Somatic		Capture	SOLID	Phase_I	13432142	NM_004654	O14601	Missense_Mutation	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																				0.323	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
FAM212B	55924	hgsc.bcm.edu	37	1	112269676	112269676	+	Nonsense_Mutation	SNP	G	G	A	rs560783748	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:112269676G>A	ENST00000357260.5	-	2	989	c.808C>T	c.(808-810)Cga>Tga	p.R270*	FAM212B_ENST00000444059.2_Nonsense_Mutation_p.R255*|FAM212B_ENST00000534365.1_Intron	NM_019099.4	NP_061972.1	Q9NTI7	F212B_HUMAN	family with sequence similarity 212, member B	270								p.R270*(1)		cervix(1)|endometrium(1)	2						TTCTCCCCTCGCCTGTGCTCC	0.592													G|||	2	0.000399361	0.0	0.0	5008	,	,		17298	0.002		0.0	False		,,,				2504	0.0				p.R270X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C808T	1						.						110.0	122.0	118.0					1																	112269676		2203	4300	6503	112071199	SO:0001587	stop_gained	55924	exon2			AK055667	CCDS841.1, CCDS44195.1	1p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000197852	ENSG00000197852			28045	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 183"""	C1orf183			Standard	NM_019099		Approved	FLJ31105	uc001ebo.2	Q9NTI7	OTTHUMG00000011953	ENST00000357260.5:c.808C>T	1.37:g.112269676G>A	ENSP00000349805:p.Arg270*	Somatic		Capture	SOLID	Phase_I	112071199	NM_019099	B3KP38|B4DF94|Q9NTI6	Nonsense_Mutation	SNP	ENST00000357260.5	37	CCDS841.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126134	0.56721	.	.	ENSG00000197852	ENST00000357260;ENST00000444059	.	.	.	4.94	0.639	0.17747	.	0.780565	0.11939	N	0.514919	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	1.0635	9.751	0.40475	0.0:0.1362:0.2627:0.6011	.	.	.	.	X	270;255	.	ENSP00000349805:R270X	R	-	1	2	C1orf183	112071199	0.019000	0.18553	0.000000	0.03702	0.388000	0.30384	0.345000	0.19979	-0.144000	0.11314	0.561000	0.74099	CGA		0.592	FAM212B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033060.2	NM_019099	
TRIM33	51592	hgsc.bcm.edu	37	1	114970467	114970467	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:114970467A>G	ENST00000358465.2	-	7	1288	c.1205T>C	c.(1204-1206)aTc>aCc	p.I402T	TRIM33_ENST00000369543.2_Missense_Mutation_p.I402T|TRIM33_ENST00000450349.2_Missense_Mutation_p.I10T	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	402					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I402T(1)		breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGGCCTGTGATGTCATTCTG	0.428			T	RET	papillary thyroid																																p.I402T			Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1205C	1						.						151.0	137.0	142.0					1																	114970467		2203	4300	6503	114771990	SO:0001583	missense	51592	exon7			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1205T>C	1.37:g.114970467A>G	ENSP00000351250:p.Ile402Thr	Somatic		Capture	SOLID	Phase_I	114771990	NM_015906	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	CCDS872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.76|16.76	3.212628|3.212628	0.58452|0.58452	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349|ENST00000448034	T;T;T|.	0.76968|.	-0.8;-0.71;-1.06|.	5.87|5.87	5.87|5.87	0.94306|0.94306	B-box, C-terminal (1);|.	0.044310|.	0.85682|.	D|.	0.000000|.	T|T	0.44519|0.44519	0.1297|0.1297	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999996|0.999996	D;D;B;B|.	0.55800|.	0.973;0.973;0.043;0.125|.	D;D;B;B|.	0.64042|.	0.921;0.921;0.028;0.085|.	T|T	0.41556|0.41556	-0.9502|-0.9502	10|5	0.56958|.	D|.	0.05|.	-9.6908|-9.6908	16.2806|16.2806	0.82678|0.82678	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	10;10;402;402|.	E7EN20;B3KN30;Q9UPN9-2;Q9UPN9|.	.;.;.;TRI33_HUMAN|.	T|P	402;402;10|139	ENSP00000351250:I402T;ENSP00000358556:I402T;ENSP00000412077:I10T|.	ENSP00000351250:I402T|.	I|S	-|-	2|1	0|0	TRIM33|TRIM33	114771990|114771990	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	7.040000|7.040000	0.76551|0.76551	2.248000|2.248000	0.74166|0.74166	0.533000|0.533000	0.62120|0.62120	ATC|TCA		0.428	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
AMPD1	270	hgsc.bcm.edu	37	1	115231344	115231344	+	Missense_Mutation	SNP	C	C	T	rs140601541		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:115231344C>T	ENST00000520113.2	-	3	167	c.152G>A	c.(151-153)cGc>cAc	p.R51H	AMPD1_ENST00000353928.6_Missense_Mutation_p.R18H|AMPD1_ENST00000369538.3_Missense_Mutation_p.R47H			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	51					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.R18H(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	AGCAAAGTTGCGCATTGCATC	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		22315	0.001		0.0	False		,,,				2504	0.0				p.R51H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G152A	1						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	130.0	128.0	129.0		152,140	5.5	0.4	1	dbSNP_134	129	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	AMPD1	NM_000036.2,NM_001172626.1	29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	51/781,47/777	115231344	2,13004	2203	4300	6503	115032867	SO:0001583	missense	270	exon3			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.152G>A	1.37:g.115231344C>T	ENSP00000430075:p.Arg51His	Somatic		Capture	SOLID	Phase_I	115032867	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578716	0.65878	2.27E-4	1.16E-4	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	T;T;T	0.55760	0.5;0.5;0.5	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.60130	0.2245	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	1.0;0.999	P;D	0.65140	0.908;0.932	T	0.62431	-0.6856	10	0.87932	D	0	-14.4529	19.7739	0.96383	0.0:1.0:0.0:0.0	.	47;18	Q5TF02;P23109	.;AMPD1_HUMAN	H	51;47;18	ENSP00000430075:R51H;ENSP00000358551:R47H;ENSP00000316520:R18H	ENSP00000316520:R18H	R	-	2	0	AMPD1	115032867	1.000000	0.71417	0.400000	0.26346	0.139000	0.21198	7.303000	0.78871	2.744000	0.94065	0.655000	0.94253	CGC		0.418	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
PHGDH	26227	hgsc.bcm.edu	37	1	120277271	120277271	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:120277271C>T	ENST00000369409.4	+	6	661	c.525C>T	c.(523-525)gaC>gaT	p.D175D	PHGDH_ENST00000369407.3_Silent_p.D141D	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	175					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)	p.D175D(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		TAGGGTATGACCCCATCATTT	0.458																																					p.D175D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525T	1						.						208.0	208.0	208.0					1																	120277271		2203	4300	6503	120078794	SO:0001819	synonymous_variant	26227	exon6			BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.525C>T	1.37:g.120277271C>T		Somatic		Capture	SOLID	Phase_I	120078794	NM_006623	B2RD08|Q5SZU3|Q9BQ01	Silent	SNP	ENST00000369409.4	37	CCDS904.1																																																																																				0.458	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033464.1	NM_006623	
VPS45	11311	hgsc.bcm.edu	37	1	150039931	150039931	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:150039931C>T	ENST00000369130.3	+	1	563	c.17C>T	c.(16-18)gCt>gTt	p.A6V	VPS45_ENST00000535106.1_Missense_Mutation_p.A6V|VPS45_ENST00000369128.5_Intron	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	6					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)		p.A6V(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTGGTTTTTGCTGTGAAGCAG	0.493																																					p.A6V												.	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.C17T	1						.						160.0	163.0	162.0					1																	150039931		2203	4300	6503	148306555	SO:0001583	missense	11311	exon1			U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.17C>T	1.37:g.150039931C>T	ENSP00000358126:p.Ala6Val	Somatic		Capture	SOLID	Phase_I	148306555	NM_007259	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Missense_Mutation	SNP	ENST00000369130.3	37	CCDS944.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.913969	0.92178	.	.	ENSG00000136631	ENST00000369130;ENST00000543996;ENST00000535106;ENST00000419023	T;T;T	0.29142	1.58;1.58;1.58	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.18299	0.0439	L	0.43646	1.37	0.80722	D	1	B;B	0.27971	0.196;0.196	B;B	0.27608	0.081;0.081	T	0.02121	-1.1210	10	0.30078	T	0.28	.	18.945	0.92618	0.0:1.0:0.0:0.0	.	6;6	Q53FR8;Q9NRW7	.;VPS45_HUMAN	V	6	ENSP00000358126:A6V;ENSP00000440690:A6V;ENSP00000400143:A6V	ENSP00000358126:A6V	A	+	2	0	VPS45	148306555	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.511000	0.67024	2.821000	0.97095	0.650000	0.86243	GCT		0.493	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034964.1	NM_007259	
C1orf54	79630	hgsc.bcm.edu	37	1	150245244	150245244	+	Silent	SNP	C	C	A	rs35018366		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:150245244C>A	ENST00000369102.1	+	3	794	c.24C>A	c.(22-24)atC>atA	p.I8I	C1orf54_ENST00000369098.3_Silent_p.I8I|C1orf54_ENST00000369099.3_Silent_p.I8I			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54	8						extracellular region (GO:0005576)		p.I8I(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTGTAGCCATCTTTGCTGTGC	0.458																																					p.I8I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C24A	1						.						187.0	163.0	171.0					1																	150245244		2203	4300	6503	148511868	SO:0001819	synonymous_variant	79630	exon1			BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.24C>A	1.37:g.150245244C>A		Somatic		Capture	SOLID	Phase_I	148511868	NM_024579	Q9H5P3	Silent	SNP	ENST00000369102.1	37	CCDS948.1																																																																																				0.458	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035055.1	NM_024579	
TUFT1	7286	hgsc.bcm.edu	37	1	151552161	151552161	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:151552161G>A	ENST00000368849.3	+	11	1023	c.961G>A	c.(961-963)Gcc>Acc	p.A321T	TUFT1_ENST00000392712.3_Missense_Mutation_p.A266T|TUFT1_ENST00000538902.1_Missense_Mutation_p.A340T|TUFT1_ENST00000353024.3_Missense_Mutation_p.A262T|TUFT1_ENST00000368848.2_Missense_Mutation_p.A296T	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	321					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)	p.A321T(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GTCAAAGGACGCCACCATCCA	0.522																																					p.A321T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G961A	1						.						68.0	60.0	63.0					1																	151552161		2203	4300	6503	149818785	SO:0001583	missense	7286	exon11			AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.961G>A	1.37:g.151552161G>A	ENSP00000357842:p.Ala321Thr	Somatic		Capture	SOLID	Phase_I	149818785	NM_020127	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Missense_Mutation	SNP	ENST00000368849.3	37	CCDS1000.1	.	.	.	.	.	.	.	.	.	.	G	6.375	0.437235	0.12104	.	.	ENSG00000143367	ENST00000368849;ENST00000392712;ENST00000353024;ENST00000368848;ENST00000538902	T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16	6.02	-4.63	0.03359	.	0.747729	0.13777	N	0.363533	T	0.16769	0.0403	N	0.01188	-0.97	0.09310	N	0.999997	B;B;B	0.28760	0.221;0.006;0.006	B;B;B	0.16722	0.016;0.006;0.006	T	0.45542	-0.9254	10	0.13853	T	0.58	-0.0111	6.6121	0.22757	0.5638:0.0:0.2419:0.1942	.	340;296;321	F5H607;Q9NNX1-2;Q9NNX1	.;.;TUFT1_HUMAN	T	321;266;262;296;340	ENSP00000357842:A321T;ENSP00000376476:A266T;ENSP00000343781:A262T;ENSP00000357841:A296T;ENSP00000437997:A340T	ENSP00000343781:A262T	A	+	1	0	TUFT1	149818785	0.000000	0.05858	0.085000	0.20634	0.954000	0.61252	0.122000	0.15687	-0.757000	0.04697	-1.850000	0.00570	GCC		0.522	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	NM_020127	
SNX27	81609	hgsc.bcm.edu	37	1	151611523	151611523	+	Silent	SNP	C	C	T	rs80102518		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:151611523C>T	ENST00000458013.2	+	2	591	c.471C>T	c.(469-471)taC>taT	p.Y157Y	SNX27_ENST00000368838.1_Silent_p.Y64Y|SNX27_ENST00000368843.3_Silent_p.Y157Y			Q96L92	SNX27_HUMAN	sorting nexin family member 27	157					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.Y157Y(1)		central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTATGATTACACAGAAAAGC	0.468																																					p.Y157Y	Colon(46;291 966 40145 41237 41888)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C471T	1						.						112.0	102.0	106.0					1																	151611523		2203	4300	6503	149878147	SO:0001819	synonymous_variant	81609	exon2			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.471C>T	1.37:g.151611523C>T		Somatic		Capture	SOLID	Phase_I	149878147	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Silent	SNP	ENST00000458013.2	37																																																																																					0.468	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
FLG	2312	hgsc.bcm.edu	37	1	152281791	152281791	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:152281791C>T	ENST00000368799.1	-	3	5606	c.5571G>A	c.(5569-5571)ggG>ggA	p.G1857G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1857	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G1857G(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCCTGACTGCCCACGGGAGA	0.547									Ichthyosis																												p.G1857G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5571A	1						.						344.0	339.0	341.0					1																	152281791		2203	4300	6503	150548415	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5571G>A	1.37:g.152281791C>T		Somatic		Capture	SOLID	Phase_I	150548415	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLG2	388698	hgsc.bcm.edu	37	1	152324738	152324738	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:152324738C>T	ENST00000388718.5	-	3	5596	c.5524G>A	c.(5524-5526)Gag>Aag	p.E1842K	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1842					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.E1842K(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGTCTCTCGTCAACTATG	0.507																																					p.E1842K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5524A	1						.						312.0	273.0	286.0					1																	152324738		2203	4300	6503	150591362	SO:0001583	missense	388698	exon3			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5524G>A	1.37:g.152324738C>T	ENSP00000373370:p.Glu1842Lys	Somatic		Capture	SOLID	Phase_I	150591362	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639021	0.29157	.	.	ENSG00000143520	ENST00000388718	T	0.03524	3.9	2.83	1.91	0.25777	.	.	.	.	.	T	0.01387	0.0045	L	0.40543	1.245	0.09310	N	1	D	0.63880	0.993	P	0.49922	0.626	T	0.25882	-1.0119	9	0.07482	T	0.82	1.3254	5.7932	0.18371	0.0:0.8487:0.0:0.1513	.	1842	Q5D862	FILA2_HUMAN	K	1842	ENSP00000373370:E1842K	ENSP00000373370:E1842K	E	-	1	0	FLG2	150591362	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.239000	0.08965	0.805000	0.34159	0.449000	0.29647	GAG		0.507	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
S100A7	6278	hgsc.bcm.edu	37	1	153431368	153431368	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:153431368G>T	ENST00000368723.3	-	2	232	c.122C>A	c.(121-123)cCc>cAc	p.P41H	S100A7_ENST00000368722.1_Missense_Mutation_p.P41H	NM_002963.3	NP_002954.2	P31151	S10A7_HUMAN	S100 calcium binding protein A7	41	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				angiogenesis (GO:0001525)|defense response to Gram-negative bacterium (GO:0050829)|epidermis development (GO:0008544)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of T cell chemotaxis (GO:0010820)|response to lipopolysaccharide (GO:0032496)|response to reactive oxygen species (GO:0000302)|sequestering of metal ion (GO:0051238)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)	p.P41H(1)		breast(1)|large_intestine(2)|lung(5)|skin(2)	10	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGGAAGTTGGGGAAGTTCTC	0.468																																					p.P41H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C122A	1						.						226.0	194.0	205.0					1																	153431368		2203	4300	6503	151697992	SO:0001583	missense	6278	exon2			BC034687	CCDS1039.1	1q21	2013-01-10	2006-09-11		ENSG00000143556	ENSG00000143556		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10497	protein-coding gene	gene with protein product		600353	"""S100 calcium-binding protein A7 (psoriasin 1)"", ""S100 calcium binding protein A7 (psoriasin 1)"""	PSOR1		1940442	Standard	NM_002963		Approved	S100A7c	uc001fbv.1	P31151	OTTHUMG00000013123	ENST00000368723.3:c.122C>A	1.37:g.153431368G>T	ENSP00000357712:p.Pro41His	Somatic		Capture	SOLID	Phase_I	151697992	NM_002963	Q5SY67|Q6FGE3|Q9H1E2	Missense_Mutation	SNP	ENST00000368723.3	37	CCDS1039.1	.	.	.	.	.	.	.	.	.	.	.	14.41	2.527179	0.44969	.	.	ENSG00000143556	ENST00000368723;ENST00000368722	T;T	0.13196	2.61;2.61	1.83	0.789	0.18607	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	.	.	.	.	T	0.12178	0.0296	L	0.46157	1.445	0.22639	N	0.998908	D	0.89917	1.0	D	0.78314	0.991	T	0.08700	-1.0709	9	0.54805	T	0.06	.	5.2328	0.15432	0.0:0.0:0.6372:0.3628	.	41	P31151	S10A7_HUMAN	H	41	ENSP00000357712:P41H;ENSP00000357711:P41H	ENSP00000357711:P41H	P	-	2	0	S100A7	151697992	0.921000	0.31238	0.999000	0.59377	0.493000	0.33554	0.247000	0.18179	0.312000	0.23038	0.134000	0.15878	CCC		0.468	S100A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036789.1	NM_002963	
S100A4	6275	hgsc.bcm.edu	37	1	153516352	153516352	+	Silent	SNP	G	G	A	rs200662974		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:153516352G>A	ENST00000368716.4	-	3	336	c.189C>T	c.(187-189)gaC>gaT	p.D63D	S100A4_ENST00000481009.1_5'UTR|S100A4_ENST00000368714.1_Silent_p.D63D|S100A5_ENST00000359215.1_5'Flank|S100A5_ENST00000368718.1_5'Flank|S100A4_ENST00000368715.1_Silent_p.D63D|S100A4_ENST00000354332.4_Silent_p.D63D	NM_002961.2	NP_002952.1	P26447	S10A4_HUMAN	S100 calcium binding protein A4	63	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epithelial to mesenchymal transition (GO:0001837)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)	p.D63D(1)		large_intestine(2)|lung(1)|prostate(1)	4	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Trifluoperazine(DB00831)	CCCTGTTGCTGTCCAAGTTGC	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		19726	0.001		0.0	False		,,,				2504	0.0				p.D63D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C189T	1						.						239.0	216.0	224.0					1																	153516352		2203	4300	6503	151782976	SO:0001819	synonymous_variant	6275	exon3			BC016300	CCDS1042.1	1q12-q22	2013-01-10	2006-09-11		ENSG00000196154	ENSG00000196154		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10494	protein-coding gene	gene with protein product	"""fibroblast-specific protein-1"""	114210	"""S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"", ""S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"""	MTS1, CAPL		3155863	Standard	NM_019554		Approved	P9KA, 18A2, PEL98, 42A, FSP1	uc001fbz.3	P26447	OTTHUMG00000013546	ENST00000368716.4:c.189C>T	1.37:g.153516352G>A		Somatic		Capture	SOLID	Phase_I	151782976	NM_002961	A8K7R8|D3DV46|Q6ICP8	Silent	SNP	ENST00000368716.4	37	CCDS1042.1																																																																																				0.498	S100A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037714.1	NM_002961	
INTS3	65123	hgsc.bcm.edu	37	1	153730091	153730091	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:153730091G>A	ENST00000318967.2	+	10	1569	c.1001G>A	c.(1000-1002)cGc>cAc	p.R334H	INTS3_ENST00000512605.1_Missense_Mutation_p.R128H|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000456435.1_Missense_Mutation_p.R128H|INTS3_ENST00000435409.2_Missense_Mutation_p.R334H	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	335					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)		p.R334H(1)		breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGGTTCCAGCGCCAGTACCTG	0.498																																					p.R334H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1001A	1						.						203.0	181.0	188.0					1																	153730091		2203	4300	6503	151996715	SO:0001583	missense	65123	exon10			BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.1001G>A	1.37:g.153730091G>A	ENSP00000318641:p.Arg334His	Somatic		Capture	SOLID	Phase_I	151996715	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113640	0.94339	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.73087	0.3542	M	0.71581	2.175	0.54753	D	0.999984	D;D;D	0.89917	0.999;1.0;0.999	D;D;P	0.78314	0.991;0.957;0.872	T	0.76451	-0.2954	9	0.72032	D	0.01	.	15.2588	0.73606	0.0:0.0:1.0:0.0	.	128;335;334	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	H	334;128;334;128	.	ENSP00000318641:R334H	R	+	2	0	INTS3	151996715	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.815000	0.75242	2.463000	0.83235	0.455000	0.32223	CGC		0.498	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
BGLAP	632	hgsc.bcm.edu	37	1	156212347	156212347	+	Missense_Mutation	SNP	C	C	T	rs183196972	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:156212347C>T	ENST00000368272.4	+	2	338	c.68C>T	c.(67-69)gCg>gTg	p.A23V	PMF1-BGLAP_ENST00000320139.5_Silent_p.C124C|PMF1_ENST00000565805.1_Silent_p.C124C|PMF1-BGLAP_ENST00000368276.4_Silent_p.C169C|PMF1_ENST00000567140.1_Silent_p.C169C|PAQR6_ENST00000492619.1_5'Flank|PMF1-BGLAP_ENST00000490491.1_Nonsense_Mutation_p.R190*	NM_199173.4	NP_954642.1	P02818	OSTCN_HUMAN	bone gamma-carboxyglutamate (gla) protein	23					bone development (GO:0060348)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cell aging (GO:0007569)|cellular response to growth factor stimulus (GO:0071363)|cellular response to vitamin D (GO:0071305)|odontogenesis (GO:0042476)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of osteoclast differentiation (GO:0045670)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to hydroxyisoflavone (GO:0033594)|response to mechanical stimulus (GO:0009612)|response to testosterone (GO:0033574)|response to vitamin D (GO:0033280)|response to vitamin K (GO:0032571)|response to zinc ion (GO:0010043)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|perikaryon (GO:0043204)|rough endoplasmic reticulum (GO:0005791)	calcium ion binding (GO:0005509)|hydroxyapatite binding (GO:0046848)|structural constituent of bone (GO:0008147)|structural molecule activity (GO:0005198)	p.A23V(1)		large_intestine(3)|lung(1)|urinary_tract(1)	5	Hepatocellular(266;0.158)				Gallium nitrate(DB05260)|Menadione(DB00170)|Phylloquinone(DB01022)	TTTGCAGGTGCGAAGCCCAGC	0.622													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20327	0.0		0.0	False		,,,				2504	0.0				p.R190X												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C568T	1						.	C	,stop/ARG,,stop/ARG,VAL/ALA	1,4295		0,1,2147	78.0	80.0	79.0		507,568,372,361,68	1.4	0.8	1		79	0,8310		0,0,4155	no	coding-synonymous,stop-gained,coding-synonymous,stop-gained,missense	BGLAP,PMF1-BGLAP	NM_001199661.1,NM_001199662.1,NM_001199663.1,NM_001199664.1,NM_199173.4	,,,,64	0,1,6302	TT,TC,CC		0.0,0.0233,0.0079	,,,,possibly-damaging	169/221,190/212,124/176,121/143,23/101	156212347	1,12605	2148	4155	6303	154478971	SO:0001583	missense	632	exon5			X04143	CCDS1134.1	1q22	2014-05-13	2008-08-01		ENSG00000242252	ENSG00000242252			1043	protein-coding gene	gene with protein product	"""osteocalcin"""	112260				2785029, 2394711	Standard	NM_199173		Approved	OCN	uc001fnt.3	P02818	OTTHUMG00000014819	ENST00000368272.4:c.68C>T	1.37:g.156212347C>T	ENSP00000357255:p.Ala23Val	Somatic		Capture	SOLID	Phase_I	154478971	NM_001199662	Q5TCK6	Missense_Mutation	SNP	ENST00000368272.4	37	CCDS1134.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	16.89	3.246148	0.59103	2.33E-4	0.0	ENSG00000242252	ENST00000368272	T	0.47177	0.85	4.49	1.42	0.22433	.	.	.	.	.	T	0.12518	0.0304	.	.	.	0.22710	N	0.99883	P	0.40083	0.702	B	0.25291	0.059	T	0.03957	-1.0989	8	0.48119	T	0.1	.	8.0978	0.30840	0.0:0.4434:0.4663:0.0903	.	23	P02818	OSTCN_HUMAN	V	23	ENSP00000357255:A23V	ENSP00000357255:A23V	A	+	2	0	BGLAP	154478971	0.059000	0.20769	0.775000	0.31657	0.640000	0.38277	0.113000	0.15499	0.200000	0.20447	-0.305000	0.09177	GCG		0.622	BGLAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040867.2	NM_199173	
BGLAP	632	hgsc.bcm.edu	37	1	156212357	156212357	+	Silent	SNP	C	C	T	rs557201215	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:156212357C>T	ENST00000368272.4	+	2	348	c.78C>T	c.(76-78)agC>agT	p.S26S	PMF1-BGLAP_ENST00000320139.5_Missense_Mutation_p.R128W|PMF1_ENST00000565805.1_Missense_Mutation_p.R128W|PMF1-BGLAP_ENST00000368276.4_Missense_Mutation_p.R173W|PMF1_ENST00000567140.1_Missense_Mutation_p.R173W|PAQR6_ENST00000492619.1_5'Flank|PMF1-BGLAP_ENST00000490491.1_Missense_Mutation_p.A193V	NM_199173.4	NP_954642.1	P02818	OSTCN_HUMAN	bone gamma-carboxyglutamate (gla) protein	26					bone development (GO:0060348)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cell aging (GO:0007569)|cellular response to growth factor stimulus (GO:0071363)|cellular response to vitamin D (GO:0071305)|odontogenesis (GO:0042476)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of osteoclast differentiation (GO:0045670)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to hydroxyisoflavone (GO:0033594)|response to mechanical stimulus (GO:0009612)|response to testosterone (GO:0033574)|response to vitamin D (GO:0033280)|response to vitamin K (GO:0032571)|response to zinc ion (GO:0010043)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|perikaryon (GO:0043204)|rough endoplasmic reticulum (GO:0005791)	calcium ion binding (GO:0005509)|hydroxyapatite binding (GO:0046848)|structural constituent of bone (GO:0008147)|structural molecule activity (GO:0005198)	p.S26S(1)		large_intestine(3)|lung(1)|urinary_tract(1)	5	Hepatocellular(266;0.158)				Gallium nitrate(DB05260)|Menadione(DB00170)|Phylloquinone(DB01022)	CGAAGCCCAGCGGTGCAGAGT	0.622																																					p.R128W												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C382T	1						.						84.0	86.0	85.0					1																	156212357		2157	4190	6347	154478981	SO:0001819	synonymous_variant	632	exon4			X04143	CCDS1134.1	1q22	2014-05-13	2008-08-01		ENSG00000242252	ENSG00000242252			1043	protein-coding gene	gene with protein product	"""osteocalcin"""	112260				2785029, 2394711	Standard	NM_199173		Approved	OCN	uc001fnt.3	P02818	OTTHUMG00000014819	ENST00000368272.4:c.78C>T	1.37:g.156212357C>T		Somatic		Capture	SOLID	Phase_I	154478981	NM_001199663	Q5TCK6	Silent	SNP	ENST00000368272.4	37	CCDS1134.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866170	0.51588	.	.	ENSG00000160783	ENST00000368276;ENST00000320139	T;T	0.56776	0.44;0.77	4.49	-7.03	0.01584	.	1.079820	0.07119	N	0.843640	T	0.14184	0.0343	.	.	.	0.26101	N	0.980826	B	0.02656	0.0	B	0.01281	0.0	T	0.31308	-0.9948	9	0.66056	D	0.02	.	4.1009	0.10014	0.1031:0.282:0.1019:0.513	.	128	Q6P1K2-3	.	W	173;128	ENSP00000357259:R173W;ENSP00000324909:R128W	ENSP00000324909:R128W	R	+	1	2	PMF1	154478981	0.000000	0.05858	0.007000	0.13788	0.513000	0.34164	-2.757000	0.00788	-1.313000	0.02303	0.561000	0.74099	CGG		0.622	BGLAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040867.2	NM_199173	
NES	10763	hgsc.bcm.edu	37	1	156642580	156642580	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:156642580G>A	ENST00000368223.3	-	4	1532	c.1400C>T	c.(1399-1401)gCa>gTa	p.A467V		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	467	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)	p.A467V(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGGGGTGGTGCCAAGGAGGC	0.622																																					p.A467V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1400T	1						.						72.0	70.0	71.0					1																	156642580		2203	4300	6503	154909204	SO:0001583	missense	10763	exon4			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1400C>T	1.37:g.156642580G>A	ENSP00000357206:p.Ala467Val	Somatic		Capture	SOLID	Phase_I	154909204	NM_006617	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096942	0.37048	.	.	ENSG00000132688	ENST00000368223;ENST00000255024	D	0.88509	-2.39	4.44	4.44	0.53790	.	.	.	.	.	D	0.83594	0.5288	M	0.64997	1.995	0.09310	N	1	P	0.52842	0.956	P	0.45712	0.491	T	0.77824	-0.2444	9	0.87932	D	0	.	10.4651	0.44602	0.0:0.1977:0.8023:0.0	.	467	P48681	NEST_HUMAN	V	467	ENSP00000357206:A467V	ENSP00000255024:A467V	A	-	2	0	NES	154909204	0.030000	0.19436	0.624000	0.29186	0.016000	0.09150	1.896000	0.39789	2.308000	0.77769	0.467000	0.42956	GCA		0.622	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
COPA	1314	hgsc.bcm.edu	37	1	160268918	160268918	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:160268918C>A	ENST00000241704.7	-	18	2033	c.1804G>T	c.(1804-1806)Gcc>Tcc	p.A602S	COPA_ENST00000368069.3_Missense_Mutation_p.A611S	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	602					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.A602S(1)		central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTGATCAGGGCCAGCTTGAAT	0.438																																					p.A602S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1804T	1						.						131.0	130.0	130.0					1																	160268918		2203	4300	6503	158535542	SO:0001583	missense	1314	exon18			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1804G>T	1.37:g.160268918C>A	ENSP00000241704:p.Ala602Ser	Somatic		Capture	SOLID	Phase_I	158535542	NM_004371	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	37	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665270	0.67700	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.68765	-0.3;-0.35	4.98	4.98	0.66077	Coatomer, WD associated region (1);	0.102052	0.64402	D	0.000002	T	0.53642	0.1809	L	0.52573	1.65	0.80722	D	1	B;B	0.28082	0.2;0.096	B;B	0.33254	0.16;0.074	T	0.56098	-0.8035	10	0.40728	T	0.16	-5.0798	17.0569	0.86536	0.0:1.0:0.0:0.0	.	602;611	P53621;P53621-2	COPA_HUMAN;.	S	611;602	ENSP00000357048:A611S;ENSP00000241704:A602S	ENSP00000241704:A602S	A	-	1	0	COPA	158535542	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.261000	0.78400	2.591000	0.87537	0.585000	0.79938	GCC		0.438	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
TBX19	9095	hgsc.bcm.edu	37	1	168262444	168262444	+	Silent	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:168262444C>A	ENST00000367821.3	+	3	582	c.531C>A	c.(529-531)gcC>gcA	p.A177A		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	177					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A177A(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					TTGGAAGTGCCCATCGAATGG	0.458																																					p.A177A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C531A	1						.						129.0	109.0	115.0					1																	168262444		2203	4300	6503	166529068	SO:0001819	synonymous_variant	9095	exon3			AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.531C>A	1.37:g.168262444C>A		Somatic		Capture	SOLID	Phase_I	166529068	NM_005149	Q52M53	Silent	SNP	ENST00000367821.3	37	CCDS1272.1	.	.	.	.	.	.	.	.	.	.	C	5.007	0.187073	0.09547	.	.	ENSG00000143178	ENST00000431969	.	.	.	5.02	1.99	0.26369	.	.	.	.	.	T	0.34019	0.0883	.	.	.	0.31099	N	0.710612	.	.	.	.	.	.	T	0.11421	-1.0588	3	.	.	.	.	10.053	0.42228	0.3919:0.4815:0.1266:0.0	.	.	.	.	T	110	.	.	P	+	1	0	TBX19	166529068	0.002000	0.14202	0.924000	0.36721	0.430000	0.31655	-0.131000	0.10482	0.125000	0.18397	-0.217000	0.12591	CCA		0.458	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
FMO3	2328	hgsc.bcm.edu	37	1	171086376	171086376	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:171086376C>A	ENST00000367755.4	+	9	1504	c.1393C>A	c.(1393-1395)Cct>Act	p.P465T	FMO3_ENST00000538429.1_Missense_Mutation_p.P402T|FMO3_ENST00000542847.1_Missense_Mutation_p.P445T|FMO3_ENST00000392085.2_Missense_Mutation_p.P465T	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	465					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)	p.P465T(1)		endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TTATTTTGGCCCTTGTAGTCC	0.522																																					p.P465T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1393A	1						.						91.0	83.0	86.0					1																	171086376		2203	4300	6503	169353000	SO:0001583	missense	2328	exon9			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1393C>A	1.37:g.171086376C>A	ENSP00000356729:p.Pro465Thr	Somatic		Capture	SOLID	Phase_I	169353000	NM_001002294	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	37	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804822	0.90623	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.83022	0.5164	M	0.88377	2.95	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.996	D;D;D	0.79108	0.941;0.987;0.992	D	0.85203	0.1016	10	0.59425	D	0.04	-11.4125	19.0456	0.93018	0.0:1.0:0.0:0.0	.	402;445;465	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	T	465;465;445;402	ENSP00000356729:P465T;ENSP00000375935:P465T;ENSP00000444073:P445T;ENSP00000439500:P402T	ENSP00000356729:P465T	P	+	1	0	FMO3	169353000	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.814000	0.86154	2.567000	0.86603	0.655000	0.94253	CCT		0.522	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
RCC2	55920	hgsc.bcm.edu	37	1	17743116	17743116	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:17743116C>T	ENST00000375436.4	-	8	1073	c.886G>A	c.(886-888)Gcc>Acc	p.A296T	RCC2_ENST00000375433.3_Missense_Mutation_p.A296T|AC004824.1_ENST00000583469.1_RNA	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	296					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)	p.A296T(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		TGTGCCCGGGCGATGAACTTC	0.547																																					p.A296T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G886A	1						.						70.0	61.0	64.0					1																	17743116		2203	4300	6503	17615703	SO:0001583	missense	55920	exon7				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.886G>A	1.37:g.17743116C>T	ENSP00000364585:p.Ala296Thr	Somatic		Capture	SOLID	Phase_I	17615703	NM_001136204	Q8IVL9|Q9BSN6|Q9NPV8	Missense_Mutation	SNP	ENST00000375436.4	37	CCDS181.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.664080	0.67700	.	.	ENSG00000179051	ENST00000375436;ENST00000375433	T;T	0.79845	-1.31;-1.31	5.56	5.56	0.83823	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.82788	0.5113	N	0.17800	0.525	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80495	-0.1357	10	0.27082	T	0.32	-25.76	18.4436	0.90676	0.0:1.0:0.0:0.0	.	296	Q9P258	RCC2_HUMAN	T	296	ENSP00000364585:A296T;ENSP00000364582:A296T	ENSP00000364582:A296T	A	-	1	0	RCC2	17615703	1.000000	0.71417	0.994000	0.49952	0.888000	0.51559	7.746000	0.85057	2.778000	0.95560	0.655000	0.94253	GCC		0.547	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1	NM_018715	
ARHGEF10L	55160	hgsc.bcm.edu	37	1	17949618	17949618	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:17949618G>A	ENST00000361221.3	+	12	1307	c.1148G>A	c.(1147-1149)cGc>cAc	p.R383H	ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.R161H|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.R344H|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.R141H|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.R383H|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.R161H|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.R344H	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	383	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R383H(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CTGTCCTCCCGCGTGGCTGAG	0.602																																					p.R383H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1148A	1						.						111.0	99.0	103.0					1																	17949618		2203	4300	6503	17822205	SO:0001583	missense	55160	exon12			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1148G>A	1.37:g.17949618G>A	ENSP00000355060:p.Arg383His	Somatic		Capture	SOLID	Phase_I	17822205	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998240	0.93227	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32;1.32	4.67	4.67	0.58626	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	M	0.89968	3.075	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.996;0.99;1.0;0.997;0.997;0.992;1.0;1.0	T	0.74688	-0.3581	10	0.54805	T	0.06	-27.1574	16.1422	0.81534	0.0:0.0:1.0:0.0	.	161;141;383;161;149;344;344;383	Q5VXI4;B4DTE2;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;.;ARGAL_HUMAN	H	383;344;383;344;141;161;161;161	ENSP00000355060:R383H;ENSP00000399401:R344H;ENSP00000394621:R383H;ENSP00000364564:R344H;ENSP00000364569:R141H;ENSP00000364557:R161H;ENSP00000167825:R161H	ENSP00000167825:R161H	R	+	2	0	ARHGEF10L	17822205	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.554000	0.82212	2.134000	0.65973	0.561000	0.74099	CGC		0.602	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
RABGAP1L	9910	hgsc.bcm.edu	37	1	174247775	174247775	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:174247775C>T	ENST00000251507.4	+	10	1355	c.1181C>T	c.(1180-1182)gCa>gTa	p.A394V	RABGAP1L_ENST00000367689.3_Missense_Mutation_p.A41V|RABGAP1L_ENST00000357444.6_Missense_Mutation_p.A357V	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0								p.A394V(1)		NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						ATGACTGTGGCAGTGGATATG	0.418																																					p.A394V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1181T	1						.						134.0	134.0	134.0					1																	174247775		2203	4300	6503	172514398	SO:0001583	missense	9910	exon10			AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.1181C>T	1.37:g.174247775C>T	ENSP00000251507:p.Ala394Val	Somatic		Capture	SOLID	Phase_I	172514398	NM_014857	B7ZAA4	Missense_Mutation	SNP	ENST00000251507.4	37	CCDS1314.1	.	.	.	.	.	.	.	.	.	.	C	34	5.354903	0.95854	.	.	ENSG00000152061	ENST00000357444;ENST00000367689;ENST00000251507;ENST00000457696;ENST00000367692	T;T;T	0.64085	-0.08;2.67;-0.03	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.81861	0.4912	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.996;1.0;1.0;0.997	D	0.83528	0.0089	10	0.49607	T	0.09	.	18.7337	0.91746	0.0:1.0:0.0:0.0	.	406;41;394;394;357	B7WPG6;Q5JZA9;F1LJ00;Q5R372;Q5R372-2	.;.;.;RBG1L_HUMAN;.	V	357;41;394;406;406	ENSP00000350027:A357V;ENSP00000251507:A394V;ENSP00000403136:A406V	ENSP00000251507:A394V	A	+	2	0	RABGAP1L	172514398	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.451000	0.80668	2.438000	0.82558	0.305000	0.20034	GCA		0.418	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084497.1	NM_001243765	
ZNF648	127665	hgsc.bcm.edu	37	1	182026716	182026716	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:182026716G>A	ENST00000339948.3	-	2	637	c.430C>T	c.(430-432)Cga>Tga	p.R144*		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R144*(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GCAGGTAGTCGGTCCCCAAGA	0.577																																					p.R144X	NSCLC(71;908 1374 5429 20458 35642)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C430T	1						.						80.0	76.0	78.0					1																	182026716		2203	4300	6503	180293339	SO:0001587	stop_gained	127665	exon2			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.430C>T	1.37:g.182026716G>A	ENSP00000344129:p.Arg144*	Somatic		Capture	SOLID	Phase_I	180293339	NM_001009992	B2RP16	Nonsense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456694	0.63401	.	.	ENSG00000179930	ENST00000339948	.	.	.	2.71	-1.12	0.09808	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	1.1939	0.01871	0.3112:0.3799:0.1229:0.186	.	.	.	.	X	144	.	ENSP00000344129:R144X	R	-	1	2	ZNF648	180293339	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-1.240000	0.02914	-0.246000	0.09611	-2.343000	0.00245	CGA		0.577	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
RGL1	23179	hgsc.bcm.edu	37	1	183854019	183854019	+	Missense_Mutation	SNP	C	C	A	rs186113354		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:183854019C>A	ENST00000360851.3	+	7	1076	c.898C>A	c.(898-900)Ctc>Atc	p.L300I	RGL1_ENST00000536277.1_Missense_Mutation_p.L298I|RGL1_ENST00000304685.4_Missense_Mutation_p.L335I|RGL1_ENST00000539189.1_Missense_Mutation_p.L300I			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	300	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.L335I(1)		breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						GGGCAAAGAACTCAAAACTCA	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		19980	0.001		0.0	False		,,,				2504	0.0				p.L335I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1003A	1						.						102.0	96.0	98.0					1																	183854019		2203	4300	6503	182120642	SO:0001583	missense	23179	exon8			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.898C>A	1.37:g.183854019C>A	ENSP00000354097:p.Leu300Ile	Somatic		Capture	SOLID	Phase_I	182120642	NM_015149	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.28	2.489003	0.44249	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000543395;ENST00000360851;ENST00000539189	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.68	4.96	4.96	0.65561	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.144291	0.47852	D	0.000205	T	0.36717	0.0977	L	0.33668	1.02	0.53688	D	0.999975	P;P;B;P;P	0.37423	0.539;0.594;0.313;0.594;0.594	B;B;B;B;B	0.34873	0.12;0.191;0.111;0.119;0.191	T	0.31888	-0.9927	10	0.52906	T	0.07	.	12.9849	0.58586	0.0:0.9221:0.0:0.0779	.	300;298;105;300;335	F5H6U6;B7Z2W5;F5H3C3;Q9NZL6;Q5SXQ6	.;.;.;RGL1_HUMAN;.	I	335;335;298;105;300;300	ENSP00000303192:L335I;ENSP00000356501:L335I;ENSP00000438662:L298I;ENSP00000354097:L300I;ENSP00000437355:L300I	ENSP00000303192:L335I	L	+	1	0	RGL1	182120642	0.994000	0.37717	0.999000	0.59377	0.997000	0.91878	2.997000	0.49457	2.467000	0.83353	0.650000	0.86243	CTC		0.418	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
HMCN1	83872	hgsc.bcm.edu	37	1	186047328	186047328	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:186047328C>A	ENST00000271588.4	+	55	8804	c.8575C>A	c.(8575-8577)Ctt>Att	p.L2859I	HMCN1_ENST00000367492.2_Missense_Mutation_p.L2859I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2859	Ig-like C2-type 26.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.L2859I(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGAAGATTCCCTTCAATATGA	0.398																																					p.L2859I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8575A	1						.						236.0	219.0	225.0					1																	186047328		2203	4300	6503	184313951	SO:0001583	missense	83872	exon55			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8575C>A	1.37:g.186047328C>A	ENSP00000271588:p.Leu2859Ile	Somatic		Capture	SOLID	Phase_I	184313951	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056106	0.36277	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66815	-0.23;-0.23	5.5	5.5	0.81552	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.163476	0.52532	D	0.000072	T	0.69296	0.3095	L	0.31664	0.95	0.35887	D	0.829375	D	0.69078	0.997	D	0.80764	0.994	T	0.68025	-0.5518	10	0.15952	T	0.53	.	12.5102	0.56002	0.2804:0.7195:0.0:0.0	.	2859	Q96RW7	HMCN1_HUMAN	I	2859	ENSP00000271588:L2859I;ENSP00000356462:L2859I	ENSP00000271588:L2859I	L	+	1	0	HMCN1	184313951	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	3.538000	0.53597	2.595000	0.87683	0.655000	0.94253	CTT		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
KCNT2	343450	hgsc.bcm.edu	37	1	196577422	196577422	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:196577422G>A	ENST00000294725.9	-	1	933	c.18C>T	c.(16-18)agC>agT	p.S6S	KCNT2_ENST00000451324.2_5'UTR|KCNT2_ENST00000367431.4_Silent_p.S6S|KCNT2_ENST00000367433.5_Silent_p.S6S|KCNT2_ENST00000609185.1_Silent_p.S6S			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	6					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.S6S(2)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GGGGCACTTCGCTCTCCAAAT	0.507																																					p.S6S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C18T	1						.						135.0	113.0	121.0					1																	196577422		2203	4300	6503	194844045	SO:0001819	synonymous_variant	343450	exon1			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.18C>T	1.37:g.196577422G>A		Somatic		Capture	SOLID	Phase_I	194844045	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	37	CCDS1384.1																																																																																				0.507	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
PRKCZ	5590	hgsc.bcm.edu	37	1	1986898	1986898	+	IGR	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:1986898C>T								RP11-547D24.3 (5389 upstream) : PRKCZ (18002 downstream)														p.S30S(2)									TCATCACCAGCGTGGACGCCG	0.537																																					p.S30S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C90T	1						.						66.0	49.0	55.0					1																	1986898		2203	4300	6503	1976758	SO:0001628	intergenic_variant	5590	exon2																															1.37:g.1986898C>T		Somatic		Capture	SOLID	Phase_I	1976758	NM_002744		Silent	SNP		37																																																																																				0	0.537								
ASPM	259266	hgsc.bcm.edu	37	1	197073533	197073533	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:197073533G>A	ENST00000367409.4	-	18	5104	c.4848C>T	c.(4846-4848)ttC>ttT	p.F1616F	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1616					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.F1616F(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TATAAGCTCGGAAATGAGTCT	0.383																																					p.F1616F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4848T	1						.						91.0	93.0	92.0					1																	197073533		2203	4298	6501	195340156	SO:0001819	synonymous_variant	259266	exon18			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.4848C>T	1.37:g.197073533G>A		Somatic		Capture	SOLID	Phase_I	195340156	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	37	CCDS1389.1																																																																																				0.383	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
LAD1	3898	hgsc.bcm.edu	37	1	201352263	201352263	+	Missense_Mutation	SNP	C	C	T	rs199664903		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:201352263C>T	ENST00000391967.2	-	7	1626	c.1325G>A	c.(1324-1326)cGc>cAc	p.R442H	LAD1_ENST00000367313.3_Missense_Mutation_p.R456H|LAD1_ENST00000488842.1_5'UTR	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	442						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)	p.R442H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						AAAGAGGTGGCGCTTGCTGGC	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		15313	0.001		0.0	False		,,,				2504	0.0				p.R442H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1325A	1						.						75.0	83.0	80.0					1																	201352263		2203	4300	6503	199618886	SO:0001583	missense	3898	exon7			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.1325G>A	1.37:g.201352263C>T	ENSP00000375829:p.Arg442His	Somatic		Capture	SOLID	Phase_I	199618886	NM_005558	O95614|Q96GD8	Missense_Mutation	SNP	ENST00000391967.2	37	CCDS1410.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	18.01	3.526852	0.64860	.	.	ENSG00000159166	ENST00000503578;ENST00000391967;ENST00000367313	T;T;T	0.61627	0.09;1.68;1.62	5.1	5.1	0.69264	.	0.000000	0.51477	D	0.000084	T	0.74176	0.3682	M	0.72894	2.215	0.45464	D	0.998434	D	0.89917	1.0	D	0.91635	0.999	T	0.77054	-0.2730	10	0.72032	D	0.01	-21.2517	14.0181	0.64536	0.0:1.0:0.0:0.0	.	442	O00515	LAD1_HUMAN	H	93;442;456	ENSP00000422687:R93H;ENSP00000375829:R442H;ENSP00000356282:R456H	ENSP00000356282:R456H	R	-	2	0	LAD1	199618886	1.000000	0.71417	1.000000	0.80357	0.169000	0.22640	4.089000	0.57685	2.385000	0.81259	0.561000	0.74099	CGC		0.587	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1	NM_005558	
NFASC	23114	hgsc.bcm.edu	37	1	204937483	204937483	+	Silent	SNP	C	C	T	rs140997318	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:204937483C>T	ENST00000401399.1	+	8	1012	c.813C>T	c.(811-813)tcC>tcT	p.S271S	NFASC_ENST00000403080.1_Silent_p.S271S|NFASC_ENST00000367170.4_Silent_p.S271S|NFASC_ENST00000367171.4_Silent_p.S271S|NFASC_ENST00000360049.4_Silent_p.S282S|NFASC_ENST00000404907.1_Silent_p.S282S|NFASC_ENST00000404076.1_Silent_p.S265S|NFASC_ENST00000367169.4_Silent_p.S271S|NFASC_ENST00000513543.1_Silent_p.S282S|NFASC_ENST00000367172.4_Silent_p.S271S|NFASC_ENST00000539706.1_Silent_p.S282S|NFASC_ENST00000338515.6_Silent_p.S271S|NFASC_ENST00000338586.6_Silent_p.S271S|NFASC_ENST00000339876.6_Silent_p.S271S			O94856	NFASC_HUMAN	neurofascin	271	Ig-like C2-type 3.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.S282S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCATCGCCTCCGGGGTGTATG	0.557																																					p.S282S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C846T	1						.	C	,,,,,	0,4406		0,0,2203	107.0	85.0	93.0		813,813,846,846,795,846	-9.9	0.9	1	dbSNP_134	93	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NFASC	NM_001005388.2,NM_001005389.1,NM_001160331.1,NM_001160332.1,NM_001160333.1,NM_015090.3	,,,,,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,,,,,	271/1241,271/620,282/1190,282/1175,265/614,282/1170	204937483	3,13003	2203	4300	6503	203204106	SO:0001819	synonymous_variant	23114	exon7			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.813C>T	1.37:g.204937483C>T		Somatic		Capture	SOLID	Phase_I	203204106	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Silent	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.497972	0.26861	0.0	3.49E-4	ENSG00000163531	ENST00000367173	.	.	.	4.93	-9.86	0.00473	.	.	.	.	.	T	0.44393	0.1291	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53222	-0.8469	4	.	.	.	.	7.2635	0.26217	0.2824:0.124:0.0:0.5936	.	.	.	.	L	241	.	.	P	+	2	0	NFASC	203204106	0.000000	0.05858	0.885000	0.34714	0.973000	0.67179	-3.459000	0.00464	-1.434000	0.01975	-0.141000	0.14075	CCG		0.557	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
CNTN2	6900	hgsc.bcm.edu	37	1	205034949	205034949	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:205034949C>T	ENST00000331830.4	+	14	2012	c.1728C>T	c.(1726-1728)aaC>aaT	p.N576N		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	576	Ig-like C2-type 6.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.N576N(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCATCCTGAACGCCCAGCTGC	0.642																																					p.N576N	Melanoma(183;2548 2817 37099 41192)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1728T	1						.						87.0	78.0	81.0					1																	205034949		2203	4300	6503	203301572	SO:0001819	synonymous_variant	6900	exon14			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1728C>T	1.37:g.205034949C>T		Somatic		Capture	SOLID	Phase_I	203301572	NM_005076	P78432|Q5T054	Silent	SNP	ENST00000331830.4	37	CCDS1449.1																																																																																				0.642	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
C4BPA	722	hgsc.bcm.edu	37	1	207314569	207314569	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:207314569G>A	ENST00000367070.3	+	10	1586	c.1392G>A	c.(1390-1392)gcG>gcA	p.A464A		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	464	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.A464A(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						TCGGACAGGCGAAACTCTCCT	0.423																																					p.A464A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1392A	1						.						96.0	98.0	97.0					1																	207314569		2203	4300	6503	205381192	SO:0001819	synonymous_variant	722	exon10			M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.1392G>A	1.37:g.207314569G>A		Somatic		Capture	SOLID	Phase_I	205381192	NM_000715	Q5VVQ8	Silent	SNP	ENST00000367070.3	37	CCDS1477.1																																																																																				0.423	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088089.3		
CD55	1604	hgsc.bcm.edu	37	1	207500115	207500115	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:207500115G>A	ENST00000367064.3	+	5	855	c.597G>A	c.(595-597)tcG>tcA	p.S199S	CD55_ENST00000391920.4_Silent_p.S199S|CD55_ENST00000314754.8_Silent_p.S199S|CD55_ENST00000391921.4_Silent_p.S135S|CD55_ENST00000367067.4_3'UTR|CD55_ENST00000367062.4_Silent_p.S199S|CD55_ENST00000465534.1_3'UTR|CD55_ENST00000367063.2_Silent_p.S199S|CD55_ENST00000367065.5_Silent_p.S199S	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	199	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.		S -> L (in Dr(a-) antigen; dbSNP:rs56283594). {ECO:0000269|PubMed:7519480}.		CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)	p.S199S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	TATTTGGCTCGACTTCTAGTT	0.383																																					p.S199S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G597A	1						.						222.0	218.0	219.0					1																	207500115		2203	4300	6503	205566738	SO:0001819	synonymous_variant	1604	exon5			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.597G>A	1.37:g.207500115G>A		Somatic		Capture	SOLID	Phase_I	205566738	NM_000574	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Silent	SNP	ENST00000367064.3	37	CCDS31006.1	.	.	.	.	.	.	.	.	.	.	G	2.649	-0.282391	0.05642	.	.	ENSG00000196352	ENST00000343420	.	.	.	4.97	1.25	0.21368	.	.	.	.	.	T	0.25195	0.0612	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.24368	-1.0162	4	.	.	.	.	5.1685	0.15098	0.5744:0.3273:0.0983:0.0	.	.	.	.	Q	209	.	.	R	+	2	0	CD55	205566738	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.237000	0.08990	0.037000	0.15575	-0.312000	0.09012	CGA		0.383	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574	
CDA	978	hgsc.bcm.edu	37	1	20931528	20931528	+	Missense_Mutation	SNP	G	G	A	rs150100090		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:20931528G>A	ENST00000375071.3	+	2	444	c.262G>A	c.(262-264)Gcc>Acc	p.A88T	CDA_ENST00000461985.1_3'UTR	NM_001785.2	NP_001776.1	P32320	CDD_HUMAN	cytidine deaminase	88	CMP/dCMP deaminase zinc-binding.				cell surface receptor signaling pathway (GO:0007166)|cytidine deamination (GO:0009972)|cytosine metabolic process (GO:0019858)|negative regulation of cell growth (GO:0030308)|negative regulation of nucleotide metabolic process (GO:0045980)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine-containing compound salvage (GO:0008655)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	cytidine deaminase activity (GO:0004126)|nucleoside binding (GO:0001882)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.A88T(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	7		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	AATTGCTATCGCCAGGTGAGT	0.453																																					p.A88T	Pancreas(74;49 1356 2772 27818 40529)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G262A	1						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	81.0	72.0	75.0		262	-4.2	0.1	1	dbSNP_134	75	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDA	NM_001785.2	58	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	88/147	20931528	2,13004	2203	4300	6503	20804115	SO:0001583	missense	978	exon2			BC054036	CCDS210.1	1p36.2-p35	2008-02-05			ENSG00000158825	ENSG00000158825	3.5.4.5		1712	protein-coding gene	gene with protein product		123920				8422236, 9878810	Standard	NM_001785		Approved	CDD	uc001bdk.3	P32320	OTTHUMG00000002845	ENST00000375071.3:c.262G>A	1.37:g.20931528G>A	ENSP00000364212:p.Ala88Thr	Somatic		Capture	SOLID	Phase_I	20804115	NM_001785		Missense_Mutation	SNP	ENST00000375071.3	37	CCDS210.1	.	.	.	.	.	.	.	.	.	.	G	6.960	0.546986	0.13312	2.27E-4	1.16E-4	ENSG00000158825	ENST00000375071	T	0.43294	0.95	5.74	-4.17	0.03857	APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);CMP/dCMP deaminase, zinc-binding (1);	0.505269	0.22145	N	0.063981	T	0.21550	0.0519	L	0.33339	1.005	0.20403	N	0.999904	B	0.32302	0.363	B	0.25614	0.062	T	0.33879	-0.9851	10	0.12766	T	0.61	.	10.6708	0.45757	0.0735:0.0:0.3531:0.5734	.	88	P32320	CDD_HUMAN	T	88	ENSP00000364212:A88T	ENSP00000364212:A88T	A	+	1	0	CDA	20804115	0.322000	0.24634	0.050000	0.19076	0.178000	0.23041	0.236000	0.17967	-0.598000	0.05806	-0.226000	0.12346	GCC		0.453	CDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007965.1	NM_001785	
TRAF3IP3	80342	hgsc.bcm.edu	37	1	209933430	209933430	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:209933430G>A	ENST00000367024.1	+	3	562	c.46G>A	c.(46-48)Gct>Act	p.A16T	TRAF3IP3_ENST00000400959.3_Missense_Mutation_p.A16T|TRAF3IP3_ENST00000367026.3_Missense_Mutation_p.A16T|TRAF3IP3_ENST00000367025.3_Missense_Mutation_p.A16T|TRAF3IP3_ENST00000010338.4_Missense_Mutation_p.A16T			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	16						integral component of membrane (GO:0016021)		p.A16T(1)		breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		GGCCCGGTGGGCTGAGAGCTA	0.622																																					p.A16T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G46A	1						.						27.0	27.0	27.0					1																	209933430		2203	4300	6503	208000053	SO:0001583	missense	80342	exon3				CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.46G>A	1.37:g.209933430G>A	ENSP00000355991:p.Ala16Thr	Somatic		Capture	SOLID	Phase_I	208000053	NM_025228	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Missense_Mutation	SNP	ENST00000367024.1	37	CCDS1490.2	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230700	0.58777	.	.	ENSG00000009790	ENST00000400959;ENST00000367025;ENST00000479796;ENST00000458110;ENST00000367026;ENST00000367024;ENST00000010338	T;T;T;T;T	0.54866	0.55;0.69;0.6;0.69;0.6	5.66	2.69	0.31865	.	0.480362	0.19815	N	0.105445	T	0.43743	0.1261	M	0.63428	1.95	0.27071	N	0.963319	B;B;B;B	0.30709	0.291;0.018;0.117;0.019	B;B;B;B	0.26693	0.072;0.018;0.043;0.021	T	0.43343	-0.9397	10	0.56958	D	0.05	-1.5786	5.221	0.15368	0.1789:0.1691:0.652:0.0	.	16;16;16;16	Q9Y228;Q9Y228-2;Q9Y228-3;E2QRE5	T3JAM_HUMAN;.;.;.	T	16	ENSP00000383743:A16T;ENSP00000355992:A16T;ENSP00000355993:A16T;ENSP00000355991:A16T;ENSP00000010338:A16T	ENSP00000010338:A16T	A	+	1	0	TRAF3IP3	208000053	0.943000	0.32029	0.997000	0.53966	0.987000	0.75469	1.577000	0.36515	0.694000	0.31654	0.655000	0.94253	GCT		0.622	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088734.2		
DTL	51514	hgsc.bcm.edu	37	1	212218015	212218015	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:212218015A>G	ENST00000366991.4	+	3	506	c.192A>G	c.(190-192)gaA>gaG	p.E64E	DTL_ENST00000542077.1_Silent_p.E22E|DTL_ENST00000475419.1_3'UTR	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	64					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.E64E(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		CCAATATGGAACATGTACTAG	0.348																																					p.E64E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A192G	1						.						65.0	67.0	66.0					1																	212218015		2203	4300	6503	210284638	SO:0001819	synonymous_variant	51514	exon3			AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.192A>G	1.37:g.212218015A>G		Somatic		Capture	SOLID	Phase_I	210284638	NM_016448	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Silent	SNP	ENST00000366991.4	37	CCDS1502.1																																																																																				0.348	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448	
CENPF	1063	hgsc.bcm.edu	37	1	214828690	214828690	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:214828690A>T	ENST00000366955.3	+	17	8597	c.8429A>T	c.(8428-8430)gAg>gTg	p.E2810V		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2906	Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E2810V(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAGGAAAAGGAGATACTGCAG	0.418																																					p.E2810V	Colon(80;575 1284 11000 14801 43496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8429T	1						.						87.0	88.0	88.0					1																	214828690		2203	4300	6503	212895313	SO:0001583	missense	1063	exon17			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.8429A>T	1.37:g.214828690A>T	ENSP00000355922:p.Glu2810Val	Somatic		Capture	SOLID	Phase_I	212895313	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446530	0.25987	.	.	ENSG00000117724	ENST00000366955	T	0.04706	3.57	5.81	2.27	0.28462	.	0.428903	0.16993	N	0.191216	T	0.03739	0.0106	L	0.31926	0.97	0.31176	N	0.702676	B	0.21905	0.062	B	0.18871	0.023	T	0.21724	-1.0237	10	0.35671	T	0.21	.	4.3489	0.11146	0.6988:0.0:0.1546:0.1466	.	2906	P49454	CENPF_HUMAN	V	2810	ENSP00000355922:E2810V	ENSP00000355922:E2810V	E	+	2	0	CENPF	212895313	0.991000	0.36638	0.399000	0.26333	0.230000	0.25150	3.010000	0.49559	0.455000	0.26910	0.533000	0.62120	GAG		0.418	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
USH2A	7399	hgsc.bcm.edu	37	1	215953272	215953272	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:215953272C>T	ENST00000307340.3	-	55	11238	c.10852G>A	c.(10852-10854)Ggc>Agc	p.G3618S	USH2A_ENST00000366943.2_Missense_Mutation_p.G3618S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3618	Fibronectin type-III 21. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G3618S(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTAATGACGCCGTTTGATTTC	0.517										HNSCC(13;0.011)																											p.G3618S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10852A	1						.						182.0	144.0	157.0					1																	215953272		2203	4300	6503	214019895	SO:0001583	missense	7399	exon55			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10852G>A	1.37:g.215953272C>T	ENSP00000305941:p.Gly3618Ser	Somatic		Capture	SOLID	Phase_I	214019895	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805098	0.90623	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.59772	0.24;0.24	5.9	5.9	0.94986	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.146541	0.31134	N	0.008197	D	0.82958	0.5150	H	0.94462	3.54	0.51767	D	0.999938	D	0.89917	1.0	D	0.64877	0.93	D	0.86755	0.1963	10	0.72032	D	0.01	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	3618	O75445	USH2A_HUMAN	S	3618	ENSP00000305941:G3618S;ENSP00000355910:G3618S	ENSP00000305941:G3618S	G	-	1	0	USH2A	214019895	0.887000	0.30362	0.983000	0.44433	0.980000	0.70556	3.550000	0.53691	2.790000	0.95986	0.650000	0.86243	GGC		0.517	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USP48	84196	hgsc.bcm.edu	37	1	22005928	22005928	+	Silent	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:22005928A>T	ENST00000308271.9	-	27	3738	c.3090T>A	c.(3088-3090)acT>acA	p.T1030T	USP48_ENST00000529637.1_Silent_p.T1042T|USP48_ENST00000400301.1_Silent_p.T978T|USP48_ENST00000374732.3_Silent_p.T516T|USP48_ENST00000479177.1_5'UTR	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	1030					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.T1030T(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CAAGAAGACCAGTACCTGGGA	0.413																																					p.T1030T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3090A	1						.						127.0	121.0	123.0					1																	22005928		2203	4300	6503	21878515	SO:0001819	synonymous_variant	84196	exon27			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.3090T>A	1.37:g.22005928A>T		Somatic		Capture	SOLID	Phase_I	21878515	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000308271.9	37	CCDS30623.1																																																																																				0.413	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
ESRRG	2104	hgsc.bcm.edu	37	1	216737606	216737606	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:216737606C>T	ENST00000408911.3	-	5	970	c.817G>A	c.(817-819)Gac>Aac	p.D273N	ESRRG_ENST00000391890.3_Missense_Mutation_p.D257N|ESRRG_ENST00000463665.1_Missense_Mutation_p.D211N|ESRRG_ENST00000366940.2_Missense_Mutation_p.D250N|ESRRG_ENST00000487276.1_Missense_Mutation_p.D250N|ESRRG_ENST00000361395.2_Missense_Mutation_p.D250N|ESRRG_ENST00000361525.3_Missense_Mutation_p.D250N|ESRRG_ENST00000360012.3_Missense_Mutation_p.D250N|ESRRG_ENST00000493603.1_Missense_Mutation_p.D250N|ESRRG_ENST00000493748.1_Missense_Mutation_p.D250N|ESRRG_ENST00000366938.2_Missense_Mutation_p.D250N|ESRRG_ENST00000359162.2_Missense_Mutation_p.D250N|ESRRG_ENST00000366937.1_Missense_Mutation_p.D285N	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	273					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.D273N(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AACTCTCGGTCGGCCAAGTCA	0.458																																					p.D250N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G748A	1						.						173.0	152.0	159.0					1																	216737606		2203	4300	6503	214804229	SO:0001583	missense	2104	exon6			AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.817G>A	1.37:g.216737606C>T	ENSP00000386171:p.Asp273Asn	Somatic		Capture	SOLID	Phase_I	214804229	NM_206595	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721077	0.89205	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09	5.56	5.56	0.83823	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.97685	0.9241	M	0.64080	1.96	0.80722	D	1	P;D;D	0.89917	0.618;1.0;1.0	B;D;D	0.71414	0.204;0.968;0.973	D	0.98085	1.0406	10	0.62326	D	0.03	.	19.5216	0.95187	0.0:1.0:0.0:0.0	.	211;285;273	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	N	250;250;285;273;250;250;250;250;250;257;211;250;250;250;250	ENSP00000355225:D250N;ENSP00000355907:D250N;ENSP00000355904:D285N;ENSP00000386171:D273N;ENSP00000352077:D250N;ENSP00000354584:D250N;ENSP00000355905:D250N;ENSP00000353108:D250N;ENSP00000419594:D250N;ENSP00000375761:D257N;ENSP00000418629:D211N;ENSP00000419155:D250N;ENSP00000417374:D250N;ENSP00000419514:D250N	ENSP00000346386:D250N	D	-	1	0	ESRRG	214804229	1.000000	0.71417	0.895000	0.35142	0.667000	0.39255	7.818000	0.86416	2.605000	0.88082	0.655000	0.94253	GAC		0.458	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
LYST	1130	hgsc.bcm.edu	37	1	235922642	235922642	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:235922642C>T	ENST00000389794.3	-	23	6685	c.6511G>A	c.(6511-6513)Gca>Aca	p.A2171T	LYST_ENST00000389793.2_Missense_Mutation_p.A2171T|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2171					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.A2171T(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ACAGTTTTTGCAGACTCACAG	0.458																																					p.A2171T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6511A	1						.						167.0	159.0	162.0					1																	235922642		2203	4300	6503	233989265	SO:0001583	missense	1130	exon23			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6511G>A	1.37:g.235922642C>T	ENSP00000374444:p.Ala2171Thr	Somatic		Capture	SOLID	Phase_I	233989265	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917319	0.92249	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.69175	-0.38;-0.38	5.23	5.23	0.72850	.	8.352320	0.00166	N	0.000000	T	0.78861	0.4350	M	0.70595	2.14	0.80722	D	1	P	0.44627	0.839	P	0.46320	0.512	T	0.67385	-0.5684	10	0.62326	D	0.03	.	18.8504	0.92225	0.0:1.0:0.0:0.0	.	2171	Q99698	LYST_HUMAN	T	2171	ENSP00000374444:A2171T;ENSP00000374443:A2171T	ENSP00000374443:A2171T	A	-	1	0	LYST	233989265	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.360000	0.66086	2.463000	0.83235	0.558000	0.71614	GCA		0.458	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
LYST	1130	hgsc.bcm.edu	37	1	235969825	235969825	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:235969825G>A	ENST00000389794.3	-	6	2785	c.2611C>T	c.(2611-2613)Ctc>Ttc	p.L871F	LYST_ENST00000389793.2_Missense_Mutation_p.L871F|LYST_ENST00000536965.1_Missense_Mutation_p.L871F			Q99698	LYST_HUMAN	lysosomal trafficking regulator	871					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.L871F(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AATTTGCTGAGACTCTGAGGA	0.393																																					p.L871F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2611T	1						.						128.0	131.0	130.0					1																	235969825		2203	4300	6503	234036448	SO:0001583	missense	1130	exon6			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.2611C>T	1.37:g.235969825G>A	ENSP00000374444:p.Leu871Phe	Somatic		Capture	SOLID	Phase_I	234036448	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637356	0.87760	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.69561	-0.41;-0.41;0.7	5.48	5.48	0.80851	.	1.534660	0.03371	N	0.198983	D	0.84383	0.5460	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.70048	-0.4979	10	0.72032	D	0.01	.	18.968	0.92704	0.0:0.0:1.0:0.0	.	871;871	Q99698-3;Q99698	.;LYST_HUMAN	F	871	ENSP00000374444:L871F;ENSP00000374443:L871F;ENSP00000438315:L871F	ENSP00000374443:L871F	L	-	1	0	LYST	234036448	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.230000	0.95299	2.589000	0.87451	0.655000	0.94253	CTC		0.393	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
NID1	4811	hgsc.bcm.edu	37	1	236176845	236176845	+	Missense_Mutation	SNP	C	C	T	rs35714220	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:236176845C>T	ENST00000264187.6	-	11	2352	c.2270G>A	c.(2269-2271)cGc>cAc	p.R757H	NID1_ENST00000366595.3_Intron	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	757					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.R757H(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GTTGATGGGGCGCTGGTCCAC	0.537													C|||	65	0.0129792	0.0182	0.0058	5008	,	,		20239	0.0109		0.0149	False		,,,				2504	0.0112				p.R757H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2270A	1						.	C	HIS/ARG	73,4333	64.7+/-102.0	0,73,2130	101.0	90.0	94.0		2270	5.0	1.0	1	dbSNP_126	94	146,8454	72.3+/-134.9	0,146,4154	yes	missense	NID1	NM_002508.2	29	0,219,6284	TT,TC,CC		1.6977,1.6568,1.6838	benign	757/1248	236176845	219,12787	2203	4300	6503	234243468	SO:0001583	missense	4811	exon11			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2270G>A	1.37:g.236176845C>T	ENSP00000264187:p.Arg757His	Somatic		Capture	SOLID	Phase_I	234243468	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	37	CCDS1608.1	30	0.013736263736263736	13	0.026422764227642278	4	0.011049723756906077	6	0.01048951048951049	7	0.009234828496042216	C	15.60	2.881246	0.51801	0.016568	0.016977	ENSG00000116962	ENST00000264187	D	0.84146	-1.81	5.93	5.02	0.67125	.	0.100209	0.64402	D	0.000001	T	0.52661	0.1748	L	0.27053	0.805	0.80722	D	1	B	0.24721	0.11	B	0.20955	0.032	T	0.62338	-0.6875	10	0.14252	T	0.57	.	12.3475	0.55130	0.0:0.8602:0.0:0.1398	rs35714220	757	P14543	NID1_HUMAN	H	757	ENSP00000264187:R757H	ENSP00000264187:R757H	R	-	2	0	NID1	234243468	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	3.236000	0.51336	1.503000	0.48686	0.655000	0.94253	CGC		0.537	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
CHML	1122	hgsc.bcm.edu	37	1	241797993	241797993	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:241797993G>A	ENST00000366553.1	-	1	1239	c.1076C>T	c.(1075-1077)gCa>gTa	p.A359V	OPN3_ENST00000331838.5_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	359					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.A359V(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			GTTTTTAGTTGCGTTAAGACC	0.403																																					p.A359V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1076T	1						.						121.0	120.0	121.0					1																	241797993		2203	4299	6502	239864616	SO:0001583	missense	1122	exon1			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1076C>T	1.37:g.241797993G>A	ENSP00000355511:p.Ala359Val	Somatic		Capture	SOLID	Phase_I	239864616	NM_001821	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	ENST00000366553.1	37	CCDS31073.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.256125	0.59321	.	.	ENSG00000203668	ENST00000366553	D	0.85702	-2.02	4.96	3.99	0.46301	.	0.334590	0.30940	U	0.008580	D	0.86781	0.6015	.	.	.	0.49798	D	0.999825	D	0.59357	0.985	P	0.52646	0.705	D	0.86713	0.1937	9	0.51188	T	0.08	-15.1191	12.6514	0.56764	0.0:0.0:0.8345:0.1655	.	359	P26374	RAE2_HUMAN	V	359	ENSP00000355511:A359V	ENSP00000355511:A359V	A	-	2	0	CHML	239864616	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	3.531000	0.53546	2.752000	0.94435	0.655000	0.94253	GCA		0.403	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821	
C1orf174	339448	hgsc.bcm.edu	37	1	3807331	3807331	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:3807331G>A	ENST00000361605.3	-	3	518	c.420C>T	c.(418-420)tcC>tcT	p.S140S	C1orf174_ENST00000486765.1_5'UTR	NM_207356.2	NP_997239.2	Q8IYL3	CA174_HUMAN	chromosome 1 open reading frame 174	140						nucleus (GO:0005634)		p.S140S(1)		endometrium(1)|large_intestine(5)|lung(4)|prostate(1)	11	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)		GTTTTGGCACGGACAGGCCAT	0.567																																					p.S140S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420T	1						.						87.0	78.0	81.0					1																	3807331		2203	4300	6503	3797191	SO:0001819	synonymous_variant	339448	exon3			BC035643	CCDS53.1	1p36.32	2012-07-25			ENSG00000198912	ENSG00000198912			27915	protein-coding gene	gene with protein product						12477932	Standard	NM_207356		Approved	RP13-531C17.2	uc001alf.3	Q8IYL3	OTTHUMG00000003739	ENST00000361605.3:c.420C>T	1.37:g.3807331G>A		Somatic		Capture	SOLID	Phase_I	3797191	NM_207356	A8K0C8|A8MUG9|Q5SR20|Q6NX36	Silent	SNP	ENST00000361605.3	37	CCDS53.1																																																																																				0.567	C1orf174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010539.1	NM_207356	
CATSPER4	378807	hgsc.bcm.edu	37	1	26527942	26527942	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:26527942T>A	ENST00000456354.2	+	9	1364	c.1297T>A	c.(1297-1299)Tca>Aca	p.S433T		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	433					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.S433T(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		GGAGACTACGTCATCCAAGGA	0.562																																					p.S433T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1297A	1						.						118.0	103.0	108.0					1																	26527942		2203	4300	6503	26400529	SO:0001583	missense	378807	exon9			BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.1297T>A	1.37:g.26527942T>A	ENSP00000390423:p.Ser433Thr	Somatic		Capture	SOLID	Phase_I	26400529	NM_198137	A1A4W6|Q5VY71	Missense_Mutation	SNP	ENST00000456354.2	37	CCDS30645.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580607	0.46006	.	.	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.97575	-4.44;-4.42	5.1	-0.23	0.13090	.	0.971924	0.08410	N	0.950035	D	0.93032	0.7782	L	0.54323	1.7	0.09310	N	1	B	0.18610	0.029	B	0.12837	0.008	T	0.81217	-0.1033	10	0.22109	T	0.4	-3.7129	0.2922	0.00260	0.2911:0.2116:0.1298:0.3675	.	433	Q7RTX7	CTSR4_HUMAN	T	433	ENSP00000341006:S433T;ENSP00000390423:S433T	ENSP00000341006:S433T	S	+	1	0	CATSPER4	26400529	0.004000	0.15560	0.004000	0.12327	0.197000	0.23852	-0.225000	0.09151	-0.025000	0.13918	0.260000	0.18958	TCA		0.562	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137	
CEP85	64793	hgsc.bcm.edu	37	1	26584709	26584709	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:26584709C>T	ENST00000252992.4	+	6	1244	c.1113C>T	c.(1111-1113)ggC>ggT	p.G371G	CEP85_ENST00000451429.2_Silent_p.G320G	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	371						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)		p.G371G(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						CCCTCTTGGGCCGCCCTGCCC	0.542																																					p.G371G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1113T	1						.						127.0	114.0	118.0					1																	26584709		2203	4300	6503	26457296	SO:0001819	synonymous_variant	64793	exon6			AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.1113C>T	1.37:g.26584709C>T		Somatic		Capture	SOLID	Phase_I	26457296	NM_022778	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Silent	SNP	ENST00000252992.4	37	CCDS277.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390666	0.25118	.	.	ENSG00000130695	ENST00000453146	.	.	.	6.04	3.96	0.45880	.	.	.	.	.	T	0.61887	0.2383	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57539	-0.7794	4	.	.	.	-13.7932	10.89	0.46990	0.0:0.8292:0.0:0.1708	.	.	.	.	V	45	.	.	A	+	2	0	CEP85	26457296	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.780000	0.26760	0.701000	0.31803	0.563000	0.77884	GCC		0.542	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009492.2	NM_022778	
SRSF4	6429	hgsc.bcm.edu	37	1	29475257	29475257	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:29475257G>A	ENST00000373795.4	-	6	1384	c.1150C>T	c.(1150-1152)Cga>Tga	p.R384*	SRSF4_ENST00000466448.1_5'UTR|SRSF4_ENST00000546138.1_3'UTR|RP11-242O24.3_ENST00000413004.1_lincRNA	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	384	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R384*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						ttgctgtctcgcttgctgcct	0.592																																					p.R384X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1150T	1						.						64.0	64.0	64.0					1																	29475257		2203	4300	6503	29347844	SO:0001587	stop_gained	6429	exon6			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.1150C>T	1.37:g.29475257G>A	ENSP00000362900:p.Arg384*	Somatic		Capture	SOLID	Phase_I	29347844	NM_005626	Q5VXP1|Q9BUA4|Q9UEB5	Nonsense_Mutation	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	G	36	5.760220	0.96898	.	.	ENSG00000116350	ENST00000373795	.	.	.	5.72	5.72	0.89469	.	0.326694	0.26334	N	0.024962	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	18.4606	0.90737	0.0:0.0:1.0:0.0	.	.	.	.	X	384	.	ENSP00000362900:R384X	R	-	1	2	SRSF4	29347844	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.538000	0.53597	2.691000	0.91804	0.655000	0.94253	CGA		0.592	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
MECR	51102	hgsc.bcm.edu	37	1	29543129	29543129	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:29543129A>T	ENST00000263702.6	-	2	270	c.245T>A	c.(244-246)aTc>aAc	p.I82N	MECR_ENST00000373791.3_Missense_Mutation_p.I6N|MECR_ENST00000489248.1_5'UTR			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	82					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)	p.I82N(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		AGATGGATTGATAGGGGCCGC	0.453																																					p.I6N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T17A	1						.						227.0	229.0	228.0					1																	29543129		2203	4300	6503	29415716	SO:0001583	missense	51102	exon2				CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.245T>A	1.37:g.29543129A>T	ENSP00000263702:p.Ile82Asn	Somatic		Capture	SOLID	Phase_I	29415716	NM_001024732	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.648489	0.87958	.	.	ENSG00000116353	ENST00000373791;ENST00000263702	T;T	0.57907	0.37;0.37	5.87	5.87	0.94306	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.138837	0.64402	D	0.000004	T	0.80555	0.4645	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86155	0.1590	10	0.87932	D	0	.	12.7209	0.57142	1.0:0.0:0.0:0.0	.	82	Q9BV79	MECR_HUMAN	N	6;82	ENSP00000362896:I6N;ENSP00000263702:I82N	ENSP00000263702:I82N	I	-	2	0	MECR	29415716	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.977000	0.88081	2.258000	0.74832	0.529000	0.55759	ATC		0.453	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011	
STK40	83931	hgsc.bcm.edu	37	1	36820917	36820917	+	Missense_Mutation	SNP	C	C	T	rs182214010		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:36820917C>T	ENST00000373129.3	-	6	866	c.460G>A	c.(460-462)Gct>Act	p.A154T	STK40_ENST00000373130.3_Missense_Mutation_p.A159T|STK40_ENST00000359297.2_Missense_Mutation_p.A154T|STK40_ENST00000482458.1_5'UTR|STK40_ENST00000373132.3_Missense_Mutation_p.A154T	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	154	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A154T(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				ATGAGGTCAGCGGTCTTATCG	0.552													C|||	1	0.000199681	0.0	0.0014	5008	,	,		25072	0.0		0.0	False		,,,				2504	0.0				p.A154T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G460A	1						.						283.0	244.0	257.0					1																	36820917		2203	4300	6503	36593504	SO:0001583	missense	83931	exon6			BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.460G>A	1.37:g.36820917C>T	ENSP00000362221:p.Ala154Thr	Somatic		Capture	SOLID	Phase_I	36593504	NM_032017	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Missense_Mutation	SNP	ENST00000373129.3	37	CCDS407.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	26.6	4.748783	0.89753	.	.	ENSG00000196182	ENST00000373129;ENST00000359297;ENST00000373130;ENST00000373132	T;T;T;T	0.63744	-0.06;1.98;1.98;-0.06	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74854	0.3771	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;0.958;0.966	D;B;P	0.83275	0.996;0.43;0.566	T	0.74022	-0.3798	10	0.54805	T	0.06	-15.0062	19.2828	0.94058	0.0:1.0:0.0:0.0	.	154;159;154	Q8N2I9-3;Q8N2I9-4;Q8N2I9	.;.;STK40_HUMAN	T	154;154;159;154	ENSP00000362221:A154T;ENSP00000352245:A154T;ENSP00000362222:A159T;ENSP00000362224:A154T	ENSP00000352245:A154T	A	-	1	0	STK40	36593504	1.000000	0.71417	0.723000	0.30687	0.884000	0.51177	7.450000	0.80656	2.804000	0.96469	0.462000	0.41574	GCT		0.552	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022592.1	NM_032017	
ZMPSTE24	10269	hgsc.bcm.edu	37	1	40737687	40737687	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:40737687C>T	ENST00000372759.3	+	6	914	c.749C>T	c.(748-750)aCg>aTg	p.T250M		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	250					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)	p.T250M(1)		endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			TTTCCTTTGACGAAGGTGTAT	0.333																																					p.T250M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C749T	1						.						112.0	108.0	109.0					1																	40737687		2203	4300	6503	40510274	SO:0001583	missense	10269	exon6			Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.749C>T	1.37:g.40737687C>T	ENSP00000361845:p.Thr250Met	Somatic		Capture	SOLID	Phase_I	40510274	NM_005857	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Missense_Mutation	SNP	ENST00000372759.3	37	CCDS449.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527676	0.85706	.	.	ENSG00000084073	ENST00000372759	T	0.74842	-0.88	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.85548	0.5722	M	0.72479	2.2	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	D	0.86468	0.1783	10	0.59425	D	0.04	-0.7817	18.5458	0.91045	0.0:1.0:0.0:0.0	.	250	O75844	FACE1_HUMAN	M	250	ENSP00000361845:T250M	ENSP00000361845:T250M	T	+	2	0	ZMPSTE24	40510274	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.301000	0.78850	2.474000	0.83562	0.579000	0.79373	ACG		0.333	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1		
SZT2	23334	hgsc.bcm.edu	37	1	43892440	43892440	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:43892440G>A	ENST00000562955.1	+	22	3098	c.3098G>A	c.(3097-3099)gGc>gAc	p.G1033D	SZT2_ENST00000372442.1_Missense_Mutation_p.G191D	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1090					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.G191D(2)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CAAGCAGTCGGCAGCACCCAG	0.607																																					p.G191D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G572A	1						.						67.0	54.0	58.0					1																	43892440		2203	4300	6503	43665027	SO:0001583	missense	23334	exon8			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.3098G>A	1.37:g.43892440G>A	ENSP00000457168:p.Gly1033Asp	Somatic		Capture	SOLID	Phase_I	43665027	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	G	1.861	-0.462587	0.04508	.	.	ENSG00000198198	ENST00000372442	.	.	.	4.34	-0.72	0.11195	.	1.129380	0.06286	N	0.698325	T	0.14098	0.0341	N	0.02011	-0.69	0.09310	N	1	B	0.11235	0.004	B	0.14023	0.01	T	0.22312	-1.0220	9	0.31617	T	0.26	.	5.6367	0.17540	0.1288:0.0:0.4536:0.4175	.	1033	Q5T011-5	.	D	191	.	ENSP00000361519:G191D	G	+	2	0	SZT2	43665027	0.152000	0.22762	0.000000	0.03702	0.003000	0.03518	0.288000	0.18939	-0.532000	0.06332	-2.732000	0.00129	GGC		0.607	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
ST3GAL3	6487	hgsc.bcm.edu	37	1	44364908	44364908	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:44364908G>A	ENST00000361392.4	+	8	707	c.530G>A	c.(529-531)cGa>cAa	p.R177Q	ST3GAL3_ENST00000372368.2_Missense_Mutation_p.R231Q|ST3GAL3_ENST00000353126.3_Missense_Mutation_p.R177Q|ST3GAL3_ENST00000372375.2_Missense_Mutation_p.R231Q|ST3GAL3_ENST00000372377.4_Intron|ST3GAL3_ENST00000372362.2_Intron|ST3GAL3_ENST00000372365.1_Missense_Mutation_p.R177Q|ST3GAL3_ENST00000531993.1_Missense_Mutation_p.R161Q|ST3GAL3_ENST00000372367.1_Missense_Mutation_p.R176Q|ST3GAL3_ENST00000335430.6_Missense_Mutation_p.R161Q|ST3GAL3_ENST00000461375.1_3'UTR|ST3GAL3_ENST00000545417.1_Intron|ST3GAL3_ENST00000347631.2_Missense_Mutation_p.R192Q|ST3GAL3_ENST00000533933.1_Missense_Mutation_p.R177Q|ST3GAL3_ENST00000361812.4_Intron|ST3GAL3_ENST00000531451.1_Intron|ST3GAL3_ENST00000351035.3_Missense_Mutation_p.R215Q|ST3GAL3_ENST00000330208.2_Intron|ST3GAL3_ENST00000372369.1_Missense_Mutation_p.R177Q|ST3GAL3_ENST00000372374.2_Missense_Mutation_p.R146Q|ST3GAL3_ENST00000531816.1_Intron|ST3GAL3_ENST00000332628.6_Missense_Mutation_p.R146Q|ST3GAL3_ENST00000528371.1_Missense_Mutation_p.R161Q|ST3GAL3_ENST00000262915.3_Missense_Mutation_p.R246Q|ST3GAL3_ENST00000372366.1_Missense_Mutation_p.R176Q|ST3GAL3_ENST00000372372.2_Missense_Mutation_p.R215Q|ST3GAL3_ENST00000361746.4_Missense_Mutation_p.R246Q|ST3GAL3_ENST00000361400.4_Missense_Mutation_p.R161Q	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3	177					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)	p.R246Q(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				CTGGGGTCACGAATTGACGAC	0.587																																					p.R192Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G575A	1						.						144.0	129.0	134.0					1																	44364908		2203	4300	6503	44137495	SO:0001583	missense	6487	exon8			L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.530G>A	1.37:g.44364908G>A	ENSP00000355341:p.Arg177Gln	Somatic		Capture	SOLID	Phase_I	44137495	NM_174964	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Missense_Mutation	SNP	ENST00000361392.4	37	CCDS492.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595638	0.66219	.	.	ENSG00000126091	ENST00000361392;ENST00000361400;ENST00000262915;ENST00000372375;ENST00000351035;ENST00000372374;ENST00000353126;ENST00000335430;ENST00000347631;ENST00000372369;ENST00000361746;ENST00000372367;ENST00000372366;ENST00000372365;ENST00000372368;ENST00000372372;ENST00000528371;ENST00000531993;ENST00000533933;ENST00000332628	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6	5.72	4.81	0.61882	.	0.129317	0.49305	D	0.000144	T	0.23688	0.0573	N	0.11698	0.16	0.80722	D	1	D;D;P;P;D;P;D;D;P;D;P;D;P;D	0.60160	0.972;0.964;0.948;0.948;0.964;0.927;0.985;0.984;0.723;0.985;0.538;0.978;0.538;0.987	P;B;B;B;B;B;P;P;B;P;B;P;B;P	0.55749	0.612;0.312;0.182;0.182;0.312;0.241;0.612;0.676;0.146;0.612;0.101;0.732;0.146;0.783	T	0.02275	-1.1184	10	0.25106	T	0.35	.	5.469	0.16660	0.266:0.0:0.734:0.0	.	177;130;161;176;161;176;146;177;215;161;231;177;246;192	Q11203-5;Q11203-21;Q11203-17;Q11203-24;Q11203-16;Q11203-23;Q11203-7;Q11203-8;Q11203-19;Q11203-15;Q11203-13;Q11203;Q11203-4;Q5T4W8	.;.;.;.;.;.;.;.;.;.;.;SIAT6_HUMAN;.;.	Q	177;161;246;231;215;146;177;161;192;177;246;176;176;177;231;215;161;161;177;146	ENSP00000355341:R177Q;ENSP00000354748:R161Q;ENSP00000262915:R246Q;ENSP00000361450:R231Q;ENSP00000316999:R215Q;ENSP00000361449:R146Q;ENSP00000330463:R177Q;ENSP00000335633:R161Q;ENSP00000317192:R192Q;ENSP00000361444:R177Q;ENSP00000354657:R246Q;ENSP00000361442:R176Q;ENSP00000361441:R176Q;ENSP00000361440:R177Q;ENSP00000361443:R231Q;ENSP00000361447:R215Q;ENSP00000434876:R161Q;ENSP00000432682:R161Q;ENSP00000432965:R177Q;ENSP00000329755:R146Q	ENSP00000262915:R246Q	R	+	2	0	ST3GAL3	44137495	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	4.642000	0.61383	2.711000	0.92665	0.655000	0.94253	CGA		0.587	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963	
DPH2	1802	hgsc.bcm.edu	37	1	44438180	44438180	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:44438180C>T	ENST00000255108.3	+	6	1611	c.1439C>T	c.(1438-1440)gCc>gTc	p.A480V	DPH2_ENST00000396758.2_Missense_Mutation_p.A252V|ATP6V0B_ENST00000236067.4_5'Flank|DPH2_ENST00000412950.2_Missense_Mutation_p.A345V|ATP6V0B_ENST00000472174.2_5'Flank|ATP6V0B_ENST00000471859.2_5'Flank|ATP6V0B_ENST00000532642.1_5'Flank	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	480					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)		p.A480V(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				CGAGGGATTGCCATCGCCTAT	0.572																																					p.A252V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C755T	1						.						127.0	105.0	112.0					1																	44438180		2203	4300	6503	44210767	SO:0001583	missense	1802	exon5			AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.1439C>T	1.37:g.44438180C>T	ENSP00000255108:p.Ala480Val	Somatic		Capture	SOLID	Phase_I	44210767	NM_001039589	A8MVC9|B2RDE3|B4DNI8|O60623	Missense_Mutation	SNP	ENST00000255108.3	37	CCDS504.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258952	0.59321	.	.	ENSG00000132768	ENST00000255108;ENST00000412950;ENST00000396758;ENST00000459879	.	.	.	5.21	4.23	0.50019	.	0.110491	0.64402	D	0.000010	T	0.73434	0.3586	M	0.85197	2.74	0.58432	D	0.999999	D;P;P	0.61697	0.99;0.877;0.78	P;B;B	0.50659	0.647;0.335;0.335	T	0.80379	-0.1407	9	0.72032	D	0.01	-6.074	15.2053	0.73175	0.0:0.8589:0.1411:0.0	.	345;252;480	B4DNI8;A8MVC9;Q9BQC3	.;.;DPH2_HUMAN	V	480;345;252;253	.	ENSP00000255108:A480V	A	+	2	0	DPH2	44210767	1.000000	0.71417	0.925000	0.36789	0.207000	0.24258	5.655000	0.67981	2.430000	0.82344	0.555000	0.69702	GCC		0.572	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022832.1	NM_001384	
TOE1	114034	hgsc.bcm.edu	37	1	45808807	45808807	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:45808807C>A	ENST00000372090.5	+	8	1549	c.966C>A	c.(964-966)gaC>gaA	p.D322E	TOE1_ENST00000495703.1_3'UTR|TESK2_ENST00000486676.1_5'Flank|TOE1_ENST00000539779.1_Missense_Mutation_p.D242E|MUTYH_ENST00000531105.1_5'Flank|MUTYH_ENST00000372098.3_5'Flank|MUTYH_ENST00000372110.3_5'Flank|MUTYH_ENST00000529984.1_5'Flank|MUTYH_ENST00000528332.2_5'Flank|MUTYH_ENST00000372115.3_5'Flank|MUTYH_ENST00000450313.1_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	322						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.D322E(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					ACGATATTGACCTTATCATTG	0.562																																					p.D322E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C966A	1						.						101.0	102.0	102.0					1																	45808807		2203	4300	6503	45581394	SO:0001583	missense	114034	exon8				CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.966C>A	1.37:g.45808807C>A	ENSP00000361162:p.Asp322Glu	Somatic		Capture	SOLID	Phase_I	45581394	NM_025077	B4DEM6|Q6IA35|Q8IWN5|Q9H846	Missense_Mutation	SNP	ENST00000372090.5	37	CCDS521.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165275	0.78339	.	.	ENSG00000132773	ENST00000372090;ENST00000539779	T;T	0.21734	1.99;1.99	5.99	4.14	0.48551	Zinc finger, CCCH-type (1);	0.000000	0.85682	D	0.000000	T	0.40171	0.1106	M	0.76170	2.325	0.58432	D	0.999999	D;D	0.62365	0.991;0.991	D;P	0.63283	0.913;0.85	T	0.18335	-1.0340	10	0.56958	D	0.05	-22.2539	8.6087	0.33789	0.1244:0.7551:0.0:0.1205	.	242;322	B4DEM6;Q96GM8	.;TOE1_HUMAN	E	322;242	ENSP00000361162:D322E;ENSP00000438900:D242E	ENSP00000361162:D322E	D	+	3	2	TOE1	45581394	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.862000	0.39448	0.874000	0.35823	0.655000	0.94253	GAC		0.562	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020517.1	NM_025077	
CYP4B1	1580	hgsc.bcm.edu	37	1	47264880	47264880	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:47264880A>G	ENST00000271153.4	+	1	163	c.127A>G	c.(127-129)Atg>Gtg	p.M43V	CYP4B1_ENST00000371919.4_Missense_Mutation_p.M43V|CYP4B1_ENST00000371923.4_Missense_Mutation_p.M43V|CYP4B1_ENST00000546128.1_Intron			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	43					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.M43V(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	GGCTAAGGCTATGGACAAATT	0.577																																					p.M43V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A127G	1						.						59.0	51.0	54.0					1																	47264880		2203	4300	6503	47037467	SO:0001583	missense	1580	exon1			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.127A>G	1.37:g.47264880A>G	ENSP00000271153:p.Met43Val	Somatic		Capture	SOLID	Phase_I	47037467	NM_001099772	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	37	CCDS542.1	.	.	.	.	.	.	.	.	.	.	A	7.461	0.644607	0.14451	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919	T;T;T	0.69175	-0.38;-0.31;-0.25	5.98	-5.14	0.02875	.	0.445371	0.26390	N	0.024659	T	0.39332	0.1074	N	0.14661	0.345	0.24268	N	0.995252	B;B;B	0.21688	0.059;0.001;0.001	B;B;B	0.15870	0.014;0.007;0.003	T	0.22800	-1.0206	10	0.66056	D	0.02	.	7.1968	0.25858	0.217:0.2315:0.0:0.5516	.	43;43;43	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	V	43	ENSP00000360991:M43V;ENSP00000271153:M43V;ENSP00000360987:M43V	ENSP00000271153:M43V	M	+	1	0	CYP4B1	47037467	0.005000	0.15991	0.357000	0.25798	0.008000	0.06430	-0.354000	0.07681	-0.458000	0.07023	0.482000	0.46254	ATG		0.577	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
NRD1	4898	hgsc.bcm.edu	37	1	52272551	52272551	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:52272551C>T	ENST00000354831.7	-	20	2418	c.2229G>A	c.(2227-2229)ccG>ccA	p.P743P	NRD1_ENST00000352171.7_Silent_p.P675P|NRD1_ENST00000544028.1_Silent_p.P543P|NRD1_ENST00000539524.1_Silent_p.P611P|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	674					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.P743P(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						ATTCTGTTTCCGGGCAATCGA	0.383																																					p.P743P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2229A	1						.						154.0	155.0	155.0					1																	52272551		2203	4300	6503	52045139	SO:0001819	synonymous_variant	4898	exon20			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.2229G>A	1.37:g.52272551C>T		Somatic		Capture	SOLID	Phase_I	52045139	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Silent	SNP	ENST00000354831.7	37	CCDS559.1																																																																																				0.383	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
CPT2	1376	hgsc.bcm.edu	37	1	53676067	53676067	+	Silent	SNP	A	A	C	rs200252755		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:53676067A>C	ENST00000371486.3	+	4	1236	c.721A>C	c.(721-723)Aga>Cga	p.R241R	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	241					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	TGACAAGGCCAGACACCTCCT	0.463																																					p.R241R												.	.	0			c.A721C	1						.						71.0	70.0	70.0					1																	53676067		2203	4300	6503	53448655	SO:0001819	synonymous_variant	1376	exon4			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.721A>C	1.37:g.53676067A>C		Somatic		Capture	SOLID	Phase_I	53448655	NM_000098	B2R6S0|Q5SW68|Q9BQ26	Silent	SNP	ENST00000371486.3	37	CCDS575.1																																																																																				0.463	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024757.1	NM_000098	
NDC1	55706	hgsc.bcm.edu	37	1	54272177	54272177	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:54272177G>T	ENST00000371429.3	-	9	1503	c.905C>A	c.(904-906)cCt>cAt	p.P302H	NDC1_ENST00000537333.1_De_novo_Start_OutOfFrame|NDC1_ENST00000540001.1_Missense_Mutation_p.P302H|NDC1_ENST00000234725.8_Missense_Mutation_p.P187H	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	302					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.P302H(1)									TGGTTGAACAGGAAACACATG	0.348																																					p.P302H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C905A	1						.						88.0	86.0	87.0					1																	54272177		2203	4300	6503	54044765	SO:0001583	missense	55706	exon9			AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.905C>A	1.37:g.54272177G>T	ENSP00000360483:p.Pro302His	Somatic		Capture	SOLID	Phase_I	54044765	NM_018087	B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	Missense_Mutation	SNP	ENST00000371429.3	37	CCDS583.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055110	0.75960	.	.	ENSG00000058804	ENST00000371429;ENST00000360494;ENST00000540001;ENST00000234725	T;T;T	0.44881	0.91;0.91;0.91	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.65312	0.2679	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67624	-0.5623	10	0.62326	D	0.03	.	18.2282	0.89926	0.0:0.0:1.0:0.0	.	262;302	B4DHA3;Q9BTX1	.;NDC1_HUMAN	H	302;302;302;187	ENSP00000360483:P302H;ENSP00000440873:P302H;ENSP00000234725:P187H	ENSP00000234725:P187H	P	-	2	0	TMEM48	54044765	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	6.950000	0.75977	2.629000	0.89072	0.579000	0.79373	CCT		0.348	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022101.1	NM_018087	
CDCP2	200008	hgsc.bcm.edu	37	1	54605680	54605680	+	Missense_Mutation	SNP	C	C	T	rs149009344		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:54605680C>T	ENST00000371330.1	-	4	1710	c.863G>A	c.(862-864)cGc>cAc	p.R288H	CDCP2_ENST00000530059.1_5'Flank|RP11-446E24.4_ENST00000525949.1_5'Flank	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	288	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)		p.R288H(1)		kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						CGGGGGCAGGCGGATGGTCCA	0.617													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18305	0.0		0.0	False		,,,				2504	0.0				p.R288H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G863A	1						.	C	HIS/ARG	0,4404		0,0,2202	40.0	36.0	38.0		863	4.7	1.0	1	dbSNP_134	38	2,8598		0,2,4298	no	missense	CDCP2	NM_201546.2	29	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	benign	288/450	54605680	2,13002	2202	4300	6502	54378268	SO:0001583	missense	200008	exon4				CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.863G>A	1.37:g.54605680C>T	ENSP00000360381:p.Arg288His	Somatic		Capture	SOLID	Phase_I	54378268	NM_201546	Q6ZWJ3	Missense_Mutation	SNP	ENST00000371330.1	37	CCDS588.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	16.07	3.018491	0.54576	0.0	2.33E-4	ENSG00000157211	ENST00000371330	T	0.19669	2.13	5.83	4.73	0.59995	CUB (5);	0.250785	0.35708	N	0.003021	T	0.12135	0.0295	N	0.21373	0.66	0.34651	D	0.721641	B	0.27192	0.171	B	0.21360	0.034	T	0.10086	-1.0645	10	0.39692	T	0.17	-38.4202	6.7623	0.23548	0.0:0.7551:0.0:0.2449	.	288	Q5VXM1	CDCP2_HUMAN	H	288	ENSP00000360381:R288H	ENSP00000360381:R288H	R	-	2	0	CDCP2	54378268	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	2.069000	0.41481	2.764000	0.94973	0.555000	0.69702	CGC		0.617	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000022209.2	NM_201546	
MRPL37	51253	hgsc.bcm.edu	37	1	54681870	54681870	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:54681870A>G	ENST00000360840.5	+	6	1124	c.1047A>G	c.(1045-1047)ggA>ggG	p.G349G	MRPL37_ENST00000605337.1_Silent_p.G349G|MRPL37_ENST00000336230.6_Silent_p.G218G	NM_016491.3	NP_057575.2	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37	349					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.G349G(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(4)|skin(2)	19						GCACGGATGGACGTGTCTTCC	0.522																																					p.G349G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1047G	1						.						184.0	158.0	167.0					1																	54681870		2203	4300	6503	54454458	SO:0001819	synonymous_variant	51253	exon6			AB051344	CCDS589.1	1p32.1	2012-09-13			ENSG00000116221	ENSG00000116221		"""Mitochondrial ribosomal proteins / large subunits"""	14034	protein-coding gene	gene with protein product		611843				10600119	Standard	NM_016491		Approved	RPML2, MRP-L2	uc001cxa.4	Q9BZE1	OTTHUMG00000008118	ENST00000360840.5:c.1047A>G	1.37:g.54681870A>G		Somatic		Capture	SOLID	Phase_I	54454458	NM_016491	Q96Q67|Q9BWR1|Q9P0P3	Silent	SNP	ENST00000360840.5	37	CCDS589.1	.	.	.	.	.	.	.	.	.	.	A	4.890	0.165465	0.09339	.	.	ENSG00000116221	ENST00000398219	.	.	.	5.38	-8.11	0.01082	.	.	.	.	.	T	0.50205	0.1602	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58487	-0.7628	4	.	.	.	-0.9175	10.1444	0.42755	0.2936:0.4161:0.2903:0.0	.	.	.	.	G	134	.	.	D	+	2	0	MRPL37	54454458	0.000000	0.05858	0.780000	0.31762	0.392000	0.30506	-2.222000	0.01215	-0.984000	0.03507	-0.666000	0.03841	GAC		0.522	MRPL37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022224.1	NM_016491	
L1TD1	54596	hgsc.bcm.edu	37	1	62672712	62672712	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:62672712G>C	ENST00000498273.1	+	3	707	c.412G>C	c.(412-414)Gaa>Caa	p.E138Q		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	138								p.E138Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						ctttaaattagaagtaaatga	0.313																																					p.E138Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G412C	1						.						40.0	46.0	44.0					1																	62672712		2197	4295	6492	62445300	SO:0001583	missense	54596	exon3			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.412G>C	1.37:g.62672712G>C	ENSP00000419901:p.Glu138Gln	Somatic		Capture	SOLID	Phase_I	62445300	NM_019079	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	ENST00000498273.1	37	CCDS619.1	.	.	.	.	.	.	.	.	.	.	G	8.312	0.822254	0.16678	.	.	ENSG00000240563	ENST00000498273	T	0.13657	2.57	2.02	-1.09	0.09904	.	.	.	.	.	T	0.07683	0.0193	N	0.24115	0.695	0.09310	N	1	B	0.33494	0.414	B	0.30943	0.122	T	0.29731	-1.0002	9	0.56958	D	0.05	.	4.9446	0.13984	0.5529:0.0:0.4471:0.0	.	138	Q5T7N2	LITD1_HUMAN	Q	138	ENSP00000419901:E138Q	ENSP00000419901:E138Q	E	+	1	0	L1TD1	62445300	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.551000	0.23361	-0.283000	0.09115	0.313000	0.20887	GAA		0.313	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
L1TD1	54596	hgsc.bcm.edu	37	1	62676260	62676262	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	AAG	AAG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:62676260_62676262delAAG	ENST00000498273.1	+	4	2109_2111	c.1814_1816delAAG	c.(1813-1818)aaagaa>aaa	p.E606del	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	606								p.E606delE(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						CTAACATCCaaagaagcagactt	0.35																																					p.605_606del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.1814_1816del	1						.																																			62448850	SO:0001651	inframe_deletion	54596	exon4			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1814_1816delAAG	1.37:g.62676263_62676265delAAG	ENSP00000419901:p.Glu606del	Somatic		Capture	SOLID	Phase_I	62448848	NM_019079	Q8NDA1|Q9NUV8|Q9NV78	In_Frame_Del	DEL	ENST00000498273.1	37	CCDS619.1																																																																																				0.350	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
IL12RB2	3595	hgsc.bcm.edu	37	1	67838158	67838158	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:67838158A>G	ENST00000262345.1	+	11	2139	c.1499A>G	c.(1498-1500)tAt>tGt	p.Y500C	IL12RB2_ENST00000541374.1_Missense_Mutation_p.Y500C|IL12RB2_ENST00000371000.1_Missense_Mutation_p.Y500C|IL12RB2_ENST00000544434.1_Intron	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	500	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)	p.Y500C(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						ATCCGTGTGTATGCACTCTCA	0.438																																					p.Y500C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1499G	1						.						124.0	119.0	121.0					1																	67838158		2203	4300	6503	67610746	SO:0001583	missense	3595	exon11			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1499A>G	1.37:g.67838158A>G	ENSP00000262345:p.Tyr500Cys	Somatic		Capture	SOLID	Phase_I	67610746	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	A	0.215	-1.033689	0.02029	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374	T;T;T	0.57907	0.37;0.37;0.37	5.64	-2.82	0.05787	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.017660	0.07790	N	0.954720	T	0.20373	0.0490	L	0.43923	1.385	0.09310	N	1	B;B;B	0.28291	0.206;0.151;0.012	B;B;B	0.27262	0.078;0.072;0.012	T	0.39272	-0.9622	10	0.72032	D	0.01	0.0462	5.2462	0.15498	0.3753:0.0:0.3887:0.236	.	500;500;500	B4DGA4;Q99665-2;Q99665	.;.;I12R2_HUMAN	C	500	ENSP00000262345:Y500C;ENSP00000360039:Y500C;ENSP00000445276:Y500C	ENSP00000262345:Y500C	Y	+	2	0	IL12RB2	67610746	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.585000	0.05794	-0.397000	0.07691	-1.180000	0.01717	TAT		0.438	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
NEGR1	257194	hgsc.bcm.edu	37	1	72076785	72076785	+	Missense_Mutation	SNP	C	C	T	rs576347795		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:72076785C>T	ENST00000357731.5	-	5	951	c.712G>A	c.(712-714)Gga>Aga	p.G238R	NEGR1_ENST00000434200.1_Missense_Mutation_p.G192R|NEGR1_ENST00000306821.3_Missense_Mutation_p.G110R	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	238	Ig-like C2-type 3.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.G238R(1)		endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CCACTGCGTCCGGGGGTCACG	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		17665	0.0		0.001	False		,,,				2504	0.0				p.G238R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G712A	1						.						71.0	73.0	72.0					1																	72076785		2203	4300	6503	71849373	SO:0001583	missense	257194	exon5			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.712G>A	1.37:g.72076785C>T	ENSP00000350364:p.Gly238Arg	Somatic		Capture	SOLID	Phase_I	71849373	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	37	CCDS661.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352688	0.61293	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.81330	-1.48;-1.48;-1.48	5.93	5.93	0.95920	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	D	0.91250	0.7242	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92046	0.5644	10	0.87932	D	0	-9.2262	19.1026	0.93279	0.0:1.0:0.0:0.0	.	192;238	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	R	238;110;192	ENSP00000350364:G238R;ENSP00000305938:G110R;ENSP00000413294:G192R	ENSP00000305938:G110R	G	-	1	0	NEGR1	71849373	1.000000	0.71417	0.966000	0.40874	0.035000	0.12851	6.028000	0.70889	2.797000	0.96272	0.655000	0.94253	GGA		0.428	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
AK5	26289	hgsc.bcm.edu	37	1	77987584	77987584	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:77987584G>A	ENST00000354567.2	+	12	1647	c.1384G>A	c.(1384-1386)Ggc>Agc	p.G462S	AK5_ENST00000344720.5_Missense_Mutation_p.G436S	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	462	Adenylate kinase 2.				ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)	p.G462S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						CCTGATTGACGGCTATCCTCG	0.582																																					p.G436S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1306A	1						.						51.0	52.0	52.0					1																	77987584		2203	4300	6503	77760172	SO:0001583	missense	26289	exon12			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.1384G>A	1.37:g.77987584G>A	ENSP00000346577:p.Gly462Ser	Somatic		Capture	SOLID	Phase_I	77760172	NM_012093	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	ENST00000354567.2	37	CCDS675.1	.	.	.	.	.	.	.	.	.	.	G	31	5.061484	0.93846	.	.	ENSG00000154027	ENST00000354567;ENST00000344720	D;D	0.84660	-1.88;-1.88	4.76	3.85	0.44370	.	0.080797	0.47852	D	0.000214	D	0.93497	0.7925	H	0.97265	3.97	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.94839	0.8003	10	0.87932	D	0	-18.129	12.1345	0.53964	0.0862:0.0:0.9138:0.0	.	462	Q9Y6K8	KAD5_HUMAN	S	462;436	ENSP00000346577:G462S;ENSP00000341430:G436S	ENSP00000341430:G436S	G	+	1	0	AK5	77760172	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	7.111000	0.77077	1.127000	0.42034	0.650000	0.86243	GGC		0.582	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026993.4	NM_174858	
PTGFR	5737	hgsc.bcm.edu	37	1	78958716	78958716	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:78958716A>C	ENST00000370757.3	+	2	525	c.288A>C	c.(286-288)aaA>aaC	p.K96N	PTGFR_ENST00000370756.3_Missense_Mutation_p.K96N|PTGFR_ENST00000370758.1_Missense_Mutation_p.K96N	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	96					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)	p.K96N(2)		breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	CTTCTGATAAAGAATGGATCC	0.438																																					p.K96N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A288C	1						.						132.0	124.0	126.0					1																	78958716		2203	4300	6503	78731304	SO:0001583	missense	5737	exon2			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.288A>C	1.37:g.78958716A>C	ENSP00000359793:p.Lys96Asn	Somatic		Capture	SOLID	Phase_I	78731304	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	.	.	.	.	.	.	.	.	.	.	A	11.77	1.738094	0.30774	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.71934	-0.61;-0.61;-0.61	5.85	2.22	0.28083	GPCR, rhodopsin-like superfamily (1);	0.143817	0.64402	D	0.000010	T	0.59266	0.2181	L	0.40543	1.245	0.41969	D	0.990747	P;D	0.63880	0.921;0.993	P;P	0.56916	0.762;0.809	T	0.58999	-0.7536	10	0.40728	T	0.16	-9.5476	9.0464	0.36349	0.705:0.0:0.295:0.0	.	96;96	P43088;P43088-2	PF2R_HUMAN;.	N	96	ENSP00000359794:K96N;ENSP00000359793:K96N;ENSP00000359792:K96N	ENSP00000359792:K96N	K	+	3	2	PTGFR	78731304	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	1.487000	0.35540	0.560000	0.29169	-0.256000	0.11100	AAA		0.438	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
CLCA1	1179	hgsc.bcm.edu	37	1	86951041	86951041	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:86951041A>G	ENST00000234701.3	+	7	1102	c.751A>G	c.(751-753)Aca>Gca	p.T251A	CLCA1_ENST00000394711.1_Missense_Mutation_p.T251A			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	251					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)	p.T251A(1)		NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TGAATTCTGTACAGAACAAAA	0.338																																					p.T251A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A751G	1						.						71.0	62.0	65.0					1																	86951041		2203	4300	6503	86723629	SO:0001583	missense	1179	exon6				CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.751A>G	1.37:g.86951041A>G	ENSP00000234701:p.Thr251Ala	Somatic		Capture	SOLID	Phase_I	86723629	NM_001285	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	CCDS709.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.826458	0.50739	.	.	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.12039	2.72;2.72	5.93	5.93	0.95920	Chloride channel calcium-activated (1);	0.441395	0.23648	N	0.045954	T	0.13200	0.0320	M	0.84433	2.695	0.27922	N	0.938205	B;B	0.30361	0.146;0.277	B;B	0.39935	0.314;0.314	T	0.19095	-1.0316	10	0.44086	T	0.13	-4.7598	8.4377	0.32797	0.8544:0.0:0.1456:0.0	.	251;14	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	A	251	ENSP00000234701:T251A;ENSP00000378200:T251A	ENSP00000234701:T251A	T	+	1	0	CLCA1	86723629	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.855000	0.48333	2.271000	0.75665	0.533000	0.62120	ACA		0.338	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
LPPR4	9890	hgsc.bcm.edu	37	1	99772541	99772542	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	CC	CC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:99772541_99772542delCC	ENST00000370185.3	+	7	2764_2765	c.2267_2268delCC	c.(2266-2268)tccfs	p.S756fs	LPPR4_ENST00000457765.1_Frame_Shift_Del_p.S698fs|LPPR4_ENST00000370184.1_Frame_Shift_Del_p.S598fs	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		756					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.P757fs*5(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		AAAGGAACCTCCCCCACACGGG	0.465																																					p.756_756del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2267_2268del	1						.																																			99545130	SO:0001589	frameshift_variant	9890	exon7																														ENST00000370185.3:c.2267_2268delCC	1.37:g.99772543_99772544delCC	ENSP00000359204:p.Ser756fs	Somatic		Capture	SOLID	Phase_I	99545129	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Frame_Shift_Del	DEL	ENST00000370185.3	37	CCDS757.1																																																																																				0.465	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
SLC16A4	9122	hgsc.bcm.edu	37	1	110906427	110906427	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:110906427delA	ENST00000369779.4	-	9	1674	c.1425delT	c.(1423-1425)tttfs	p.F475fs	SLC16A4_ENST00000472422.2_Frame_Shift_Del_p.F427fs|SLC16A4_ENST00000437429.2_Frame_Shift_Del_p.L372fs|SLC16A4_ENST00000541986.1_Frame_Shift_Del_p.F413fs|SLC16A4_ENST00000369781.4_Frame_Shift_Del_p.F307fs	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	475					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)	p.F475fs*12(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	CCAATGGTACAAAAAAAAAGG	0.388																																					p.F475fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1425delT	1						.		,,,,	2,8,4256		0,0,2,3,2,2126	96.0	95.0	95.0		,,,,	0.9	1.0	1		97	2,31,8221		0,0,2,11,9,4105	no	codingComplex,codingComplex,codingComplex,codingComplex,codingComplex	SLC16A4	NM_004696.2,NM_001201549.1,NM_001201548.1,NM_001201547.1,NM_001201546.1	,,,,	0,0,4,14,11,6231	A1A1,A1A2,A1R,A2A2,A2R,RR		0.3998,0.2344,0.3435	,,,,	,,,,	110906427	4,39,12477	2203	4300	6503	110707950	SO:0001589	frameshift_variant	9122	exon9			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.1425delT	1.37:g.110906427delA	ENSP00000358794:p.Phe475fs	Somatic		Capture	SOLID	Phase_I	110707950	NM_004696	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Frame_Shift_Del	DEL	ENST00000369779.4	37	CCDS823.1																																																																																				0.388	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696	
RAB3GAP2	25782	hgsc.bcm.edu	37	1	220387312	220387314	+	In_Frame_Del	DEL	CTT	CTT	-	rs77431737		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	CTT	CTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:220387312_220387314delCTT	ENST00000358951.2	-	3	304_306	c.188_190delAAG	c.(187-192)gaagga>gga	p.E63del		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	63					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)	p.E63delE(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CAAGTATTTCCTTCTTCTTCCTG	0.389																																					p.63_64del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.188_190del	1						.																																			218453937	SO:0001651	inframe_deletion	25782	exon3			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.188_190delAAG	1.37:g.220387318_220387320delCTT	ENSP00000351832:p.Glu63del	Somatic		Capture	SOLID	Phase_I	218453935	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	In_Frame_Del	DEL	ENST00000358951.2	37	CCDS31028.1																																																																																				0.389	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
SUSD4	55061	hgsc.bcm.edu	37	1	223536703	223536705	+	In_Frame_Del	DEL	TGC	TGC	-	rs143929528	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	TGC	TGC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:223536703_223536705delTGC	ENST00000343846.3	-	1	696_698	c.63_65delGCA	c.(61-66)cagcaa>caa	p.21_22QQ>Q	SUSD4_ENST00000366878.4_In_Frame_Del_p.21_22QQ>Q|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000484758.2_In_Frame_Del_p.21_22QQ>Q|SUSD4_ENST00000344029.6_In_Frame_Del_p.21_22QQ>Q|SUSD4_ENST00000366877.3_In_Frame_Del_p.21_22QQ>Q|SUSD4_ENST00000494793.2_In_Frame_Del_p.21_22QQ>Q			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	21						integral component of membrane (GO:0016021)		p.Q22R(2)|p.Q22delQ(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GGACTGAGGTtgctgctgctgct	0.571														161	0.0321486	0.0008	0.0216	5008	,	,		16437	0.0972		0.002	False		,,,				2504	0.046				p.21_22del												.	.	4	Substitution - Missense(2)|Deletion - In frame(2)	large_intestine(4)	c.63_65del	1						.		,	73,323,3854		0,1,72,15,292,1745					,	1.4	1.0		dbSNP_134	32	171,5,8058		1,0,169,0,5,3942	no	codingComplex,codingComplex	SUSD4	NM_017982.3,NM_001037175.2	,	1,1,241,15,297,5687	A1A1,A1A2,A1R,A2A2,A2R,RR		2.1375,9.3176,4.5819	,	,		244,328,11912				221603328	SO:0001651	inframe_deletion	55061	exon2			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.63_65delGCA	1.37:g.223536712_223536714delTGC	ENSP00000344219:p.Gln22del	Somatic		Capture	SOLID	Phase_I	221603326	NM_001037175	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	In_Frame_Del	DEL	ENST00000343846.3	37	CCDS41471.1																																																																																				0.571	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
TARBP1	6894	hgsc.bcm.edu	37	1	234529527	234529529	+	In_Frame_Del	DEL	TCT	TCT	-	rs371543809		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	TCT	TCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:234529527_234529529delTCT	ENST00000040877.1	-	27	4297_4299	c.4298_4300delAGA	c.(4297-4302)aagatt>att	p.K1433del	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1433					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.K1433delK(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CACGGGATAATCTTCTTCTGAAC	0.438																																					p.1433_1434del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.4298_4300del	1						.																																			232596152	SO:0001651	inframe_deletion	6894	exon27				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4298_4300delAGA	1.37:g.234529533_234529535delTCT	ENSP00000040877:p.Lys1433del	Somatic		Capture	SOLID	Phase_I	232596150	NM_005646	Q9H581	In_Frame_Del	DEL	ENST00000040877.1	37	CCDS1601.1																																																																																				0.438	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	
AKT3	10000	hgsc.bcm.edu	37	1	243668608	243668608	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr1:243668608G>A	ENST00000366539.1	-	14	1583	c.1383C>T	c.(1381-1383)gaC>gaT	p.D461D	AKT3_ENST00000366540.1_Intron|AKT3_ENST00000263826.5_Silent_p.D461D|AKT3_ENST00000336199.5_Intron			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	461	AGC-kinase C-terminal.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D461D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			GCCTCTCATTGTCCATGCAGT	0.378																																					p.D461D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1383T	1						.						117.0	113.0	114.0					1																	243668608		2203	4300	6503	241735231	SO:0001819	synonymous_variant	10000	exon13			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.1383C>T	1.37:g.243668608G>A		Somatic		Capture	SOLID	Phase_I	241735231	NM_005465	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Silent	SNP	ENST00000366539.1	37	CCDS31077.1																																																																																				0.378	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690	
ARHGAP20	57569	hgsc.bcm.edu	37	11	110451494	110451494	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:110451494G>T	ENST00000260283.4	-	16	2460	c.2176C>A	c.(2176-2178)Cta>Ata	p.L726I	ARHGAP20_ENST00000533353.1_Missense_Mutation_p.L700I|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.L690I|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.L703I|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.L700I|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.L269I|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.L690I	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	726					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.L726I(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GACTTGCGTAGCTTTTTCTGA	0.458																																					p.L726I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2176A	11						.						61.0	64.0	63.0					11																	110451494		2201	4298	6499	109956704	SO:0001583	missense	57569	exon16			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2176C>A	11.37:g.110451494G>T	ENSP00000260283:p.Leu726Ile	Somatic		Capture	SOLID	Phase_I	109956704	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934931	0.52866	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.09817	2.94;2.95;2.97;2.95;2.95;2.95;2.95	5.93	-5.04	0.02964	.	0.243150	0.26251	N	0.025457	T	0.07638	0.0192	M	0.65975	2.015	0.09310	N	1	B;B;B	0.14438	0.01;0.003;0.004	B;B;B	0.17433	0.018;0.002;0.006	T	0.32214	-0.9915	10	0.29301	T	0.29	.	0.5426	0.00648	0.3216:0.1216:0.1971:0.3597	.	700;726;703	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	I	726;700;269;703;690;700;690	ENSP00000260283:L726I;ENSP00000349660:L700I;ENSP00000437905:L269I;ENSP00000432076:L703I;ENSP00000436319:L690I;ENSP00000436522:L700I;ENSP00000431399:L690I	ENSP00000260283:L726I	L	-	1	2	ARHGAP20	109956704	0.260000	0.24053	0.002000	0.10522	0.890000	0.51754	0.287000	0.18920	-1.091000	0.03065	-0.169000	0.13324	CTA		0.458	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
SIK3	23387	hgsc.bcm.edu	37	11	116744654	116744654	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:116744654G>A	ENST00000292055.4	-	12	1407	c.1372C>T	c.(1372-1374)Caa>Taa	p.Q458*	SIK3_ENST00000434315.2_Nonsense_Mutation_p.Q357*|SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000375300.1_Nonsense_Mutation_p.Q516*|SIK3_ENST00000542607.1_Nonsense_Mutation_p.Q410*|SIK3_ENST00000446921.2_Nonsense_Mutation_p.Q468*	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	458					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.Q516*(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						TGCAAGTTTTGCATAGGCAAC	0.512																																					p.Q458X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1372T	11						.						141.0	138.0	139.0					11																	116744654		2201	4296	6497	116249864	SO:0001587	stop_gained	23387	exon12			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1372C>T	11.37:g.116744654G>A	ENSP00000292055:p.Gln458*	Somatic		Capture	SOLID	Phase_I	116249864	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Nonsense_Mutation	SNP	ENST00000292055.4	37	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.481756|9.481756	0.99183|0.99183	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000445177;ENST00000446921;ENST00000413553|ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	.|.	.|.	.|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.000000	.|0.37577	.|U	.|0.002025	T|.	0.76018|.	0.3929|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.75619|.	-0.3255|.	4|.	.|0.44086	.|T	.|0.13	.|.	19.0039|19.0039	0.92843|0.92843	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	509;432;418|516;458;410;357	.|.	.|ENSP00000292055:Q458X	A|Q	-|-	2|1	0|0	SIK3|SIK3	116249864|116249864	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.992000|0.992000	0.81027|0.81027	8.855000|8.855000	0.92236|0.92236	2.494000|2.494000	0.84150|0.84150	0.650000|0.650000	0.86243|0.86243	GCA|CAA		0.512	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
AMICA1	120425	hgsc.bcm.edu	37	11	118076617	118076617	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:118076617A>T	ENST00000356289.5	-	5	687	c.514T>A	c.(514-516)Ttt>Att	p.F172I	AMICA1_ENST00000292067.7_Missense_Mutation_p.F162I|AMICA1_ENST00000533261.1_Intron|AMICA1_ENST00000526620.1_Missense_Mutation_p.F133I	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	172	Ig-like V-type 2.				blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)	p.F162I(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CGTCCTGAAAATATCCATTCT	0.468																																					p.F162I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T484A	11						.						316.0	241.0	266.0					11																	118076617		2200	4296	6496	117581827	SO:0001583	missense	120425	exon4			AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.514T>A	11.37:g.118076617A>T	ENSP00000348635:p.Phe172Ile	Somatic		Capture	SOLID	Phase_I	117581827	NM_153206	B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Missense_Mutation	SNP	ENST00000356289.5	37	CCDS41723.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.750525	0.89753	.	.	ENSG00000160593	ENST00000356289;ENST00000292067;ENST00000526620;ENST00000537867	T;T;T	0.65178	-0.14;-0.14;-0.14	5.19	5.19	0.71726	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.49305	D	0.000144	T	0.80576	0.4649	M	0.88450	2.955	0.27726	N	0.944956	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.99;0.995;0.986;0.975	T	0.76260	-0.3024	10	0.52906	T	0.07	-26.4225	11.7158	0.51653	1.0:0.0:0.0:0.0	.	172;133;172;162	B4DVI6;E9PKK2;Q86YT9;Q86YT9-2	.;.;JAML1_HUMAN;.	I	172;162;133;133	ENSP00000348635:F172I;ENSP00000292067:F162I;ENSP00000431218:F133I	ENSP00000292067:F162I	F	-	1	0	AMICA1	117581827	0.994000	0.37717	0.878000	0.34440	0.234000	0.25298	4.194000	0.58393	2.075000	0.62263	0.455000	0.32223	TTT		0.468	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392105.2	NM_153206	
KMT2A	4297	hgsc.bcm.edu	37	11	118392088	118392088	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:118392088C>T	ENST00000389506.5	+	35	11590	c.11590C>T	c.(11590-11592)Cgc>Tgc	p.R3864C	RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000556583.1_RNA|RP11-770J1.3_ENST00000554407.1_RNA|RP11-770J1.3_ENST00000528578.1_RNA|KMT2A_ENST00000354520.4_Missense_Mutation_p.R3826C|KMT2A_ENST00000534358.1_Missense_Mutation_p.R3867C|RP11-770J1.3_ENST00000532597.1_RNA			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3864	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.R3864C(1)									CAACGTCATCCGCTCCATCCA	0.488																																					p.R3864C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C11590T	11						.						116.0	106.0	110.0					11																	118392088		2200	4295	6495	117897298	SO:0001583	missense	4297	exon35			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.11590C>T	11.37:g.118392088C>T	ENSP00000374157:p.Arg3864Cys	Somatic		Capture	SOLID	Phase_I	117897298	NM_005933	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376391	0.82682	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.81739	-1.53;-1.53;-1.53	5.72	5.72	0.89469	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.93556	0.7943	H	0.96142	3.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94990	0.8133	10	0.87932	D	0	.	19.8653	0.96802	0.0:1.0:0.0:0.0	.	3867;3864	E9PQG7;Q03164	.;MLL1_HUMAN	C	3867;3864;3826;2774	ENSP00000436786:R3867C;ENSP00000374157:R3864C;ENSP00000346516:R3826C	ENSP00000346516:R3826C	R	+	1	0	MLL	117897298	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.691000	0.91804	0.591000	0.81541	CGC		0.488	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
HINFP	25988	hgsc.bcm.edu	37	11	119003428	119003428	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:119003428G>A	ENST00000350777.2	+	7	875	c.812G>A	c.(811-813)cGc>cAc	p.R271H	HINFP_ENST00000527410.1_Missense_Mutation_p.R271H	NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor	271					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.R271H(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						TCCTCCCTCCGCAACCACATG	0.532																																					p.R271H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G812A	11						.						133.0	124.0	127.0					11																	119003428		2200	4295	6495	118508638	SO:0001583	missense	25988	exon8			AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.812G>A	11.37:g.119003428G>A	ENSP00000318085:p.Arg271His	Somatic		Capture	SOLID	Phase_I	118508638	NM_015517	B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	ENST00000350777.2	37	CCDS8414.1	.	.	.	.	.	.	.	.	.	.	G	31	5.087228	0.94100	.	.	ENSG00000172273	ENST00000350777;ENST00000527410	T;T	0.52983	0.64;0.64	5.71	5.71	0.89125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.62011	0.2393	L	0.41356	1.27	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.54357	-0.8306	10	0.29301	T	0.29	-24.9529	19.8599	0.96779	0.0:0.0:1.0:0.0	.	271	Q9BQA5	HINFP_HUMAN	H	271	ENSP00000318085:R271H;ENSP00000436815:R271H	ENSP00000318085:R271H	R	+	2	0	HINFP	118508638	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.363000	0.97131	2.710000	0.92621	0.655000	0.94253	CGC		0.532	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388201.2	NM_015517	
SIAE	54414	hgsc.bcm.edu	37	11	124507044	124507044	+	Missense_Mutation	SNP	C	C	T	rs188195886	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:124507044C>T	ENST00000263593.3	-	10	1547	c.1375G>A	c.(1375-1377)Gtc>Atc	p.V459I	SIAE_ENST00000545756.1_Missense_Mutation_p.V424I|RNA5SP352_ENST00000363408.1_RNA			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	459					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)	p.V459I(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		TGGGTGGAGACGGTGTTCATA	0.498													C|||	2	0.000399361	0.0	0.0	5008	,	,		18690	0.0		0.002	False		,,,				2504	0.0				p.V459I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1375A	11						.						187.0	170.0	176.0					11																	124507044		2201	4299	6500	124012254	SO:0001583	missense	54414	exon10			AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.1375G>A	11.37:g.124507044C>T	ENSP00000263593:p.Val459Ile	Somatic		Capture	SOLID	Phase_I	124012254	NM_170601	B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Missense_Mutation	SNP	ENST00000263593.3	37	CCDS8449.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	9.029	0.986705	0.18889	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	D;D	0.83250	-1.7;-1.7	5.67	2.17	0.27698	.	0.989959	0.08257	N	0.973607	T	0.60599	0.2281	N	0.08118	0	0.09310	N	1	B	0.20887	0.049	B	0.09377	0.004	T	0.50004	-0.8878	10	0.05959	T	0.93	-15.4754	4.9708	0.14115	0.6763:0.1604:0.1633:0.0	.	459	Q9HAT2	SIAE_HUMAN	I	459;424	ENSP00000263593:V459I;ENSP00000437877:V424I	ENSP00000263593:V459I	V	-	1	0	SIAE	124012254	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.625000	0.24477	0.447000	0.26695	-0.256000	0.11100	GTC		0.498	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387070.1	NM_170601	
CDON	50937	hgsc.bcm.edu	37	11	125848257	125848257	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:125848257C>T	ENST00000392693.3	-	18	3425	c.3298G>A	c.(3298-3300)Gtg>Atg	p.V1100M	CDON_ENST00000531738.1_Missense_Mutation_p.V477M|CDON_ENST00000263577.7_Missense_Mutation_p.V1100M	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	1100					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V1100M(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ATCTGAGGCACGGCCGTGTAC	0.448																																					p.V1100M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3298A	11						.						86.0	67.0	74.0					11																	125848257		2201	4299	6500	125353467	SO:0001583	missense	50937	exon18			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.3298G>A	11.37:g.125848257C>T	ENSP00000376458:p.Val1100Met	Somatic		Capture	SOLID	Phase_I	125353467	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995122	0.54147	.	.	ENSG00000064309	ENST00000392693;ENST00000531738;ENST00000263577	T;T;T	0.72051	-0.62;0.05;-0.62	5.82	3.95	0.45737	.	0.155438	0.30043	N	0.010550	T	0.68577	0.3016	L	0.51422	1.61	0.21740	N	0.999569	D;D;D	0.63046	0.992;0.982;0.969	P;P;B	0.52793	0.595;0.709;0.428	T	0.62656	-0.6808	10	0.66056	D	0.02	-14.9376	4.0341	0.09722	0.1326:0.5989:0.1284:0.1402	.	1100;1100;477	Q4KMG0;Q4KMG0-2;E9PN78	CDON_HUMAN;.;.	M	1100;477;1100	ENSP00000376458:V1100M;ENSP00000432901:V477M;ENSP00000263577:V1100M	ENSP00000263577:V1100M	V	-	1	0	CDON	125353467	0.526000	0.26298	0.056000	0.19401	0.781000	0.44180	0.984000	0.29565	1.465000	0.48006	0.446000	0.29264	GTG		0.448	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
CARS	833	hgsc.bcm.edu	37	11	3023796	3023796	+	Missense_Mutation	SNP	G	G	A	rs141404196		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:3023796G>A	ENST00000397111.5	-	20	2248	c.2003C>T	c.(2002-2004)gCg>gTg	p.A668V	CARS_ENST00000278224.9_Missense_Mutation_p.A668V|CARS_ENST00000397114.3_Missense_Mutation_p.A658V|CARS_ENST00000401769.3_Missense_Mutation_p.A681V|CARS_ENST00000380525.4_Missense_Mutation_p.A751V|CARS_ENST00000470221.2_Intron			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	668					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.A668V(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CCTCCGGGCCGCCTCCTCTTT	0.572			T	ALK	ALCL																																p.A751V	Ovarian(61;932 1157 5961 20446 52152)		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2252T	11						.	G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4404		0,0,2202	280.0	259.0	266.0		2252,2252,2003,2003	3.5	0.9	11	dbSNP_134	266	2,8594	2.2+/-6.3	0,2,4296	no	missense,missense,missense,missense	CARS	NM_001014437.2,NM_001194997.1,NM_001751.5,NM_139273.3	64,64,64,64	0,2,6498	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	751/832,751/810,668/749,668/727	3023796	2,12998	2202	4298	6500	2980372	SO:0001583	missense	833	exon21			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.2003C>T	11.37:g.3023796G>A	ENSP00000380300:p.Ala668Val	Somatic		Capture	SOLID	Phase_I	2980372	NM_001014437	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	ENST00000397111.5	37	CCDS7742.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.159808	0.38119	0.0	2.33E-4	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.48836	0.8;0.81;0.82;0.81;0.82	3.54	3.54	0.40534	.	0.069873	0.56097	D	0.000025	T	0.49236	0.1545	M	0.90369	3.11	0.80722	D	1	P;P;P;P;P;P	0.50369	0.934;0.668;0.819;0.807;0.668;0.668	B;B;B;B;B;B	0.35470	0.203;0.158;0.1;0.202;0.148;0.1	T	0.62760	-0.6786	10	0.38643	T	0.18	-22.3921	12.3261	0.55011	0.0:0.0:1.0:0.0	.	681;751;668;668;751;658	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	V	751;668;668;658;681	ENSP00000369897:A751V;ENSP00000380300:A668V;ENSP00000278224:A668V;ENSP00000380303:A658V;ENSP00000384069:A681V	ENSP00000278224:A668V	A	-	2	0	CARS	2980372	0.998000	0.40836	0.912000	0.35992	0.173000	0.22820	4.728000	0.62000	1.995000	0.58328	0.467000	0.42956	GCG		0.572	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751	
TRIM3	10612	hgsc.bcm.edu	37	11	6479490	6479490	+	Silent	SNP	C	C	T	rs372879493	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:6479490C>T	ENST00000525074.1	-	3	562	c.168G>A	c.(166-168)acG>acA	p.T56T	TRIM3_ENST00000536344.1_5'UTR|TRIM3_ENST00000359518.3_Silent_p.T56T|TRIM3_ENST00000529058.1_5'Flank|TRIM3_ENST00000345851.3_Silent_p.T56T|TRIM3_ENST00000537602.1_Silent_p.T56T	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	56					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T56T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACAGGATAGCGTCAGGCTCT	0.547													C|||	3	0.000599042	0.0008	0.0	5008	,	,		19878	0.0		0.001	False		,,,				2504	0.001				p.T56T	Melanoma(6;5 510 1540 25169 29084)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G168A	11						.	C	,	0,4402		0,0,2201	68.0	70.0	69.0		168,168	-2.8	0.9	11		69	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous,coding-synonymous	TRIM3	NM_006458.2,NM_033278.2	,	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	,	56/745,56/745	6479490	1,12993	2201	4296	6497	6436066	SO:0001819	synonymous_variant	10612	exon4			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.168G>A	11.37:g.6479490C>T		Somatic		Capture	SOLID	Phase_I	6436066	NM_006458	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Silent	SNP	ENST00000525074.1	37	CCDS7764.1																																																																																				0.547	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458	
ST5	6764	hgsc.bcm.edu	37	11	8732443	8732443	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:8732443C>T	ENST00000534127.1	-	14	2686	c.2301G>A	c.(2299-2301)atG>atA	p.M767I	ST5_ENST00000357665.1_Missense_Mutation_p.M767I|ST5_ENST00000534278.1_5'Flank|ST5_ENST00000313726.6_Missense_Mutation_p.M767I|ST5_ENST00000530991.1_Missense_Mutation_p.M239I|ST5_ENST00000526099.1_Missense_Mutation_p.M280I|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000526757.1_Missense_Mutation_p.M347I|ST5_ENST00000530438.1_Missense_Mutation_p.M347I	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	767	UDENN.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.M767I(1)		NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CCCCAGTCAGCATGAAAGAAA	0.557																																					p.M767I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2301A	11						.						60.0	56.0	57.0					11																	8732443		2201	4296	6497	8689019	SO:0001583	missense	6764	exon14			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.2301G>A	11.37:g.8732443C>T	ENSP00000433528:p.Met767Ile	Somatic		Capture	SOLID	Phase_I	8689019	NM_005418	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	37	CCDS7791.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.52|18.52	3.642446|3.642446	0.67244|0.67244	.|.	.|.	ENSG00000166444|ENSG00000166444	ENST00000447053|ENST00000526757;ENST00000534127;ENST00000313726;ENST00000530991;ENST00000357665;ENST00000526099;ENST00000530438;ENST00000533020	.|T;T;T;T;T;T;T;T	.|0.38887	.|1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11	5.85|5.85	5.85|5.85	0.93711|0.93711	.|uDENN (3);	.|0.036767	.|0.85682	.|D	.|0.000000	T|T	0.30947|0.30947	0.0781|0.0781	N|N	0.14661|0.14661	0.345|0.345	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B;B	.|0.22800	.|0.075;0.024;0.012	.|B;B;B	.|0.25759	.|0.063;0.022;0.05	T|T	0.11108|0.11108	-1.0601|-1.0601	6|10	0.87932|0.72032	D|D	0|0.01	-10.5989|-10.5989	15.6181|15.6181	0.76784|0.76784	0.0:0.8632:0.1368:0.0|0.0:0.8632:0.1368:0.0	.|.	.|280;347;767	.|B4DDL8;P78524-2;P78524	.|.;.;ST5_HUMAN	Y|I	420|347;767;767;239;767;280;347;239	.|ENSP00000435097:M347I;ENSP00000433528:M767I;ENSP00000319678:M767I;ENSP00000432887:M239I;ENSP00000350294:M767I;ENSP00000436808:M280I;ENSP00000436802:M347I;ENSP00000433588:M239I	ENSP00000397400:C420Y|ENSP00000319678:M767I	C|M	-|-	2|3	0|0	ST5|ST5	8689019|8689019	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.578000|3.578000	0.53892|0.53892	2.767000|2.767000	0.95098|0.95098	0.655000|0.655000	0.94253|0.94253	TGC|ATG		0.557	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
SCUBE2	57758	hgsc.bcm.edu	37	11	9048991	9048991	+	Missense_Mutation	SNP	C	C	T	rs202164644		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:9048991C>T	ENST00000309263.3	-	19	2606	c.2534G>A	c.(2533-2535)cGc>cAc	p.R845H	SCUBE2_ENST00000520467.1_Missense_Mutation_p.R817H|SCUBE2_ENST00000450649.2_Intron|RP11-467K18.2_ENST00000531592.1_RNA|SCUBE2_ENST00000457346.2_Missense_Mutation_p.R874H			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	845	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R845H(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		CAGGATGCGGCGCTTGGGGGG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18790	0.001		0.0	False		,,,				2504	0.0				p.R817H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2450A	11						.						146.0	120.0	129.0					11																	9048991		2201	4296	6497	9005567	SO:0001583	missense	57758	exon19			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.2534G>A	11.37:g.9048991C>T	ENSP00000310658:p.Arg845His	Somatic		Capture	SOLID	Phase_I	9005567	NM_020974	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.431907|5.431907	0.96150|0.96150	.|.	.|.	ENSG00000175356|ENSG00000175356	ENST00000519202|ENST00000457346;ENST00000309263;ENST00000520467	.|T;T;T	.|0.33438	.|1.41;1.41;1.41	5.34|5.34	5.34|5.34	0.76211|0.76211	.|CUB (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.44871|0.44871	0.1314|0.1314	N|N	0.21583|0.21583	0.68|0.68	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	T|T	0.48681|0.48681	-0.9014|-0.9014	5|10	.|0.87932	.|D	.|0	.|.	19.0472|19.0472	0.93027|0.93027	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|817;845	.|Q9NQ36-2;Q9NQ36	.|.;SCUB2_HUMAN	T|H	28|874;845;817	.|ENSP00000390481:R874H;ENSP00000310658:R845H;ENSP00000429969:R817H	.|ENSP00000310658:R845H	A|R	-|-	1|2	0|0	SCUBE2|SCUBE2	9005567|9005567	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	7.726000|7.726000	0.84824|0.84824	2.506000|2.506000	0.84524|0.84524	0.585000|0.585000	0.79938|0.79938	GCC|CGC		0.567	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974	
NAV2	89797	hgsc.bcm.edu	37	11	20005746	20005746	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:20005746G>A	ENST00000396087.3	+	12	2889	c.2790G>A	c.(2788-2790)cgG>cgA	p.R930R	NAV2_ENST00000349880.4_Silent_p.R907R|NAV2_ENST00000540292.1_Silent_p.R861R|NAV2_ENST00000527559.2_Silent_p.R859R|NAV2_ENST00000396085.1_Silent_p.R907R|NAV2_ENST00000360655.4_Silent_p.R843R|NAV2-AS3_ENST00000534036.1_RNA	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	930					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.R930R(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CTGTGGTACGGGAGACCCTGC	0.572																																					p.R843R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2529A	11						.						125.0	114.0	118.0					11																	20005746		2203	4300	6503	19962322	SO:0001819	synonymous_variant	89797	exon11			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.2790G>A	11.37:g.20005746G>A		Somatic		Capture	SOLID	Phase_I	19962322	NM_001111018	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	CCDS58126.1																																																																																				0.572	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
BDNF	627	hgsc.bcm.edu	37	11	27679632	27679632	+	Silent	SNP	C	C	T	rs370102323		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:27679632C>T	ENST00000525528.1	-	1	1573	c.480G>A	c.(478-480)tcG>tcA	p.S160S	BDNF_ENST00000395980.2_Silent_p.S160S|BDNF_ENST00000395983.3_Silent_p.S160S|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000418212.1_Silent_p.S160S|BDNF_ENST00000395981.3_Silent_p.S160S|BDNF_ENST00000530861.1_Silent_p.S160S|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000356660.4_Silent_p.S160S|BDNF_ENST00000395978.3_Silent_p.S160S|BDNF_ENST00000420794.1_Silent_p.S160S|BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000525950.1_Silent_p.S160S|BDNF_ENST00000395986.2_Silent_p.S175S|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000439476.2_Silent_p.S160S|BDNF_ENST00000314915.6_Silent_p.S168S|BDNF_ENST00000532997.1_Silent_p.S160S|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000533131.1_Silent_p.S160S|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000438929.1_Silent_p.S242S|BDNF_ENST00000533246.1_Silent_p.S160S|BDNF-AS_ENST00000532965.1_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	160					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)	p.S168S(1)		breast(1)|large_intestine(3)|lung(2)	6						CCGTCCCGCCCGACATGTCCA	0.542																																					p.S160S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G480A	11						.						164.0	163.0	163.0					11																	27679632		2202	4299	6501	27636208	SO:0001819	synonymous_variant	627	exon2			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.480G>A	11.37:g.27679632C>T		Somatic		Capture	SOLID	Phase_I	27636208	NM_001143805	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Silent	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																				0.542	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
TSPAN18	90139	hgsc.bcm.edu	37	11	44948262	44948262	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:44948262A>G	ENST00000520358.2	+	9	1068	c.653A>G	c.(652-654)tAc>tGc	p.Y218C	TSPAN18_ENST00000340160.3_Missense_Mutation_p.Y218C			Q96SJ8	TSN18_HUMAN	tetraspanin 18	218						integral component of membrane (GO:0016021)		p.Y218C(1)		endometrium(1)|large_intestine(6)|lung(3)	10						TTCGAGACCTACGTCTACTTG	0.597											OREG0020922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y218C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A653G	11						.						219.0	189.0	199.0					11																	44948262		2203	4299	6502	44904838	SO:0001583	missense	90139	exon8			AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.653A>G	11.37:g.44948262A>G	ENSP00000429993:p.Tyr218Cys	Somatic	927	Capture	SOLID	Phase_I	44904838	NM_130783	Q6UY44|Q8NBI9	Missense_Mutation	SNP	ENST00000520358.2	37	CCDS7910.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.841912	0.51057	.	.	ENSG00000157570	ENST00000520358;ENST00000340160	T;T	0.79845	-1.31;-1.31	4.54	4.54	0.55810	Tetraspanin, EC2 domain (1);	0.272241	0.38381	N	0.001720	D	0.89448	0.6718	M	0.82517	2.595	0.80722	D	1	D;P	0.89917	1.0;0.473	D;B	0.91635	0.999;0.347	D	0.90599	0.4543	10	0.62326	D	0.03	.	12.9081	0.58164	1.0:0.0:0.0:0.0	.	218;218	Q8WUV1;Q96SJ8	.;TSN18_HUMAN	C	218	ENSP00000429993:Y218C;ENSP00000339820:Y218C	ENSP00000339820:Y218C	Y	+	2	0	TSPAN18	44904838	1.000000	0.71417	0.994000	0.49952	0.291000	0.27294	8.298000	0.89944	1.706000	0.51276	0.392000	0.25879	TAC		0.597	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376197.3	NM_130783	
PHF21A	51317	hgsc.bcm.edu	37	11	45992851	45992851	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:45992851G>A	ENST00000418153.2	-	7	627	c.428C>T	c.(427-429)gCg>gTg	p.A143V	PHF21A_ENST00000323180.6_Missense_Mutation_p.A143V|PHF21A_ENST00000257821.4_Missense_Mutation_p.A143V			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	143					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A143V(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						AGGCATGGTCGCAGTTGCTGC	0.493																																					p.A143V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C428T	11						.						103.0	95.0	98.0					11																	45992851		2202	4299	6501	45949427	SO:0001583	missense	51317	exon7			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.428C>T	11.37:g.45992851G>A	ENSP00000398824:p.Ala143Val	Somatic		Capture	SOLID	Phase_I	45949427	NM_001101802	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	ENST00000418153.2	37	CCDS44578.1	.	.	.	.	.	.	.	.	.	.	G	35	5.589153	0.96590	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153	D;D;D	0.95518	-3.29;-3.73;-3.29	5.79	5.79	0.91817	.	0.141276	0.64402	D	0.000004	D	0.95020	0.8388	L	0.51422	1.61	0.58432	D	0.999997	D;D	0.62365	0.987;0.991	P;P	0.49561	0.492;0.615	D	0.92996	0.6419	10	0.21014	T	0.42	-5.2113	20.0313	0.97540	0.0:0.0:1.0:0.0	.	143;143	Q96BD5;Q96BD5-2	PF21A_HUMAN;.	V	143	ENSP00000257821:A143V;ENSP00000323152:A143V;ENSP00000398824:A143V	ENSP00000257821:A143V	A	-	2	0	PHF21A	45949427	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.373000	0.66162	2.746000	0.94184	0.655000	0.94253	GCG		0.493	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621	
MADD	8567	hgsc.bcm.edu	37	11	47306558	47306558	+	Missense_Mutation	SNP	G	G	A	rs557907564		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:47306558G>A	ENST00000311027.5	+	13	2389	c.2224G>A	c.(2224-2226)Gtg>Atg	p.V742M	MADD_ENST00000406482.1_Missense_Mutation_p.V742M|MADD_ENST00000342922.4_Missense_Mutation_p.V742M|MADD_ENST00000395344.3_Missense_Mutation_p.V742M|MADD_ENST00000402799.1_Missense_Mutation_p.V742M|MADD_ENST00000402192.2_Missense_Mutation_p.V742M|MADD_ENST00000407859.3_Missense_Mutation_p.V742M|MADD_ENST00000395336.3_Missense_Mutation_p.V742M|MADD_ENST00000349238.3_Missense_Mutation_p.V742M	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.V742M(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CCTCCCTTCCGTGCCTCCCAG	0.537																																					p.V742M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2224A	11						.						81.0	79.0	79.0					11																	47306558		2201	4298	6499	47263134	SO:0001583	missense	8567	exon13			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2224G>A	11.37:g.47306558G>A	ENSP00000310933:p.Val742Met	Somatic		Capture	SOLID	Phase_I	47263134	NM_003682		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068030	0.36470	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.06294	3.46;3.36;3.36;3.46;3.45;3.32;3.36;3.45;3.46	5.88	1.72	0.24424	.	0.640743	0.14433	N	0.319899	T	0.02304	0.0071	N	0.08118	0	0.22156	N	0.999328	P;B;B;B;B;P;B;P;B;B	0.39131	0.661;0.414;0.184;0.252;0.371;0.541;0.293;0.549;0.212;0.293	B;B;B;B;B;B;B;B;B;B	0.32724	0.057;0.072;0.126;0.045;0.104;0.104;0.098;0.151;0.06;0.098	T	0.39461	-0.9613	10	0.31617	T	0.26	-1.1959	1.8548	0.03176	0.1687:0.1057:0.433:0.2926	.	742;742;742;742;742;742;742;742;742;742	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	M	742	ENSP00000343902:V742M;ENSP00000385585:V742M;ENSP00000384435:V742M;ENSP00000304505:V742M;ENSP00000310933:V742M;ENSP00000384204:V742M;ENSP00000378753:V742M;ENSP00000378745:V742M;ENSP00000384287:V742M	ENSP00000310933:V742M	V	+	1	0	MADD	47263134	0.012000	0.17670	0.331000	0.25455	0.957000	0.61999	0.208000	0.17415	0.834000	0.34852	0.655000	0.94253	GTG		0.537	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
MADD	8567	hgsc.bcm.edu	37	11	47306624	47306624	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:47306624C>T	ENST00000311027.5	+	13	2455	c.2290C>T	c.(2290-2292)Cgc>Tgc	p.R764C	MADD_ENST00000406482.1_Intron|MADD_ENST00000342922.4_Missense_Mutation_p.R764C|MADD_ENST00000395344.3_Intron|MADD_ENST00000402799.1_Intron|MADD_ENST00000402192.2_Missense_Mutation_p.R764C|MADD_ENST00000407859.3_Intron|MADD_ENST00000395336.3_Missense_Mutation_p.R764C|MADD_ENST00000349238.3_Missense_Mutation_p.R764C	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.R764C(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GGGGTCAGTGCGCCGGCGAAT	0.567																																					p.R764C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2290T	11						.						99.0	92.0	95.0					11																	47306624		2201	4298	6499	47263200	SO:0001583	missense	8567	exon13			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2290C>T	11.37:g.47306624C>T	ENSP00000310933:p.Arg764Cys	Somatic		Capture	SOLID	Phase_I	47263200	NM_003682		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.469773	0.43839	.	.	ENSG00000110514	ENST00000342922;ENST00000349238;ENST00000311027;ENST00000395336;ENST00000402192	T;T;T;T;T	0.05649	3.41;3.46;3.46;3.46;3.41	5.99	-1.87	0.07737	.	0.421162	0.26923	N	0.021801	T	0.03564	0.0102	L	0.27053	0.805	0.21105	N	0.999781	B;B;B;B	0.09022	0.001;0.001;0.0;0.002	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.37244	-0.9714	10	0.30854	T	0.27	0.2803	5.4928	0.16785	0.232:0.3854:0.0:0.3826	.	764;764;764;764	Q8WXG6-7;Q8WXG6-2;Q8WXG6;Q8WXG6-3	.;.;MADD_HUMAN;.	C	764	ENSP00000343902:R764C;ENSP00000304505:R764C;ENSP00000310933:R764C;ENSP00000378745:R764C;ENSP00000384287:R764C	ENSP00000310933:R764C	R	+	1	0	MADD	47263200	0.681000	0.27614	0.963000	0.40424	0.982000	0.71751	0.369000	0.20416	-0.336000	0.08438	0.655000	0.94253	CGC		0.567	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
MADD	8567	hgsc.bcm.edu	37	11	47346038	47346038	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:47346038C>T	ENST00000311027.5	+	33	4797	c.4632C>T	c.(4630-4632)ggC>ggT	p.G1544G	MADD_ENST00000395344.3_Silent_p.G1438G|MADD_ENST00000406482.1_Silent_p.G1442G|MADD_ENST00000342922.4_Silent_p.G1485G|MADD_ENST00000402799.1_Silent_p.G1442G|MADD_ENST00000405573.2_Silent_p.G354G|MADD_ENST00000402192.2_Silent_p.G1484G|MADD_ENST00000407859.3_Silent_p.G1462G|MADD_ENST00000395336.3_Silent_p.G1544G|MADD_ENST00000349238.3_Silent_p.G1505G	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.G1544G(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		AATTGGGTGGCGAGTTCCCTG	0.597																																					p.G1544G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4632T	11						.						74.0	72.0	73.0					11																	47346038		2201	4298	6499	47302614	SO:0001819	synonymous_variant	8567	exon33			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4632C>T	11.37:g.47346038C>T		Somatic		Capture	SOLID	Phase_I	47302614	NM_003682		Silent	SNP	ENST00000311027.5	37	CCDS7930.1																																																																																				0.597	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
OR5F1	338674	hgsc.bcm.edu	37	11	55761880	55761880	+	Silent	SNP	T	T	C	rs146899581	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:55761880T>C	ENST00000278409.1	-	1	221	c.222A>G	c.(220-222)tcA>tcG	p.S74S		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	74					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S74S(1)		endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TGATGGTAGTTGAGTTACAAA	0.443													T|||	11	0.00219649	0.0	0.0014	5008	,	,		17302	0.0		0.006	False		,,,				2504	0.0041				p.S74S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A222G	11						.	T		5,4397	9.9+/-24.2	0,5,2196	63.0	60.0	61.0		222	-5.6	0.0	11	dbSNP_134	61	45,8547	30.7+/-82.3	0,45,4251	yes	coding-synonymous	OR5F1	NM_003697.1		0,50,6447	CC,CT,TT		0.5237,0.1136,0.3848		74/315	55761880	50,12944	2201	4296	6497	55518456	SO:0001819	synonymous_variant	338674	exon1			AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.222A>G	11.37:g.55761880T>C		Somatic		Capture	SOLID	Phase_I	55518456	NM_003697	Q495D1|Q6IFB9	Silent	SNP	ENST00000278409.1	37	CCDS31515.1																																																																																				0.443	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
OR5T2	219464	hgsc.bcm.edu	37	11	55999758	55999758	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:55999758T>C	ENST00000313264.4	-	1	979	c.904A>G	c.(904-906)Agt>Ggt	p.S302G		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S302G(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TAGCTGGAACTTGGTCTCACA	0.428																																					p.S302G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A904G	11						.						199.0	176.0	184.0					11																	55999758		2201	4296	6497	55756334	SO:0001583	missense	219464	exon1			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.904A>G	11.37:g.55999758T>C	ENSP00000323688:p.Ser302Gly	Somatic		Capture	SOLID	Phase_I	55756334	NM_001004746	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.546511	0.45383	.	.	ENSG00000181718	ENST00000313264	T	0.00179	8.61	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.138912	0.32301	U	0.006300	T	0.00271	0.0008	L	0.28458	0.855	0.09310	N	1	P	0.49253	0.921	P	0.59012	0.85	T	0.59773	-0.7391	10	0.52906	T	0.07	.	8.4534	0.32884	0.2707:0.0:0.0:0.7293	.	302	Q8NGG2	OR5T2_HUMAN	G	302	ENSP00000323688:S302G	ENSP00000323688:S302G	S	-	1	0	OR5T2	55756334	0.000000	0.05858	0.810000	0.32431	0.803000	0.45373	0.358000	0.20216	2.041000	0.60428	0.391000	0.25812	AGT		0.428	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
OR5AP2	338675	hgsc.bcm.edu	37	11	56409747	56409747	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:56409747T>C	ENST00000302981.1	-	1	168	c.169A>G	c.(169-171)Att>Gtt	p.I57V	OR5AP2_ENST00000544374.1_Missense_Mutation_p.I58V	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I57V(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						CAGAGATCAATCTTAATCAAT	0.428																																					p.I57V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A169G	11						.						98.0	90.0	93.0					11																	56409747		2201	4296	6497	56166323	SO:0001583	missense	338675	exon1			AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.169A>G	11.37:g.56409747T>C	ENSP00000303111:p.Ile57Val	Somatic		Capture	SOLID	Phase_I	56166323	NM_001002925	B2RNM8	Missense_Mutation	SNP	ENST00000302981.1	37	CCDS31534.1	.	.	.	.	.	.	.	.	.	.	T	0.035	-1.309425	0.01342	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.02916	4.11;4.11	5.19	-0.0449	0.13853	GPCR, rhodopsin-like superfamily (1);	1.393450	0.04688	N	0.413606	T	0.01695	0.0054	N	0.04787	-0.16	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.47114	-0.9142	10	0.22109	T	0.4	.	5.1725	0.15118	0.0:0.2695:0.2676:0.4629	.	57	Q8NGF4	O5AP2_HUMAN	V	58;57	ENSP00000442701:I58V;ENSP00000303111:I57V	ENSP00000303111:I57V	I	-	1	0	OR5AP2	56166323	0.000000	0.05858	0.259000	0.24435	0.304000	0.27724	-2.215000	0.01222	0.071000	0.16664	0.519000	0.50382	ATT		0.428	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925	
SDHAF2	54949	hgsc.bcm.edu	37	11	61205545	61205545	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:61205545C>T	ENST00000301761.2	+	3	404	c.330C>T	c.(328-330)aaC>aaT	p.N110N	SDHAF2_ENST00000542074.1_Intron|SDHAF2_ENST00000537782.1_Silent_p.N110N|SDHAF2_ENST00000534878.1_Silent_p.N110N|RP11-286N22.8_ENST00000544880.1_3'UTR|RP11-286N22.8_ENST00000543044.1_Silent_p.N98N|SDHAF2_ENST00000543265.1_Intron	NM_017841.2	NP_060311.1			succinate dehydrogenase complex assembly factor 2									p.N110N(1)		large_intestine(3)|lung(4)|ovary(2)	9						GCCTGATTAACGAGCCTAGTA	0.393																																					p.N110N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C330T	11						.						161.0	151.0	155.0					11																	61205545		2202	4299	6501	60962121	SO:0001819	synonymous_variant	54949	exon3			AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000301761.2:c.330C>T	11.37:g.61205545C>T		Somatic		Capture	SOLID	Phase_I	60962121	NM_017841		Silent	SNP	ENST00000301761.2	37	CCDS8007.1																																																																																				0.393	SDHAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398438.1	NM_017841	
SLC22A8	9376	hgsc.bcm.edu	37	11	62782319	62782319	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:62782319G>A	ENST00000336232.2	-	2	247	c.112C>T	c.(112-114)Cag>Tag	p.Q38*	SLC22A8_ENST00000430500.2_Nonsense_Mutation_p.Q38*|SLC22A8_ENST00000535878.1_Intron|SLC22A8_ENST00000545207.1_Intron|SLC22A8_ENST00000311438.8_Nonsense_Mutation_p.Q38*	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	38					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)	p.Q38*(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GTGAAGATCTGCAGCAGGTTG	0.617																																					p.Q38X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C112T	11						.						187.0	187.0	187.0					11																	62782319		2201	4298	6499	62538895	SO:0001587	stop_gained	9376	exon2			AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.112C>T	11.37:g.62782319G>A	ENSP00000337335:p.Gln38*	Somatic		Capture	SOLID	Phase_I	62538895	NM_001184732	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Nonsense_Mutation	SNP	ENST00000336232.2	37	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	G	37	6.205178	0.97376	.	.	ENSG00000149452	ENST00000336232;ENST00000311438;ENST00000430500	.	.	.	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	15.3285	0.74186	0.0:0.0:1.0:0.0	.	.	.	.	X	38	.	ENSP00000311463:Q38X	Q	-	1	0	SLC22A8	62538895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.435000	0.90297	2.460000	0.83146	0.655000	0.94253	CAG		0.617	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	
SLC22A25	387601	hgsc.bcm.edu	37	11	62996914	62996914	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:62996914C>A	ENST00000306494.6	-	1	210	c.211G>T	c.(211-213)Gcc>Tcc	p.A71S	SLC22A25_ENST00000403374.2_5'Flank|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25									p.A71S(1)		NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						CTCAGGAGGGCATCCTGGCTG	0.512																																					p.A71S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G211T	11						.						141.0	129.0	133.0					11																	62996914		2201	4298	6499	62753490	SO:0001583	missense	387601	exon1			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.211G>T	11.37:g.62996914C>A	ENSP00000307443:p.Ala71Ser	Somatic		Capture	SOLID	Phase_I	62753490	NM_199352		Missense_Mutation	SNP	ENST00000306494.6	37	CCDS31592.1	.	.	.	.	.	.	.	.	.	.	C	7.575	0.667447	0.14710	.	.	ENSG00000196600	ENST00000306494;ENST00000451441	T	0.35973	1.28	3.81	1.65	0.23941	Major facilitator superfamily domain (1);	0.827994	0.10980	N	0.612747	T	0.37320	0.0999	M	0.76328	2.33	0.09310	N	1	P;P	0.37548	0.583;0.599	B;B	0.41332	0.196;0.354	T	0.23655	-1.0182	10	0.21540	T	0.41	.	5.5725	0.17204	0.2908:0.5984:0.0:0.1107	.	69;71	A4IF29;Q6T423	.;S22AP_HUMAN	S	71	ENSP00000307443:A71S	ENSP00000307443:A71S	A	-	1	0	SLC22A25	62753490	0.001000	0.12720	0.066000	0.19879	0.613000	0.37349	0.041000	0.13927	0.690000	0.31570	0.472000	0.43445	GCC		0.512	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383519.3	NM_199352	
OTUB1	55611	hgsc.bcm.edu	37	11	63764063	63764063	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:63764063G>A	ENST00000538426.1	+	4	325	c.281G>A	c.(280-282)cGg>cAg	p.R94Q	OTUB1_ENST00000422031.2_Missense_Mutation_p.R131Q|OTUB1_ENST00000543004.1_Missense_Mutation_p.R103Q|OTUB1_ENST00000541478.1_Intron|OTUB1_ENST00000543988.1_Missense_Mutation_p.R64Q|OTUB1_ENST00000428192.2_Missense_Mutation_p.R94Q|OTUB1_ENST00000535715.1_Missense_Mutation_p.R94Q	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	94	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)	p.R94Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						TGTTTCTATCGGGCTTTCGGA	0.587																																					p.R94Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G281A	11						.						98.0	81.0	86.0					11																	63764063		2201	4297	6498	63520639	SO:0001583	missense	55611	exon4			AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.281G>A	11.37:g.63764063G>A	ENSP00000444357:p.Arg94Gln	Somatic		Capture	SOLID	Phase_I	63520639	NM_017670	Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Missense_Mutation	SNP	ENST00000538426.1	37	CCDS8055.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306042	0.60305	.	.	ENSG00000167770	ENST00000535715;ENST00000428192;ENST00000422031;ENST00000538426;ENST00000543004;ENST00000543988	T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28	4.51	3.59	0.41128	Ovarian tumour, otubain (1);	.	.	.	.	T	0.80341	0.4605	H	0.94771	3.58	0.33205	D	0.552679	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.86058	0.1530	9	0.72032	D	0.01	.	9.7719	0.40595	0.0981:0.0:0.9019:0.0	.	131;94	B4DPD5;Q96FW1	.;OTUB1_HUMAN	Q	94;94;131;94;103;64	ENSP00000440211:R94Q;ENSP00000402551:R94Q;ENSP00000416973:R131Q;ENSP00000444357:R94Q;ENSP00000437453:R103Q;ENSP00000441328:R64Q	ENSP00000416973:R131Q	R	+	2	0	OTUB1	63520639	1.000000	0.71417	0.002000	0.10522	0.016000	0.09150	8.803000	0.91915	1.255000	0.44051	0.563000	0.77884	CGG		0.587	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396277.1	NM_017670	
CDC42BPG	55561	hgsc.bcm.edu	37	11	64594594	64594594	+	Silent	SNP	C	C	T	rs186031768		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:64594594C>T	ENST00000342711.5	-	34	4316	c.4317G>A	c.(4315-4317)ccG>ccA	p.P1439P		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)									p.P1439P(1)		central_nervous_system(1)|lung(3)	4						AGTTGGTAGGCGGCGAGATGA	0.632													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16344	0.0		0.0	False		,,,				2504	0.0				p.P1439P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4317A	11						.	C		0,4402		0,0,2201	130.0	112.0	118.0		4317	-2.0	0.8	11		118	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	CDC42BPG	NM_017525.2		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		1439/1552	64594594	1,12995	2201	4297	6498	64351170	SO:0001819	synonymous_variant	55561	exon34			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.4317G>A	11.37:g.64594594C>T		Somatic		Capture	SOLID	Phase_I	64351170	NM_017525		Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																				0.632	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
KAT5	10524	hgsc.bcm.edu	37	11	65486179	65486179	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:65486179G>A	ENST00000377046.3	+	12	1556	c.1284G>A	c.(1282-1284)ggG>ggA	p.G428G	KAT5_ENST00000352980.4_Silent_p.G376G|KAT5_ENST00000530446.1_Silent_p.G409G|KAT5_ENST00000534650.1_Silent_p.G217G|KAT5_ENST00000341318.4_Silent_p.G461G|RNASEH2C_ENST00000308418.4_3'UTR	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	428	Interaction with ATF2.|MYST-type HAT.				androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)	p.G461G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						TCCTGATGGGGCTGAAGTCGG	0.582																																					p.G461G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1383A	11						.						96.0	105.0	102.0					11																	65486179		2201	4297	6498	65242755	SO:0001819	synonymous_variant	10524	exon11			U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.1284G>A	11.37:g.65486179G>A		Somatic		Capture	SOLID	Phase_I	65242755	NM_182710	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Silent	SNP	ENST00000377046.3	37	CCDS31610.1																																																																																				0.582	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	
AIP	9049	hgsc.bcm.edu	37	11	67250681	67250681	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:67250681A>G	ENST00000279146.3	+	1	170	c.52A>G	c.(52-54)Ata>Gta	p.I18V		NM_003977.2	NP_003968.2	O00170	AIP_HUMAN	aryl hydrocarbon receptor interacting protein	18					negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GAF domain binding (GO:0036004)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|unfolded protein binding (GO:0051082)	p.I18V(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|skin(2)	7						AAAACGTGTGATACAGGAAGG	0.607									Familial Isolated Pituitary Adenoma																												p.I18V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A52G	11						.						134.0	127.0	129.0					11																	67250681		2200	4295	6495	67007257	SO:0001583	missense	9049	exon1	Familial Cancer Database	FIPA, incl. Familial Isolated Somatotropinomas, FIS, IFS, Familial Acromegaly	U31913	CCDS8168.1	11q13.3	2014-09-17	2001-11-29		ENSG00000110711	ENSG00000110711			358	protein-coding gene	gene with protein product		605555	"""aryl hydrocarbon receptor-interacting protein"""			8972861, 9111057	Standard	NM_003977		Approved	XAP2, ARA9, FKBP16	uc001olv.3	O00170	OTTHUMG00000167674	ENST00000279146.3:c.52A>G	11.37:g.67250681A>G	ENSP00000279146:p.Ile18Val	Somatic		Capture	SOLID	Phase_I	67007257	NM_003977	A0SZW3|A0SZW4|A0SZW5|A0SZW6|Q2M3Q2|Q99606	Missense_Mutation	SNP	ENST00000279146.3	37	CCDS8168.1	.	.	.	.	.	.	.	.	.	.	A	12.14	1.849259	0.32699	.	.	ENSG00000110711	ENST00000528641;ENST00000279146;ENST00000529797	D;D;D	0.91740	-2.9;-2.9;-2.9	5.69	1.88	0.25563	.	0.352800	0.30365	N	0.009781	T	0.80352	0.4607	N	0.14661	0.345	0.47308	D	0.999384	B	0.09022	0.002	B	0.12837	0.008	T	0.69292	-0.5183	10	0.30854	T	0.27	-12.3057	3.5951	0.08003	0.5969:0.1971:0.206:0.0	.	18	O00170	AIP_HUMAN	V	18	ENSP00000434982:I18V;ENSP00000279146:I18V;ENSP00000434580:I18V	ENSP00000279146:I18V	I	+	1	0	AIP	67007257	0.958000	0.32768	1.000000	0.80357	0.575000	0.36095	0.885000	0.28227	0.989000	0.38761	-0.464000	0.05259	ATA		0.607	AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395516.1		
NADSYN1	55191	hgsc.bcm.edu	37	11	71191870	71191870	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:71191870G>A	ENST00000319023.2	+	11	1131	c.943G>A	c.(943-945)Gca>Aca	p.A315T	NADSYN1_ENST00000526039.2_3'UTR|NADSYN1_ENST00000539574.1_Missense_Mutation_p.A55T|NADSYN1_ENST00000530055.1_5'UTR	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	315					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)	p.A315T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	GGACTTGCTGGCACCCATCTC	0.607																																					p.A315T	Ovarian(79;763 1781 6490 50276)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G943A	11						.						94.0	73.0	80.0					11																	71191870		2200	4294	6494	70869518	SO:0001583	missense	55191	exon11			AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.943G>A	11.37:g.71191870G>A	ENSP00000326424:p.Ala315Thr	Somatic		Capture	SOLID	Phase_I	70869518	NM_018161	B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	ENST00000319023.2	37	CCDS8201.1	.	.	.	.	.	.	.	.	.	.	G	2.045	-0.419119	0.04766	.	.	ENSG00000172890	ENST00000319023;ENST00000539574	T;T	0.22539	2.53;1.95	5.18	-3.05	0.05396	.	1.296500	0.05324	N	0.527195	T	0.11239	0.0274	N	0.17474	0.49	0.09310	N	0.999999	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.36311	-0.9753	10	0.10377	T	0.69	-5.7117	8.9578	0.35829	0.0741:0.6263:0.2067:0.0929	.	55;315	B3KUU4;Q6IA69	.;NADE_HUMAN	T	315;55	ENSP00000326424:A315T;ENSP00000443718:A55T	ENSP00000326424:A315T	A	+	1	0	NADSYN1	70869518	0.011000	0.17503	0.284000	0.24805	0.040000	0.13550	-0.040000	0.12104	-0.426000	0.07360	0.561000	0.74099	GCA		0.607	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	NM_018161	
LRTOMT	220074	hgsc.bcm.edu	37	11	71806037	71806037	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:71806037G>T	ENST00000289488.2	+	5	710	c.332G>T	c.(331-333)gGc>gTc	p.G111V	LAMTOR1_ENST00000535107.1_Intron|LRTOMT_ENST00000536917.1_Missense_Mutation_p.G111V|LRTOMT_ENST00000435085.1_5'UTR|LAMTOR1_ENST00000545249.1_Intron|LRTOMT_ENST00000447974.1_Missense_Mutation_p.G111V|LRTOMT_ENST00000419228.1_5'UTR|LAMTOR1_ENST00000539797.1_5'Flank|LRTOMT_ENST00000324866.7_Missense_Mutation_p.G111V|LRTOMT_ENST00000538478.1_Missense_Mutation_p.G111V|LRTOMT_ENST00000539271.1_5'UTR|LRTOMT_ENST00000423494.2_Missense_Mutation_p.G93V|LRTOMT_ENST00000440313.2_5'UTR|LRTOMT_ENST00000439209.1_Missense_Mutation_p.G111V|LRTOMT_ENST00000539587.1_5'UTR|LRTOMT_ENST00000541614.1_Missense_Mutation_p.G111V|LRTOMT_ENST00000307198.7_5'UTR	NM_001271471.2|NM_145309.5	NP_001258400.1|NP_660352.1	Q96E66	LRC51_HUMAN	leucine rich transmembrane and O-methyltransferase domain containing	111						cytoplasm (GO:0005737)		p.G111V(1)		large_intestine(2)|lung(1)|ovary(1)	4						TATCTTCACGGCAACAGCATC	0.557																																					p.G111V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G332T	11						.						131.0	126.0	128.0					11																	71806037		2200	4293	6493	71483685	SO:0001583	missense	220074	exon5				CCDS8208.1, CCDS44667.1, CCDS44668.1, CCDS55778.1, CCDS59227.1	11q13.4	2014-09-05	2013-08-19	2008-11-27	ENSG00000184154	ENSG00000184154			25033	protein-coding gene	gene with protein product		612414	"""leucine rich repeat containing 51"", ""deafness, autosomal recessive 63"""	LRRC51, DFNB63		18794526, 18953341	Standard	NM_145309		Approved	COMT2, CFAP111	uc010rqw.2	Q8WZ04	OTTHUMG00000154887	ENST00000289488.2:c.332G>T	11.37:g.71806037G>T	ENSP00000289488:p.Gly111Val	Somatic		Capture	SOLID	Phase_I	71483685	NM_001145307	B2R7X1|B6CZ35|B6CZ36|B6CZ37|B6CZ38|B6CZ39|B7Z5I4	Missense_Mutation	SNP	ENST00000289488.2	37	CCDS8208.1	.	.	.	.	.	.	.	.	.	.	g	21.8	4.204025	0.79127	.	.	ENSG00000184154	ENST00000289488;ENST00000447974;ENST00000423494;ENST00000538478;ENST00000324866;ENST00000439209;ENST00000541614;ENST00000536917	T;T;T;T;T;T;T;T	0.60171	1.82;0.21;1.82;1.82;0.21;0.21;0.21;0.21	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.73249	0.3563	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.991;0.998;0.996	T	0.72232	-0.4353	10	0.42905	T	0.14	-26.3037	16.2113	0.82164	0.0:0.0:1.0:0.0	.	93;111;111	Q96E66-6;Q96E66-2;Q96E66	.;.;LRC51_HUMAN	V	111;111;93;111;111;111;111;111	ENSP00000289488:G111V;ENSP00000414271:G111V;ENSP00000441249:G93V;ENSP00000444583:G111V;ENSP00000440693:G111V;ENSP00000395139:G111V;ENSP00000438522:G111V;ENSP00000443421:G111V	ENSP00000289488:G111V	G	+	2	0	LRTOMT	71483685	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	6.054000	0.71096	2.571000	0.86741	0.604000	0.83254	GGC		0.557	LRTOMT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337504.1	NM_145309	
SLCO2B1	11309	hgsc.bcm.edu	37	11	74904577	74904577	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:74904577G>A	ENST00000289575.5	+	9	1785	c.1390G>A	c.(1390-1392)Ggc>Agc	p.G464S	SLCO2B1_ENST00000454962.2_Missense_Mutation_p.G237S|SLCO2B1_ENST00000531756.1_Missense_Mutation_p.G209S|SLCO2B1_ENST00000532236.1_Missense_Mutation_p.G348S|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.G442S|SLCO2B1_ENST00000341411.4_Missense_Mutation_p.G237S|SLCO2B1_ENST00000525650.1_Missense_Mutation_p.G320S	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	464					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.G464S(1)		breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	CTTCTTTATCGGCTGCTCCAG	0.627																																					p.G320S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G958A	11						.						37.0	33.0	34.0					11																	74904577		2200	4293	6493	74582225	SO:0001583	missense	11309	exon6			AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1390G>A	11.37:g.74904577G>A	ENSP00000289575:p.Gly464Ser	Somatic		Capture	SOLID	Phase_I	74582225	NM_001145212	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963967	0.74131	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000531756;ENST00000525650;ENST00000454962;ENST00000428359	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.02	5.02	0.67125	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.61148	0.2324	M	0.62266	1.93	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.57734	-0.7760	10	0.36615	T	0.2	.	15.8595	0.79012	0.0:0.0:1.0:0.0	.	320;209;237;464	E9PPU8;E9PPJ4;O94956-2;O94956	.;.;.;SO2B1_HUMAN	S	464;237;348;209;320;237;442	ENSP00000289575:G464S;ENSP00000341286:G237S;ENSP00000434112:G348S;ENSP00000432650:G209S;ENSP00000436324:G320S;ENSP00000389653:G237S;ENSP00000388912:G442S	ENSP00000289575:G464S	G	+	1	0	SLCO2B1	74582225	1.000000	0.71417	0.998000	0.56505	0.061000	0.15899	7.562000	0.82300	2.605000	0.88082	0.561000	0.74099	GGC		0.627	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
DGAT2	84649	hgsc.bcm.edu	37	11	75507491	75507491	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:75507491A>C	ENST00000228027.7	+	5	808	c.548A>C	c.(547-549)aAg>aCg	p.K183T	DGAT2_ENST00000376262.3_Missense_Mutation_p.K140T	NM_032564.4	NP_115953.2	Q96PD7	DGAT2_HUMAN	diacylglycerol O-acyltransferase 2	183					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|cellular response to oleic acid (GO:0071400)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|diacylglycerol metabolic process (GO:0046339)|fat pad development (GO:0060613)|fatty acid homeostasis (GO:0055089)|glycerol metabolic process (GO:0006071)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)|protein homodimerization activity (GO:0042803)|retinol O-fatty-acyltransferase activity (GO:0050252)	p.K183T(1)		endometrium(3)|large_intestine(5)|lung(5)|prostate(2)|skin(2)	17	Ovarian(111;0.103)					GAAGTGAGCAAGAAGTTCCCA	0.542																																					p.K183T	Melanoma(35;811 1096 8354 24009 39363)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A548C	11						.						138.0	115.0	123.0					11																	75507491		2200	4293	6493	75185139	SO:0001583	missense	84649	exon5				CCDS31642.1, CCDS58162.1	11q13.3	2010-06-24	2010-06-24		ENSG00000062282	ENSG00000062282			16940	protein-coding gene	gene with protein product		606983	"""diacylglycerol O-acyltransferase homolog 2 (mouse)"""			11481335, 14970677	Standard	NM_032564		Approved		uc001oxa.3	Q96PD7	OTTHUMG00000165338	ENST00000228027.7:c.548A>C	11.37:g.75507491A>C	ENSP00000228027:p.Lys183Thr	Somatic		Capture	SOLID	Phase_I	75185139	NM_032564	A6ND76|Q5U810|Q68CL3|Q68DJ0|Q8NDB7|Q96BS0|Q9BYE5	Missense_Mutation	SNP	ENST00000228027.7	37	CCDS31642.1	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799241	0.70567	.	.	ENSG00000062282	ENST00000524706;ENST00000533517;ENST00000228027;ENST00000376262;ENST00000525612;ENST00000526306	T;T	0.14640	2.49;2.49	5.88	5.88	0.94601	.	0.041481	0.85682	D	0.000000	T	0.17492	0.0420	L	0.58669	1.825	0.80722	D	1	B;P	0.43231	0.397;0.801	B;B	0.39531	0.302;0.258	T	0.01048	-1.1469	10	0.46703	T	0.11	-33.8707	15.1358	0.72566	1.0:0.0:0.0:0.0	.	140;183	Q96PD7-2;Q96PD7	.;DGAT2_HUMAN	T	92;92;183;140;137;92	ENSP00000228027:K183T;ENSP00000365438:K140T	ENSP00000228027:K183T	K	+	2	0	DGAT2	75185139	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.104000	0.77024	2.246000	0.74042	0.533000	0.62120	AAG		0.542	DGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383506.1	NM_032564	
ACER3	55331	hgsc.bcm.edu	37	11	76696756	76696756	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:76696756A>G	ENST00000532485.1	+	5	494	c.390A>G	c.(388-390)ttA>ttG	p.L130L	ACER3_ENST00000533873.1_Silent_p.L93L|ACER3_ENST00000538157.1_Silent_p.L88L|ACER3_ENST00000526597.1_Silent_p.L35L|ACER3_ENST00000530182.1_3'UTR	NM_018367.5	NP_060837.3	Q9NUN7	ACER3_HUMAN	alkaline ceramidase 3	130					ceramide metabolic process (GO:0006672)|phytosphingosine biosynthetic process (GO:0071602)|positive regulation of cell proliferation (GO:0008284)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of Golgi membrane (GO:0030173)	phytoceramidase activity (GO:0070774)	p.L130L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	9						TATTCAGTTTAATAGTAACCA	0.289																																					p.L130L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A390G	11						.						73.0	73.0	73.0					11																	76696756		2196	4286	6482	76374404	SO:0001819	synonymous_variant	55331	exon5			AF214454	CCDS8247.1, CCDS73352.1	11q13.5	2013-01-25	2008-12-19	2008-12-19	ENSG00000078124	ENSG00000078124	3.5.1.23	"""Alkaline ceramidase"""	16066	protein-coding gene	gene with protein product	"""alkaline phytoceramidase"""		"""phytoceramidase, alkaline"""	PHCA		11356846, 18619555	Standard	XM_005274090		Approved	FLJ11238, APHC	uc009yum.1	Q9NUN7	OTTHUMG00000165225	ENST00000532485.1:c.390A>G	11.37:g.76696756A>G		Somatic		Capture	SOLID	Phase_I	76374404	NM_018367	B2RC99	Silent	SNP	ENST00000532485.1	37	CCDS8247.1																																																																																				0.289	ACER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382770.2	NM_018367	
PAK1	5058	hgsc.bcm.edu	37	11	77064625	77064625	+	Silent	SNP	G	G	A	rs200649525		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:77064625G>A	ENST00000356341.3	-	8	1323	c.792C>T	c.(790-792)ggC>ggT	p.G264G	PAK1_ENST00000530617.1_Silent_p.G264G|PAK1_ENST00000528203.1_Silent_p.G166G|PAK1_ENST00000525542.1_Intron|PAK1_ENST00000278568.4_Silent_p.G264G	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	264	Interaction with CRIPAK.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G264G(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					TCTTAGGATCGCCCACACTCA	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		19176	0.0		0.001	False		,,,				2504	0.0				p.G264G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C792T	11						.						159.0	139.0	146.0					11																	77064625		2200	4292	6492	76742273	SO:0001819	synonymous_variant	5058	exon8			U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.792C>T	11.37:g.77064625G>A		Somatic		Capture	SOLID	Phase_I	76742273	NM_002576	O75561|Q13567|Q32M53|Q32M54|Q86W79	Silent	SNP	ENST00000356341.3	37	CCDS8250.1																																																																																				0.418	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576	
INTS4	92105	hgsc.bcm.edu	37	11	77590170	77590170	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:77590170G>A	ENST00000534064.1	-	23	2751	c.2717C>T	c.(2716-2718)gCa>gTa	p.A906V	AAMDC_ENST00000532481.1_Intron|AAMDC_ENST00000527134.1_Intron|AAMDC_ENST00000304716.8_Intron|INTS4_ENST00000535943.1_Missense_Mutation_p.A281V	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	906					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.A906V(1)	INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			CACCTGGCATGCCTCTGAAAA	0.458																																					p.A906V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2717T	11						.						65.0	63.0	64.0					11																	77590170		2200	4292	6492	77267818	SO:0001583	missense	92105	exon23			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.2717C>T	11.37:g.77590170G>A	ENSP00000434466:p.Ala906Val	Somatic		Capture	SOLID	Phase_I	77267818	NM_033547	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061779	0.76187	.	.	ENSG00000149262	ENST00000534064;ENST00000535943	.	.	.	5.38	5.38	0.77491	.	0.154649	0.64402	D	0.000014	T	0.49830	0.1580	N	0.17082	0.46	0.41892	D	0.990374	B	0.14805	0.011	B	0.15870	0.014	T	0.39461	-0.9613	9	0.37606	T	0.19	-7.586	19.3283	0.94273	0.0:0.0:1.0:0.0	.	906	Q96HW7	INT4_HUMAN	V	906;281	.	ENSP00000434466:A906V	A	-	2	0	INTS4	77267818	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	8.782000	0.91809	2.801000	0.96364	0.655000	0.94253	GCA		0.458	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
NDUFC2	4718	hgsc.bcm.edu	37	11	77784147	77784147	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:77784147delA	ENST00000281031.4	-	2	681	c.207delT	c.(205-207)tttfs	p.F69fs	NDUFC2_ENST00000528164.1_Frame_Shift_Del_p.F69fs|NDUFC2_ENST00000534029.1_Intron|NDUFC2-KCTD14_ENST00000528251.1_Intron|NDUFC2-KCTD14_ENST00000530054.1_Frame_Shift_Del_p.F69fs|NDUFC2_ENST00000525085.1_Intron|NDUFC2_ENST00000527806.1_Frame_Shift_Del_p.F69fs	NM_001204055.1|NM_004549.5	NP_001190984.1|NP_004540.1	O95298	NDUC2_HUMAN	NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa	69					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.F69fs*7(1)		large_intestine(1)|lung(2)|prostate(1)	4	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)		Carvedilol(DB01136)	AATATCCAGCAAAAAAAAAGG	0.358																																					p.F69fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.207delT	11						.						83.0	84.0	83.0					11																	77784147		2200	4292	6492	77461795	SO:0001589	frameshift_variant	4718	exon2			AF087659	CCDS8257.1, CCDS55779.1, CCDS55781.1	11q14.1	2011-07-04	2002-08-29		ENSG00000151366	ENSG00000151366		"""Mitochondrial respiratory chain complex / Complex I"""	7706	protein-coding gene	gene with protein product	"""human lung cancer oncogene 1"", ""complex I subunit B14.5b"""	603845	"""NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2 (14.5kD, B14.5b)"""			9878551	Standard	NM_001204055		Approved	B14.5b, HLC-1		O95298		ENST00000281031.4:c.207delT	11.37:g.77784147delA	ENSP00000281031:p.Phe69fs	Somatic		Capture	SOLID	Phase_I	77461795	NM_004549	E9PNU8|E9PRB2|Q549M5|Q6FIH8|Q9UBJ9	Frame_Shift_Del	DEL	ENST00000281031.4	37	CCDS8257.1																																																																																				0.358	NDUFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390821.1	NM_004549	
ANKRD49	54851	hgsc.bcm.edu	37	11	94231448	94231448	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:94231448C>T	ENST00000544612.1	+	3	967	c.470C>T	c.(469-471)gCt>gTt	p.A157V	ANKRD49_ENST00000544253.1_3'UTR|ANKRD49_ENST00000302755.4_Missense_Mutation_p.A157V|ANKRD49_ENST00000538535.1_3'UTR	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49	157					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)		p.A157V(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACCAGAGTGGCTTCTTTCTTA	0.517																																					p.A157V	Melanoma(113;823 1621 4352 9582 22033)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C470T	11						.						95.0	85.0	88.0					11																	94231448		2201	4298	6499	93871096	SO:0001583	missense	54851	exon3			AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.470C>T	11.37:g.94231448C>T	ENSP00000440396:p.Ala157Val	Somatic		Capture	SOLID	Phase_I	93871096	NM_017704	Q8NDF2|Q96JE5|Q9NXK7	Missense_Mutation	SNP	ENST00000544612.1	37	CCDS8300.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984678	0.74474	.	.	ENSG00000168876	ENST00000544612;ENST00000535502;ENST00000302755	T;T;T	0.57752	0.38;0.38;0.38	5.88	5.88	0.94601	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.39989	0.1099	N	0.05510	-0.035	0.80722	D	1	B	0.18863	0.031	B	0.33960	0.173	T	0.26916	-1.0089	10	0.12430	T	0.62	-21.3249	20.2187	0.98312	0.0:1.0:0.0:0.0	.	157	Q8WVL7	ANR49_HUMAN	V	157;116;157	ENSP00000440396:A157V;ENSP00000442449:A116V;ENSP00000303518:A157V	ENSP00000303518:A157V	A	+	2	0	ANKRD49	93871096	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.202000	0.77856	2.780000	0.95670	0.655000	0.94253	GCT		0.517	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396314.2	NM_017704	
KCNJ1	3758	hgsc.bcm.edu	37	11	128709588	128709588	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr11:128709588C>T	ENST00000392664.2	-	2	724	c.608G>A	c.(607-609)cGg>cAg	p.R203Q	KCNJ1_ENST00000392665.2_Missense_Mutation_p.R184Q|KCNJ1_ENST00000392666.1_Missense_Mutation_p.R184Q|KCNJ1_ENST00000324036.3_Missense_Mutation_p.R184Q|KCNJ1_ENST00000440599.2_Missense_Mutation_p.R184Q	NM_000220.4	NP_000211.1	P48048	KCNJ1_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 1	203					cardiovascular system development (GO:0072358)|excretion (GO:0007588)|kidney development (GO:0001822)|post-embryonic development (GO:0009791)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of G-protein activated inward rectifier potassium channel activity (GO:1900128)|renal sodium ion absorption (GO:0070294)|synaptic transmission (GO:0007268)|tissue homeostasis (GO:0001894)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.R203Q(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)	23	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Bethanidine(DB00217)|Glimepiride(DB00222)|Glyburide(DB01016)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Tolazamide(DB00839)|Tolbutamide(DB01124)|Yohimbine(DB01392)	CTTCCCTCCCCGTTTGCTGAT	0.478																																					p.R184Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G551A	11						.						81.0	76.0	78.0					11																	128709588		2198	4289	6487	128214798	SO:0001583	missense	3758	exon3			BC063109	CCDS8476.1, CCDS8477.1	11q24	2011-07-05			ENSG00000151704	ENSG00000151704		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6255	protein-coding gene	gene with protein product		600359				7680431, 8190102, 16382105	Standard	NM_153765		Approved	Kir1.1, ROMK1	uc001qeo.2	P48048	OTTHUMG00000048247	ENST00000392664.2:c.608G>A	11.37:g.128709588C>T	ENSP00000376432:p.Arg203Gln	Somatic		Capture	SOLID	Phase_I	128214798	NM_153765	B2RMR4|Q6LD67	Missense_Mutation	SNP	ENST00000392664.2	37	CCDS8476.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265673	0.59431	.	.	ENSG00000151704	ENST00000392665;ENST00000392666;ENST00000440599;ENST00000324036;ENST00000392664	D;D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63;-3.63	5.71	5.71	0.89125	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.109084	0.64402	D	0.000013	D	0.96034	0.8708	M	0.70595	2.14	0.53005	D	0.999969	D	0.65815	0.995	P	0.53401	0.725	D	0.95995	0.8989	10	0.66056	D	0.02	.	19.8655	0.96803	0.0:1.0:0.0:0.0	.	203	P48048	IRK1_HUMAN	Q	184;184;184;184;203	ENSP00000376433:R184Q;ENSP00000376434:R184Q;ENSP00000406320:R184Q;ENSP00000316233:R184Q;ENSP00000376432:R203Q	ENSP00000316233:R184Q	R	-	2	0	KCNJ1	128214798	0.997000	0.39634	0.905000	0.35620	0.411000	0.31082	3.472000	0.53114	2.690000	0.91761	0.514000	0.50259	CGG		0.478	KCNJ1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386233.1	NM_000220	
MCHR2	84539	hgsc.bcm.edu	37	6	100395799	100395799	+	Silent	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:100395799C>A	ENST00000281806.2	-	3	545	c.231G>T	c.(229-231)gtG>gtT	p.V77V	MCHR2_ENST00000369212.2_Silent_p.V77V	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V77V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CCAAATCAGCCACAGCCAGGT	0.463																																					p.V77V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G231T	6						.						79.0	81.0	80.0					6																	100395799		2203	4300	6503	100502520	SO:0001819	synonymous_variant	84539	exon3			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.231G>T	6.37:g.100395799C>A		Somatic		Capture	SOLID	Phase_I	100502520	NM_001040179	B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Silent	SNP	ENST00000281806.2	37	CCDS5044.1																																																																																				0.463	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041620.2	NM_032503	
HACE1	57531	hgsc.bcm.edu	37	6	105219221	105219221	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:105219221T>C	ENST00000262903.4	-	19	2334	c.2058A>G	c.(2056-2058)gaA>gaG	p.E686E	HACE1_ENST00000369125.2_Intron|HACE1_ENST00000517995.1_5'UTR	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	686	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.E686E(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		TTTTCGCATATTCTGGATCAA	0.348																																					p.E686E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2058G	6						.						75.0	75.0	75.0					6																	105219221		2203	4300	6503	105325914	SO:0001819	synonymous_variant	57531	exon19			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2058A>G	6.37:g.105219221T>C		Somatic		Capture	SOLID	Phase_I	105325914	NM_020771	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Silent	SNP	ENST00000262903.4	37	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	T	8.158	0.788969	0.16258	.	.	ENSG00000085382	ENST00000518503;ENST00000518402	.	.	.	5.32	2.96	0.34315	.	.	.	.	.	T	0.43100	0.1232	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34775	-0.9815	4	.	.	.	.	8.1687	0.31241	0.0:0.2354:0.0:0.7646	.	.	.	.	V	169;121	.	.	I	-	1	0	HACE1	105325914	0.995000	0.38212	1.000000	0.80357	0.992000	0.81027	0.362000	0.20284	0.852000	0.35287	0.482000	0.46254	ATA		0.348	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
SESN1	27244	hgsc.bcm.edu	37	6	109309862	109309862	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:109309862T>A	ENST00000356644.7	-	9	1370	c.1276A>T	c.(1276-1278)Aac>Tac	p.N426Y	SESN1_ENST00000302071.2_Missense_Mutation_p.N360Y|SESN1_ENST00000436639.2_Missense_Mutation_p.N485Y	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	426					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)		p.N485Y(1)		cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		AATAGCTGGTTAATTTCACCA	0.318																																					p.N485Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1453T	6						.						59.0	54.0	56.0					6																	109309862		2203	4300	6503	109416555	SO:0001583	missense	27244	exon9			AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.1276A>T	6.37:g.109309862T>A	ENSP00000349061:p.Asn426Tyr	Somatic		Capture	SOLID	Phase_I	109416555	NM_014454	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Missense_Mutation	SNP	ENST00000356644.7	37	CCDS56445.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.555567	0.86231	.	.	ENSG00000080546	ENST00000436639;ENST00000302071;ENST00000356644	T;T;T	0.46819	0.86;0.86;0.86	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	M	0.91090	3.175	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.85130	0.997;0.996	T	0.79085	-0.1948	10	0.87932	D	0	-12.5011	15.7383	0.77863	0.0:0.0:0.0:1.0	.	485;426	Q9Y6P5-2;Q9Y6P5	.;SESN1_HUMAN	Y	485;360;426	ENSP00000393762:N485Y;ENSP00000306734:N360Y;ENSP00000349061:N426Y	ENSP00000306734:N360Y	N	-	1	0	SESN1	109416555	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.651000	0.83577	2.120000	0.65058	0.533000	0.62120	AAC		0.318	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454	
ELOVL2	54898	hgsc.bcm.edu	37	6	10990004	10990004	+	Missense_Mutation	SNP	C	C	T	rs533736335		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:10990004C>T	ENST00000354666.3	-	7	780	c.697G>A	c.(697-699)Ggt>Agt	p.G233S		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	233					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)	p.G233S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			ATGAGACAACCGAAGGGGAAG	0.483																																					p.G233S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G697A	6						.						105.0	92.0	96.0					6																	10990004		2203	4300	6503	11097990	SO:0001583	missense	54898	exon7			AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.697G>A	6.37:g.10990004C>T	ENSP00000346693:p.Gly233Ser	Somatic		Capture	SOLID	Phase_I	11097990	NM_017770	Q6P9E1|Q86W94	Missense_Mutation	SNP	ENST00000354666.3	37	CCDS4518.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208330	0.79240	.	.	ENSG00000197977	ENST00000354666	T	0.20463	2.07	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.33962	0.0881	M	0.64260	1.97	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.01925	-1.1246	10	0.19590	T	0.45	-0.9643	19.3429	0.94350	0.0:1.0:0.0:0.0	.	233	Q9NXB9	ELOV2_HUMAN	S	233	ENSP00000346693:G233S	ENSP00000346693:G233S	G	-	1	0	ELOVL2	11097990	1.000000	0.71417	0.867000	0.34043	0.993000	0.82548	4.772000	0.62324	2.562000	0.86427	0.650000	0.86243	GGT		0.483	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039849.1		
AK9	221264	hgsc.bcm.edu	37	6	109980483	109980483	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:109980483T>C	ENST00000424296.2	-	7	654	c.578A>G	c.(577-579)aAg>aGg	p.K193R	AK9_ENST00000368948.2_Missense_Mutation_p.K193R|AK9_ENST00000341338.6_5'UTR|AK9_ENST00000285397.5_Missense_Mutation_p.K193R	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	193	Adenylate kinase 1.|LID 1. {ECO:0000250}.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)	p.K193R(2)									ttttccgtccttttgggcttc	0.393																																					p.K193R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A578G	6						.						122.0	117.0	119.0					6																	109980483		2203	4300	6503	110087176	SO:0001583	missense	221264	exon7			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.578A>G	6.37:g.109980483T>C	ENSP00000410186:p.Lys193Arg	Somatic		Capture	SOLID	Phase_I	110087176	NM_001145128	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	ENST00000424296.2	37	CCDS55048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.96|11.96	1.794833|1.794833	0.31777|0.31777	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000424296;ENST00000368948;ENST00000285397;ENST00000448084;ENST00000532976|ENST00000524674	T;T;T;T;T|.	0.64803|.	-0.12;-0.11;-0.1;1.01;1.01|.	5.05|5.05	3.9|3.9	0.45041|0.45041	ATPase, AAA+ type, core (1);|.	1.104770|.	0.06713|.	N|.	0.773576|.	T|T	0.29588|0.29588	0.0738|0.0738	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999998|0.999998	B;D|.	0.58268|.	0.023;0.982|.	B;P|.	0.57620|.	0.01;0.824|.	T|T	0.09818|0.09818	-1.0657|-1.0657	9|5	.|.	.|.	.|.	-3.021|-3.021	7.9358|7.9358	0.29929|0.29929	0.0:0.0951:0.0:0.9049|0.0:0.0951:0.0:0.9049	.|.	193;193|.	Q5TCS8-2;Q5TCS8|.	.;AKD1_HUMAN|.	R|G	193;193;193;116;193|81	ENSP00000410186:K193R;ENSP00000357944:K193R;ENSP00000285397:K193R;ENSP00000407510:K116R;ENSP00000436325:K193R|.	.|.	K|R	-|-	2|1	0|2	AKD1|AKD1	110087176|110087176	0.991000|0.991000	0.36638|0.36638	0.322000|0.322000	0.25334|0.25334	0.013000|0.013000	0.08279|0.08279	0.836000|0.836000	0.27545|0.27545	1.898000|1.898000	0.54952|0.54952	0.528000|0.528000	0.53228|0.53228	AAG|AGG		0.393	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001145128	
HSF2	3298	hgsc.bcm.edu	37	6	122743311	122743311	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:122743311C>T	ENST00000368455.4	+	8	890	c.698C>T	c.(697-699)aCt>aTt	p.T233I	HSF2_ENST00000452194.1_Missense_Mutation_p.T233I	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2	233					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.T233I(1)		large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		CACAGTAGGACTGAAGGTTTA	0.318																																					p.T233I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C698T	6						.						87.0	89.0	89.0					6																	122743311		2203	4299	6502	122785010	SO:0001583	missense	3298	exon8			M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.698C>T	6.37:g.122743311C>T	ENSP00000357440:p.Thr233Ile	Somatic		Capture	SOLID	Phase_I	122785010	NM_004506	B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Missense_Mutation	SNP	ENST00000368455.4	37	CCDS5124.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237948	0.39598	.	.	ENSG00000025156	ENST00000368455;ENST00000452194	.	.	.	5.65	5.65	0.86999	Vertebrate heat shock transcription factor (1);	0.392138	0.28312	N	0.015806	T	0.43590	0.1254	L	0.44542	1.39	0.44024	D	0.996741	B;B	0.19706	0.03;0.038	B;B	0.20384	0.017;0.029	T	0.29427	-1.0012	9	0.35671	T	0.21	-15.9327	16.3677	0.83341	0.1323:0.8677:0.0:0.0	.	233;233	Q03933-2;Q03933	.;HSF2_HUMAN	I	233	.	ENSP00000357440:T233I	T	+	2	0	HSF2	122785010	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	1.743000	0.38258	2.827000	0.97445	0.650000	0.86243	ACT		0.318	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043520.1	NM_004506	
RNF217	154214	hgsc.bcm.edu	37	6	125379202	125379202	+	Missense_Mutation	SNP	A	A	C	rs142610684	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:125379202A>C	ENST00000521654.2	+	3	1231	c.1231A>C	c.(1231-1233)Agc>Cgc	p.S411R	RNF217_ENST00000275184.6_Missense_Mutation_p.S55R|RNF217_ENST00000368414.2_5'UTR|RNF217_ENST00000359704.2_Missense_Mutation_p.S119R|RNF217_ENST00000560949.1_Missense_Mutation_p.S176R			Q8TC41	RN217_HUMAN	ring finger protein 217	411					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S119R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		TCACTGGGCCAGCGAAATTGA	0.448																																					p.S119R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A355C	6						.						105.0	99.0	101.0					6																	125379202		2203	4300	6503	125420901	SO:0001583	missense	154214	exon5			BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.1231A>C	6.37:g.125379202A>C	ENSP00000428698:p.Ser411Arg	Somatic		Capture	SOLID	Phase_I	125420901	NM_152553	H7C5V4|Q5TCA4|Q9BX48	Missense_Mutation	SNP	ENST00000521654.2	37		.	.	.	.	.	.	.	.	.	.	A	21.9	4.223461	0.79464	.	.	ENSG00000146373	ENST00000521654;ENST00000359704;ENST00000275184	T;T	0.62232	0.04;0.04	5.37	5.37	0.77165	Zinc finger, C6HC-type (1);	0.092795	0.85682	D	0.000000	T	0.32615	0.0835	N	0.08118	0	0.44531	D	0.997481	P;B	0.51147	0.942;0.003	P;B	0.49999	0.628;0.01	T	0.23404	-1.0189	10	0.17369	T	0.5	.	10.8327	0.46669	0.9261:0.0:0.0739:0.0	.	119;176	Q8TC41;F2Z2M4	RN217_HUMAN;.	R	176;119;55	ENSP00000352734:S119R;ENSP00000275184:S55R	ENSP00000275184:S55R	S	+	1	0	RNF217	125420901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.133000	0.77259	2.175000	0.68902	0.472000	0.43445	AGC		0.448	RNF217-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000042063.3	NM_152553	
LAMA2	3908	hgsc.bcm.edu	37	6	129475792	129475792	+	Silent	SNP	C	C	T	rs372654432		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:129475792C>T	ENST00000421865.2	+	8	1219	c.1170C>T	c.(1168-1170)tgC>tgT	p.C390C		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	390	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.C390C(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTATAAACTGCGAGACATGTA	0.353																																					p.C390C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1170T	6						.	C	,	1,4405		0,1,2202	103.0	99.0	101.0		1170,1170	-0.4	1.0	6		101	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	LAMA2	NM_000426.3,NM_001079823.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	390/3123,390/3119	129475792	1,13005	2203	4300	6503	129517485	SO:0001819	synonymous_variant	3908	exon8			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.1170C>T	6.37:g.129475792C>T		Somatic		Capture	SOLID	Phase_I	129517485	NM_001079823	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	CCDS5138.1																																																																																				0.353	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
EPB41L2	2037	hgsc.bcm.edu	37	6	131211472	131211472	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:131211472C>T	ENST00000337057.3	-	11	1803	c.1622G>A	c.(1621-1623)cGc>cAc	p.R541H	EPB41L2_ENST00000529208.1_Missense_Mutation_p.R541H|EPB41L2_ENST00000525193.1_Missense_Mutation_p.R541H|EPB41L2_ENST00000527411.1_Missense_Mutation_p.R541H|EPB41L2_ENST00000527659.1_Missense_Mutation_p.R541H|EPB41L2_ENST00000445890.2_Missense_Mutation_p.R541H|EPB41L2_ENST00000525271.1_Missense_Mutation_p.R541H|EPB41L2_ENST00000528282.1_Missense_Mutation_p.R541H|EPB41L2_ENST00000392427.3_Missense_Mutation_p.R541H|EPB41L2_ENST00000530481.1_Missense_Mutation_p.R541H|EPB41L2_ENST00000368128.2_Missense_Mutation_p.R541H	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	541	Hydrophilic.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)	p.R541H(2)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		ACTAGAAGTGCGCTCAAAGTG	0.478																																					p.R541H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1622A	6						.						139.0	152.0	148.0					6																	131211472		2203	4300	6503	131253165	SO:0001583	missense	2037	exon11			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.1622G>A	6.37:g.131211472C>T	ENSP00000338481:p.Arg541His	Somatic		Capture	SOLID	Phase_I	131253165	NM_001135555	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	ENST00000337057.3	37	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	C	34	5.362394	0.95877	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	D;D;D;D;D;D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	5.44	5.44	0.79542	FERM adjacent (FA) (1);	0.000000	0.85682	D	0.000000	D	0.98185	0.9400	M	0.83852	2.665	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.987	D	0.98977	1.0803	10	0.87932	D	0	.	19.2709	0.94010	0.0:1.0:0.0:0.0	.	541;541;541;541;541	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	H	541	ENSP00000434308:R541H;ENSP00000434576:R541H;ENSP00000402041:R541H;ENSP00000338481:R541H;ENSP00000376222:R541H;ENSP00000357110:R541H;ENSP00000436348:R541H;ENSP00000432803:R541H;ENSP00000431988:R541H;ENSP00000431647:R541H;ENSP00000436641:R541H	ENSP00000338481:R541H	R	-	2	0	EPB41L2	131253165	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.567000	0.86603	0.555000	0.69702	CGC		0.478	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042204.3		
IL20RA	53832	hgsc.bcm.edu	37	6	137325835	137325835	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:137325835C>T	ENST00000316649.5	-	6	1022	c.787G>A	c.(787-789)Gtg>Atg	p.V263M	IL20RA_ENST00000541547.1_Missense_Mutation_p.V214M|IL20RA_ENST00000367748.1_Missense_Mutation_p.V152M|IL20RA_ENST00000468393.1_5'UTR	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	263					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)		p.V263M(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		AAAAGAAACACGGTAATAGAT	0.408																																					p.V263M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G787A	6						.						120.0	125.0	124.0					6																	137325835		2203	4300	6503	137367528	SO:0001583	missense	53832	exon6			AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.787G>A	6.37:g.137325835C>T	ENSP00000314976:p.Val263Met	Somatic		Capture	SOLID	Phase_I	137367528	NM_014432	B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Missense_Mutation	SNP	ENST00000316649.5	37	CCDS5181.1	.	.	.	.	.	.	.	.	.	.	C	8.531	0.870929	0.17322	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	T;T;T	0.65916	0.05;1.28;-0.18	5.29	3.29	0.37713	.	1.473300	0.03995	N	0.295580	T	0.34803	0.0910	L	0.59436	1.845	0.23685	N	0.997117	P;P	0.47034	0.889;0.685	B;B	0.32864	0.154;0.074	T	0.36065	-0.9763	10	0.59425	D	0.04	-6.9028	7.1618	0.25669	0.0:0.7324:0.1664:0.1012	.	152;263	Q9UHF4-2;Q9UHF4	.;I20RA_HUMAN	M	263;152;214	ENSP00000314976:V263M;ENSP00000356722:V152M;ENSP00000437843:V214M	ENSP00000314976:V263M	V	-	1	0	IL20RA	137367528	0.136000	0.22515	0.306000	0.25113	0.230000	0.25150	0.286000	0.18902	0.464000	0.27142	0.655000	0.94253	GTG		0.408	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432	
PEX3	8504	hgsc.bcm.edu	37	6	143792562	143792562	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:143792562A>C	ENST00000367591.4	+	6	562	c.499A>C	c.(499-501)Agt>Cgt	p.S167R		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	167					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)	p.S167R(1)		endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		GTATTTATCAAGTATTCAGCA	0.284																																					p.S167R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A499C	6						.						100.0	103.0	102.0					6																	143792562		2203	4298	6501	143834255	SO:0001583	missense	8504	exon6			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.499A>C	6.37:g.143792562A>C	ENSP00000356563:p.Ser167Arg	Somatic		Capture	SOLID	Phase_I	143834255	NM_003630	Q6FGP5	Missense_Mutation	SNP	ENST00000367591.4	37	CCDS5199.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.944126	0.73672	.	.	ENSG00000034693	ENST00000344281;ENST00000367592;ENST00000367591	T;T	0.46063	0.88;0.88	5.54	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.46112	0.1376	M	0.67953	2.075	0.80722	D	1	D;D	0.65815	0.995;0.994	D;P	0.65323	0.934;0.879	T	0.40869	-0.9540	10	0.26408	T	0.33	-13.7915	13.0049	0.58699	0.8651:0.1349:0.0:0.0	.	167;167	B4DV31;P56589	.;PEX3_HUMAN	R	123;123;167	ENSP00000356564:S123R;ENSP00000356563:S167R	ENSP00000344195:S123R	S	+	1	0	PEX3	143834255	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.476000	0.90421	1.008000	0.39264	0.482000	0.46254	AGT		0.284	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042525.1		
GRM1	2911	hgsc.bcm.edu	37	6	146625840	146625840	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:146625840G>A	ENST00000282753.1	+	3	1279	c.1044G>A	c.(1042-1044)agG>agA	p.R348R	GRM1_ENST00000361719.2_Silent_p.R348R|GRM1_ENST00000492807.2_Silent_p.R348R|GRM1_ENST00000507907.1_Silent_p.R348R|GRM1_ENST00000355289.4_Silent_p.R348R|GRM1_ENST00000392299.2_Silent_p.R348R			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	348					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R348R(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CAGAGGTCAGGTCATTTGATG	0.493																																					p.R348R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1044A	6						.						118.0	98.0	105.0					6																	146625840		2203	4300	6503	146667533	SO:0001819	synonymous_variant	2911	exon4			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1044G>A	6.37:g.146625840G>A		Somatic		Capture	SOLID	Phase_I	146667533	NM_001114329	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	CCDS5209.1																																																																																				0.493	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
GRM1	2911	hgsc.bcm.edu	37	6	146720698	146720698	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:146720698G>A	ENST00000282753.1	+	7	2758	c.2523G>A	c.(2521-2523)aaG>aaA	p.K841K	GRM1_ENST00000361719.2_Silent_p.K841K|GRM1_ENST00000492807.2_Silent_p.K841K|GRM1_ENST00000507907.1_Silent_p.K841K|GRM1_ENST00000355289.4_Silent_p.K841K|GRM1_ENST00000392299.2_Silent_p.K841K			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	841					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.K841K(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TTATTGCCAAGCCTGAGAGGA	0.512																																					p.K841K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2523A	6						.						118.0	96.0	103.0					6																	146720698		2203	4300	6503	146762391	SO:0001819	synonymous_variant	2911	exon8			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2523G>A	6.37:g.146720698G>A		Somatic		Capture	SOLID	Phase_I	146762391	NM_001114329	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	CCDS5209.1																																																																																				0.512	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
SASH1	23328	hgsc.bcm.edu	37	6	148861651	148861651	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:148861651G>A	ENST00000367467.3	+	17	2643	c.2168G>A	c.(2167-2169)cGa>cAa	p.R723Q		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	723					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.R723Q(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TGCTCACCCCGAGACTCAGGA	0.522																																					p.R723Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2168A	6						.						77.0	60.0	66.0					6																	148861651		2203	4300	6503	148903344	SO:0001583	missense	23328	exon17			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.2168G>A	6.37:g.148861651G>A	ENSP00000356437:p.Arg723Gln	Somatic		Capture	SOLID	Phase_I	148903344	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	37	6.141281	0.97320	.	.	ENSG00000111961	ENST00000367467;ENST00000535767;ENST00000537769	T	0.77620	-1.11	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.86468	0.5940	M	0.68952	2.095	0.50813	D	0.999896	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	D	0.86127	0.1572	10	0.87932	D	0	-10.073	20.6439	0.99570	0.0:0.0:1.0:0.0	.	704;723	Q6P4R9;O94885	.;SASH1_HUMAN	Q	723;484;133	ENSP00000356437:R723Q	ENSP00000356437:R723Q	R	+	2	0	SASH1	148903344	1.000000	0.71417	0.868000	0.34077	0.996000	0.88848	9.835000	0.99442	2.884000	0.98904	0.655000	0.94253	CGA		0.522	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
MTHFD1L	25902	hgsc.bcm.edu	37	6	151226825	151226825	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:151226825C>T	ENST00000367321.3	+	8	1094	c.820C>T	c.(820-822)Cca>Tca	p.P274S		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	274	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)	p.P274S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		CTCACCTAAGCCAGAAGAGAT	0.448																																					p.P274S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C820T	6						.						172.0	150.0	157.0					6																	151226825		2203	4300	6503	151268518	SO:0001583	missense	25902	exon8			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.820C>T	6.37:g.151226825C>T	ENSP00000356290:p.Pro274Ser	Somatic		Capture	SOLID	Phase_I	151268518	NM_015440	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	37	CCDS5228.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.00|16.00	2.998356|2.998356	0.54147|0.54147	.|.	.|.	ENSG00000120254|ENSG00000120254	ENST00000421497|ENST00000367321;ENST00000392243	.|T	.|0.60672	.|0.17	5.63|5.63	5.63|5.63	0.86233|0.86233	.|Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	.|0.297157	.|0.39341	.|N	.|0.001396	T|T	0.54382|0.54382	0.1855|0.1855	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	.|P;B;P	.|0.50528	.|0.936;0.314;0.936	.|P;B;P	.|0.45071	.|0.468;0.378;0.468	T|T	0.59048|0.59048	-0.7527|-0.7527	5|9	.|.	.|.	.|.	.|.	17.161|17.161	0.86803|0.86803	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|275;29;274	.|B7ZM99;B2RD24;Q6UB35	.|.;.;C1TM_HUMAN	V|S	7|274;27	.|ENSP00000356290:P274S	.|.	A|P	+|+	2|1	0|0	MTHFD1L|MTHFD1L	151268518|151268518	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.073000|0.073000	0.16967|0.16967	4.436000|4.436000	0.59948|0.59948	2.659000|2.659000	0.90383|0.90383	0.655000|0.655000	0.94253|0.94253	GCC|CCA		0.448	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440	
ESR1	2099	hgsc.bcm.edu	37	6	152265479	152265479	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:152265479C>T	ENST00000206249.3	+	4	1294	c.932C>T	c.(931-933)aCg>aTg	p.T311M	ESR1_ENST00000440973.1_Missense_Mutation_p.T311M|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000482101.1_3'UTR|ESR1_ENST00000456483.2_Intron|ESR1_ENST00000443427.1_Missense_Mutation_p.T311M|ESR1_ENST00000338799.5_Missense_Mutation_p.T311M|ESR1_ENST00000427531.2_Missense_Mutation_p.T138M	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	311	Interaction with AKAP13.|Self-association.|Steroid-binding.|Transactivation AF-2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.T311M(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	TTGTCCCTGACGGCCGACCAG	0.557																																					p.T311M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C932T	6						.						117.0	112.0	114.0					6																	152265479		2203	4300	6503	152307172	SO:0001583	missense	2099	exon5			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.932C>T	6.37:g.152265479C>T	ENSP00000206249:p.Thr311Met	Somatic		Capture	SOLID	Phase_I	152307172	NM_001122740	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	ENST00000206249.3	37	CCDS5234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.098235|4.098235	0.76870|0.76870	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000427531|ENST00000440973;ENST00000338799;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394	.|D;D;D;D;T	.|0.92965	.|-3.14;-3.14;-3.14;-3.14;1.28	5.66|5.66	5.66|5.66	0.87406|0.87406	.|Nuclear hormone receptor, ligand-binding (2);	.|0.154926	.|0.64402	.|D	.|0.000017	D|D	0.95996|0.95996	0.8696|0.8696	M|M	0.81942|0.81942	2.565|2.565	0.53688|0.53688	D|D	0.99997|0.99997	.|D;P;D;D;D;D	.|0.89917	.|1.0;0.539;1.0;0.983;0.999;0.999	.|P;B;D;P;P;P	.|0.74348	.|0.889;0.02;0.983;0.578;0.907;0.81	D|D	0.95850|0.95850	0.8874|0.8874	5|10	.|0.72032	.|D	.|0.01	.|.	19.7375|19.7375	0.96212|0.96212	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|215;92;53;310;311;311	.|B0QYW6;E7EVR3;Q9Y2W8;A8KAF4;G4XH65;P03372	.|.;.;.;.;.;ESR1_HUMAN	W|M	216|311;311;92;311;311;239;138	.|ENSP00000405330:T311M;ENSP00000342630:T311M;ENSP00000387500:T311M;ENSP00000206249:T311M;ENSP00000445454:T138M	.|ENSP00000206249:T311M	R|T	+|+	1|2	2|0	ESR1|ESR1	152307172|152307172	0.988000|0.988000	0.35896|0.35896	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	2.374000|2.374000	0.44274|0.44274	2.680000|2.680000	0.91292|0.91292	0.655000|0.655000	0.94253|0.94253	CGG|ACG		0.557	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152552533	152552533	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:152552533G>C	ENST00000367255.5	-	114	21633	c.21032C>G	c.(21031-21033)aCt>aGt	p.T7011S	SYNE1_ENST00000448038.1_Missense_Mutation_p.T6940S|SYNE1_ENST00000341594.5_Missense_Mutation_p.T6623S|SYNE1_ENST00000356820.4_Missense_Mutation_p.T1535S|SYNE1_ENST00000265368.4_Missense_Mutation_p.T7011S|SYNE1_ENST00000423061.1_Missense_Mutation_p.T6940S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7011					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.T7011S(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TACCTTCTCAGTTACTAGACC	0.453										HNSCC(10;0.0054)																											p.T1535S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4604G	6						.						168.0	151.0	157.0					6																	152552533		2203	4300	6503	152594226	SO:0001583	missense	23345	exon29			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21032C>G	6.37:g.152552533G>C	ENSP00000356224:p.Thr7011Ser	Somatic		Capture	SOLID	Phase_I	152594226	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698025	0.30142	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39	5.99	0.776	0.18532	.	0.488946	0.20268	N	0.095723	T	0.15869	0.0382	M	0.63428	1.95	0.09310	N	1	B;B;B	0.12013	0.001;0.001;0.005	B;B;B	0.19148	0.011;0.011;0.024	T	0.53655	-0.8408	10	0.07175	T	0.84	.	20.2073	0.98281	0.0:0.5884:0.4116:0.0	.	7011;7011;6940	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	S	7011;6940;7011;6940;6623;1535	ENSP00000356224:T7011S;ENSP00000396024:T6940S;ENSP00000265368:T7011S;ENSP00000390975:T6940S;ENSP00000341887:T6623S;ENSP00000349276:T1535S	ENSP00000265368:T7011S	T	-	2	0	SYNE1	152594226	0.273000	0.24181	0.000000	0.03702	0.978000	0.69477	1.626000	0.37039	-0.143000	0.11334	-0.182000	0.12963	ACT		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
IGF2R	3482	hgsc.bcm.edu	37	6	160497000	160497000	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Visver			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:160497000C>T	ENST00000356956.1	+	36	5436	c.5288C>T	c.(5287-5289)gCg>gTg	p.A1763V		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1763					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.A1763V(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TCGCTCATCGCGTTTCACTGT	0.458																																					p.A1763V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5288T	6						.						180.0	164.0	169.0					6																	160497000		2203	4300	6503	160416990	SO:0001583	missense	3482	exon36			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5288C>T	6.37:g.160497000C>T	ENSP00000349437:p.Ala1763Val	Somatic		Capture	SOLID	Phase_I	160416990	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	C	3.837	-0.034622	0.07543	.	.	ENSG00000197081	ENST00000356956	T	0.10960	2.82	5.31	4.2	0.49525	Mannose-6-phosphate receptor, binding (1);	1.138800	0.06318	N	0.703930	T	0.01523	0.0049	N	0.10837	0.055	0.19575	N	0.999963	B	0.19200	0.034	B	0.13407	0.009	T	0.47169	-0.9138	10	0.11485	T	0.65	-7.6509	3.8681	0.09025	0.0:0.6638:0.0:0.3362	.	1763	P11717	MPRI_HUMAN	V	1763	ENSP00000349437:A1763V	ENSP00000349437:A1763V	A	+	2	0	IGF2R	160416990	0.339000	0.24784	0.000000	0.03702	0.410000	0.31052	4.255000	0.58804	2.637000	0.89404	0.655000	0.94253	GCG		0.458	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
TTLL2	83887	hgsc.bcm.edu	37	6	167753659	167753659	+	Missense_Mutation	SNP	G	G	A	rs140657695	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:167753659G>A	ENST00000239587.5	+	3	359	c.271G>A	c.(271-273)Gtt>Att	p.V91I		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	91	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)	p.V91I(2)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GGTTTTTCGCGTTGACGAGAC	0.512													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19944	0.0		0.0	False		,,,				2504	0.0				p.V91I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G271A	6						.	G	ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	53.0	54.0	53.0		271	1.5	0.0	6	dbSNP_134	53	0,8600		0,0,4300	yes	missense	TTLL2	NM_031949.4	29	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	91/593	167753659	3,13003	2203	4300	6503	167673649	SO:0001583	missense	83887	exon3			AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.271G>A	6.37:g.167753659G>A	ENSP00000239587:p.Val91Ile	Somatic		Capture	SOLID	Phase_I	167673649	NM_031949	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	37	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	G	4.623	0.115827	0.08831	6.81E-4	0.0	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02472	4.28	3.37	1.46	0.22682	.	0.760646	0.11193	N	0.589623	T	0.00608	0.0020	L	0.41415	1.275	0.09310	N	1	P	0.40107	0.703	B	0.23716	0.048	T	0.48927	-0.8991	10	0.33940	T	0.23	.	2.4826	0.04591	0.1111:0.3068:0.4117:0.1704	.	91	Q9BWV7	TTLL2_HUMAN	I	91;18	ENSP00000239587:V91I	ENSP00000239587:V91I	V	+	1	0	TTLL2	167673649	0.046000	0.20272	0.000000	0.03702	0.006000	0.05464	1.637000	0.37155	0.218000	0.20820	0.484000	0.47621	GTT		0.512	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
F13A1	2162	hgsc.bcm.edu	37	6	6174834	6174834	+	Missense_Mutation	SNP	C	C	T	rs61734486	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:6174834C>T	ENST00000264870.3	-	12	1991	c.1726G>A	c.(1726-1728)Gtg>Atg	p.V576M		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	576					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.V576M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TCCAGCGTCACGTCGAACGTC	0.522																																					p.V576M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1726A	6						.	C	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	256.0	226.0	236.0		1726	2.0	0.0	6	dbSNP_129	236	1,8599	1.2+/-3.3	0,1,4299	no	missense	F13A1	NM_000129.3	21	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	possibly-damaging	576/733	6174834	3,13003	2203	4300	6503	6119833	SO:0001583	missense	2162	exon12			M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1726G>A	6.37:g.6174834C>T	ENSP00000264870:p.Val576Met	Somatic		Capture	SOLID	Phase_I	6119833	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	C	8.097	0.775829	0.16051	4.54E-4	1.16E-4	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.76968	-1.06	5.78	2.02	0.26589	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.203374	0.42420	D	0.000712	T	0.67515	0.2901	M	0.82323	2.585	0.09310	N	1	P;D	0.60160	0.906;0.987	B;P	0.47162	0.306;0.54	T	0.63409	-0.6644	10	0.52906	T	0.07	.	6.7435	0.23449	0.254:0.6122:0.0:0.1338	.	513;576	F5H080;P00488	.;F13A_HUMAN	M	576;513	ENSP00000264870:V576M	ENSP00000264870:V576M	V	-	1	0	F13A1	6119833	0.031000	0.19500	0.000000	0.03702	0.016000	0.09150	1.396000	0.34531	0.081000	0.16988	-0.857000	0.03018	GTG		0.522	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
BTN2A2	10385	hgsc.bcm.edu	37	6	26388463	26388463	+	Missense_Mutation	SNP	C	C	T	rs145439434		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:26388463C>T	ENST00000356709.4	+	4	776	c.665C>T	c.(664-666)tCc>tTc	p.S222F	BTN2A2_ENST00000432533.2_Intron|BTN2A2_ENST00000352867.2_Missense_Mutation_p.S106F|BTN2A2_ENST00000416795.2_Missense_Mutation_p.S222F|BTN2A2_ENST00000469230.1_Missense_Mutation_p.S222F|BTN2A2_ENST00000482536.1_Intron	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	222	Ig-like C2-type.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S222F(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						AGGAATGTGTCCTGCTCTGTC	0.512																																					p.S222F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C665T	6						.	C	PHE/SER,PHE/SER,,,PHE/SER,PHE/SER	0,4406		0,0,2203	195.0	168.0	177.0		665,665,,,665,317	1.8	0.5	6	dbSNP_134	177	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron,intron,missense,missense	BTN2A2	NM_001197237.1,NM_001197238.1,NM_001197239.1,NM_001197240.1,NM_006995.4,NM_181531.2	155,155,,,155,155	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,,,benign,benign	222/524,222/337,,,222/524,106/408	26388463	1,13005	2203	4300	6503	26496442	SO:0001583	missense	10385	exon4			U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.665C>T	6.37:g.26388463C>T	ENSP00000349143:p.Ser222Phe	Somatic		Capture	SOLID	Phase_I	26496442	NM_006995	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	ENST00000356709.4	37	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	c	8.633	0.894172	0.17613	0.0	1.16E-4	ENSG00000124508	ENST00000469230;ENST00000490025;ENST00000356709;ENST00000352867;ENST00000493275;ENST00000472507;ENST00000482842;ENST00000416795;ENST00000483410	T;T;T;T;T;T;T;T;T	0.76968	-1.06;0.33;-1.06;-1.06;-1.06;-1.06;1.97;-1.06;-1.06	4.11	1.83	0.25207	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	0.499423	0.18740	N	0.132473	T	0.61274	0.2334	M	0.67517	2.055	0.26666	N	0.97183	B;B;B;B	0.17667	0.023;0.007;0.019;0.01	B;B;B;B	0.28991	0.058;0.02;0.046;0.097	T	0.62483	-0.6845	10	0.66056	D	0.02	.	8.9479	0.35769	0.0:0.7688:0.0:0.2312	.	106;222;106;222	B4E3J1;Q8WVV5-2;A6NM84;Q8WVV5	.;.;.;BT2A2_HUMAN	F	222;17;222;106;222;106;17;222;106	ENSP00000417472:S222F;ENSP00000418965:S17F;ENSP00000349143:S222F;ENSP00000337117:S106F;ENSP00000418857:S222F;ENSP00000419226:S106F;ENSP00000417676:S17F;ENSP00000399308:S222F;ENSP00000418176:S106F	ENSP00000337117:S106F	S	+	2	0	BTN2A2	26496442	0.771000	0.28555	0.500000	0.27589	0.463000	0.32649	0.926000	0.28804	0.724000	0.32296	0.454000	0.30748	TCC		0.512	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1		
TRIM31	11074	hgsc.bcm.edu	37	6	30079476	30079478	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	CTT	CTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:30079476_30079478delCTT	ENST00000376734.3	-	3	585_587	c.460_462delAAG	c.(460-462)aagdel	p.K154del	TRIM31_ENST00000540829.1_In_Frame_Del_p.K154del|TRIM31_ENST00000485864.1_5'UTR|TRIM31-AS1_ENST00000440874.1_RNA	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	154					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.K154delK(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						GTACTGTCTCCTTCTCCTTTTGC	0.502																																					p.154_154del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.460_462del	6						.																																			30187457	SO:0001651	inframe_deletion	11074	exon3			AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.460_462delAAG	6.37:g.30079476_30079478delCTT	ENSP00000365924:p.Lys154del	Somatic		Capture	SOLID	Phase_I	30187455	NM_007028	A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	In_Frame_Del	DEL	ENST00000376734.3	37	CCDS34374.1																																																																																				0.502	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076081.2		
DHX16	8449	hgsc.bcm.edu	37	6	30623050	30623050	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:30623050G>A	ENST00000376442.3	-	18	2920	c.2725C>T	c.(2725-2727)Cgc>Tgc	p.R909C	DHX16_ENST00000376437.5_Missense_Mutation_p.R428C	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	909					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.R909C(1)		kidney(2)|ovary(2)	4						CGGGCTCGGCGCATCGATCTG	0.512																																					p.R909C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2725T	6						.						86.0	83.0	84.0					6																	30623050		2203	4300	6503	30731029	SO:0001583	missense	8449	exon18			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.2725C>T	6.37:g.30623050G>A	ENSP00000365625:p.Arg909Cys	Somatic		Capture	SOLID	Phase_I	30731029	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157743	0.78114	.	.	ENSG00000204560	ENST00000376442;ENST00000376437	T;T	0.04654	4.03;3.58	5.7	5.7	0.88788	.	0.049175	0.85682	D	0.000000	T	0.12008	0.0292	M	0.81239	2.535	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	P;P;P	0.57371	0.819;0.811;0.754	T	0.00157	-1.1977	10	0.87932	D	0	.	14.1515	0.65387	0.0:0.0:0.8494:0.1506	.	849;909;428	B4DZ28;O60231;Q5SQH5	.;DHX16_HUMAN;.	C	909;428	ENSP00000365625:R909C;ENSP00000365620:R428C	ENSP00000365620:R428C	R	-	1	0	DHX16	30731029	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.997000	0.57016	2.696000	0.92011	0.561000	0.74099	CGC		0.512	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
NOTCH4	4855	hgsc.bcm.edu	37	6	32182003	32182003	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:32182003G>A	ENST00000375023.3	-	13	2189	c.2051C>T	c.(2050-2052)aCg>aTg	p.T684M	NOTCH4_ENST00000465528.1_5'UTR	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	684	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.T684M(2)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTCTGGCCCCGTCCAACCCAC	0.592																																					p.G684V												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G2051T	6						.						110.0	111.0	111.0					6																	32182003		2203	4300	6503	32289981	SO:0001583	missense	4855	exon13				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2051C>T	6.37:g.32182003G>A	ENSP00000364163:p.Thr684Met	Somatic		Capture	SOLID	Phase_I	32289981	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.248222	0.39697	.	.	ENSG00000204301	ENST00000375023	T	0.70631	-0.5	4.18	4.18	0.49190	EGF-like region, conserved site (2);	0.000000	0.43919	D	0.000517	T	0.77391	0.4123	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80125	-0.1513	10	0.66056	D	0.02	.	14.0247	0.64580	0.0:0.0:1.0:0.0	.	684	Q99466	NOTC4_HUMAN	M	684	ENSP00000364163:T684M	ENSP00000364163:T684M	T	-	2	0	NOTCH4	32289981	0.928000	0.31464	0.998000	0.56505	0.375000	0.29983	1.636000	0.37144	2.169000	0.68431	0.561000	0.74099	ACG		0.592	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
IP6K3	117283	hgsc.bcm.edu	37	6	33690520	33690520	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:33690520G>A	ENST00000293756.4	-	6	1536	c.1210C>T	c.(1210-1212)Cag>Tag	p.Q404*	IP6K3_ENST00000451316.1_Nonsense_Mutation_p.Q404*	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	404					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.Q404*(1)		skin(1)	1						TGGATATCCTGCAGGATCCTG	0.478																																					p.Q404X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1210T	6						.						104.0	112.0	109.0					6																	33690520		2203	4300	6503	33798498	SO:0001587	stop_gained	117283	exon6			AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.1210C>T	6.37:g.33690520G>A	ENSP00000293756:p.Gln404*	Somatic		Capture	SOLID	Phase_I	33798498	NM_054111	Q96MQ9	Nonsense_Mutation	SNP	ENST00000293756.4	37	CCDS34435.1	.	.	.	.	.	.	.	.	.	.	G	38	7.152405	0.98099	.	.	ENSG00000161896	ENST00000451316;ENST00000293756	.	.	.	5.99	4.1	0.47936	.	0.652860	0.15077	N	0.281895	.	.	.	.	.	.	0.46874	D	0.999236	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-12.3297	11.1066	0.48207	0.0:0.2603:0.605:0.1347	.	.	.	.	X	404	.	ENSP00000293756:Q404X	Q	-	1	0	IP6K3	33798498	0.138000	0.22547	1.000000	0.80357	0.598000	0.36846	1.063000	0.30567	1.522000	0.49001	-0.175000	0.13238	CAG		0.478	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
DEF6	50619	hgsc.bcm.edu	37	6	35289014	35289014	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:35289014C>T	ENST00000316637.5	+	11	1728	c.1723C>T	c.(1723-1725)Ctt>Ttt	p.L575F	DEF6_ENST00000542066.1_Missense_Mutation_p.L320F	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	575						cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L575F(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						GCCCCCTCTGCTTGCCCACCG	0.602																																					p.L575F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1723T	6						.						151.0	157.0	155.0					6																	35289014		2203	4300	6503	35396992	SO:0001583	missense	50619	exon11			AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.1723C>T	6.37:g.35289014C>T	ENSP00000319831:p.Leu575Phe	Somatic		Capture	SOLID	Phase_I	35396992	NM_022047	Q86VF4	Missense_Mutation	SNP	ENST00000316637.5	37	CCDS4802.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763309	0.49574	.	.	ENSG00000023892	ENST00000542066;ENST00000316637	T;T	0.37235	1.21;2.85	5.42	5.42	0.78866	.	0.199276	0.34046	N	0.004320	T	0.39835	0.1093	L	0.43152	1.355	0.41562	D	0.988635	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.83275	0.996;0.986;0.986	T	0.26883	-1.0090	10	0.49607	T	0.09	-10.6518	10.3112	0.43710	0.0:0.91:0.0:0.09	.	320;575;575	F5H853;B2RBP7;Q9H4E7	.;.;DEFI6_HUMAN	F	320;575	ENSP00000442166:L320F;ENSP00000319831:L575F	ENSP00000319831:L575F	L	+	1	0	DEF6	35396992	0.989000	0.36119	0.965000	0.40720	0.975000	0.68041	4.759000	0.62227	2.539000	0.85634	0.561000	0.74099	CTT		0.602	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040276.1	NM_022047	
BRPF3	27154	hgsc.bcm.edu	37	6	36168930	36168930	+	Silent	SNP	C	C	T	rs374253115		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:36168930C>T	ENST00000357641.6	+	2	1084	c.831C>T	c.(829-831)ggC>ggT	p.G277G	BRPF3_ENST00000443324.2_Silent_p.G277G|BRPF3_ENST00000543502.1_Silent_p.G277G|BRPF3_ENST00000534400.1_Silent_p.G277G|BRPF3_ENST00000534694.1_Silent_p.G277G|BRPF3_ENST00000339717.7_Silent_p.G277G	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	277					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.G277G(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						ATAAGGGTGGCGCCTTCAAAC	0.577																																					p.G277G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C831T	6						.	C		0,4406		0,0,2203	66.0	61.0	63.0		831	-4.1	1.0	6		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BRPF3	NM_015695.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		277/1206	36168930	1,13005	2203	4300	6503	36276908	SO:0001819	synonymous_variant	27154	exon2			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.831C>T	6.37:g.36168930C>T		Somatic		Capture	SOLID	Phase_I	36276908	NM_015695	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Silent	SNP	ENST00000357641.6	37	CCDS34437.1																																																																																				0.577	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695	
ZNF318	24149	hgsc.bcm.edu	37	6	43322666	43322666	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:43322666C>T	ENST00000361428.2	-	4	2483	c.2406G>A	c.(2404-2406)tgG>tgA	p.W802*	ZNF318_ENST00000318149.3_Nonsense_Mutation_p.W802*	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	802					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.W802*(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GATACATGGGCCATCTGGAGG	0.527																																					p.W802X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2406A	6						.						270.0	232.0	245.0					6																	43322666		2203	4300	6503	43430644	SO:0001587	stop_gained	24149	exon4			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2406G>A	6.37:g.43322666C>T	ENSP00000354964:p.Trp802*	Somatic		Capture	SOLID	Phase_I	43430644	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Nonsense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	39	7.500237	0.98322	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4813	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	802	.	ENSP00000323032:W802X	W	-	3	0	ZNF318	43430644	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.223000	0.72257	2.885000	0.99019	0.655000	0.94253	TGG		0.527	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
CRISP1	167	hgsc.bcm.edu	37	6	49803068	49803068	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:49803068G>T	ENST00000335847.4	-	8	812	c.711C>A	c.(709-711)ttC>ttA	p.F237L	CRISP1_ENST00000507853.1_3'UTR|CRISP1_ENST00000505118.1_Missense_Mutation_p.F237L|CRISP1_ENST00000355791.2_Missense_Mutation_p.F237L|CRISP1_ENST00000536021.1_3'UTR|CRISP1_ENST00000329411.5_3'UTR	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	237	ShKT. {ECO:0000255|PROSITE- ProRule:PRU01005}.				binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)	p.F237L(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					TGGCTTTACAGAATAGGATAG	0.398																																					p.F237L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C711A	6						.						196.0	184.0	188.0					6																	49803068		2203	4300	6503	49911027	SO:0001583	missense	167	exon8			D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.711C>A	6.37:g.49803068G>T	ENSP00000338276:p.Phe237Leu	Somatic		Capture	SOLID	Phase_I	49911027	NM_001131	B5BU98|O00698|Q13248|Q14082|Q96SF6	Missense_Mutation	SNP	ENST00000335847.4	37	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	G	7.803	0.714110	0.15306	.	.	ENSG00000124812	ENST00000335847;ENST00000355791;ENST00000505118	T;T;T	0.07327	3.2;3.2;3.2	4.9	-0.462	0.12168	Cysteine-rich secretory protein (1);	1.168410	0.05932	N	0.635451	T	0.01765	0.0056	L	0.33710	1.025	0.20563	N	0.99989	B	0.13145	0.007	B	0.12837	0.008	T	0.47898	-0.9081	9	.	.	.	.	4.8378	0.13473	0.0856:0.4066:0.3694:0.1383	.	237	P54107	CRIS1_HUMAN	L	237	ENSP00000338276:F237L;ENSP00000348044:F237L;ENSP00000427589:F237L	.	F	-	3	2	CRISP1	49911027	0.041000	0.20044	0.002000	0.10522	0.293000	0.27360	-0.144000	0.10280	-0.069000	0.12931	0.655000	0.94253	TTC		0.398	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	
HCRTR2	3062	hgsc.bcm.edu	37	6	55147183	55147183	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:55147183G>A	ENST00000370862.3	+	7	1602	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	422					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)	p.E422E(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AACTTTCTGAGCAAGTTGTGC	0.468																																					p.E422E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1266A	6						.						70.0	59.0	63.0					6																	55147183		2203	4300	6503	55255142	SO:0001819	synonymous_variant	3062	exon7			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.1266G>A	6.37:g.55147183G>A		Somatic		Capture	SOLID	Phase_I	55255142	NM_001526	Q5VTM0	Silent	SNP	ENST00000370862.3	37	CCDS4956.1																																																																																				0.468	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
PHF3	23469	hgsc.bcm.edu	37	6	64423127	64423127	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:64423127G>A	ENST00000262043.3	+	16	5983	c.5643G>A	c.(5641-5643)ccG>ccA	p.P1881P	PHF3_ENST00000393387.1_Silent_p.P1881P			Q92576	PHF3_HUMAN	PHD finger protein 3	1881					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.P1881P(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			ATATAGGCCCGCAGAATTTTT	0.502																																					p.P1881P	GBM(135;136 1820 29512 34071 46235)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5643A	6						.						67.0	76.0	73.0					6																	64423127		2203	4300	6503	64481086	SO:0001819	synonymous_variant	23469	exon15			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.5643G>A	6.37:g.64423127G>A		Somatic		Capture	SOLID	Phase_I	64481086	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Silent	SNP	ENST00000262043.3	37	CCDS4966.1																																																																																				0.502	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
COL9A1	1297	hgsc.bcm.edu	37	6	70993483	70993483	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:70993483C>T	ENST00000357250.6	-	6	895	c.737G>A	c.(736-738)cGg>cAg	p.R246Q	COL9A1_ENST00000320755.7_5'Flank|COL9A1_ENST00000370496.3_Missense_Mutation_p.R246Q|COL9A1_ENST00000370499.4_5'Flank	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	246	Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.R246Q(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TCTCCTGGGCCGCAGGGGGTC	0.517																																					p.R246Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G737A	6						.						104.0	84.0	91.0					6																	70993483		2203	4300	6503	71050204	SO:0001583	missense	1297	exon6				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.737G>A	6.37:g.70993483C>T	ENSP00000349790:p.Arg246Gln	Somatic		Capture	SOLID	Phase_I	71050204	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.905826	0.92107	.	.	ENSG00000112280	ENST00000357250;ENST00000370496	T;T	0.02067	4.47;4.47	5.56	5.56	0.83823	Concanavalin A-like lectin/glucanase (1);	0.000000	0.64402	D	0.000003	T	0.06645	0.0170	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.50988	-0.8762	10	0.23302	T	0.38	.	18.5065	0.90900	0.0:1.0:0.0:0.0	.	246	P20849	CO9A1_HUMAN	Q	246	ENSP00000349790:R246Q;ENSP00000359527:R246Q	ENSP00000349790:R246Q	R	-	2	0	COL9A1	71050204	1.000000	0.71417	0.806000	0.32338	0.858000	0.48976	5.735000	0.68587	2.633000	0.89246	0.655000	0.94253	CGG		0.517	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
PHIP	55023	hgsc.bcm.edu	37	6	79707219	79707219	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:79707219C>T	ENST00000275034.4	-	19	2280	c.2113G>A	c.(2113-2115)Gca>Aca	p.A705T		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	705					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.A705T(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CTTCTTGGTGCGTTGCTGTGC	0.498																																					p.A705T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G2113A	6						.						247.0	212.0	224.0					6																	79707219		2203	4300	6503	79763938	SO:0001583	missense	55023	exon19			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2113G>A	6.37:g.79707219C>T	ENSP00000275034:p.Ala705Thr	Somatic		Capture	SOLID	Phase_I	79763938	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780506	0.90195	.	.	ENSG00000146247	ENST00000275034	T	0.29917	1.55	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000003	T	0.45637	0.1352	M	0.68593	2.085	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75020	0.985;0.985	T	0.38887	-0.9640	9	.	.	.	-14.6205	17.1852	0.86865	0.0:1.0:0.0:0.0	.	705;705	A7J992;Q8WWQ0	.;PHIP_HUMAN	T	705	ENSP00000275034:A705T	.	A	-	1	0	PHIP	79763938	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	7.487000	0.81328	2.264000	0.75181	0.655000	0.94253	GCA		0.498	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
SH3BGRL2	83699	hgsc.bcm.edu	37	6	80383446	80383446	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:80383446C>A	ENST00000369838.4	+	2	340	c.161C>A	c.(160-162)cCc>cAc	p.P54H		NM_031469.2	NP_113657.1	Q9UJC5	SH3L2_HUMAN	SH3 domain binding glutamate-rich protein like 2	54						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.P54H(1)		large_intestine(2)|lung(3)	5		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)		BRCA - Breast invasive adenocarcinoma(397;0.0278)		AAAAACGTCCCCCCGGAAAAG	0.463																																					p.P54H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C161A	6						.						132.0	137.0	135.0					6																	80383446		2203	4300	6503	80440165	SO:0001583	missense	83699	exon2			AJ297972	CCDS4991.1	6q14.1	2014-02-19	2014-02-19		ENSG00000198478	ENSG00000198478			15567	protein-coding gene	gene with protein product		615678	"""SH3 domain binding glutamic acid-rich protein like 2"""			12095696	Standard	NM_031469		Approved		uc003piz.1	Q9UJC5	OTTHUMG00000015081	ENST00000369838.4:c.161C>A	6.37:g.80383446C>A	ENSP00000358853:p.Pro54His	Somatic		Capture	SOLID	Phase_I	80440165	NM_031469	A8MQU2|Q2VPC2|Q5VV96|Q6NSK8|Q6P9E8|Q7Z734|Q8IWD3|Q9BPY5	Missense_Mutation	SNP	ENST00000369838.4	37	CCDS4991.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333172	0.60853	.	.	ENSG00000198478	ENST00000369838	T	0.77358	-1.09	5.75	5.75	0.90469	Thioredoxin-like fold (2);	0.148140	0.64402	D	0.000007	D	0.88262	0.6389	M	0.86420	2.815	0.58432	D	0.999998	D	0.76494	0.999	D	0.70716	0.97	D	0.88057	0.2791	10	0.49607	T	0.09	-2.4494	18.9446	0.92616	0.0:1.0:0.0:0.0	.	54	Q9UJC5	SH3L2_HUMAN	H	54	ENSP00000358853:P54H	ENSP00000358853:P54H	P	+	2	0	SH3BGRL2	80440165	1.000000	0.71417	0.383000	0.26132	0.007000	0.05969	7.487000	0.81328	2.708000	0.92522	0.650000	0.86243	CCC		0.463	SH3BGRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041309.1		
MMS22L	253714	hgsc.bcm.edu	37	6	97610000	97610000	+	Missense_Mutation	SNP	C	C	T	rs149054595	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:97610000C>T	ENST00000275053.4	-	22	3528	c.3263G>A	c.(3262-3264)cGc>cAc	p.R1088H	MMS22L_ENST00000369251.2_Missense_Mutation_p.R1048H	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1088					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.R1088H(2)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						GGATGCTAAGCGAGGAGGAGG	0.408													C|||	7	0.00139776	0.0045	0.0014	5008	,	,		17403	0.0		0.0	False		,,,				2504	0.0				p.R1088H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G3263A	6						.	C	HIS/ARG	5,4401	9.9+/-24.2	0,5,2198	120.0	115.0	117.0		3263	4.8	1.0	6	dbSNP_134	117	1,8599	1.2+/-3.3	0,1,4299	yes	missense	MMS22L	NM_198468.2	29	0,6,6497	TT,TC,CC		0.0116,0.1135,0.0461	probably-damaging	1088/1244	97610000	6,13000	2203	4300	6503	97716721	SO:0001583	missense	253714	exon22				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3263G>A	6.37:g.97610000C>T	ENSP00000275053:p.Arg1088His	Somatic		Capture	SOLID	Phase_I	97716721	NM_198468	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	23.4	4.408624	0.83340	0.001135	1.16E-4	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.28666	1.6;1.6	5.68	4.81	0.61882	.	0.052393	0.85682	D	0.000000	T	0.40222	0.1108	M	0.69823	2.125	0.49213	D	0.999764	D;D	0.76494	0.999;0.997	D;P	0.65443	0.935;0.847	T	0.37033	-0.9723	10	0.49607	T	0.09	-19.3496	11.5924	0.50953	0.0:0.8568:0.0:0.1432	.	1048;1088	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	H	1088;1048	ENSP00000275053:R1088H;ENSP00000358254:R1048H	ENSP00000275053:R1088H	R	-	2	0	MMS22L	97716721	1.000000	0.71417	0.971000	0.41717	0.952000	0.60782	2.641000	0.46587	1.395000	0.46643	0.650000	0.86243	CGC		0.408	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
MMS22L	253714	hgsc.bcm.edu	37	6	97620986	97620986	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:97620986C>T	ENST00000275053.4	-	19	3057	c.2792G>A	c.(2791-2793)gGa>gAa	p.G931E	MMS22L_ENST00000369251.2_Missense_Mutation_p.G891E	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	931					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.G931E(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						AACTTTTTTTCCCAAATAAGG	0.388																																					p.G931E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2792A	6						.						64.0	64.0	64.0					6																	97620986		2203	4300	6503	97727707	SO:0001583	missense	253714	exon19				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2792G>A	6.37:g.97620986C>T	ENSP00000275053:p.Gly931Glu	Somatic		Capture	SOLID	Phase_I	97727707	NM_198468	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	C	8.211	0.800324	0.16397	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.21031	2.36;2.03	5.43	4.51	0.55191	.	0.576965	0.18987	N	0.125701	T	0.10937	0.0267	L	0.54323	1.7	0.25581	N	0.986794	P;P	0.52316	0.952;0.902	P;B	0.46543	0.52;0.359	T	0.13361	-1.0512	10	0.32370	T	0.25	-18.8593	5.6111	0.17406	0.1452:0.6392:0.1404:0.0752	.	891;931	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	E	931;891	ENSP00000275053:G931E;ENSP00000358254:G891E	ENSP00000275053:G931E	G	-	2	0	MMS22L	97727707	0.889000	0.30405	0.999000	0.59377	0.874000	0.50279	1.478000	0.35442	2.693000	0.91896	0.655000	0.94253	GGA		0.388	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
KIF25	3834	hgsc.bcm.edu	37	6	168443257	168443257	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr6:168443257C>T	ENST00000443060.2	+	9	1237	c.846C>T	c.(844-846)acC>acT	p.T282T	KIF25_ENST00000351261.3_Intron|KIF25_ENST00000354419.2_Silent_p.T282T			Q9UIL4	KIF25_HUMAN	kinesin family member 25	282	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T282T(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CTGGAGTGACCGGGTTGGCCC	0.652																																					p.T282T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C846T	6						.						127.0	119.0	121.0					6																	168443257		2203	4300	6503	168186106	SO:0001819	synonymous_variant	3834	exon8			AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.846C>T	6.37:g.168443257C>T		Somatic		Capture	SOLID	Phase_I	168186106	NM_030615	O94775|Q5SZU9	Silent	SNP	ENST00000443060.2	37	CCDS5305.1																																																																																				0.652	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
MYOCD	93649	hgsc.bcm.edu	37	17	12647709	12647709	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:12647709G>A	ENST00000343344.4	+	8	927	c.927G>A	c.(925-927)caG>caA	p.Q309Q	AC005358.1_ENST00000609971.1_Silent_p.Q213Q|MYOCD_ENST00000425538.1_Silent_p.Q309Q|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	309	Gln-rich.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.Q309Q(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		agcagcagcagcaacaCCGAT	0.587																																					p.Q309Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G927A	17						.						42.0	30.0	34.0					17																	12647709		2203	4300	6503	12588434	SO:0001819	synonymous_variant	93649	exon8			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.927G>A	17.37:g.12647709G>A		Somatic		Capture	SOLID	Phase_I	12588434	NM_001146312	Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	37	CCDS11163.1																																																																																				0.587	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
TRPV2	51393	hgsc.bcm.edu	37	17	16340127	16340127	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:16340127C>T	ENST00000338560.7	+	15	2618	c.2219C>T	c.(2218-2220)gCt>gTt	p.A740V	C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|TRPV2_ENST00000577397.1_Missense_Mutation_p.A310V|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	740					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)	p.A740V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CCTGTCCTGGCTTCCCCTCCC	0.582																																					p.A740V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2219T	17						.						179.0	156.0	163.0					17																	16340127		2203	4300	6503	16280852	SO:0001583	missense	51393	exon15			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.2219C>T	17.37:g.16340127C>T	ENSP00000342222:p.Ala740Val	Somatic		Capture	SOLID	Phase_I	16280852	NM_016113	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	CCDS32576.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.380736	0.24944	.	.	ENSG00000187688	ENST00000338560	D	0.87966	-2.32	3.73	3.73	0.42828	.	1.219660	0.05662	N	0.587054	T	0.76716	0.4026	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.17433	0.018	T	0.61505	-0.7049	10	0.30078	T	0.28	-43.2136	11.3164	0.49394	0.0:1.0:0.0:0.0	.	740	Q9Y5S1	TRPV2_HUMAN	V	740	ENSP00000342222:A740V	ENSP00000342222:A740V	A	+	2	0	TRPV2	16280852	0.000000	0.05858	0.006000	0.13384	0.008000	0.06430	0.477000	0.22196	2.379000	0.81126	0.561000	0.74099	GCT		0.582	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113	
MPRIP	23164	hgsc.bcm.edu	37	17	17083923	17083923	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:17083923C>T	ENST00000341712.4	+	23	3048	c.3048C>T	c.(3046-3048)tcC>tcT	p.S1016S	RN7SL775P_ENST00000498361.2_RNA|RP11-45M22.3_ENST00000584203.1_RNA|MPRIP_ENST00000395811.5_Intron|MPRIP_ENST00000395804.3_Silent_p.S1016S|MPRIP_ENST00000444976.1_Intron			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	1016						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.S1016S(2)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TCTGACAGTCCGTAATTGAGC	0.612																																					p.S1016S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C3048T	17						.						397.0	312.0	341.0					17																	17083923		2203	4300	6503	17024648	SO:0001819	synonymous_variant	23164	exon23			BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.3048C>T	17.37:g.17083923C>T		Somatic		Capture	SOLID	Phase_I	17024648	NM_201274	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Silent	SNP	ENST00000341712.4	37	CCDS32578.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.293048	0.40594	.	.	ENSG00000133030	ENST00000414263	.	.	.	5.35	4.35	0.52113	.	.	.	.	.	T	0.72003	0.3407	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71938	-0.4441	4	.	.	.	.	16.1425	0.81536	0.0:0.8561:0.1439:0.0	.	.	.	.	L	1082	.	.	P	+	2	0	MPRIP	17024648	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.553000	0.45837	1.195000	0.43115	0.462000	0.41574	CCG		0.612	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
PRPSAP2	5636	hgsc.bcm.edu	37	17	18832203	18832203	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:18832203T>C	ENST00000268835.2	+	11	1167	c.884T>C	c.(883-885)gTg>gCg	p.V295A	PRPSAP2_ENST00000542013.1_Intron|PRPSAP2_ENST00000536323.1_Missense_Mutation_p.V209A|PRPSAP2_ENST00000419071.2_Missense_Mutation_p.V255A	NM_002767.3	NP_002758.1	O60256	KPRB_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 2	295					bone development (GO:0060348)|negative regulation of catalytic activity (GO:0043086)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)	p.V295A(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11						AAGATCTTTGTGATGGCAACT	0.498																																					p.V295A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T884C	17						.						194.0	177.0	183.0					17																	18832203		2203	4300	6503	18772928	SO:0001583	missense	5636	exon11			AB007851	CCDS11200.1, CCDS58525.1, CCDS58526.1, CCDS58527.1	17p12-p11.2	2008-05-14			ENSG00000141127	ENSG00000141127			9467	protein-coding gene	gene with protein product		603762				9806849	Standard	NM_002767		Approved	PAP41	uc002gup.2	O60256	OTTHUMG00000059406	ENST00000268835.2:c.884T>C	17.37:g.18832203T>C	ENSP00000268835:p.Val295Ala	Somatic		Capture	SOLID	Phase_I	18772928	NM_002767	B4E1M8|B4E329|B7ZKZ1|E7EMY2|Q6IAS2	Missense_Mutation	SNP	ENST00000268835.2	37	CCDS11200.1	.	.	.	.	.	.	.	.	.	.	T	6.449	0.450983	0.12223	.	.	ENSG00000141127	ENST00000395656;ENST00000419071;ENST00000268835;ENST00000536323	T;T;T	0.74209	-0.82;-0.82;-0.82	5.16	5.16	0.70880	.	0.059987	0.64402	N	0.000003	T	0.51958	0.1705	N	0.12443	0.215	0.58432	D	0.999997	B;B;B	0.30542	0.011;0.284;0.024	B;B;B	0.33339	0.033;0.162;0.033	T	0.52917	-0.8511	10	0.02654	T	1	3.0049	9.8119	0.40828	0.0:0.0778:0.0:0.9222	.	255;82;295	E7EMY2;Q6ZTP6;O60256	.;.;KPRB_HUMAN	A	295;255;295;209	ENSP00000392536:V255A;ENSP00000268835:V295A;ENSP00000443967:V209A	ENSP00000268835:V295A	V	+	2	0	PRPSAP2	18772928	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	7.930000	0.87610	2.070000	0.61991	0.472000	0.43445	GTG		0.498	PRPSAP2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132112.3	NM_002767	
PAFAH1B1	5048	hgsc.bcm.edu	37	17	2573468	2573468	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:2573468T>C	ENST00000397195.5	+	6	862	c.411T>C	c.(409-411)taT>taC	p.Y137Y	PAFAH1B1_ENST00000572915.2_Intron|PAFAH1B1_ENST00000451360.2_5'Flank	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)									p.Y137Y(1)		endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						TGTGGGATTATGAGACTGGAG	0.458																																					p.Y137Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T411C	17						.						176.0	174.0	174.0					17																	2573468		2203	4300	6503	2520218	SO:0001819	synonymous_variant	5048	exon6			L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.411T>C	17.37:g.2573468T>C		Somatic		Capture	SOLID	Phase_I	2520218	NM_000430		Silent	SNP	ENST00000397195.5	37	CCDS32528.1																																																																																				0.458	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437797.2	NM_000430	
SPAG5	10615	hgsc.bcm.edu	37	17	26913504	26913504	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:26913504A>G	ENST00000321765.5	-	5	1783	c.1451T>C	c.(1450-1452)cTt>cCt	p.L484P		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	484	Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)		p.L484P(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					AAGATGCTGAAGTTTATTAGT	0.438																																					p.L484P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1451C	17						.						170.0	149.0	156.0					17																	26913504		2203	4300	6503	23937631	SO:0001583	missense	10615	exon5			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1451T>C	17.37:g.26913504A>G	ENSP00000323300:p.Leu484Pro	Somatic		Capture	SOLID	Phase_I	23937631	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	A	10.69	1.420610	0.25639	.	.	ENSG00000076382	ENST00000321765	.	.	.	5.39	-0.523	0.11924	.	0.485527	0.19516	N	0.112390	T	0.16938	0.0407	N	0.03050	-0.425	0.41837	D	0.990104	B	0.02656	0.0	B	0.08055	0.003	T	0.04005	-1.0985	9	0.25106	T	0.35	-0.1613	3.7827	0.08687	0.4027:0.0:0.4312:0.1661	.	484	Q96R06	SPAG5_HUMAN	P	484	.	ENSP00000323300:L484P	L	-	2	0	SPAG5	23937631	0.996000	0.38824	0.978000	0.43139	0.924000	0.55760	0.213000	0.17521	0.145000	0.18977	-0.408000	0.06270	CTT		0.438	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
GOSR1	9527	hgsc.bcm.edu	37	17	28849379	28849379	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:28849379C>T	ENST00000225724.5	+	9	808	c.736C>T	c.(736-738)Ctg>Ttg	p.L246L	GOSR1_ENST00000581721.1_Silent_p.L232L|GOSR1_ENST00000451249.2_Silent_p.L244L|GOSR1_ENST00000467337.2_Silent_p.L181L	NM_001007024.1|NM_001007025.1|NM_004871.2	NP_001007025.1|NP_001007026.1|NP_004862.1	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1	246					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.L246L(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	12						CCTGTTGCTGCTGTATGCGTT	0.527																																					p.L181L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C541T	17						.						265.0	258.0	260.0					17																	28849379		2203	4300	6503	25873505	SO:0001819	synonymous_variant	9527	exon9			AF047438	CCDS11258.1, CCDS45643.1, CCDS45644.1	17q11	2011-04-15			ENSG00000108587	ENSG00000108587			4430	protein-coding gene	gene with protein product	"""golgi integral membrane protein 2"""	604026				8638159, 9653160, 15004235	Standard	XM_005258072		Approved	GOS28, P28, GS28, GOS-28, GOLIM2	uc002hfe.3	O95249	OTTHUMG00000132796	ENST00000225724.5:c.736C>T	17.37:g.28849379C>T		Somatic		Capture	SOLID	Phase_I	25873505	NM_001007024	J3KST5|O75392	Silent	SNP	ENST00000225724.5	37	CCDS11258.1																																																																																				0.527	GOSR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256208.2		
OR3A1	4994	hgsc.bcm.edu	37	17	3195183	3195183	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:3195183G>A	ENST00000323404.1	-	1	693	c.694C>T	c.(694-696)Cgc>Tgc	p.R232C	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	232					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R232C(2)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20						TCTACAGAGCGAATTCGCAGG	0.493																																					p.R232C	GBM(20;287 516 18743 28660 36594)											.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C694T	17						.						65.0	62.0	63.0					17																	3195183		2203	4300	6503	3141933	SO:0001583	missense	4994	exon1			X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090		"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product						8921386, 8647456	Standard	NM_002550		Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.694C>T	17.37:g.3195183G>A	ENSP00000313803:p.Arg232Cys	Somatic		Capture	SOLID	Phase_I	3141933	NM_002550	Q4VB06|Q6IFM4	Missense_Mutation	SNP	ENST00000323404.1	37	CCDS11023.1	.	.	.	.	.	.	.	.	.	.	G	6.027	0.373265	0.11409	.	.	ENSG00000180090	ENST00000323404	T	0.40225	1.04	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.127459	0.36374	N	0.002621	T	0.45155	0.1328	M	0.76938	2.355	0.09310	N	1	B	0.30439	0.279	B	0.29524	0.103	T	0.50074	-0.8870	10	0.66056	D	0.02	-11.7715	12.4902	0.55895	0.0:0.0:0.8329:0.1671	.	232	P47881	OR3A1_HUMAN	C	232	ENSP00000313803:R232C	ENSP00000313803:R232C	R	-	1	0	OR3A1	3141933	0.019000	0.18553	0.008000	0.14137	0.015000	0.08874	1.259000	0.32956	2.753000	0.94483	0.650000	0.86243	CGC		0.493	OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207302.2		
NF1	4763	hgsc.bcm.edu	37	17	29647443	29647443	+	Intron	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:29647443G>A	ENST00000358273.4	+	37	5218				NF1_ENST00000581113.2_Intron|EVI2A_ENST00000247270.3_Missense_Mutation_p.L3F|NF1_ENST00000356175.3_Intron|EVI2A_ENST00000462804.2_Intron|CTD-2370N5.3_ENST00000578584.1_5'Flank|EVI2A_ENST00000461237.1_Intron	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.L3F(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		caactcctaagcaacatggat	0.343			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.L3F		yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	.	12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|large_intestine(1)|central_nervous_system(1)	c.C7T	17						.						81.0	77.0	78.0					17																	29647443		2203	4300	6503	26671569	SO:0001627	intron_variant	2123	exon2	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4836-5395G>A	17.37:g.29647443G>A		Somatic		Capture	SOLID	Phase_I	26671569	NM_001003927	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701009	0.48307	.	.	ENSG00000126860	ENST00000247270	.	.	.	4.06	-1.46	0.08800	.	1.974730	0.03411	N	0.204821	T	0.33206	0.0855	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.39292	-0.9621	8	0.87932	D	0	.	7.5115	0.27577	0.5009:0.0:0.4991:0.0	.	3	P22794-2	.	F	3	.	ENSP00000247270:L3F	L	-	1	0	EVI2A	26671569	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.124000	0.15728	-0.191000	0.10448	0.650000	0.86243	CTT		0.343	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
SYNRG	11276	hgsc.bcm.edu	37	17	35930854	35930854	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:35930854G>A	ENST00000339208.6	-	10	1369	c.1229C>T	c.(1228-1230)gCg>gTg	p.A410V	SYNRG_ENST00000345615.4_Missense_Mutation_p.A332V|SYNRG_ENST00000591288.1_Intron|SYNRG_ENST00000585472.1_Missense_Mutation_p.A331V|SYNRG_ENST00000588194.1_5'UTR|SYNRG_ENST00000502449.2_Missense_Mutation_p.A332V|SYNRG_ENST00000394378.2_Missense_Mutation_p.A332V|SYNRG_ENST00000346661.4_Missense_Mutation_p.A410V	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	410					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)	p.A410V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CATGGAGCCCGCAGGACCTGA	0.532																																					p.A410V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1229T	17						.						67.0	66.0	66.0					17																	35930854		2203	4300	6503	33004967	SO:0001583	missense	11276	exon10			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.1229C>T	17.37:g.35930854G>A	ENSP00000343610:p.Ala410Val	Somatic		Capture	SOLID	Phase_I	33004967	NM_007247	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434417	0.62955	.	.	ENSG00000006114	ENST00000346661;ENST00000345615;ENST00000502449;ENST00000394378	T;T;T	0.47869	1.42;0.83;0.84	5.62	3.63	0.41609	.	0.173239	0.51477	D	0.000092	T	0.42063	0.1186	L	0.50333	1.59	0.34737	D	0.73039	B;B;B;P;P	0.49961	0.112;0.066;0.112;0.93;0.93	B;B;B;B;B	0.42163	0.011;0.011;0.011;0.378;0.378	T	0.56141	-0.8028	10	0.44086	T	0.13	-2.1785	11.4576	0.50191	0.0677:0.126:0.8063:0.0	.	332;332;332;410;410	Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;SYNRG_HUMAN	V	410;410;332;332	ENSP00000005279:A410V;ENSP00000424893:A332V;ENSP00000377903:A332V	ENSP00000315722:A410V	A	-	2	0	SYNRG	33004967	0.998000	0.40836	0.888000	0.34837	0.897000	0.52465	5.531000	0.67148	0.738000	0.32606	-0.182000	0.12963	GCG		0.532	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
PGAP3	93210	hgsc.bcm.edu	37	17	37842180	37842180	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:37842180C>A	ENST00000300658.4	-	2	366	c.274G>T	c.(274-276)Ggc>Tgc	p.G92C	ERBB2_ENST00000584601.1_5'Flank|ERBB2_ENST00000406381.2_5'Flank|PGAP3_ENST00000579146.1_Missense_Mutation_p.G92C|PGAP3_ENST00000378011.4_Missense_Mutation_p.G92C|PGAP3_ENST00000429199.2_Missense_Mutation_p.G92C|ERBB2_ENST00000578199.1_5'Flank	NM_033419.3	NP_219487.3	Q96FM1	PGAP3_HUMAN	post-GPI attachment to proteins 3	92			G -> D (in HPMRS4; results in loss of function; the mutant localizes to the Golgi apparatus as the wild-type). {ECO:0000269|PubMed:24439110}.		GPI anchor biosynthetic process (GO:0006506)|GPI anchor metabolic process (GO:0006505)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	hydrolase activity, acting on ester bonds (GO:0016788)	p.G92C(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12						CTCACCTTGCCATGGAACTGA	0.537																																					p.G92C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G274T	17						.						167.0	102.0	124.0					17																	37842180		2203	4300	6503	35095706	SO:0001583	missense	93210	exon2			AB088396	CCDS32641.1	17q21.2	2009-06-02	2009-06-02	2009-06-02		ENSG00000161395			23719	protein-coding gene	gene with protein product	"""post-GPI attachment to proteins 3"""	611801	"""per1-like domain containing 1"""	PERLD1		15010812, 17021251, 17314402	Standard	NM_001291728		Approved	MGC9753, CAB2, PP1498, PER1	uc002hsj.3	Q96FM1		ENST00000300658.4:c.274G>T	17.37:g.37842180C>A	ENSP00000300658:p.Gly92Cys	Somatic		Capture	SOLID	Phase_I	35095706	NM_033419	B4DGK7|Q86Z03|Q8NBJ8	Missense_Mutation	SNP	ENST00000300658.4	37	CCDS32641.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725179	0.89298	.	.	ENSG00000161395	ENST00000300658;ENST00000378011;ENST00000309862;ENST00000429199	.	.	.	5.0	5.0	0.66597	.	0.110729	0.64402	D	0.000011	D	0.86460	0.5938	M	0.93854	3.465	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.997;0.996	D	0.90289	0.4321	9	0.87932	D	0	-31.2596	17.0499	0.86516	0.0:1.0:0.0:0.0	.	92;36;92;92	B4DGK7;B4DVJ3;Q96FM1-2;Q96FM1	.;.;.;PGAP3_HUMAN	C	92;92;36;92	.	ENSP00000300658:G92C	G	-	1	0	PGAP3	35095706	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.678000	0.74508	2.325000	0.78763	0.561000	0.74099	GGC		0.537	PGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444825.2	NM_033419	
ZPBP2	124626	hgsc.bcm.edu	37	17	38031647	38031647	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:38031647A>G	ENST00000348931.4	+	7	1040	c.849A>G	c.(847-849)ggA>ggG	p.G283G	ZPBP2_ENST00000377940.3_Silent_p.G261G|ZPBP2_ENST00000584588.1_Silent_p.G210G	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	283					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.G283G(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			CAGGCTTTGGAAAAAATGAAC	0.338																																					p.G283G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A849G	17						.						76.0	69.0	72.0					17																	38031647		2203	4300	6503	35285173	SO:0001819	synonymous_variant	124626	exon7			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.849A>G	17.37:g.38031647A>G		Somatic		Capture	SOLID	Phase_I	35285173	NM_199321	A8K8L8|Q6X783|Q86XL5	Silent	SNP	ENST00000348931.4	37	CCDS11352.1																																																																																				0.338	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256609.2	NM_198844	
MED24	9862	hgsc.bcm.edu	37	17	38182513	38182513	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:38182513G>A	ENST00000394128.2	-	19	1962	c.1881C>T	c.(1879-1881)caC>caT	p.H627H	MED24_ENST00000394126.1_Silent_p.H652H|MED24_ENST00000394127.2_Silent_p.H614H|MED24_ENST00000501516.3_Silent_p.H646H|SNORD124_ENST00000459577.1_RNA|MED24_ENST00000356271.3_Silent_p.H614H	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	627					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.H627H(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GCATCCGGACGTGGGCCACAA	0.557																																					p.H614H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1842T	17						.						157.0	140.0	146.0					17																	38182513		2203	4300	6503	35436039	SO:0001819	synonymous_variant	9862	exon18			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1881C>T	17.37:g.38182513G>A		Somatic		Capture	SOLID	Phase_I	35436039	NM_001079518	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	ENST00000394128.2	37	CCDS11359.1																																																																																				0.557	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
KRT23	25984	hgsc.bcm.edu	37	17	39081718	39081718	+	Missense_Mutation	SNP	G	G	A	rs544856938		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:39081718G>A	ENST00000209718.3	-	7	1454	c.1030C>T	c.(1030-1032)Cgc>Tgc	p.R344C	AC004231.2_ENST00000418393.1_RNA|KRT23_ENST00000436344.3_Missense_Mutation_p.R207C	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	344	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R344C(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				AGTTCATGGCGTAGCTGCGTC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		21347	0.0		0.0	False		,,,				2504	0.001				p.R344C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1030T	17						.						209.0	156.0	174.0					17																	39081718		2203	4300	6503	36335244	SO:0001583	missense	25984	exon7			AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.1030C>T	17.37:g.39081718G>A	ENSP00000209718:p.Arg344Cys	Somatic		Capture	SOLID	Phase_I	36335244	NM_015515	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Missense_Mutation	SNP	ENST00000209718.3	37	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203572	0.38905	.	.	ENSG00000108244	ENST00000209718;ENST00000436344	D;D	0.91521	-2.86;-2.86	5.49	5.49	0.81192	Filament (1);	0.000000	0.53938	D	0.000047	D	0.96519	0.8864	H	0.94886	3.595	0.50467	D	0.999874	D	0.89917	1.0	D	0.97110	1.0	D	0.97271	0.9911	10	0.87932	D	0	.	14.2483	0.66001	0.0:0.0:0.8509:0.149	.	344	Q9C075	K1C23_HUMAN	C	344;207	ENSP00000209718:R344C;ENSP00000414056:R207C	ENSP00000209718:R344C	R	-	1	0	KRT23	36335244	0.992000	0.36948	0.857000	0.33713	0.032000	0.12392	2.256000	0.43231	2.581000	0.87130	0.655000	0.94253	CGC		0.532	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1		
CNTNAP1	8506	hgsc.bcm.edu	37	17	40845335	40845335	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:40845335C>T	ENST00000264638.4	+	18	2990	c.2773C>T	c.(2773-2775)Cgc>Tgc	p.R925C	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	925	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.R925C(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GCTTAAGAGACGCCCCTTTGT	0.597																																					p.R925C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2773T	17						.						92.0	90.0	90.0					17																	40845335		2203	4300	6503	38098861	SO:0001583	missense	8506	exon18			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2773C>T	17.37:g.40845335C>T	ENSP00000264638:p.Arg925Cys	Somatic		Capture	SOLID	Phase_I	38098861	NM_003632		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060857	0.76074	.	.	ENSG00000108797	ENST00000264638	T	0.80123	-1.34	5.6	5.6	0.85130	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.093173	0.45606	D	0.000348	D	0.87224	0.6124	M	0.66297	2.02	0.53005	D	0.999961	D	0.76494	0.999	D	0.65443	0.935	D	0.87838	0.2649	10	0.66056	D	0.02	.	13.1458	0.59461	0.2795:0.7205:0.0:0.0	.	925	P78357	CNTP1_HUMAN	C	925	ENSP00000264638:R925C	ENSP00000264638:R925C	R	+	1	0	CNTNAP1	38098861	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.126000	0.31344	2.634000	0.89283	0.491000	0.48974	CGC		0.597	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	
PSME3	10197	hgsc.bcm.edu	37	17	40991328	40991328	+	Silent	SNP	C	C	T	rs139649789	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:40991328C>T	ENST00000590720.1	+	10	848	c.615C>T	c.(613-615)acC>acT	p.T205T	PSME3_ENST00000293362.3_Silent_p.T218T|PSME3_ENST00000592169.1_Silent_p.T149T|PSME3_ENST00000541124.1_3'UTR|PSME3_ENST00000545225.1_Silent_p.T144T|PSME3_ENST00000441946.2_Silent_p.T216T			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)	205					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)	p.T218T(1)		NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		ATCGCCGCACCGTGACAGAGA	0.468													C|||	4	0.000798722	0.003	0.0	5008	,	,		19967	0.0		0.0	False		,,,				2504	0.0				p.T205T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C615T	17						.	C	,	22,4384	29.9+/-59.1	0,22,2181	87.0	83.0	85.0		615,654	-9.1	0.9	17	dbSNP_134	85	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PSME3	NM_005789.2,NM_176863.1	,	0,22,6481	TT,TC,CC		0.0,0.4993,0.1692	,	205/255,218/268	40991328	22,12984	2203	4300	6503	38244854	SO:0001819	synonymous_variant	10197	exon10			U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.615C>T	17.37:g.40991328C>T		Somatic		Capture	SOLID	Phase_I	38244854	NM_005789	A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Silent	SNP	ENST00000590720.1	37	CCDS45689.1																																																																																				0.468	PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452430.1	NM_176863	
AOC2	314	hgsc.bcm.edu	37	17	40998087	40998087	+	Missense_Mutation	SNP	C	C	T	rs151168110		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:40998087C>T	ENST00000253799.3	+	1	1471	c.1444C>T	c.(1444-1446)Cgg>Tgg	p.R482W	AOC2_ENST00000452774.2_Missense_Mutation_p.R482W	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	482					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.R482W(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		ACTTGAAGGGCGGGTCCATGC	0.547																																					p.R482W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1444T	17						.	C	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	109.0	106.0	107.0		1444,1444	2.0	0.4	17	dbSNP_134	107	0,8600		0,0,4300	no	missense,missense	AOC2	NM_001158.3,NM_009590.2	101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	482/730,482/757	40998087	1,13005	2203	4300	6503	38251613	SO:0001583	missense	314	exon1			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1444C>T	17.37:g.40998087C>T	ENSP00000253799:p.Arg482Trp	Somatic		Capture	SOLID	Phase_I	38251613	NM_001158	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	37	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.207614	0.39003	2.27E-4	0.0	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.03831	3.79;3.79	5.23	1.96	0.26148	Copper amine oxidase, C-terminal (3);	0.089274	0.50627	D	0.000118	T	0.19406	0.0466	M	0.76002	2.32	0.44469	D	0.997402	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.975	T	0.00443	-1.1736	10	0.87932	D	0	-1.194	14.6237	0.68605	0.6848:0.3152:0.0:0.0	.	482;482	O75106;O75106-2	AOC2_HUMAN;.	W	482	ENSP00000253799:R482W;ENSP00000406134:R482W	ENSP00000253799:R482W	R	+	1	2	AOC2	38251613	1.000000	0.71417	0.450000	0.26969	0.501000	0.33797	3.040000	0.49799	0.154000	0.19237	-0.282000	0.10007	CGG		0.547	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
NFE2L1	4779	hgsc.bcm.edu	37	17	46136464	46136464	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:46136464G>A	ENST00000362042.3	+	6	2396	c.1780G>A	c.(1780-1782)Gcc>Acc	p.A594T	NFE2L1_ENST00000585291.1_Missense_Mutation_p.A564T|RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000357480.5_Missense_Mutation_p.A564T|NFE2L1_ENST00000361665.3_Missense_Mutation_p.A583T|NFE2L1_ENST00000582155.1_Missense_Mutation_p.A406T|NFE2L1_ENST00000536222.1_Missense_Mutation_p.A438T|NFE2L1_ENST00000583378.1_Missense_Mutation_p.A395T	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	594					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.A594T(1)		cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACCACCCAGTGCCCTCAAGAA	0.597																																					p.A594T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1780A	17						.						64.0	55.0	58.0					17																	46136464		2203	4300	6503	43491463	SO:0001583	missense	4779	exon6			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.1780G>A	17.37:g.46136464G>A	ENSP00000354855:p.Ala594Thr	Somatic		Capture	SOLID	Phase_I	43491463	NM_003204	D3DTU3|D3DTU5|Q12877|Q96FN6	Missense_Mutation	SNP	ENST00000362042.3	37	CCDS11524.1	.	.	.	.	.	.	.	.	.	.	G	2.734	-0.263809	0.05754	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	T;T	0.11821	2.74;2.74	5.13	-7.26	0.01466	.	1.125180	0.06431	N	0.724116	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.46498	-0.9187	10	0.09590	T	0.72	-25.8613	9.7059	0.40216	0.7147:0.0:0.1846:0.1007	.	438;406;564;594	F5H1B7;B4DYE1;Q14494-2;Q14494	.;.;.;NF2L1_HUMAN	T	613;594;564;438	ENSP00000350072:A564T;ENSP00000445811:A438T	ENSP00000350072:A564T	A	+	1	0	NFE2L1	43491463	0.000000	0.05858	0.021000	0.16686	0.981000	0.71138	-0.651000	0.05372	-0.894000	0.03925	0.563000	0.77884	GCC		0.597	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1	NM_003204	
ZFP3	124961	hgsc.bcm.edu	37	17	4996037	4996037	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:4996037G>T	ENST00000318833.3	+	2	1574	c.1238G>T	c.(1237-1239)aGa>aTa	p.R413I		NM_153018.2	NP_694563.1	Q96NJ6	ZFP3_HUMAN	ZFP3 zinc finger protein	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R413I(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(3)|prostate(1)	20						GTCCACCAGAGAATTCATACT	0.433																																					p.R413I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1238T	17						.						69.0	67.0	68.0					17																	4996037		2203	4300	6503	4936761	SO:0001583	missense	124961	exon2			BX647638	CCDS11067.1	17p13.2	2013-01-08	2012-11-27		ENSG00000180787	ENSG00000180787		"""Zinc fingers, C2H2-type"""	12861	protein-coding gene	gene with protein product		194480	"""zinc finger protein homologous to Zfp-3 in mouse"", ""zinc finger protein 3 homolog (mouse)"""				Standard	NM_153018		Approved	FLJ30726, ZNF752	uc002gaq.3	Q96NJ6		ENST00000318833.3:c.1238G>T	17.37:g.4996037G>T	ENSP00000320347:p.Arg413Ile	Somatic		Capture	SOLID	Phase_I	4936761	NM_153018	A5PLL4	Missense_Mutation	SNP	ENST00000318833.3	37	CCDS11067.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106746	0.56291	.	.	ENSG00000180787	ENST00000318833	T	0.24908	1.83	3.96	3.0	0.34707	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.187735	0.26213	N	0.025679	T	0.42921	0.1224	M	0.66378	2.025	0.42926	D	0.994303	D	0.89917	1.0	D	0.87578	0.998	T	0.35025	-0.9805	10	0.66056	D	0.02	-8.6404	6.0389	0.19722	0.2245:0.0:0.7755:0.0	.	413	Q96NJ6	ZFP3_HUMAN	I	413	ENSP00000320347:R413I	ENSP00000320347:R413I	R	+	2	0	ZFP3	4936761	0.018000	0.18449	0.994000	0.49952	0.998000	0.95712	1.704000	0.37857	1.260000	0.44134	0.655000	0.94253	AGA		0.433	ZFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438979.1	NM_153018	
NLRP1	22861	hgsc.bcm.edu	37	17	5424954	5424954	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:5424954C>T	ENST00000572272.1	-	13	3672	c.3673G>A	c.(3673-3675)Gcc>Acc	p.A1225T	NLRP1_ENST00000269280.4_Missense_Mutation_p.A1225T|NLRP1_ENST00000354411.3_Missense_Mutation_p.A1195T|NLRP1_ENST00000577119.1_Missense_Mutation_p.A1195T|NLRP1_ENST00000345221.3_Missense_Mutation_p.A1225T|NLRP1_ENST00000262467.5_Missense_Mutation_p.A1229T			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1225					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.A1225T(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				AAGCGCAGGGCATTATGGATC	0.552																																					p.A1195T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3583A	17						.						97.0	91.0	93.0					17																	5424954		2203	4300	6503	5365678	SO:0001583	missense	22861	exon12			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3673G>A	17.37:g.5424954C>T	ENSP00000460475:p.Ala1225Thr	Somatic		Capture	SOLID	Phase_I	5365678	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.384468	0.25031	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24	4.2	0.0202	0.14123	.	0.411591	0.18003	N	0.154822	T	0.09598	0.0236	N	0.25890	0.77	0.09310	N	1	B;B;B;B;B	0.14438	0.008;0.003;0.004;0.008;0.01	B;B;B;B;B	0.15870	0.008;0.008;0.014;0.008;0.014	T	0.21348	-1.0248	10	0.48119	T	0.1	.	4.2028	0.10475	0.0:0.4397:0.1673:0.393	.	1195;1195;1225;1225;1229	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	T	1229;1229;1225;1195;1225;491	ENSP00000442029:A1229T;ENSP00000262467:A1229T;ENSP00000269280:A1225T;ENSP00000346390:A1195T;ENSP00000324366:A1225T	ENSP00000262467:A1229T	A	-	1	0	NLRP1	5365678	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.015000	0.03637	0.164000	0.19529	-0.205000	0.12727	GCC		0.552	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
NLRP1	22861	hgsc.bcm.edu	37	17	5462474	5462474	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:5462474C>A	ENST00000572272.1	-	4	1541	c.1542G>T	c.(1540-1542)tgG>tgT	p.W514C	NLRP1_ENST00000269280.4_Missense_Mutation_p.W514C|NLRP1_ENST00000354411.3_Missense_Mutation_p.W514C|NLRP1_ENST00000577119.1_Missense_Mutation_p.W514C|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000345221.3_Missense_Mutation_p.W514C|NLRP1_ENST00000262467.5_Missense_Mutation_p.W514C			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	514	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.W514*(3)|p.W514C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GACACAGGGCCCAGAGCTCTT	0.488																																					p.W514C												.	.	4	Substitution - Nonsense(3)|Substitution - Missense(1)	kidney(3)|large_intestine(1)	c.G1542T	17						.						100.0	97.0	98.0					17																	5462474		2203	4300	6503	5403198	SO:0001583	missense	22861	exon4			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1542G>T	17.37:g.5462474C>A	ENSP00000460475:p.Trp514Cys	Somatic		Capture	SOLID	Phase_I	5403198	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.087904	0.36855	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221	T;T;T;T;T	0.69561	-0.41;-0.41;-0.39;-0.37;-0.39	4.44	-0.224	0.13115	NACHT nucleoside triphosphatase (1);	0.622916	0.12234	N	0.487136	T	0.56001	0.1956	N	0.12182	0.205	0.09310	N	0.999997	D;D;D;D;D	0.60575	0.988;0.988;0.979;0.988;0.979	P;P;P;P;P	0.57244	0.816;0.816;0.659;0.816;0.659	T	0.47623	-0.9103	10	0.87932	D	0	.	4.5986	0.12341	0.0:0.4421:0.3541:0.2038	.	514;514;514;514;514	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	C	514	ENSP00000442029:W514C;ENSP00000262467:W514C;ENSP00000269280:W514C;ENSP00000346390:W514C;ENSP00000324366:W514C	ENSP00000262467:W514C	W	-	3	0	NLRP1	5403198	0.000000	0.05858	0.002000	0.10522	0.048000	0.14542	-0.846000	0.04336	0.217000	0.20800	0.650000	0.86243	TGG		0.488	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
B4GALNT2	124872	hgsc.bcm.edu	37	17	47246180	47246180	+	Silent	SNP	C	C	T	rs536287109		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:47246180C>T	ENST00000300404.2	+	10	1472	c.1413C>T	c.(1411-1413)ggC>ggT	p.G471G	B4GALNT2_ENST00000504681.1_Silent_p.G385G|B4GALNT2_ENST00000393354.2_Silent_p.G411G	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	471					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)	p.G471G(1)		endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			TGACCAGTGGCGTGGTCAACT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		17746	0.0		0.0	False		,,,				2504	0.001				p.G471G	GBM(124;244 1635 8663 18097 33175)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1413T	17						.						80.0	59.0	66.0					17																	47246180		2203	4300	6503	44601179	SO:0001819	synonymous_variant	124872	exon10			AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1413C>T	17.37:g.47246180C>T		Somatic		Capture	SOLID	Phase_I	44601179	NM_153446	B4DZE4|Q14CP1|Q86Y40	Silent	SNP	ENST00000300404.2	37	CCDS11544.1																																																																																				0.572	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446	
KCNJ16	3773	hgsc.bcm.edu	37	17	68129334	68129334	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:68129334C>T	ENST00000589377.1	+	2	1269	c.1106C>T	c.(1105-1107)gCg>gTg	p.A369V	KCNJ16_ENST00000392670.1_Missense_Mutation_p.A369V|KCNJ16_ENST00000283936.1_Missense_Mutation_p.A369V|KCNJ16_ENST00000585558.1_Missense_Mutation_p.A404V|KCNJ16_ENST00000586462.1_Missense_Mutation_p.A408V|KCNJ16_ENST00000392671.1_Missense_Mutation_p.A369V	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	369					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.A369V(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					GACACCAAGGCGAGACGAAGG	0.512																																					p.A369V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1106T	17						.						113.0	97.0	103.0					17																	68129334		2203	4300	6503	65640929	SO:0001583	missense	3773	exon5			AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.1106C>T	17.37:g.68129334C>T	ENSP00000465967:p.Ala369Val	Somatic		Capture	SOLID	Phase_I	65640929	NM_018658		Missense_Mutation	SNP	ENST00000589377.1	37	CCDS11687.1	.	.	.	.	.	.	.	.	.	.	C	2.060	-0.415693	0.04766	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.88124	-2.34;-2.34;-2.34	5.79	-1.04	0.10068	.	1.370700	0.04441	N	0.370844	T	0.70228	0.3200	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.57613	-0.7781	9	.	.	.	.	7.5368	0.27714	0.0:0.2192:0.1083:0.6726	.	369;369	A8K434;Q9NPI9	.;IRK16_HUMAN	V	369	ENSP00000283936:A369V;ENSP00000376439:A369V;ENSP00000376438:A369V	.	A	+	2	0	KCNJ16	65640929	0.876000	0.30132	0.312000	0.25196	0.002000	0.02628	0.329000	0.19698	-0.181000	0.10619	-0.941000	0.02677	GCG		0.512	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450880.1	NM_018658	
ACAP1	9744	hgsc.bcm.edu	37	17	7251686	7251686	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:7251686C>T	ENST00000158762.3	+	17	1776	c.1570C>T	c.(1570-1572)Cct>Tct	p.P524S	ACAP1_ENST00000571471.1_5'Flank|ACAP1_ENST00000575415.1_5'Flank|ACAP1_ENST00000570504.1_5'Flank|ACAP1_ENST00000574499.1_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	524	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.|Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.P524S(1)		NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						GACCAAGCTGCCTGAGATTCG	0.627																																					p.P524S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1570T	17						.						39.0	27.0	31.0					17																	7251686		2203	4300	6503	7192410	SO:0001583	missense	9744	exon17			D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1570C>T	17.37:g.7251686C>T	ENSP00000158762:p.Pro524Ser	Somatic		Capture	SOLID	Phase_I	7192410	NM_014716	Q53XN9	Missense_Mutation	SNP	ENST00000158762.3	37	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200619	0.79015	.	.	ENSG00000072818	ENST00000158762	T	0.74526	-0.85	5.22	4.26	0.50523	.	2.428240	0.01332	N	0.011293	D	0.82806	0.5117	L	0.49571	1.57	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.70687	-0.4803	10	0.13108	T	0.6	.	9.5842	0.39506	0.0:0.9058:0.0:0.0942	.	524	Q15027	ACAP1_HUMAN	S	524	ENSP00000158762:P524S	ENSP00000158762:P524S	P	+	1	0	ACAP1	7192410	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.293000	0.78740	1.442000	0.47568	0.655000	0.94253	CCT		0.627	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
MIF4GD	57409	hgsc.bcm.edu	37	17	73265439	73265439	+	Intron	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:73265439G>A	ENST00000325102.8	-	2	207				MIF4GD_ENST00000245551.5_Missense_Mutation_p.T58M|RP11-649A18.12_ENST00000582668.1_RNA|RP11-649A18.12_ENST00000585075.1_RNA|MIF4GD_ENST00000580571.1_Intron|MIF4GD_ENST00000577542.1_Missense_Mutation_p.T65M|MIF4GD_ENST00000579297.1_Missense_Mutation_p.T65M|MIF4GD_ENST00000579119.1_Intron|MIF4GD_ENST00000578305.1_Intron	NM_001242501.1	NP_001229430.1	A9UHW6	MI4GD_HUMAN	MIF4G domain containing						regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.T58M(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	10	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			TCTGTACTGCGTGTTACAGCG	0.498																																					p.T58M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C173T	17						.						138.0	124.0	129.0					17																	73265439		2203	4300	6503	70777034	SO:0001627	intron_variant	57409	exon3			CR605810	CCDS11719.1, CCDS56044.1, CCDS58598.1	17q25.1	2005-12-15		2005-12-15					24030	protein-coding gene	gene with protein product		612072		MIFD			Standard	NM_001242498		Approved	AD023, MGC45027	uc002jnq.3	A9UHW6		ENST00000325102.8:c.82+755C>T	17.37:g.73265439G>A		Somatic		Capture	SOLID	Phase_I	70777034	NM_020679	B4DUM7|Q8N4Q5|Q9HBL5	Missense_Mutation	SNP	ENST00000325102.8	37	CCDS56044.1	.	.	.	.	.	.	.	.	.	.	G	2.868	-0.234518	0.05983	.	.	ENSG00000125457	ENST00000245551	.	.	.	2.4	0.291	0.15732	.	.	.	.	.	T	0.26122	0.0637	M	0.63428	1.95	0.09310	N	1	P;P	0.40431	0.669;0.717	B;B	0.32583	0.057;0.148	T	0.15694	-1.0428	8	0.39692	T	0.17	.	3.0703	0.06229	0.1529:0.0:0.5853:0.2618	.	58;65	A9UHW6-2;B4DUM7	.;.	M	58	.	ENSP00000245551:T58M	T	-	2	0	MIF4GD	70777034	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	0.655000	0.24933	0.122000	0.18314	-0.374000	0.07098	ACG		0.498	MIF4GD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446671.1	NM_020679	
ABR	29	hgsc.bcm.edu	37	17	995067	995067	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:995067G>A	ENST00000302538.5	-	4	515	c.369C>T	c.(367-369)acC>acT	p.T123T	ABR_ENST00000544583.2_Silent_p.T77T|ABR_ENST00000291107.2_Silent_p.T86T|ABR_ENST00000574437.1_Silent_p.T77T	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	123	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T123T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		AGGTGGTGGCGGTGGCCTTCA	0.572																																					p.T123T	Esophageal Squamous(197;2016 2115 4129 29033 46447)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C369T	17						.						126.0	122.0	123.0					17																	995067		2203	4300	6503	941817	SO:0001819	synonymous_variant	29	exon4			L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.369C>T	17.37:g.995067G>A		Somatic		Capture	SOLID	Phase_I	941817	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Silent	SNP	ENST00000302538.5	37	CCDS10999.1																																																																																				0.572	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
ZZEF1	23140	hgsc.bcm.edu	37	17	3984757	3984759	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	AAG	AAG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:3984757_3984759delAAG	ENST00000381638.2	-	18	2864_2866	c.2740_2742delCTT	c.(2740-2742)cttdel	p.L915del	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	915							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.L914delL(1)		central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCTCAGGTAAAAGAAGAAGGCCG	0.448																																					p.914_914del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.2740_2742del	17						.			1,4263		0,1,2131						3.1	1.0			96	0,8254		0,0,4127	no	coding	ZZEF1	NM_015113.3		0,1,6258	A1A1,A1R,RR		0.0,0.0235,0.0080				1,12517				3931508	SO:0001651	inframe_deletion	23140	exon18			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.2740_2742delCTT	17.37:g.3984763_3984765delAAG	ENSP00000371051:p.Leu915del	Somatic		Capture	SOLID	Phase_I	3931506	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	In_Frame_Del	DEL	ENST00000381638.2	37	CCDS11043.1																																																																																				0.448	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
CNTROB	116840	hgsc.bcm.edu	37	17	7843560	7843560	+	Splice_Site	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:7843560G>T	ENST00000563694.1	+	9	2236	c.1311G>T	c.(1309-1311)caG>caT	p.Q437H	CNTROB_ENST00000380255.3_Splice_Site_p.Q437H|CNTROB_ENST00000380262.3_Splice_Site_p.Q437H|CNTROB_ENST00000565740.1_Splice_Site_p.Q437H	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	437	Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)	p.Q437H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				GCTTGGTGCAGGTCAGAAGGC	0.547																																					p.Q437H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1311T	17						.						70.0	76.0	74.0					17																	7843560		2203	4300	6503	7784285	SO:0001630	splice_region_variant	116840	exon9			AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.1311+1G>T	17.37:g.7843560G>T		Somatic		Capture	SOLID	Phase_I	7784285	NM_053051	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	37	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988538	0.74589	.	.	ENSG00000170037	ENST00000380262;ENST00000380255	T;T	0.48522	0.81;0.81	4.95	3.98	0.46160	.	0.129921	0.35555	N	0.003130	T	0.52025	0.1709	N	0.19112	0.55	0.42015	D	0.990959	D;D;D;D	0.71674	0.998;0.965;0.965;0.994	D;P;P;D	0.80764	0.994;0.799;0.66;0.931	T	0.58020	-0.7710	10	0.72032	D	0.01	-20.3769	12.4772	0.55821	0.0831:0.0:0.9169:0.0	.	437;437;437;437	Q8N137-4;Q8N137-3;Q8N137;Q8N137-2	.;.;CNTRB_HUMAN;.	H	437	ENSP00000369614:Q437H;ENSP00000369605:Q437H	ENSP00000369605:Q437H	Q	+	3	2	CNTROB	7784285	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.698000	0.68302	1.319000	0.45190	0.591000	0.81541	CAG		0.547	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	Missense_Mutation
MFSD6L	162387	hgsc.bcm.edu	37	17	8701383	8701383	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:8701383G>A	ENST00000329805.4	-	1	1284	c.1056C>T	c.(1054-1056)agC>agT	p.S352S		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	352						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						CCCTTTTGTAGCTGGGCTCCC	0.567																																					p.S352S												.	.	0			c.C1056T	17						.						78.0	78.0	78.0					17																	8701383		2203	4300	6503	8642108	SO:0001819	synonymous_variant	162387	exon1			AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.1056C>T	17.37:g.8701383G>A		Somatic		Capture	SOLID	Phase_I	8642108	NM_152599	Q6YL34|Q8NA76	Silent	SNP	ENST00000329805.4	37	CCDS11146.1																																																																																				0.567	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442554.1	NM_152599	
GLP2R	9340	hgsc.bcm.edu	37	17	9792972	9792972	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:9792972G>T	ENST00000262441.5	+	13	2125	c.1612G>T	c.(1612-1614)Gtc>Ttc	p.V538F	GLP2R_ENST00000574745.1_Missense_Mutation_p.V358F	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	538					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.V538F(1)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	TGAGGGGGATGTCACCATGGC	0.642																																					p.V538F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1612T	17						.						33.0	27.0	29.0					17																	9792972		2203	4299	6502	9733697	SO:0001583	missense	9340	exon13			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1612G>T	17.37:g.9792972G>T	ENSP00000262441:p.Val538Phe	Somatic		Capture	SOLID	Phase_I	9733697	NM_004246	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531776	0.27387	.	.	ENSG00000065325	ENST00000396206;ENST00000262441	T	0.55930	0.49	5.73	3.49	0.39957	.	0.183124	0.26907	N	0.021890	T	0.18964	0.0455	N	0.01705	-0.755	0.25420	N	0.988278	B	0.02656	0.0	B	0.04013	0.001	T	0.31943	-0.9925	10	0.02654	T	1	.	6.5612	0.22487	0.1351:0.0:0.3571:0.5078	.	538	O95838	GLP2R_HUMAN	F	538	ENSP00000262441:V538F	ENSP00000262441:V538F	V	+	1	0	GLP2R	9733697	1.000000	0.71417	0.988000	0.46212	0.830000	0.47004	1.331000	0.33793	0.452000	0.26830	0.655000	0.94253	GTC		0.642	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
AKAP10	11216	hgsc.bcm.edu	37	17	19812545	19812548	+	Frame_Shift_Del	DEL	ACTG	ACTG	-	rs139686167		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	ACTG	ACTG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:19812545_19812548delACTG	ENST00000225737.6	-	14	2086_2089	c.1929_1932delCAGT	c.(1927-1932)gtcagtfs	p.VS643fs	AKAP10_ENST00000395536.3_Frame_Shift_Del_p.VS585fs	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	643	PKA-RII subunit binding.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)		p.S644fs*12(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					GCATAATGTCACTGACTATCATTT	0.363																																					p.643_644del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1929_1932del	17						.																																			19753140	SO:0001589	frameshift_variant	11216	exon14			AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.1929_1932delCAGT	17.37:g.19812545_19812548delACTG	ENSP00000225737:p.Val643fs	Somatic		Capture	SOLID	Phase_I	19753137	NM_007202	B2R650|Q96AJ7	Frame_Shift_Del	DEL	ENST00000225737.6	37	CCDS11214.1																																																																																				0.363	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202	
RNF213	57674	hgsc.bcm.edu	37	17	78269421	78269421	+	Missense_Mutation	SNP	C	C	T	rs375693737		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr17:78269421C>T	ENST00000582970.1	+	10	1963	c.1820C>T	c.(1819-1821)aCg>aTg	p.T607M	RNF213_ENST00000456466.1_Missense_Mutation_p.T607M|RNF213_ENST00000508628.2_Missense_Mutation_p.T656M|RNF213_ENST00000319921.4_Missense_Mutation_p.T607M	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	607					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T607M(1)|p.T656M(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GGAAAAAGCACGGACTTTTTG	0.458																																					p.T607M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1820T	17						.	C	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	98.0	87.0	90.0		1967,1820	-4.8	0.0	17		90	0,8600		0,0,4300	no	missense,missense	RNF213	NM_020914.4,NM_020954.2	81,81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	656/5257,607/1064	78269421	1,13005	2203	4300	6503	75884016	SO:0001583	missense	57714	exon10			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1820C>T	17.37:g.78269421C>T	ENSP00000464087:p.Thr607Met	Somatic		Capture	SOLID	Phase_I	75884016	NM_020954	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	5.155	0.214220	0.09810	2.27E-4	0.0	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	4.03	-4.78	0.03209	.	2.437310	0.02637	U	0.104916	T	0.13543	0.0328	N	0.19112	0.55	0.09310	N	1	P;P	0.43024	0.798;0.798	B;B	0.33042	0.157;0.157	T	0.19582	-1.0301	9	0.46703	T	0.11	-13.7049	0.9566	0.01387	0.3565:0.3006:0.1938:0.1491	.	607;607	Q9HCF4;Q9HCF4-2	ALO17_HUMAN;.	M	607;656;607;607	.	ENSP00000324392:T607M	T	+	2	0	RNF213	75884016	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.866000	0.04245	-0.522000	0.06417	-1.917000	0.00517	ACG		0.458	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
TCP10L	140290	hgsc.bcm.edu	37	21	33951028	33951028	+	Silent	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr21:33951028T>A	ENST00000300258.3	-	4	587	c.474A>T	c.(472-474)tcA>tcT	p.S158S	TCP10L_ENST00000472557.1_Silent_p.S72S|LINC00846_ENST00000334165.4_lincRNA	NM_144659.5	NP_653260.1	Q8TDR4	TCP1L_HUMAN	t-complex 10-like	158					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	protein self-association (GO:0043621)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)			breast(1)|central_nervous_system(1)|liver(1)|skin(1)	4						AATTGTTAGATGACGATCTTT	0.458																																					p.S158S												.	.	0			c.A474T	21						.						207.0	176.0	187.0					21																	33951028		2203	4300	6503	32872899	SO:0001819	synonymous_variant	140290	exon4			AF115967	CCDS13616.1	21p22.11	2012-09-20	2012-09-20		ENSG00000242220	ENSG00000242220			11657	protein-coding gene	gene with protein product		608365	"""t-complex 10 (a murine tcp homolog)-like"", ""t-complex 10 (mouse)-like"""			10830953	Standard	NM_144659		Approved	PRED77		Q8TDR4	OTTHUMG00000064901	ENST00000300258.3:c.474A>T	21.37:g.33951028T>A		Somatic		Capture	SOLID	Phase_I	32872899	NM_144659	Q53EW0|Q96LN5	Silent	SNP	ENST00000300258.3	37	CCDS13616.1																																																																																				0.458	TCP10L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139350.1	NM_144659	
ITSN1	6453	hgsc.bcm.edu	37	21	35107452	35107452	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr21:35107452G>A	ENST00000381318.3	+	5	577	c.289G>A	c.(289-291)Gca>Aca	p.A97T	ITSN1_ENST00000399326.3_Missense_Mutation_p.A97T|ITSN1_ENST00000399338.4_Missense_Mutation_p.A97T|ITSN1_ENST00000381291.4_Missense_Mutation_p.A97T|ITSN1_ENST00000381285.4_Missense_Mutation_p.A97T|ITSN1_ENST00000379960.5_Missense_Mutation_p.A97T|ITSN1_ENST00000399352.1_Missense_Mutation_p.A97T|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399353.1_Missense_Mutation_p.A97T|ITSN1_ENST00000399355.2_Missense_Mutation_p.A97T|ITSN1_ENST00000437442.2_Missense_Mutation_p.A97T|ITSN1_ENST00000399367.3_Missense_Mutation_p.A97T|ITSN1_ENST00000399349.1_Missense_Mutation_p.A97T	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	97	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A97T(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						GCTACCCTCTGCACTTCCCCC	0.388																																					p.A97T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G289A	21						.						126.0	111.0	116.0					21																	35107452		2203	4300	6503	34029322	SO:0001583	missense	6453	exon5			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.289G>A	21.37:g.35107452G>A	ENSP00000370719:p.Ala97Thr	Somatic		Capture	SOLID	Phase_I	34029322	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.415|5.415	0.261655|0.261655	0.10239|0.10239	.|.	.|.	ENSG00000205726|ENSG00000205726	ENST00000399353;ENST00000444491;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000381283;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960|ENST00000456489	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.28454|.	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61|.	5.58|5.58	0.67|0.67	0.17923|0.17923	EPS15 homology (EH) (2);EF-hand-like domain (1);|.	0.186750|.	0.47093|.	N|.	0.000242|.	T|T	0.13798|0.13798	0.0334|0.0334	N|N	0.03115|0.03115	-0.41|-0.41	0.22366|0.22366	N|N	0.999161|0.999161	B;B;B;B;B;B;B;B;B;B|.	0.24186|.	0.0;0.0;0.0;0.0;0.0;0.099;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B;B;B;B;B|.	0.23574|.	0.0;0.0;0.0;0.001;0.0;0.047;0.001;0.001;0.0;0.0|.	T|T	0.30327|0.30327	-0.9982|-0.9982	10|5	0.30854|.	T|.	0.27|.	.|.	7.2236|7.2236	0.26002|0.26002	0.3453:0.0:0.5516:0.1032|0.3453:0.0:0.5516:0.1032	.|.	97;97;97;97;97;97;97;97;97;97|.	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0|.	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.|.	T|Y	97|36	ENSP00000382290:A97T;ENSP00000400079:A97T;ENSP00000370719:A97T;ENSP00000370691:A97T;ENSP00000370685:A97T;ENSP00000382301:A97T;ENSP00000382289:A97T;ENSP00000382292:A97T;ENSP00000382286:A97T;ENSP00000370683:A97T;ENSP00000382275:A97T;ENSP00000387377:A97T;ENSP00000382265:A97T;ENSP00000369294:A97T|.	ENSP00000369294:A97T|.	A|C	+|+	1|2	0|0	ITSN1|ITSN1	34029322|34029322	0.000000|0.000000	0.05858|0.05858	0.036000|0.036000	0.18154|0.18154	0.804000|0.804000	0.45430|0.45430	-0.413000|-0.413000	0.07123|0.07123	-0.160000|-0.160000	0.11002|0.11002	-0.244000|-0.244000	0.11960|0.11960	GCA|TGC		0.388	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
DOPEY2	9980	hgsc.bcm.edu	37	21	37584317	37584317	+	Missense_Mutation	SNP	C	C	T	rs376364814		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr21:37584317C>T	ENST00000399151.3	+	7	911	c.826C>T	c.(826-828)Cgc>Tgc	p.R276C	RN7SL73P_ENST00000585239.1_RNA|DOPEY2_ENST00000492760.1_3'UTR	NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	276					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.R276C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TGACATCGTGCGCATTCTCTC	0.493																																					p.R276C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C826T	21						.						108.0	94.0	99.0					21																	37584317		2203	4300	6503	36506187	SO:0001583	missense	9980	exon7			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.826C>T	21.37:g.37584317C>T	ENSP00000382104:p.Arg276Cys	Somatic		Capture	SOLID	Phase_I	36506187	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969402	0.74246	.	.	ENSG00000142197	ENST00000399151	T	0.13307	2.6	5.12	1.07	0.20283	Dopey, N-terminal (1);	0.724056	0.14205	N	0.334442	T	0.23370	0.0565	M	0.74881	2.28	0.09310	N	1	D;D	0.59767	0.971;0.986	P;P	0.53185	0.599;0.72	T	0.09250	-1.0683	10	0.39692	T	0.17	.	6.7433	0.23449	0.0:0.5605:0.2347:0.2048	.	276;276	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	C	276	ENSP00000382104:R276C	ENSP00000382104:R276C	R	+	1	0	DOPEY2	36506187	0.001000	0.12720	0.000000	0.03702	0.633000	0.38033	1.293000	0.33353	-0.081000	0.12662	-0.119000	0.15052	CGC		0.493	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
ABCG1	9619	hgsc.bcm.edu	37	21	43710232	43710232	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr21:43710232G>A	ENST00000361802.2	+	11	1478	c.1333G>A	c.(1333-1335)Ggg>Agg	p.G445R	ABCG1_ENST00000347800.2_Missense_Mutation_p.G430R|ABCG1_ENST00000398449.3_Missense_Mutation_p.G433R|ABCG1_ENST00000398457.2_Missense_Mutation_p.G435R|ABCG1_ENST00000340588.4_Missense_Mutation_p.G553R|ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398437.1_Missense_Mutation_p.G591R|ABCG1_ENST00000343687.3_Missense_Mutation_p.G444R	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	445	ABC transmembrane type-2.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)	p.G445R(1)|p.G435R(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	CTTGGGGATCGGGAACGAAGC	0.567																																					p.G430R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1288A	21						.						200.0	150.0	167.0					21																	43710232		2203	4300	6503	42583301	SO:0001583	missense	9619	exon11			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.1333G>A	21.37:g.43710232G>A	ENSP00000354995:p.Gly445Arg	Somatic		Capture	SOLID	Phase_I	42583301	NM_207629	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	ENST00000361802.2	37	CCDS13682.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.3|27.3	4.814837|4.814837	0.90790|0.90790	.|.	.|.	ENSG00000160179|ENSG00000160179	ENST00000398457;ENST00000347800;ENST00000398449;ENST00000361802;ENST00000343687;ENST00000398437;ENST00000340588|ENST00000489035;ENST00000469119;ENST00000482161	T;T;T;T;T;T;T|.	0.73575|.	-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76|.	4.17|4.17	4.17|4.17	0.49024|0.49024	ABC-2 type transporter (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87026|0.87026	0.6075|0.6075	H|H	0.95611|0.95611	3.695|3.695	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;0.988;1.0;0.988;0.998;1.0|.	D;P;D;D;D;D|.	0.97110|.	1.0;0.901;1.0;0.919;0.966;1.0|.	D|D	0.91663|0.91663	0.5344|0.5344	9|5	.|.	.|.	.|.	-33.503|-33.503	16.8608|16.8608	0.86018|0.86018	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	456;444;445;433;430;435|.	B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3|.	.;.;ABCG1_HUMAN;.;.;.|.	R|Q	435;430;433;445;444;591;553|180;168;168	ENSP00000381475:G435R;ENSP00000291524:G430R;ENSP00000381467:G433R;ENSP00000354995:G445R;ENSP00000339744:G444R;ENSP00000381464:G591R;ENSP00000343820:G553R|.	.|.	G|R	+|+	1|2	0|0	ABCG1|ABCG1	42583301|42583301	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.995000|0.995000	0.86356|0.86356	9.390000|9.390000	0.97246|0.97246	2.041000|2.041000	0.60428|0.60428	0.563000|0.563000	0.77884|0.77884	GGG|CGG		0.567	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	NM_207174	
UMOD	7369	hgsc.bcm.edu	37	16	20355364	20355364	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:20355364G>A	ENST00000570689.1	-	6	1459	c.1313C>T	c.(1312-1314)gCc>gTc	p.A438V	UMOD_ENST00000570331.1_5'Flank|UMOD_ENST00000396142.2_Missense_Mutation_p.A438V|UMOD_ENST00000396138.4_Missense_Mutation_p.A487V|UMOD_ENST00000302509.4_Missense_Mutation_p.A438V|UMOD_ENST00000424589.1_Missense_Mutation_p.A471V|UMOD_ENST00000396134.2_Missense_Mutation_p.A471V			P07911	UROM_HUMAN	uromodulin	438	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.A438V(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TGGCTGTAGGGCGGTCTTCAG	0.537																																					p.A438V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1313T	16						.						112.0	97.0	102.0					16																	20355364		2203	4300	6503	20262865	SO:0001583	missense	7369	exon6			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1313C>T	16.37:g.20355364G>A	ENSP00000460548:p.Ala438Val	Somatic		Capture	SOLID	Phase_I	20262865	NM_003361	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	ENST00000570689.1	37	CCDS10583.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331399	0.41297	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	5.49	5.49	0.81192	Zona pellucida sperm-binding protein (3);	0.137477	0.34110	N	0.004243	T	0.77644	0.4161	L	0.45470	1.425	0.21325	N	0.999726	P;B	0.35493	0.505;0.033	B;B	0.39738	0.308;0.124	T	0.67102	-0.5755	10	0.19590	T	0.45	-31.8589	16.864	0.86025	0.0:0.0:1.0:0.0	.	471;438	E9PEA4;P07911	.;UROM_HUMAN	V	438;471;471;438;416;438	ENSP00000379438:A471V;ENSP00000416346:A471V;ENSP00000306279:A438V;ENSP00000379446:A438V	ENSP00000306279:A438V	A	-	2	0	UMOD	20262865	0.991000	0.36638	1.000000	0.80357	0.732000	0.41865	5.338000	0.65947	2.559000	0.86315	0.655000	0.94253	GCC		0.537	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1		
ACSM2B	348158	hgsc.bcm.edu	37	16	20548586	20548586	+	Silent	SNP	C	C	T	rs184873551		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:20548586C>T	ENST00000329697.6	-	14	1896	c.1728G>A	c.(1726-1728)gcG>gcA	p.A576A	ACSM2B_ENST00000565232.1_Silent_p.A576A|ACSM2B_ENST00000567001.1_Silent_p.A576A|ACSM2B_ENST00000565322.1_Silent_p.A497A	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	576					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)	p.A576A(2)		breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						CGCCTCACTGCGCACGGGCTT	0.458																																					p.A576A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|breast(1)	c.G1728A	16						.	C	,	0,4404		0,0,2202	241.0	221.0	228.0		1728,1728	0.5	0.0	16		228	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	ACSM2B	NM_001105069.1,NM_182617.3	,	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	,	576/578,576/578	20548586	2,13002	2202	4300	6502	20456087	SO:0001819	synonymous_variant	348158	exon14			AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1728G>A	16.37:g.20548586C>T		Somatic		Capture	SOLID	Phase_I	20456087	NM_001105069	Q86YT1	Silent	SNP	ENST00000329697.6	37	CCDS10586.1																																																																																				0.458	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617	
TMEM159	57146	hgsc.bcm.edu	37	16	21185346	21185346	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:21185346T>C	ENST00000233047.4	+	4	749	c.281T>C	c.(280-282)gTg>gCg	p.V94A	TMEM159_ENST00000572258.1_Intron|TMEM159_ENST00000572599.1_Missense_Mutation_p.V94A|TMEM159_ENST00000261388.3_Missense_Mutation_p.V94A|TMEM159_ENST00000451578.2_Missense_Mutation_p.V118A			Q96B96	TM159_HUMAN	transmembrane protein 159	94						integral component of membrane (GO:0016021)		p.V94A(1)		large_intestine(3)|lung(2)|ovary(1)	6				GBM - Glioblastoma multiforme(48;0.0972)		GTCATCTCTGTGGGTGGCTTC	0.498																																					p.V94A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T281C	16						.						244.0	187.0	206.0					16																	21185346		2200	4300	6500	21092847	SO:0001583	missense	57146	exon4			AF070596	CCDS10595.1	16p12.2	2008-02-05			ENSG00000011638	ENSG00000011638			30136	protein-coding gene	gene with protein product		611304				8619474, 9110174, 15589683	Standard	NM_020422		Approved	promethin	uc002dif.4	Q96B96	OTTHUMG00000131559	ENST00000233047.4:c.281T>C	16.37:g.21185346T>C	ENSP00000233047:p.Val94Ala	Somatic		Capture	SOLID	Phase_I	21092847	NM_020422	A6NMA9|B4DEC1|O00323	Missense_Mutation	SNP	ENST00000233047.4	37	CCDS10595.1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.635865	0.67130	.	.	ENSG00000011638	ENST00000233047;ENST00000261388;ENST00000451578	T;T;T	0.16457	2.34;2.34;2.34	5.93	5.93	0.95920	.	0.070849	0.52532	D	0.000068	T	0.38532	0.1044	M	0.72894	2.215	0.42558	D	0.993132	D;D	0.69078	0.997;0.997	P;P	0.61800	0.894;0.894	T	0.21621	-1.0240	10	0.72032	D	0.01	0.6641	14.3148	0.66443	0.0:0.0:0.0:1.0	.	118;94	B4DEC1;Q96B96	.;TM159_HUMAN	A	94;94;118	ENSP00000233047:V94A;ENSP00000261388:V94A;ENSP00000409879:V118A	ENSP00000233047:V94A	V	+	2	0	TMEM159	21092847	1.000000	0.71417	0.996000	0.52242	0.444000	0.32077	4.808000	0.62583	2.263000	0.75096	0.528000	0.53228	GTG		0.498	TMEM159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254421.1	NM_020422	
SRRM2	23524	hgsc.bcm.edu	37	16	2816149	2816149	+	Missense_Mutation	SNP	C	C	T	rs146698076		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:2816149C>T	ENST00000301740.8	+	11	6169	c.5620C>T	c.(5620-5622)Cgg>Tgg	p.R1874W		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1874	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.R1874W(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGCCACTCACCGGCGATCCAG	0.612																																					p.R1874W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5620T	16						.	C	TRP/ARG	0,4396		0,0,2198	82.0	79.0	80.0		5620	3.3	1.0	16	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	no	missense	SRRM2	NM_016333.3	101	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1874/2753	2816149	1,12995	2198	4300	6498	2756150	SO:0001583	missense	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5620C>T	16.37:g.2816149C>T	ENSP00000301740:p.Arg1874Trp	Somatic		Capture	SOLID	Phase_I	2756150	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	1.251	-0.618463	0.03663	0.0	1.16E-4	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.34275	1.37	5.34	3.29	0.37713	.	0.000000	0.53938	D	0.000046	T	0.32941	0.0846	N	0.08118	0	0.34713	D	0.727971	D	0.89917	1.0	D	0.69654	0.965	T	0.48433	-0.9036	10	0.87932	D	0	-8.3574	6.4652	0.21977	0.3256:0.5901:0.0:0.0843	.	1874	Q9UQ35	SRRM2_HUMAN	W	1874;1874;1126	ENSP00000301740:R1874W	ENSP00000301740:R1874W	R	+	1	2	SRRM2	2756150	0.245000	0.23899	1.000000	0.80357	0.994000	0.84299	0.126000	0.15769	1.228000	0.43614	0.650000	0.86243	CGG		0.612	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
ZSCAN32	54925	hgsc.bcm.edu	37	16	3433125	3433125	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:3433125G>A	ENST00000396852.4	-	7	2128	c.1821C>T	c.(1819-1821)tgC>tgT	p.C607C	ZSCAN32_ENST00000439568.2_Silent_p.C318C|ZSCAN32_ENST00000396846.3_Silent_p.C607C|ZSCAN32_ENST00000304926.3_Silent_p.C395C|NAA60_ENST00000576906.1_Intron	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	607					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A73T(1)|p.C395C(1)									CACAGACAATGCACTGGTAAG	0.527																																					p.C395C												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C1185T	16						.						145.0	139.0	141.0					16																	3433125		2197	4300	6497	3373126	SO:0001819	synonymous_variant	54925	exon6			AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1821C>T	16.37:g.3433125G>A		Somatic		Capture	SOLID	Phase_I	3373126	NM_017810	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Silent	SNP	ENST00000396852.4	37																																																																																					0.527	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251509.2	NM_017810	
SLX4	84464	hgsc.bcm.edu	37	16	3639147	3639147	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:3639147G>T	ENST00000294008.3	-	12	5132	c.4492C>A	c.(4492-4494)Ctg>Atg	p.L1498M		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1498	Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.L1498M(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CTATTCCCCAGGGAGCCCGCG	0.642								Direct reversal of damage																													p.L1498M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4492A	16						.						72.0	87.0	82.0					16																	3639147		2197	4300	6497	3579148	SO:0001583	missense	84464	exon12			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.4492C>A	16.37:g.3639147G>T	ENSP00000294008:p.Leu1498Met	Somatic		Capture	SOLID	Phase_I	3579148	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	G	12.57	1.976798	0.34848	.	.	ENSG00000188827	ENST00000294008	T	0.01178	5.22	5.16	2.05	0.26809	.	0.705640	0.13123	N	0.412053	T	0.00815	0.0027	N	0.22421	0.69	0.09310	N	1	P	0.43287	0.802	B	0.33392	0.163	T	0.53194	-0.8473	10	0.42905	T	0.14	.	4.5865	0.12285	0.2763:0.1625:0.5612:0.0	.	1498	Q8IY92	SLX4_HUMAN	M	1498	ENSP00000294008:L1498M	ENSP00000294008:L1498M	L	-	1	2	SLX4	3579148	0.538000	0.26394	0.000000	0.03702	0.029000	0.11900	1.988000	0.40697	0.259000	0.21709	0.655000	0.94253	CTG		0.642	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
ARHGAP17	55114	hgsc.bcm.edu	37	16	24971288	24971288	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:24971288C>T	ENST00000289968.6	-	8	655	c.586G>A	c.(586-588)Gca>Aca	p.A196T	ARHGAP17_ENST00000575975.1_5'UTR|ARHGAP17_ENST00000441763.2_Missense_Mutation_p.A196T|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.A196T	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	196	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)	p.A196T(2)		breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		TACATGTCTGCTGCAAGTTGA	0.378																																					p.A196T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G586A	16						.						111.0	111.0	111.0					16																	24971288		2197	4300	6497	24878789	SO:0001583	missense	55114	exon8			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.586G>A	16.37:g.24971288C>T	ENSP00000289968:p.Ala196Thr	Somatic		Capture	SOLID	Phase_I	24878789	NM_001006634	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.906214	0.72868	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000441763;ENST00000455311	T;T;T	0.63744	-0.06;-0.06;-0.06	5.67	5.67	0.87782	BAR (3);	0.000000	0.42821	D	0.000646	T	0.77061	0.4075	M	0.66939	2.045	0.58432	D	0.999997	D;D;D;D	0.76494	0.992;0.999;0.997;0.996	P;D;D;D	0.74674	0.906;0.984;0.942;0.964	T	0.74290	-0.3713	10	0.34782	T	0.22	.	17.2386	0.87006	0.0:1.0:0.0:0.0	.	196;196;196;196	Q68EM7-4;C9IZD3;Q68EM7-2;Q68EM7	.;.;.;RHG17_HUMAN	T	196	ENSP00000289968:A196T;ENSP00000303130:A196T;ENSP00000406950:A196T	ENSP00000289968:A196T	A	-	1	0	ARHGAP17	24878789	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.413000	0.80104	2.666000	0.90696	0.585000	0.79938	GCA		0.378	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054	
CPNE2	221184	hgsc.bcm.edu	37	16	57155623	57155623	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:57155623A>G	ENST00000535318.2	+	10	1179	c.818A>G	c.(817-819)aAg>aGg	p.K273R	CPNE2_ENST00000537605.1_Missense_Mutation_p.K171R|CPNE2_ENST00000565874.1_Missense_Mutation_p.K273R|CPNE2_ENST00000290776.8_Missense_Mutation_p.K273R			Q96FN4	CPNE2_HUMAN	copine II	273						extracellular vesicular exosome (GO:0070062)		p.K273R(1)		central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				AAGCAGAGGAAGAAGAAGAAC	0.537																																					p.K273R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A818G	16						.						141.0	129.0	133.0					16																	57155623		2198	4300	6498	55713124	SO:0001583	missense	221184	exon9				CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.818A>G	16.37:g.57155623A>G	ENSP00000439018:p.Lys273Arg	Somatic		Capture	SOLID	Phase_I	55713124	NM_152727	Q68D19|Q719H8|Q86XP9	Missense_Mutation	SNP	ENST00000535318.2	37	CCDS10774.1	.	.	.	.	.	.	.	.	.	.	A	18.83	3.706627	0.68615	.	.	ENSG00000140848	ENST00000290776;ENST00000537605;ENST00000535318	T;T;T	0.39592	1.07;1.07;1.07	5.14	5.14	0.70334	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.53706	0.1813	M	0.72894	2.215	0.50171	D	0.999853	P;P	0.51057	0.941;0.897	B;P	0.50352	0.444;0.638	T	0.59857	-0.7375	10	0.62326	D	0.03	-11.5973	14.9542	0.71098	1.0:0.0:0.0:0.0	.	273;273	A8K8A4;Q96FN4	.;CPNE2_HUMAN	R	273;171;273	ENSP00000290776:K273R;ENSP00000445468:K171R;ENSP00000439018:K273R	ENSP00000290776:K273R	K	+	2	0	CPNE2	55713124	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.839000	0.69395	1.929000	0.55896	0.460000	0.39030	AAG		0.537	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432986.2	NM_152727	
CDH8	1006	hgsc.bcm.edu	37	16	61851554	61851554	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:61851554C>A	ENST00000577390.1	-	7	2060	c.1106G>T	c.(1105-1107)aGg>aTg	p.R369M	CDH8_ENST00000584337.1_Missense_Mutation_p.R369M|CDH8_ENST00000299345.6_Missense_Mutation_p.R369M|CDH8_ENST00000577730.1_Missense_Mutation_p.R369M	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	369	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.R369M(2)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AAAGGGCCCCCTGCCACTGAA	0.468																																					p.R369M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1106T	16						.						83.0	66.0	72.0					16																	61851554		2203	4300	6503	60409055	SO:0001583	missense	1006	exon7			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1106G>T	16.37:g.61851554C>A	ENSP00000462701:p.Arg369Met	Somatic		Capture	SOLID	Phase_I	60409055	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.571334	0.28003	.	.	ENSG00000150394	ENST00000299345	T	0.52526	0.66	5.96	5.0	0.66597	Cadherin (4);Cadherin-like (1);	0.175672	0.64402	D	0.000009	T	0.38719	0.1051	L	0.38953	1.18	0.30841	N	0.735709	B;B	0.09022	0.002;0.0	B;B	0.12156	0.007;0.0	T	0.39035	-0.9633	10	0.39692	T	0.17	.	12.7062	0.57061	0.131:0.7431:0.126:0.0	.	185;369	Q3LID3;P55286	.;CADH8_HUMAN	M	369	ENSP00000299345:R369M	ENSP00000299345:R369M	R	-	2	0	CDH8	60409055	0.972000	0.33761	1.000000	0.80357	0.869000	0.49853	0.980000	0.29513	1.492000	0.48499	0.655000	0.94253	AGG		0.468	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
PRMT7	54496	hgsc.bcm.edu	37	16	68358698	68358698	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:68358698C>T	ENST00000339507.5	+	5	1075	c.245C>T	c.(244-246)gCg>gTg	p.A82V	PRMT7_ENST00000348497.4_Missense_Mutation_p.A82V|PRMT7_ENST00000564441.1_3'UTR|PRMT7_ENST00000441236.1_Intron|PRMT7_ENST00000449359.3_Intron			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	82	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.A82V(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		TCAATGATGGCGGTCACAGCA	0.557																																					p.A82V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C245T	16						.						134.0	111.0	119.0					16																	68358698		2198	4300	6498	66916199	SO:0001583	missense	54496	exon5			AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.245C>T	16.37:g.68358698C>T	ENSP00000343103:p.Ala82Val	Somatic		Capture	SOLID	Phase_I	66916199	NM_019023	B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	ENST00000339507.5	37	CCDS10866.1	.	.	.	.	.	.	.	.	.	.	C	36	5.869540	0.97049	.	.	ENSG00000132600	ENST00000348497;ENST00000339507	T;T	0.28666	1.6;1.6	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.64951	0.2645	M	0.91354	3.2	0.44745	D	0.997747	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.71830	-0.4474	10	0.56958	D	0.05	-22.6925	16.993	0.86359	0.0:1.0:0.0:0.0	.	82;82;82	Q9NVM4-2;Q9NVM4;Q9NVM4-4	.;ANM7_HUMAN;.	V	82	ENSP00000345775:A82V;ENSP00000343103:A82V	ENSP00000343103:A82V	A	+	2	0	PRMT7	66916199	1.000000	0.71417	0.964000	0.40570	0.985000	0.73830	7.720000	0.84759	2.599000	0.87857	0.655000	0.94253	GCG		0.557	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268892.3	NM_019023	
CDH1	999	hgsc.bcm.edu	37	16	68847302	68847302	+	Silent	SNP	G	G	A	rs200161607		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:68847302G>A	ENST00000261769.5	+	9	1415	c.1224G>A	c.(1222-1224)gcG>gcA	p.A408A	CDH1_ENST00000422392.2_Intron|CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	408	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.Y380_K440del(2)|p.A408A(1)|p.W409fs*8(1)|p.?(1)|p.T406fs*6(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ATACCCCAGCGTGGGAGGCTG	0.473			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer				G|||	1	0.000199681	0.0	0.0014	5008	,	,		22857	0.0		0.0	False		,,,				2504	0.0				p.A408A		yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	.	6	Deletion - In frame(2)|Deletion - Frameshift(2)|Unknown(1)|Substitution - coding silent(1)	breast(4)|large_intestine(1)|stomach(1)	c.G1224A	16						.						199.0	169.0	179.0					16																	68847302		2198	4300	6498	67404803	SO:0001819	synonymous_variant	999	exon9	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1224G>A	16.37:g.68847302G>A		Somatic		Capture	SOLID	Phase_I	67404803	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Silent	SNP	ENST00000261769.5	37	CCDS10869.1																																																																																				0.473	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
ZFHX3	463	hgsc.bcm.edu	37	16	72992354	72992354	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:72992354G>A	ENST00000268489.5	-	2	2363	c.1691C>T	c.(1690-1692)gCg>gTg	p.A564V	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	564					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A564V(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCTCCTGTTCGCACCATCAAA	0.512																																					p.A564V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1691T	16						.						95.0	91.0	92.0					16																	72992354		2198	4300	6498	71549855	SO:0001583	missense	463	exon2			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1691C>T	16.37:g.72992354G>A	ENSP00000268489:p.Ala564Val	Somatic		Capture	SOLID	Phase_I	71549855	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582629	0.46006	.	.	ENSG00000140836	ENST00000268489	T	0.73681	-0.77	4.94	4.94	0.65067	.	0.000000	0.49916	D	0.000136	T	0.67813	0.2933	N	0.08118	0	0.80722	D	1	D	0.67145	0.996	P	0.53490	0.727	T	0.70985	-0.4723	10	0.33141	T	0.24	.	18.5479	0.91054	0.0:0.0:1.0:0.0	.	564	Q15911	ZFHX3_HUMAN	V	564	ENSP00000268489:A564V	ENSP00000268489:A564V	A	-	2	0	ZFHX3	71549855	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.881000	0.75584	2.458000	0.83093	0.650000	0.86243	GCG		0.512	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
CREBBP	1387	hgsc.bcm.edu	37	16	3781324	3781326	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	AGG	AGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:3781324_3781326delAGG	ENST00000262367.5	-	30	5848_5850	c.5039_5041delCCT	c.(5038-5043)tccttg>ttg	p.S1680del	CREBBP_ENST00000382070.3_In_Frame_Del_p.S1642del	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1680	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S1680delS(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GAGCGGCGCAAGGAGGAGAACTC	0.645			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.1680_1681del			Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.	1	Deletion - In frame(1)	large_intestine(1)	c.5039_5041del	16	GRCh37	CD084702	CREBBP	D		.																																			3721327	SO:0001651	inframe_deletion	1387	exon30			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5039_5041delCCT	16.37:g.3781327_3781329delAGG	ENSP00000262367:p.Ser1680del	Somatic		Capture	SOLID	Phase_I	3721325	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	In_Frame_Del	DEL	ENST00000262367.5	37	CCDS10509.1																																																																																				0.645	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
ADAMTS18	170692	hgsc.bcm.edu	37	16	77317886	77317886	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr16:77317886T>G	ENST00000282849.5	-	23	4051	c.3633A>C	c.(3631-3633)aaA>aaC	p.K1211N	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1211	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K1211N(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TGCAGCATTGTTTTCCGTAAA	0.468																																					p.K1211N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3633C	16						.						207.0	173.0	184.0					16																	77317886		2198	4300	6498	75875387	SO:0001583	missense	170692	exon23			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3633A>C	16.37:g.77317886T>G	ENSP00000282849:p.Lys1211Asn	Somatic		Capture	SOLID	Phase_I	75875387	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	T	17.15	3.316235	0.60524	.	.	ENSG00000140873	ENST00000282849	T	0.47869	0.83	5.82	-4.31	0.03698	PLAC (2);	0.233260	0.43260	D	0.000589	T	0.46249	0.1383	L	0.55481	1.735	0.38534	D	0.94904	P	0.40731	0.728	P	0.49012	0.598	T	0.50693	-0.8798	10	0.62326	D	0.03	.	10.034	0.42118	0.1132:0.5662:0.0:0.3206	.	1211	Q8TE60	ATS18_HUMAN	N	1211	ENSP00000282849:K1211N	ENSP00000282849:K1211N	K	-	3	2	ADAMTS18	75875387	0.971000	0.33674	0.096000	0.21009	0.553000	0.35397	0.141000	0.16076	-0.875000	0.04022	0.533000	0.62120	AAA		0.468	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
HRH4	59340	hgsc.bcm.edu	37	18	22056897	22056897	+	Nonsense_Mutation	SNP	G	G	T	rs377649493		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:22056897G>T	ENST00000256906.4	+	3	644	c.544G>T	c.(544-546)Gaa>Taa	p.E182*	HRH4_ENST00000426880.2_Nonsense_Mutation_p.E94*	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	182					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.E182*(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	ATCATTCTTGGAATTCGTGAT	0.428																																					p.E94X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G280T	18						.						231.0	215.0	220.0					18																	22056897		2203	4300	6503	20310895	SO:0001587	stop_gained	59340	exon2			AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.544G>T	18.37:g.22056897G>T	ENSP00000256906:p.Glu182*	Somatic		Capture	SOLID	Phase_I	20310895	NM_001143828	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Nonsense_Mutation	SNP	ENST00000256906.4	37	CCDS11887.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227154	0.79576	.	.	ENSG00000134489	ENST00000256906;ENST00000426880	.	.	.	5.66	5.66	0.87406	.	0.114454	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-17.7718	18.7291	0.91728	0.0:0.0:1.0:0.0	.	.	.	.	X	182;94	.	ENSP00000256906:E182X	E	+	1	0	HRH4	20310895	1.000000	0.71417	0.892000	0.35008	0.167000	0.22549	9.283000	0.95860	2.670000	0.90874	0.561000	0.74099	GAA		0.428	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254904.1		
ZNF521	25925	hgsc.bcm.edu	37	18	22930903	22930903	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:22930903C>T	ENST00000361524.3	-	2	156	c.8G>A	c.(7-9)cGc>cAc	p.R3H	ZNF521_ENST00000584787.1_Intron|ZNF521_ENST00000538137.2_Missense_Mutation_p.R3H|ZNF521_ENST00000579111.1_5'UTR	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	3					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.R3H(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TTGCTTGCGGCGAGACATCCT	0.602			T	PAX5	ALL																																p.R3H			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8A	18						.						58.0	58.0	58.0					18																	22930903		2159	4217	6376	21184901	SO:0001583	missense	25925	exon2			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.8G>A	18.37:g.22930903C>T	ENSP00000354794:p.Arg3His	Somatic		Capture	SOLID	Phase_I	21184901	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.127980	0.37533	.	.	ENSG00000198795	ENST00000361524	T	0.10288	2.89	4.52	3.65	0.41850	.	.	.	.	.	T	0.05731	0.0150	N	0.24115	0.695	0.35883	D	0.829075	P	0.40107	0.703	B	0.15484	0.013	T	0.37911	-0.9685	9	0.54805	T	0.06	-16.5223	10.9569	0.47362	0.0:0.9112:0.0:0.0888	.	3	Q96K83	ZN521_HUMAN	H	3	ENSP00000354794:R3H	ENSP00000354794:R3H	R	-	2	0	ZNF521	21184901	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.672000	0.74477	0.999000	0.39023	0.455000	0.32223	CGC		0.602	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
MOCOS	55034	hgsc.bcm.edu	37	18	33848614	33848614	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:33848614C>A	ENST00000261326.5	+	15	2654	c.2633C>A	c.(2632-2634)cCt>cAt	p.P878H		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase									p.P878H(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CATGATTTACCTGCATCTGAG	0.388																																					p.P878H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2633A	18						.						209.0	180.0	190.0					18																	33848614		2203	4300	6503	32102612	SO:0001583	missense	55034	exon15			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2633C>A	18.37:g.33848614C>A	ENSP00000261326:p.Pro878His	Somatic		Capture	SOLID	Phase_I	32102612	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973433	0.53614	.	.	ENSG00000075643	ENST00000261326	T	0.16743	2.32	5.59	2.67	0.31697	.	0.646613	0.15147	N	0.277927	T	0.15565	0.0375	L	0.47716	1.5	0.09310	N	1	P	0.52170	0.951	B	0.44163	0.443	T	0.14035	-1.0487	10	0.66056	D	0.02	-2.6368	4.8794	0.13672	0.152:0.6163:0.1476:0.0841	.	878	Q96EN8	MOCOS_HUMAN	H	878	ENSP00000261326:P878H	ENSP00000261326:P878H	P	+	2	0	MOCOS	32102612	0.029000	0.19370	0.004000	0.12327	0.103000	0.19146	1.023000	0.30065	0.840000	0.34995	0.650000	0.86243	CCT		0.388	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
EPB41L3	23136	hgsc.bcm.edu	37	18	5433911	5433911	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:5433911T>C	ENST00000341928.2	-	7	1155	c.815A>G	c.(814-816)aAg>aGg	p.K272R	EPB41L3_ENST00000540638.2_Missense_Mutation_p.K272R|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000544123.1_Missense_Mutation_p.K272R|EPB41L3_ENST00000400111.3_Missense_Mutation_p.K272R|EPB41L3_ENST00000342933.3_Missense_Mutation_p.K272R	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	272	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.K272R(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CCTGTGGCTCTTGTGCAGCTC	0.483																																					p.K272R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A815G	18						.						274.0	240.0	251.0					18																	5433911		2203	4300	6503	5423911	SO:0001583	missense	23136	exon7			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.815A>G	18.37:g.5433911T>C	ENSP00000343158:p.Lys272Arg	Somatic		Capture	SOLID	Phase_I	5423911	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171247	0.78452	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	6.16	6.16	0.99307	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.82962	0.5151	L	0.35723	1.085	0.80722	D	1	D;B;B;P;B	0.56968	0.978;0.197;0.126;0.5;0.303	D;B;B;B;P	0.69142	0.962;0.092;0.082;0.088;0.447	T	0.82822	-0.0267	10	0.45353	T	0.12	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	272;272;163;272;272	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	R	272;163;272;163;272;272	ENSP00000343158:K272R;ENSP00000441174:K272R;ENSP00000341138:K272R;ENSP00000382981:K272R	ENSP00000343158:K272R	K	-	2	0	EPB41L3	5423911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.117000	0.57877	2.367000	0.80283	0.528000	0.53228	AAG		0.483	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
FHOD3	80206	hgsc.bcm.edu	37	18	34298520	34298520	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:34298520C>T	ENST00000359247.4	+	15	2683	c.2683C>T	c.(2683-2685)Cgt>Tgt	p.R895C	FHOD3_ENST00000257209.4_Missense_Mutation_p.R912C|FHOD3_ENST00000445677.1_Missense_Mutation_p.R874C|FHOD3_ENST00000592128.1_5'UTR|FHOD3_ENST00000591635.1_Missense_Mutation_p.R108C|FHOD3_ENST00000590592.1_Missense_Mutation_p.R1087C	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	895	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.R912C(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GAAGACCATCCGTTTGTTCTG	0.502																																					p.R912C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2734T	18						.						117.0	110.0	112.0					18																	34298520		2203	4300	6503	32552518	SO:0001583	missense	80206	exon16			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2683C>T	18.37:g.34298520C>T	ENSP00000352186:p.Arg895Cys	Somatic		Capture	SOLID	Phase_I	32552518	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	C	22.0	4.225922	0.79576	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.19105	2.17;2.17;2.17	4.46	4.46	0.54185	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.962	T	0.53387	-0.8446	10	0.87932	D	0	.	15.6858	0.77409	0.0:1.0:0.0:0.0	.	874;895;912	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	C	912;895;874	ENSP00000257209:R912C;ENSP00000352186:R895C;ENSP00000411430:R874C	ENSP00000257209:R912C	R	+	1	0	FHOD3	32552518	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.937000	0.70162	2.034000	0.60081	0.555000	0.69702	CGT		0.502	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
ALPK2	115701	hgsc.bcm.edu	37	18	56202302	56202302	+	Missense_Mutation	SNP	G	G	A	rs149829322		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:56202302G>A	ENST00000361673.3	-	5	5330	c.5117C>T	c.(5116-5118)aCg>aTg	p.T1706M	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1706						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T1067M(1)|p.T1706M(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CTCTGACCCCGTCACTGCTGT	0.567																																					p.T1706M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5117T	18						.	A	MET/THR	1,4405	2.1+/-5.4	0,1,2202	80.0	80.0	80.0		5117	-0.3	0.0	18	dbSNP_134	80	0,8600		0,0,4300	no	missense	ALPK2	NM_052947.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	1706/2171	56202302	1,13005	2203	4300	6503	54353282	SO:0001583	missense	115701	exon5			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5117C>T	18.37:g.56202302G>A	ENSP00000354991:p.Thr1706Met	Somatic		Capture	SOLID	Phase_I	54353282	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	g	7.306	0.613978	0.14066	2.27E-4	0.0	ENSG00000198796	ENST00000361673	T	0.48836	0.8	4.65	-0.297	0.12820	.	3.945630	0.00166	N	0.000016	T	0.35711	0.0941	L	0.33485	1.01	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.001	T	0.07139	-1.0788	10	0.23302	T	0.38	3.9142	5.3221	0.15887	0.3306:0.146:0.5234:0.0	.	1701;1706	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	M	1706	ENSP00000354991:T1706M	ENSP00000354991:T1706M	T	-	2	0	ALPK2	54353282	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.103000	0.10940	-0.190000	0.10465	-0.119000	0.15052	ACG		0.567	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
SERPINB4	6318	hgsc.bcm.edu	37	18	61305070	61305070	+	Silent	SNP	G	G	A	rs184695104|rs386804122		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:61305070G>A	ENST00000341074.5	-	8	1171	c.1056C>T	c.(1054-1056)gtC>gtT	p.V352V	SERPINB4_ENST00000356424.6_Silent_p.V300V	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	352					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V352V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						ATGATAATTCGACTACTACTA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		20597	0.001		0.0	False		,,,				2504	0.0				p.V352V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1056T	18						.						123.0	117.0	119.0					18																	61305070		2203	4300	6503	59456050	SO:0001819	synonymous_variant	6318	exon8			X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.1056C>T	18.37:g.61305070G>A		Somatic		Capture	SOLID	Phase_I	59456050	NM_002974	A8K847	Silent	SNP	ENST00000341074.5	37	CCDS11986.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.729	-0.780579	0.02929	.	.	ENSG00000206073	ENST00000413673	.	.	.	0.591	-0.994	0.10225	.	.	.	.	.	T	0.23766	0.0575	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28299	-1.0048	3	.	.	.	.	.	.	.	.	.	.	.	L	333	.	.	S	-	2	0	SERPINB4	59456050	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.089000	0.15002	-0.327000	0.08551	0.089000	0.15464	TCG		0.463	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041	
CDH19	28513	hgsc.bcm.edu	37	18	64172243	64172243	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr18:64172243C>T	ENST00000262150.2	-	12	2417	c.2125G>A	c.(2125-2127)Gat>Aat	p.D709N		NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D709N(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				GCACACGGATCAGTATTAGCT	0.498																																					p.D709N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2125A	18						.						136.0	130.0	132.0					18																	64172243		2203	4300	6503	62323223	SO:0001583	missense	28513	exon12			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.2125G>A	18.37:g.64172243C>T	ENSP00000262150:p.Asp709Asn	Somatic		Capture	SOLID	Phase_I	62323223	NM_021153	O15098	Missense_Mutation	SNP	ENST00000262150.2	37	CCDS11994.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716727	0.89205	.	.	ENSG00000071991	ENST00000262150	T	0.80033	-1.33	5.19	5.19	0.71726	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.92054	0.7482	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93476	0.6823	10	0.72032	D	0.01	.	19.0889	0.93217	0.0:1.0:0.0:0.0	.	709	Q9H159	CAD19_HUMAN	N	709	ENSP00000262150:D709N	ENSP00000262150:D709N	D	-	1	0	CDH19	62323223	1.000000	0.71417	0.485000	0.27403	0.852000	0.48524	5.508000	0.67006	2.569000	0.86673	0.655000	0.94253	GAT		0.498	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153	
CMSS1	84319	hgsc.bcm.edu	37	3	99885227	99885227	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:99885227A>G	ENST00000421999.2	+	5	550	c.404A>G	c.(403-405)tAc>tGc	p.Y135C	CMSS1_ENST00000489081.1_Missense_Mutation_p.Y117C	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)	135							poly(A) RNA binding (GO:0044822)	p.Y135C(1)									CTTTCCTCATACCTAAAAGAA	0.308																																					p.Y117C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A350G	3						.						91.0	92.0	92.0					3																	99885227		2202	4300	6502	101367917	SO:0001583	missense	84319	exon5				CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.404A>G	3.37:g.99885227A>G	ENSP00000410396:p.Tyr135Cys	Somatic		Capture	SOLID	Phase_I	101367917	NM_001167924	A8K5S7|B4DUM1|E9PHS3	Missense_Mutation	SNP	ENST00000421999.2	37	CCDS2935.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.44|18.44	3.623499|3.623499	0.66901|0.66901	.|.	.|.	ENSG00000184220|ENSG00000184220	ENST00000497345|ENST00000421999;ENST00000489081;ENST00000478909	.|T;T;T	.|0.39592	.|1.07;1.07;1.07	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.055193	.|0.85682	.|D	.|0.000000	T|T	0.64338|0.64338	0.2589|0.2589	M|M	0.73962|0.73962	2.25|2.25	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.65809|0.65809	-0.6078|-0.6078	5|9	.|.	.|.	.|.	.|.	14.6055|14.6055	0.68475|0.68475	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|135	.|Q9BQ75	.|CC026_HUMAN	M|C	43|135;117;91	.|ENSP00000410396:Y135C;ENSP00000419161:Y117C;ENSP00000417293:Y91C	.|.	I|Y	+|+	3|2	3|0	C3orf26|C3orf26	101367917|101367917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.496000|5.496000	0.66918|0.66918	2.125000|2.125000	0.65367|0.65367	0.533000|0.533000	0.62120|0.62120	ATA|TAC		0.308	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353060.1	NM_032359	
CEP97	79598	hgsc.bcm.edu	37	3	101451395	101451395	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:101451395A>G	ENST00000341893.3	+	6	1377	c.625A>G	c.(625-627)Atg>Gtg	p.M209V	CEP97_ENST00000327230.4_Missense_Mutation_p.M209V|CEP97_ENST00000494050.1_Missense_Mutation_p.M209V			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	209					cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)		p.M209V(1)		cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						TCCTTGTGTGATGGCAACACC	0.418																																					p.M209V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A625G	3						.						154.0	139.0	144.0					3																	101451395		2203	4300	6503	102934085	SO:0001583	missense	79598	exon6			AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.625A>G	3.37:g.101451395A>G	ENSP00000342510:p.Met209Val	Somatic		Capture	SOLID	Phase_I	102934085	NM_024548	B5MDY8|Q8NA71|Q9H5T9	Missense_Mutation	SNP	ENST00000341893.3	37	CCDS2944.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918534	0.52546	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	T;T;T	0.53423	1.91;1.91;0.62	5.82	5.82	0.92795	.	0.075745	0.85682	D	0.000000	T	0.43478	0.1249	L	0.41236	1.265	0.37902	D	0.931066	P;P;P	0.45428	0.858;0.594;0.459	B;B;B	0.41666	0.271;0.363;0.142	T	0.49995	-0.8879	10	0.46703	T	0.11	-16.6315	16.19	0.81981	1.0:0.0:0.0:0.0	.	209;209;209	E9PG22;Q8IW35-2;Q8IW35	.;.;CEP97_HUMAN	V	209	ENSP00000342510:M209V;ENSP00000325881:M209V;ENSP00000418185:M209V	ENSP00000325881:M209V	M	+	1	0	CEP97	102934085	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.924000	0.70054	2.225000	0.72522	0.460000	0.39030	ATG		0.418	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548	
CD96	10225	hgsc.bcm.edu	37	3	111264057	111264057	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:111264057G>A	ENST00000283285.5	+	2	357	c.226G>A	c.(226-228)Ggc>Agc	p.G76S	CD96_ENST00000438817.2_Missense_Mutation_p.G76S|CD96_ENST00000352690.4_Missense_Mutation_p.G76S	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	76	Ig-like V-type 1.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.G76S(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						TCCCCAATACGGCTTCTACTG	0.473									Opitz Trigonocephaly syndrome																												p.G76S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G226A	3						.						175.0	136.0	149.0					3																	111264057		2203	4300	6503	112746747	SO:0001583	missense	10225	exon2	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.226G>A	3.37:g.111264057G>A	ENSP00000283285:p.Gly76Ser	Somatic		Capture	SOLID	Phase_I	112746747	NM_005816	Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	37	CCDS2959.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373712	0.42105	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.27720	1.65;1.65;1.65	5.23	4.36	0.52297	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.48804	0.1520	M	0.72894	2.215	0.24566	N	0.993941	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;P;D;D	0.64237	0.923;0.873;0.923;0.923	T	0.40646	-0.9552	10	0.54805	T	0.06	-6.1649	9.6476	0.39877	0.0973:0.0:0.9027:0.0	.	76;76;76;76	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	S	76	ENSP00000342040:G76S;ENSP00000283285:G76S;ENSP00000389801:G76S	ENSP00000283285:G76S	G	+	1	0	CD96	112746747	0.998000	0.40836	0.131000	0.22000	0.018000	0.09664	4.769000	0.62300	1.196000	0.43129	0.609000	0.83330	GGC		0.473	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2		
PHLDB2	90102	hgsc.bcm.edu	37	3	111688735	111688735	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:111688735C>T	ENST00000431670.2	+	16	3925	c.3514C>T	c.(3514-3516)Cga>Tga	p.R1172*	PHLDB2_ENST00000481953.1_Nonsense_Mutation_p.R1129*|PHLDB2_ENST00000412622.1_Nonsense_Mutation_p.R1129*|PHLDB2_ENST00000495180.1_Nonsense_Mutation_p.R663*|PHLDB2_ENST00000393923.3_Nonsense_Mutation_p.R1156*|PHLDB2_ENST00000393925.3_Nonsense_Mutation_p.R1172*	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	1172	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.R1129*(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TCGGAACAAGCGAACATTCTC	0.378																																					p.R1172X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3514T	3						.						134.0	138.0	136.0					3																	111688735		2203	4300	6503	113171425	SO:0001587	stop_gained	90102	exon16				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.3514C>T	3.37:g.111688735C>T	ENSP00000405405:p.Arg1172*	Somatic		Capture	SOLID	Phase_I	113171425	NM_001134439	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Nonsense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	C	42	9.528564	0.99196	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000393925;ENST00000481953;ENST00000495180	.	.	.	5.09	3.24	0.37175	.	0.058148	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4431	0.55635	0.4279:0.5721:0.0:0.0	.	.	.	.	X	1156;1172;1129;1172;1129;663	.	ENSP00000377500:R1156X	R	+	1	2	PHLDB2	113171425	0.369000	0.25039	0.999000	0.59377	0.992000	0.81027	0.065000	0.14466	0.683000	0.31428	0.585000	0.79938	CGA		0.378	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
SIDT1	54847	hgsc.bcm.edu	37	3	113342542	113342542	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:113342542G>A	ENST00000264852.4	+	23	2995	c.2269G>A	c.(2269-2271)Gcc>Acc	p.A757T	SIDT1_ENST00000393830.3_Missense_Mutation_p.A762T|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	757					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.A757T(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						GTGGGCTGCCGCCCTATATTT	0.537																																					p.A757T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2269A	3						.						83.0	87.0	86.0					3																	113342542		2203	4300	6503	114825232	SO:0001583	missense	54847	exon23			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.2269G>A	3.37:g.113342542G>A	ENSP00000264852:p.Ala757Thr	Somatic		Capture	SOLID	Phase_I	114825232	NM_017699	Q17RR4	Missense_Mutation	SNP	ENST00000264852.4	37	CCDS2974.1	.	.	.	.	.	.	.	.	.	.	G	35	5.418354	0.96092	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.37058	1.22;1.22	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000002	T	0.66287	0.2774	M	0.88775	2.98	0.80722	D	1	D;D	0.65815	0.994;0.995	P;D	0.63597	0.863;0.916	T	0.72527	-0.4266	10	0.87932	D	0	-19.5521	18.6103	0.91283	0.0:0.0:1.0:0.0	.	762;757	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	T	757;762	ENSP00000264852:A757T;ENSP00000377416:A762T	ENSP00000264852:A757T	A	+	1	0	SIDT1	114825232	1.000000	0.71417	0.960000	0.40013	0.845000	0.48019	7.146000	0.77373	2.695000	0.91970	0.561000	0.74099	GCC		0.537	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	
FSTL1	11167	hgsc.bcm.edu	37	3	120134820	120134820	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:120134820G>A	ENST00000295633.3	-	3	474	c.118C>T	c.(118-120)Cgg>Tgg	p.R40W	FSTL1_ENST00000424703.2_Intron	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	40	Follistatin-like.				BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R40W(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		GCACATTCCCGGCCGGCTCCA	0.507																																					p.R40W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C118T	3						.						142.0	138.0	139.0					3																	120134820		2203	4300	6503	121617510	SO:0001583	missense	11167	exon3			U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.118C>T	3.37:g.120134820G>A	ENSP00000295633:p.Arg40Trp	Somatic		Capture	SOLID	Phase_I	121617510	NM_007085	A8K523|B4DTT5|D3DN90|Q549Z0	Missense_Mutation	SNP	ENST00000295633.3	37	CCDS2998.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041487	0.75732	.	.	ENSG00000163430	ENST00000295633;ENST00000469005	T;T	0.63913	-0.07;-0.07	6.17	4.36	0.52297	Follistatin-like, N-terminal (1);Follistatin/Osteonectin EGF domain (1);	0.000000	0.85682	D	0.000000	T	0.81123	0.4757	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.84080	0.0384	10	0.87932	D	0	-21.3079	13.9806	0.64301	0.0:0.0:0.605:0.395	.	40;40	A8K523;Q12841	.;FSTL1_HUMAN	W	40	ENSP00000295633:R40W;ENSP00000418505:R40W	ENSP00000295633:R40W	R	-	1	2	FSTL1	121617510	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.278000	0.51662	0.899000	0.36444	0.655000	0.94253	CGG		0.507	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355399.1	NM_007085	
GTF2E1	2960	hgsc.bcm.edu	37	3	120500197	120500197	+	Silent	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:120500197C>A	ENST00000283875.5	+	5	1293	c.1200C>A	c.(1198-1200)ggC>ggA	p.G400G		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	400					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.G400G(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		TGGTGGCTGGCCGTCCGTTCT	0.522																																					p.G400G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1200A	3						.						149.0	147.0	148.0					3																	120500197		2203	4300	6503	121982887	SO:0001819	synonymous_variant	2960	exon5			S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.1200C>A	3.37:g.120500197C>A		Somatic		Capture	SOLID	Phase_I	121982887	NM_005513	Q16103	Silent	SNP	ENST00000283875.5	37	CCDS3002.1																																																																																				0.522	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513	
TSEN2	80746	hgsc.bcm.edu	37	3	12560684	12560684	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:12560684G>A	ENST00000284995.6	+	8	1474	c.1087G>A	c.(1087-1089)Ggg>Agg	p.G363R	TSEN2_ENST00000415684.1_Missense_Mutation_p.G337R|TSEN2_ENST00000454502.2_Missense_Mutation_p.G304R|TSEN2_ENST00000444864.1_Missense_Mutation_p.G337R|TSEN2_ENST00000314571.7_Missense_Mutation_p.G337R|TSEN2_ENST00000383797.5_Missense_Mutation_p.G346R|TSEN2_ENST00000402228.3_Missense_Mutation_p.G363R|C3orf83_ENST00000567514.1_Intron	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	363					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)	p.G363R(1)		central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						ACTCAAGTACGGGACAGATTT	0.443																																					p.G363R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1087A	3						.						109.0	102.0	104.0					3																	12560684		2203	4300	6503	12535684	SO:0001583	missense	80746	exon8			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.1087G>A	3.37:g.12560684G>A	ENSP00000284995:p.Gly363Arg	Somatic		Capture	SOLID	Phase_I	12535684	NM_025265	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	ENST00000284995.6	37	CCDS2611.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659850	0.88154	.	.	ENSG00000154743	ENST00000446004;ENST00000314571;ENST00000454502;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T;T	0.73897	-0.79;-0.61;-0.63;-0.64;-0.74;-0.74;-0.63;-0.61	5.39	5.39	0.77823	tRNA intron endonuclease, catalytic domain-like (2);Endonuclease TnsA, N-terminal/resolvase Hjc/tRNA endonuclease, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90463	0.7013	H	0.94183	3.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	D	0.92916	0.6351	10	0.87932	D	0	-36.7966	18.7846	0.91949	0.0:0.0:1.0:0.0	.	337;363;337;304	G5E9Q3;Q8NCE0;Q8NCE0-3;C9IZI7	.;SEN2_HUMAN;.;.	R	363;337;304;346;363;363;337;336;337	ENSP00000406238:G363R;ENSP00000323188:G337R;ENSP00000392029:G304R;ENSP00000373307:G346R;ENSP00000385976:G363R;ENSP00000284995:G363R;ENSP00000407974:G337R;ENSP00000416510:G337R	ENSP00000284995:G363R	G	+	1	0	TSEN2	12535684	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	6.484000	0.73621	2.526000	0.85167	0.563000	0.77884	GGG		0.443	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251981.1	NM_025265	
PARP15	165631	hgsc.bcm.edu	37	3	122351032	122351032	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:122351032T>C	ENST00000464300.2	+	10	1604	c.1538T>C	c.(1537-1539)tTc>tCc	p.F513S	PARP15_ENST00000493645.1_Missense_Mutation_p.F210S|PARP15_ENST00000465304.1_3'UTR|PARP15_ENST00000483793.1_Missense_Mutation_p.F318S|PARP15_ENST00000310366.4_Missense_Mutation_p.F279S	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	513	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		AAGGACAAGTTCACCCGAACT	0.368																																					p.F279S												.	.	0			c.T836C	3						.						82.0	78.0	79.0					3																	122351032		2203	4300	6503	123833722	SO:0001583	missense	165631	exon6			AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.1538T>C	3.37:g.122351032T>C	ENSP00000417214:p.Phe513Ser	Somatic		Capture	SOLID	Phase_I	123833722	NM_152615	J3KR47|Q8N1K3	Missense_Mutation	SNP	ENST00000464300.2	37	CCDS46893.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.101227	0.56183	.	.	ENSG00000173200	ENST00000464300;ENST00000483793;ENST00000542823;ENST00000310366;ENST00000493645	T;T;T;T	0.15256	2.44;2.44;2.44;2.44	3.77	3.77	0.43336	Poly(ADP-ribose) polymerase, catalytic domain (2);	.	.	.	.	T	0.54303	0.1850	H	0.97023	3.925	0.30329	N	0.786805	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.998	D;D;D;D;D	0.97110	1.0;0.995;1.0;0.999;0.993	T	0.64063	-0.6495	9	0.62326	D	0.03	.	11.4728	0.50280	0.0:0.0:0.0:1.0	.	210;279;260;318;491	B7ZL48;Q460N3-2;F5H8I1;C9J7L3;Q460N3	.;.;.;.;PAR15_HUMAN	S	513;318;260;279;210	ENSP00000417214:F513S;ENSP00000417785:F318S;ENSP00000308436:F279S;ENSP00000419488:F210S	ENSP00000308436:F279S	F	+	2	0	PARP15	123833722	0.998000	0.40836	0.074000	0.20217	0.124000	0.20399	4.081000	0.57627	1.589000	0.49982	0.533000	0.62120	TTC		0.368	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	NM_152615	
ABTB1	80325	hgsc.bcm.edu	37	3	127396675	127396675	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:127396675G>A	ENST00000232744.8	+	10	1104	c.1018G>A	c.(1018-1020)Gac>Aac	p.D340N	ABTB1_ENST00000468137.1_Missense_Mutation_p.D198N|ABTB1_ENST00000453791.2_Missense_Mutation_p.D198N|ABTB1_ENST00000393363.3_Missense_Mutation_p.D198N					ankyrin repeat and BTB (POZ) domain containing 1									p.D340N(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						CATGTACAGCGACCACACTGA	0.657																																					p.D340N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1018A	3						.						32.0	31.0	31.0					3																	127396675		2203	4300	6503	128879365	SO:0001583	missense	80325	exon10			AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.1018G>A	3.37:g.127396675G>A	ENSP00000232744:p.Asp340Asn	Somatic		Capture	SOLID	Phase_I	128879365	NM_172027		Missense_Mutation	SNP	ENST00000232744.8	37	CCDS3045.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065382	0.55432	.	.	ENSG00000114626	ENST00000361019;ENST00000393363;ENST00000232744;ENST00000453791;ENST00000468137	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.17	4.3	0.51218	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.046186	0.85682	N	0.000000	T	0.29524	0.0736	M	0.75884	2.315	0.80722	D	1	P;B;P	0.47409	0.895;0.184;0.487	B;B;B	0.38712	0.28;0.076;0.062	T	0.20306	-1.0279	10	0.51188	T	0.08	-5.576	13.665	0.62389	0.0748:0.0:0.9252:0.0	.	176;340;315	C9JBQ0;Q969K4;Q969K4-3	.;ABTB1_HUMAN;.	N	176;198;340;198;198	ENSP00000377030:D198N;ENSP00000232744:D340N;ENSP00000412684:D198N;ENSP00000417366:D198N	ENSP00000232744:D340N	D	+	1	0	ABTB1	128879365	1.000000	0.71417	0.980000	0.43619	0.954000	0.61252	7.882000	0.87258	1.164000	0.42652	0.591000	0.81541	GAC		0.657	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356595.1	NM_172027	
GATA2	2624	hgsc.bcm.edu	37	3	128202738	128202738	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:128202738G>A	ENST00000341105.2	-	4	1313	c.982C>T	c.(982-984)Cag>Tag	p.Q328*	GATA2_ENST00000487848.1_Nonsense_Mutation_p.Q328*|GATA2_ENST00000430265.2_Nonsense_Mutation_p.Q328*|GATA2_ENST00000489987.1_5'Flank	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	328					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Q328*(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		GGTCGGTTCTGCCCATTCATC	0.637			Mis		AML(CML blast transformation)																																p.Q328X			Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C982T	3						.						91.0	76.0	81.0					3																	128202738		2203	4300	6503	129685428	SO:0001587	stop_gained	2624	exon4			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.982C>T	3.37:g.128202738G>A	ENSP00000345681:p.Gln328*	Somatic		Capture	SOLID	Phase_I	129685428	NM_032638	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Nonsense_Mutation	SNP	ENST00000341105.2	37	CCDS3049.1	.	.	.	.	.	.	.	.	.	.	G	41	9.064123	0.99053	.	.	ENSG00000179348	ENST00000341105;ENST00000430265;ENST00000487848	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.9832	18.6153	0.91300	0.0:0.0:1.0:0.0	.	.	.	.	X	328	.	ENSP00000345681:Q328X	Q	-	1	0	GATA2	129685428	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.854000	0.99522	2.388000	0.81334	0.491000	0.48974	CAG		0.637	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1	NM_032638	
ACAD9	28976	hgsc.bcm.edu	37	3	128614203	128614203	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:128614203A>G	ENST00000308982.7	+	4	478	c.397A>G	c.(397-399)Agc>Ggc	p.S133G		NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	133						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.S133G(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						GGAGATCATCAGCATGGATGG	0.562																																					p.S133G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A397G	3						.						122.0	97.0	105.0					3																	128614203		2203	4300	6503	130096893	SO:0001583	missense	28976	exon4			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.397A>G	3.37:g.128614203A>G	ENSP00000312618:p.Ser133Gly	Somatic		Capture	SOLID	Phase_I	130096893	NM_014049	D3DNB8|Q8WXX3	Missense_Mutation	SNP	ENST00000308982.7	37	CCDS3053.1	.	.	.	.	.	.	.	.	.	.	A	0.059	-1.228002	0.01518	.	.	ENSG00000177646	ENST00000308982;ENST00000514336	D;D	0.99683	-6.39;-6.39	5.46	-8.83	0.00806	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.462473	0.26470	N	0.024195	D	0.96426	0.8834	N	0.16368	0.405	0.30927	N	0.727322	B;B	0.10296	0.0;0.003	B;B	0.11329	0.0;0.006	D	0.92047	0.5645	10	0.02654	T	1	.	10.9571	0.47364	0.1938:0.0:0.6352:0.171	.	10;133	Q9H9W4;Q9H845	.;ACAD9_HUMAN	G	133;145	ENSP00000312618:S133G;ENSP00000423758:S145G	ENSP00000312618:S133G	S	+	1	0	ACAD9	130096893	0.014000	0.17966	0.000000	0.03702	0.058000	0.15608	0.227000	0.17795	-1.150000	0.02840	-0.256000	0.11100	AGC		0.562	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049	
ACAD9	28976	hgsc.bcm.edu	37	3	128629584	128629584	+	Splice_Site	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:128629584G>A	ENST00000308982.7	+	17	1774	c.1693G>A	c.(1693-1695)Gtt>Att	p.V565I	RP11-723O4.6_ENST00000508239.1_Intron|KIAA1257_ENST00000511438.1_Intron|ACAD9_ENST00000511526.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	565						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.V565I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						GTTCTGGCAGGTTCTCTTGGC	0.517																																					p.V565I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1693A	3						.						172.0	174.0	173.0					3																	128629584		2203	4300	6503	130112274	SO:0001630	splice_region_variant	28976	exon17			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.1693-1G>A	3.37:g.128629584G>A		Somatic		Capture	SOLID	Phase_I	130112274	NM_014049	D3DNB8|Q8WXX3	Missense_Mutation	SNP	ENST00000308982.7	37	CCDS3053.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.374|8.374	0.836033|0.836033	0.16891|0.16891	.|.	.|.	ENSG00000177646|ENSG00000177646	ENST00000406840|ENST00000308982;ENST00000334167	.|D	.|0.88124	.|-2.34	5.0|5.0	1.04|1.04	0.20106|0.20106	.|.	.|0.115644	.|0.64402	.|N	.|0.000017	T|T	0.74366|0.74366	0.3707|0.3707	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.10450	.|0.005	T|T	0.57831|0.57831	-0.7743|-0.7743	5|9	.|.	.|.	.|.	.|.	4.8301|4.8301	0.13435|0.13435	0.257:0.0:0.5915:0.1515|0.257:0.0:0.5915:0.1515	.|.	.|565	.|Q9H845	.|ACAD9_HUMAN	D|I	41|565;432	.|ENSP00000312618:V565I	.|.	G|V	+|+	2|1	0|0	ACAD9|ACAD9	130112274|130112274	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.373000|0.373000	0.29922|0.29922	2.151000|2.151000	0.42263|0.42263	0.204000|0.204000	0.20548|0.20548	-0.244000|-0.244000	0.11960|0.11960	GGT|GTT		0.517	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049	Missense_Mutation
RHO	6010	hgsc.bcm.edu	37	3	129251531	129251531	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:129251531T>C	ENST00000296271.3	+	4	946	c.852T>C	c.(850-852)ggT>ggC	p.G284G		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	284					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)	p.G284G(1)		breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	CCAACTTCGGTCCCATCTTCA	0.552																																					p.G284G	Esophageal Squamous(118;214 1623 30842 43234 46940)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T852C	3						.						190.0	160.0	170.0					3																	129251531		2203	4300	6503	130734221	SO:0001819	synonymous_variant	6010	exon4			AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.852T>C	3.37:g.129251531T>C		Somatic		Capture	SOLID	Phase_I	130734221	NM_000539	Q16414|Q2M249	Silent	SNP	ENST00000296271.3	37	CCDS3063.1																																																																																				0.552	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539	
CNTN6	27255	hgsc.bcm.edu	37	3	1337479	1337479	+	Missense_Mutation	SNP	C	C	T	rs137989555	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:1337479C>T	ENST00000446702.2	+	6	1276	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	CNTN6_ENST00000350110.2_Missense_Mutation_p.R217C|CNTN6_ENST00000539053.1_Missense_Mutation_p.R145C			Q9UQ52	CNTN6_HUMAN	contactin 6	217					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R217C(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		ATTAGTGCAGCGCACTGATGG	0.438													C|||	3	0.000599042	0.0	0.0	5008	,	,		18746	0.003		0.0	False		,,,				2504	0.0				p.R217C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C649T	3						.	C	CYS/ARG	0,4406		0,0,2203	62.0	58.0	59.0		649	5.9	1.0	3	dbSNP_134	59	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CNTN6	NM_014461.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	217/1029	1337479	1,13005	2203	4300	6503	1312479	SO:0001583	missense	27255	exon6			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.649C>T	3.37:g.1337479C>T	ENSP00000407822:p.Arg217Cys	Somatic		Capture	SOLID	Phase_I	1312479	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	37	CCDS2557.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	25.0	4.588461	0.86851	0.0	1.16E-4	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.62788	0.0;0.0;0.0	5.95	5.95	0.96441	Immunoglobulin subtype (1);	0.000000	0.64402	D	0.000020	T	0.79305	0.4423	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.979	T	0.81573	-0.0871	10	0.40728	T	0.16	.	19.9648	0.97261	0.0:1.0:0.0:0.0	.	145;217	B4DGV0;Q9UQ52	.;CNTN6_HUMAN	C	217;145;217	ENSP00000407822:R217C;ENSP00000442791:R145C;ENSP00000341882:R217C	ENSP00000341882:R217C	R	+	1	0	CNTN6	1312479	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.701000	0.47094	2.811000	0.96726	0.655000	0.94253	CGC		0.438	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
TMCC1	23023	hgsc.bcm.edu	37	3	129373845	129373845	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:129373845G>A	ENST00000393238.3	-	5	1953	c.1613C>T	c.(1612-1614)gCg>gTg	p.A538V	TMCC1_ENST00000329333.5_Missense_Mutation_p.A359V|TMCC1_ENST00000432054.2_Missense_Mutation_p.A214V|TMCC1_ENST00000426664.2_Missense_Mutation_p.A424V	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	538						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A538V(2)	PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						GGACTGATACGCGATTTTTTC	0.423																																					p.A538V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1613T	3						.						155.0	153.0	154.0					3																	129373845		2203	4300	6503	130856535	SO:0001583	missense	23023	exon5			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1613C>T	3.37:g.129373845G>A	ENSP00000376930:p.Ala538Val	Somatic		Capture	SOLID	Phase_I	130856535	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	G	36	5.633708	0.96682	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333;ENST00000510323	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.69762	0.3147	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.995	T	0.68685	-0.5343	10	0.59425	D	0.04	-23.3768	20.394	0.98981	0.0:0.0:1.0:0.0	.	359;538	B4DE04;O94876	.;TMCC1_HUMAN	V	214;538;424;359;6	ENSP00000404711:A214V;ENSP00000376930:A538V;ENSP00000389892:A424V;ENSP00000327349:A359V;ENSP00000426180:A6V	ENSP00000327349:A359V	A	-	2	0	TMCC1	130856535	1.000000	0.71417	0.917000	0.36280	0.871000	0.50021	9.863000	0.99569	2.830000	0.97506	0.585000	0.79938	GCG		0.423	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
DBR1	51163	hgsc.bcm.edu	37	3	137882675	137882675	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:137882675C>T	ENST00000260803.4	-	6	893	c.740G>A	c.(739-741)aGa>aAa	p.R247K	DBR1_ENST00000505015.2_Missense_Mutation_p.R13K	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	247					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)	p.R247K(1)		NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TTTGGTTGCTCTGGCTGTCTG	0.363																																					p.R247K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G740A	3						.						122.0	115.0	118.0					3																	137882675		2202	4300	6502	139365365	SO:0001583	missense	51163	exon6			AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.740G>A	3.37:g.137882675C>T	ENSP00000260803:p.Arg247Lys	Somatic		Capture	SOLID	Phase_I	139365365	NM_016216	Q96GH0|Q9NXQ6	Missense_Mutation	SNP	ENST00000260803.4	37	CCDS33863.1	.	.	.	.	.	.	.	.	.	.	C	5.506	0.278382	0.10403	.	.	ENSG00000138231	ENST00000260803;ENST00000505015	T	0.37915	1.17	6.06	2.4	0.29515	Lariat debranching enzyme, C-terminal (1);	0.257136	0.38492	N	0.001677	T	0.08179	0.0204	N	0.00599	-1.345	0.23776	N	0.996874	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.003	T	0.39396	-0.9616	10	0.02654	T	1	-38.0713	7.3979	0.26946	0.0:0.2565:0.0:0.7435	.	247;15	Q9UK59;Q9UK59-2	DBR1_HUMAN;.	K	247;13	ENSP00000260803:R247K	ENSP00000260803:R247K	R	-	2	0	DBR1	139365365	1.000000	0.71417	0.977000	0.42913	0.929000	0.56500	1.119000	0.31258	0.178000	0.19917	-0.302000	0.09304	AGA		0.363	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357585.1		
CAPN7	23473	hgsc.bcm.edu	37	3	15288907	15288907	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:15288907T>C	ENST00000253693.2	+	19	2400	c.2147T>C	c.(2146-2148)aTc>aCc	p.I716T		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	716	Domain N.				positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)	p.I716T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						AATAACCCCATCTACCAATTC	0.358																																					p.I716T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2147C	3						.						86.0	87.0	87.0					3																	15288907		2203	4300	6503	15263911	SO:0001583	missense	23473	exon19			AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.2147T>C	3.37:g.15288907T>C	ENSP00000253693:p.Ile716Thr	Somatic		Capture	SOLID	Phase_I	15263911	NM_014296		Missense_Mutation	SNP	ENST00000253693.2	37	CCDS2624.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.944888	0.53079	.	.	ENSG00000131375	ENST00000253693	D	0.86627	-2.15	5.57	4.4	0.53042	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.046900	0.85682	D	0.000000	D	0.85745	0.5768	M	0.70595	2.14	0.54753	D	0.999982	P	0.39404	0.672	B	0.41946	0.371	T	0.82659	-0.0348	10	0.19147	T	0.46	-9.416	11.4878	0.50363	0.0:0.0724:0.0:0.9276	.	716	Q9Y6W3	CAN7_HUMAN	T	716	ENSP00000253693:I716T	ENSP00000253693:I716T	I	+	2	0	CAPN7	15263911	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.024000	0.64090	2.133000	0.65898	0.533000	0.62120	ATC		0.358	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296	
XRN1	54464	hgsc.bcm.edu	37	3	142142402	142142402	+	Splice_Site	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:142142402C>T	ENST00000264951.4	-	6	827	c.710G>A	c.(709-711)cGg>cAg	p.R237Q	XRN1_ENST00000463916.1_Splice_Site_p.R237Q|XRN1_ENST00000544157.1_Splice_Site_p.R27Q|XRN1_ENST00000392981.2_Splice_Site_p.R237Q	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	237					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R237Q(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TATAATTTACCGTTGTGTTTT	0.313																																					p.R237Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G710A	3						.						121.0	116.0	118.0					3																	142142402		2200	4295	6495	143625092	SO:0001630	splice_region_variant	54464	exon6			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.710+1G>A	3.37:g.142142402C>T		Somatic		Capture	SOLID	Phase_I	143625092	NM_019001	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.185535	0.57909	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157;ENST00000477237	T;T	0.33865	1.39;1.39	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.35740	0.0942	L	0.60455	1.87	0.80722	D	1	D;P;B;B;B	0.54601	0.967;0.754;0.021;0.009;0.071	B;B;B;B;B	0.38880	0.284;0.14;0.011;0.019;0.021	T	0.25502	-1.0130	9	.	.	.	-14.3843	17.6281	0.88098	0.0:1.0:0.0:0.0	.	27;237;98;237;237	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	Q	237;237;237;27;98	ENSP00000264951:R237Q;ENSP00000376707:R237Q	.	R	-	2	0	XRN1	143625092	1.000000	0.71417	1.000000	0.80357	0.224000	0.24922	5.644000	0.67902	2.609000	0.88269	0.460000	0.39030	CGG		0.313	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	Missense_Mutation
HACL1	26061	hgsc.bcm.edu	37	3	15624460	15624460	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:15624460C>T	ENST00000321169.5	-	8	958	c.591G>A	c.(589-591)atG>atA	p.M197I	HACL1_ENST00000456194.2_Missense_Mutation_p.M170I|HACL1_ENST00000435217.2_Intron|HACL1_ENST00000451445.2_Missense_Mutation_p.M115I|HACL1_ENST00000457447.2_Missense_Mutation_p.M171I	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	197					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)	p.M197I(1)		NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						AGGTTTCTGCCATGCTAATAG	0.413																																					p.M197I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G591A	3						.						66.0	63.0	64.0					3																	15624460		2203	4300	6503	15599464	SO:0001583	missense	26061	exon8			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.591G>A	3.37:g.15624460C>T	ENSP00000323811:p.Met197Ile	Somatic		Capture	SOLID	Phase_I	15599464	NM_012260	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	ENST00000321169.5	37	CCDS2627.1	.	.	.	.	.	.	.	.	.	.	C	8.117	0.780007	0.16120	.	.	ENSG00000131373	ENST00000321169;ENST00000451445;ENST00000456194;ENST00000457447;ENST00000421993;ENST00000414979	T;T;T;T	0.40756	1.59;1.59;1.58;1.02	5.45	5.45	0.79879	.	0.429185	0.26820	N	0.022333	T	0.26085	0.0636	N	0.17474	0.49	0.34631	D	0.719587	B;B;B;B	0.24483	0.104;0.004;0.01;0.004	B;B;B;B	0.18561	0.022;0.007;0.017;0.007	T	0.29088	-1.0023	10	0.24483	T	0.36	.	11.8759	0.52548	0.0:0.9185:0.0:0.0815	.	115;171;170;197	B4DXI5;E9PEN4;B4DWI1;Q9UJ83	.;.;.;HACL1_HUMAN	I	197;115;170;171;170;132	ENSP00000323811:M197I;ENSP00000403656:M115I;ENSP00000390699:M170I;ENSP00000404883:M171I	ENSP00000323811:M197I	M	-	3	0	HACL1	15599464	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	2.743000	0.47442	2.728000	0.93425	0.591000	0.81541	ATG		0.413	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252104.3	NM_012260	
IGSF10	285313	hgsc.bcm.edu	37	3	151166329	151166329	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:151166329A>G	ENST00000282466.3	-	4	1439	c.1440T>C	c.(1438-1440)aaT>aaC	p.N480N		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	480	Ig-like C2-type 1.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.N480N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCAGCTTAGTATTGTTATCCC	0.483																																					p.N480N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1440C	3						.						254.0	235.0	241.0					3																	151166329		2203	4300	6503	152649019	SO:0001819	synonymous_variant	285313	exon4			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.1440T>C	3.37:g.151166329A>G		Somatic		Capture	SOLID	Phase_I	152649019	NM_178822	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	CCDS3160.1																																																																																				0.483	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
RFTN1	23180	hgsc.bcm.edu	37	3	16450914	16450914	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:16450914C>A	ENST00000334133.4	-	4	681	c.409G>T	c.(409-411)Gac>Tac	p.D137Y	RFTN1_ENST00000432519.1_Missense_Mutation_p.D101Y	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	137					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)	p.D137Y(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						AGTTTCTGGTCTGTCGGGTGG	0.463																																					p.D137Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G409T	3						.						153.0	144.0	147.0					3																	16450914		2203	4300	6503	16425918	SO:0001583	missense	23180	exon4			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.409G>T	3.37:g.16450914C>A	ENSP00000334153:p.Asp137Tyr	Somatic		Capture	SOLID	Phase_I	16425918	NM_015150	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	37	CCDS33712.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734785	0.48939	.	.	ENSG00000131378	ENST00000432519;ENST00000334133;ENST00000451036;ENST00000449415;ENST00000441460	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	5.53	4.64	0.57946	.	0.392546	0.29924	N	0.010850	T	0.52948	0.1766	L	0.59436	1.845	0.43222	D	0.995109	D;P	0.76494	0.999;0.785	D;P	0.65874	0.939;0.509	T	0.54781	-0.8242	10	0.62326	D	0.03	-24.0931	12.3381	0.55079	0.0:0.83:0.17:0.0	.	101;137	G3XAJ6;Q14699	.;RFTN1_HUMAN	Y	101;137;137;137;137	ENSP00000403926:D101Y;ENSP00000334153:D137Y;ENSP00000403997:D137Y;ENSP00000409427:D137Y;ENSP00000388718:D137Y	ENSP00000334153:D137Y	D	-	1	0	RFTN1	16425918	0.961000	0.32948	0.992000	0.48379	0.348000	0.29142	2.647000	0.46639	1.312000	0.45043	0.655000	0.94253	GAC		0.463	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150	
GFM1	85476	hgsc.bcm.edu	37	3	158370019	158370019	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:158370019C>T	ENST00000486715.1	+	6	1181	c.824C>T	c.(823-825)tCg>tTg	p.S275L	GFM1_ENST00000264263.5_Missense_Mutation_p.S294L|GFM1_ENST00000478576.1_Missense_Mutation_p.S275L	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1									p.S275L(1)|p.S9L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			AAAATCCCCTCGATTTCTGAT	0.413																																					p.S275L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C824T	3						.						68.0	75.0	72.0					3																	158370019		2203	4300	6503	159852713	SO:0001583	missense	85476	exon6			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.824C>T	3.37:g.158370019C>T	ENSP00000419038:p.Ser275Leu	Somatic		Capture	SOLID	Phase_I	159852713	NM_024996		Missense_Mutation	SNP	ENST00000486715.1	37	CCDS33885.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430723	0.62844	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263;ENST00000312756	T;T;T	0.73152	-0.72;-0.72;-0.72	5.63	5.63	0.86233	Protein synthesis factor, GTP-binding (1);	0.134755	0.48767	D	0.000177	T	0.71384	0.3333	M	0.63169	1.94	0.80722	D	1	B;B;B	0.25312	0.101;0.07;0.123	B;B;B	0.24394	0.031;0.053;0.053	T	0.70019	-0.4987	10	0.87932	D	0	-12.2758	19.2887	0.94090	0.0:1.0:0.0:0.0	.	294;275;275	Q96RP9-2;Q96RP9;C9IZ01	.;EFGM_HUMAN;.	L	275;275;294;9	ENSP00000419038:S275L;ENSP00000418755:S275L;ENSP00000264263:S294L	ENSP00000264263:S294L	S	+	2	0	GFM1	159852713	0.999000	0.42202	0.918000	0.36340	0.991000	0.79684	4.381000	0.59587	2.665000	0.90641	0.655000	0.94253	TCG		0.413	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
WDR49	151790	hgsc.bcm.edu	37	3	167277908	167277908	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:167277908C>T	ENST00000308378.3	-	5	900	c.595G>A	c.(595-597)Gcc>Acc	p.A199T	WDR49_ENST00000453925.2_Missense_Mutation_p.A252T|WDR49_ENST00000479765.1_Intron|WDR49_ENST00000476376.1_Missense_Mutation_p.A24T	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	199								p.A199T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						GCATCAAGGGCCATAGTGCTG	0.463																																					p.A199T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G595A	3						.						183.0	166.0	172.0					3																	167277908		2203	4300	6503	168760602	SO:0001583	missense	151790	exon5			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.595G>A	3.37:g.167277908C>T	ENSP00000311343:p.Ala199Thr	Somatic		Capture	SOLID	Phase_I	168760602	NM_178824	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.417|8.417	0.845469|0.845469	0.16963|0.16963	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000308378;ENST00000476376;ENST00000453925;ENST00000466760|ENST00000472600	T;T;T;T|.	0.63744|.	-0.06;-0.06;-0.06;-0.06|.	4.94|4.94	4.05|4.05	0.47172|0.47172	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.171002|.	0.52532|.	N|.	0.000075|.	T|.	0.54095|.	0.1837|.	L|L	0.46741|0.46741	1.465|1.465	0.33633|0.33633	D|D	0.606338|0.606338	B;B|.	0.32409|.	0.37;0.207|.	B;B|.	0.34873|.	0.191;0.146|.	T|.	0.63928|.	-0.6526|.	10|.	0.32370|.	T|.	0.25|.	.|.	12.886|12.886	0.58045|0.58045	0.0:0.9179:0.0:0.0821|0.0:0.9179:0.0:0.0821	.|.	252;199|.	E7EQK3;Q8IV35|.	.;WDR49_HUMAN|.	T|X	199;24;252;92|263	ENSP00000311343:A199T;ENSP00000420508:A24T;ENSP00000410863:A252T;ENSP00000418718:A92T|.	ENSP00000311343:A199T|.	A|W	-|-	1|3	0|0	WDR49|WDR49	168760602|168760602	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.371000|0.371000	0.29859|0.29859	2.548000|2.548000	0.45794|0.45794	1.181000|1.181000	0.42912|0.42912	0.591000|0.591000	0.81541|0.81541	GCC|TGG		0.463	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
MECOM	2122	hgsc.bcm.edu	37	3	168807793	168807793	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:168807793T>C	ENST00000464456.1	-	13	4005	c.2805A>G	c.(2803-2805)ccA>ccG	p.P935P	MECOM_ENST00000494292.1_Silent_p.P1123P|MECOM_ENST00000433243.2_Silent_p.P945P|MECOM_ENST00000264674.3_Silent_p.P1009P|MECOM_ENST00000460814.1_Silent_p.P935P|MECOM_ENST00000468789.1_Silent_p.P944P|MECOM_ENST00000392736.3_Silent_p.P944P|MECOM_ENST00000472280.1_Silent_p.P945P	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P944P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						CTCACCTCACTGGGGATGTCT	0.423																																					p.P1009P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3027G	3						.						169.0	161.0	164.0					3																	168807793		2203	4300	6503	170290487	SO:0001819	synonymous_variant	2122	exon15			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2805A>G	3.37:g.168807793T>C		Somatic		Capture	SOLID	Phase_I	170290487	NM_001105077	Q13466|Q6FH90	Silent	SNP	ENST00000464456.1	37	CCDS54669.1																																																																																				0.423	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
EIF2B5	8893	hgsc.bcm.edu	37	3	183860047	183860047	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:183860047C>T	ENST00000273783.3	+	9	1447	c.1325C>T	c.(1324-1326)aCg>aTg	p.T442M	EIF2B5_ENST00000444495.1_Missense_Mutation_p.T442M	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	442					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.T442M(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CCAAATATCACGCTGCCTGAG	0.483																																					p.T442M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1325T	3						.						85.0	73.0	77.0					3																	183860047		2203	4300	6503	185342741	SO:0001583	missense	8893	exon9			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.1325C>T	3.37:g.183860047C>T	ENSP00000273783:p.Thr442Met	Somatic		Capture	SOLID	Phase_I	185342741	NM_003907	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	c	2.489	-0.317967	0.05386	.	.	ENSG00000145191	ENST00000273783;ENST00000444495;ENST00000544027	D;D	0.97041	-4.22;-4.22	5.61	-2.96	0.05547	Trimeric LpxA-like (1);	1.154270	0.06176	N	0.678460	D	0.95140	0.8425	M	0.81112	2.525	0.09310	N	1	B;B	0.32051	0.172;0.354	B;B	0.19391	0.018;0.025	D	0.86651	0.1898	10	0.44086	T	0.13	.	8.2005	0.31421	0.1416:0.5135:0.0:0.3449	.	442;442	E9PC74;Q13144	.;EI2BE_HUMAN	M	442;442;198	ENSP00000273783:T442M;ENSP00000409142:T442M	ENSP00000273783:T442M	T	+	2	0	EIF2B5	185342741	0.000000	0.05858	0.004000	0.12327	0.072000	0.16883	0.027000	0.13621	-0.708000	0.05015	-1.134000	0.01955	ACG		0.483	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		
ABCF3	55324	hgsc.bcm.edu	37	3	183911219	183911219	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:183911219C>T	ENST00000429586.2	+	20	2135	c.1950C>T	c.(1948-1950)ggC>ggT	p.G650G	ABCF3_ENST00000292808.5_Silent_p.G644G|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	650	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.G650G(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGGCTCTGGGCCGTGCCCTCA	0.592																																					p.G650G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1950T	3						.						150.0	139.0	142.0					3																	183911219		2203	4300	6503	185393913	SO:0001819	synonymous_variant	55324	exon20			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1950C>T	3.37:g.183911219C>T		Somatic		Capture	SOLID	Phase_I	185393913	NM_018358	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Silent	SNP	ENST00000429586.2	37	CCDS3254.1																																																																																				0.592	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358	
CLDN16	10686	hgsc.bcm.edu	37	3	190120162	190120162	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:190120162G>A	ENST00000264734.2	+	2	609	c.361G>A	c.(361-363)Gtc>Atc	p.V121I	CLDN16_ENST00000456423.1_Intron|CLDN16_ENST00000468220.1_3'UTR	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	121					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)	p.V121I(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		GTGGGAATGCGTCACAAATGC	0.498																																					p.V121I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G361A	3						.						179.0	164.0	169.0					3																	190120162		2203	4300	6503	191602856	SO:0001583	missense	10686	exon2			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.361G>A	3.37:g.190120162G>A	ENSP00000264734:p.Val121Ile	Somatic		Capture	SOLID	Phase_I	191602856	NM_006580		Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790021	0.90367	.	.	ENSG00000113946	ENST00000264734	D	0.89552	-2.53	5.72	5.72	0.89469	Claudin, conserved site (1);	0.000000	0.64402	D	0.000002	D	0.91472	0.7308	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	P	0.45998	0.5	D	0.92132	0.5713	10	0.52906	T	0.07	-33.332	18.879	0.92350	0.0:0.0:1.0:0.0	.	121	Q9Y5I7	CLD16_HUMAN	I	121	ENSP00000264734:V121I	ENSP00000264734:V121I	V	+	1	0	CLDN16	191602856	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.028000	0.76470	2.707000	0.92482	0.650000	0.86243	GTC		0.498	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
PLCD1	5333	hgsc.bcm.edu	37	3	38053064	38053064	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:38053064C>T	ENST00000334661.4	-	4	751	c.529G>A	c.(529-531)Gac>Aac	p.D177N	Y_RNA_ENST00000363709.1_RNA|PLCD1_ENST00000479619.1_5'UTR|PLCD1_ENST00000463876.1_Missense_Mutation_p.D198N	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	177	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)	p.D177N(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TAGCTGTCGTCCACCTGGATG	0.572																																					p.D177N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G529A	3						.						136.0	127.0	130.0					3																	38053064		2203	4300	6503	38028068	SO:0001583	missense	5333	exon4				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.529G>A	3.37:g.38053064C>T	ENSP00000335600:p.Asp177Asn	Somatic		Capture	SOLID	Phase_I	38028068	NM_006225	B3KR14|Q86VN8	Missense_Mutation	SNP	ENST00000334661.4	37	CCDS2671.1	.	.	.	.	.	.	.	.	.	.	C	9.610	1.130897	0.21041	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	T;T	0.80123	-1.34;-1.34	5.17	5.17	0.71159	EF-hand-like domain (1);	0.295909	0.42053	D	0.000777	T	0.69575	0.3126	N	0.25890	0.77	0.51767	D	0.999932	P;B	0.44946	0.846;0.044	B;B	0.37943	0.261;0.062	T	0.68318	-0.5440	10	0.16420	T	0.52	.	19.0461	0.93020	0.0:1.0:0.0:0.0	.	177;198	P51178;B3KR14	PLCD1_HUMAN;.	N	198;177	ENSP00000430344:D198N;ENSP00000335600:D177N	ENSP00000335600:D177N	D	-	1	0	PLCD1	38028068	0.996000	0.38824	0.997000	0.53966	0.431000	0.31685	1.316000	0.33620	2.584000	0.87258	0.655000	0.94253	GAC		0.572	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
ZKSCAN7	55888	hgsc.bcm.edu	37	3	44598650	44598650	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:44598650G>A	ENST00000273320.3	+	2	540	c.111G>A	c.(109-111)ggG>ggA	p.G37G	ZKSCAN7_ENST00000431636.1_Silent_p.G37G|ZKSCAN7_ENST00000341840.3_Silent_p.G37G|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000426540.1_Silent_p.G37G	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	37					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G37G(1)									AGACCTGGGGGCAGGGCAGCA	0.572																																					p.G37G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G111A	3						.						59.0	60.0	60.0					3																	44598650		2203	4300	6503	44573654	SO:0001819	synonymous_variant	55888	exon2			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.111G>A	3.37:g.44598650G>A		Somatic		Capture	SOLID	Phase_I	44573654	NM_025169	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	ENST00000273320.3	37	CCDS2715.1																																																																																				0.572	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
KIF15	56992	hgsc.bcm.edu	37	3	44879868	44879868	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:44879868A>C	ENST00000326047.4	+	27	3422	c.3273A>C	c.(3271-3273)gaA>gaC	p.E1091D	KIF15_ENST00000425755.1_Missense_Mutation_p.E726D	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	1091					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E1091D(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		CTGCCCAGGAAGAACTGACCA	0.527																																					p.E1091D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3273C	3						.						55.0	59.0	58.0					3																	44879868		2203	4300	6503	44854872	SO:0001583	missense	56992	exon27			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.3273A>C	3.37:g.44879868A>C	ENSP00000324020:p.Glu1091Asp	Somatic		Capture	SOLID	Phase_I	44854872	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	37	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	A	17.21	3.332174	0.60853	.	.	ENSG00000163808	ENST00000326047;ENST00000425755	T;T	0.51574	0.7;0.7	5.26	-2.82	0.05787	.	0.120245	0.36703	N	0.002444	T	0.28034	0.0691	N	0.19112	0.55	0.29651	N	0.843948	P	0.48911	0.917	B	0.41917	0.37	T	0.38628	-0.9652	10	0.41790	T	0.15	.	10.9635	0.47399	0.4119:0.0:0.5881:0.0	.	1091	Q9NS87	KIF15_HUMAN	D	1091;726	ENSP00000324020:E1091D;ENSP00000389982:E726D	ENSP00000324020:E1091D	E	+	3	2	KIF15	44854872	1.000000	0.71417	0.848000	0.33437	0.571000	0.35966	0.615000	0.24329	-0.720000	0.04935	-0.256000	0.11100	GAA		0.527	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
TMEM42	131616	hgsc.bcm.edu	37	3	44905729	44905729	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:44905729C>T	ENST00000302392.4	+	2	289	c.233C>T	c.(232-234)gCg>gTg	p.A78V	MIR564_ENST00000385049.1_RNA	NM_144638.1	NP_653239.1	Q69YG0	TMM42_HUMAN	transmembrane protein 42	78						integral component of membrane (GO:0016021)		p.A78V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00839)|KIRC - Kidney renal clear cell carcinoma(197;0.0461)|Kidney(197;0.0576)		ATTGTGATGGCGAGCACCAAT	0.517																																					p.A78V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C233T	3						.						300.0	258.0	273.0					3																	44905729		2203	4300	6503	44880733	SO:0001583	missense	131616	exon2			AL834253	CCDS2722.1	3p21.31	2005-01-19			ENSG00000169964	ENSG00000169964			28444	protein-coding gene	gene with protein product						12477932	Standard	NM_144638		Approved	MGC29956	uc003cnz.3	Q69YG0	OTTHUMG00000133092	ENST00000302392.4:c.233C>T	3.37:g.44905729C>T	ENSP00000306564:p.Ala78Val	Somatic		Capture	SOLID	Phase_I	44880733	NM_144638	Q8WUQ6	Missense_Mutation	SNP	ENST00000302392.4	37	CCDS2722.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.291897	0.23564	.	.	ENSG00000169964	ENST00000302392	T	0.11385	2.78	4.85	-1.98	0.07480	.	1.289750	0.05408	N	0.541954	T	0.05410	0.0143	N	0.20685	0.6	0.09310	N	1	B	0.31054	0.306	B	0.22386	0.039	T	0.37009	-0.9724	10	0.08381	T	0.77	-2.7902	7.0979	0.25319	0.0:0.205:0.5306:0.2644	.	78	Q69YG0	TMM42_HUMAN	V	78	ENSP00000306564:A78V	ENSP00000306564:A78V	A	+	2	0	TMEM42	44880733	0.321000	0.24625	0.006000	0.13384	0.052000	0.14988	0.389000	0.20751	-0.271000	0.09272	-0.878000	0.02970	GCG		0.517	TMEM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256750.2	NM_144638	
LTF	4057	hgsc.bcm.edu	37	3	46492049	46492049	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:46492049G>A	ENST00000231751.4	-	7	1113	c.818C>T	c.(817-819)gCc>gTc	p.A273V	LTF_ENST00000426532.2_Missense_Mutation_p.A229V|LTF_ENST00000417439.1_Missense_Mutation_p.A273V	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	273	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)	p.A273V(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		TGCCACAACGGCATGAGAAGG	0.557																																					p.A229V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C686T	3						.						101.0	88.0	92.0					3																	46492049		2203	4296	6499	46467053	SO:0001583	missense	4057	exon7				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.818C>T	3.37:g.46492049G>A	ENSP00000231751:p.Ala273Val	Somatic		Capture	SOLID	Phase_I	46467053	NM_001199149	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	37	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.766866	0.69878	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.9	4.02	0.46733	.	0.101582	0.64402	D	0.000002	T	0.64929	0.2643	M	0.82923	2.615	0.53688	D	0.999971	D;D;D	0.89917	0.997;1.0;0.997	P;D;P	0.91635	0.847;0.999;0.847	T	0.69367	-0.5164	10	0.62326	D	0.03	-9.8053	11.5925	0.50953	0.0896:0.0:0.9104:0.0	.	273;260;273	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	V	273;229;273;260	ENSP00000231751:A273V;ENSP00000405719:A229V;ENSP00000405546:A273V;ENSP00000397427:A260V	ENSP00000231751:A273V	A	-	2	0	LTF	46467053	0.998000	0.40836	0.773000	0.31616	0.310000	0.27922	4.212000	0.58514	1.376000	0.46267	0.655000	0.94253	GCC		0.557	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343	
SETD2	29072	hgsc.bcm.edu	37	3	47098427	47098427	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:47098427G>A	ENST00000409792.3	-	15	6889	c.6847C>T	c.(6847-6849)Cag>Tag	p.Q2283*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2283	Gln-rich.|Low charge region.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.Q2283*(1)|p.Q1780*(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TACTGCTGCTGTACACTGACA	0.493			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.Q2283X			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C6847T	3						.						118.0	112.0	114.0					3																	47098427		2203	4300	6503	47073431	SO:0001587	stop_gained	29072	exon15			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6847C>T	3.37:g.47098427G>A	ENSP00000386759:p.Gln2283*	Somatic		Capture	SOLID	Phase_I	47073431	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	47	13.535813	0.99748	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.2	5.2	0.72013	.	0.000000	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.2916	0.94102	0.0:0.0:1.0:0.0	.	.	.	.	X	2283	.	ENSP00000386759:Q2283X	Q	-	1	0	SETD2	47073431	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	9.143000	0.94623	2.861000	0.98227	0.655000	0.94253	CAG		0.493	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
KLHL18	23276	hgsc.bcm.edu	37	3	47385309	47385309	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:47385309C>T	ENST00000232766.5	+	10	1623	c.1603C>T	c.(1603-1605)Cag>Tag	p.Q535*	KLHL18_ENST00000455924.2_Nonsense_Mutation_p.Q423*	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	535								p.Q535*(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		CTACGACGGACAGTCAAACCT	0.627																																					p.Q535X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1603T	3						.						91.0	93.0	92.0					3																	47385309		2203	4300	6503	47360313	SO:0001587	stop_gained	23276	exon10			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.1603C>T	3.37:g.47385309C>T	ENSP00000232766:p.Gln535*	Somatic		Capture	SOLID	Phase_I	47360313	NM_025010	A8K612|Q7Z3E8|Q8N125	Nonsense_Mutation	SNP	ENST00000232766.5	37	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649742	0.87958	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	17.8105	0.88614	0.0:1.0:0.0:0.0	.	.	.	.	X	535;423	.	ENSP00000232766:Q535X	Q	+	1	0	KLHL18	47360313	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	5.877000	0.69675	2.683000	0.91414	0.561000	0.74099	CAG		0.627	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
DHX30	22907	hgsc.bcm.edu	37	3	47883153	47883153	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:47883153C>T	ENST00000445061.1	+	8	1122	c.715C>T	c.(715-717)Ctg>Ttg	p.L239L	DHX30_ENST00000348968.4_Silent_p.L211L|DHX30_ENST00000457607.1_Silent_p.L267L|DHX30_ENST00000446256.2_Silent_p.L200L	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	239						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.L239L(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CATTAGGGCTCTGACCCAGTT	0.483																																					p.L239L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C715T	3						.						117.0	107.0	110.0					3																	47883153		2203	4300	6503	47858157	SO:0001819	synonymous_variant	22907	exon8			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.715C>T	3.37:g.47883153C>T		Somatic		Capture	SOLID	Phase_I	47858157	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Silent	SNP	ENST00000445061.1	37	CCDS2759.1																																																																																				0.483	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
ARIH2	10425	hgsc.bcm.edu	37	3	49017027	49017027	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:49017027G>A	ENST00000356401.4	+	12	1413	c.1074G>A	c.(1072-1074)gcG>gcA	p.A358A	RP13-131K19.1_ENST00000429681.1_RNA|ARIH2_ENST00000490095.1_3'UTR|ARIH2_ENST00000449376.1_Silent_p.A358A|RP13-131K19.1_ENST00000415982.1_RNA	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	358					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A358A(1)		cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		AAGCCCAGGCGAGGGAAGCCC	0.507																																					p.A358A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1074A	3						.						132.0	110.0	118.0					3																	49017027		2203	4300	6503	48992031	SO:0001819	synonymous_variant	10425	exon12			AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.1074G>A	3.37:g.49017027G>A		Somatic		Capture	SOLID	Phase_I	48992031	NM_006321	Q9HBZ6|Q9UEM9	Silent	SNP	ENST00000356401.4	37	CCDS2780.1																																																																																				0.507	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257525.1	NM_006321	
LSMEM2	132228	hgsc.bcm.edu	37	3	50324548	50324550	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	AGG	AGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:50324548_50324550delAGG	ENST00000316436.3	+	4	497_499	c.410_412delAGG	c.(409-414)caggag>cag	p.E139del	IFRD2_ENST00000484043.1_5'Flank	NM_153215.1	NP_694947.1	Q8N112	LSME2_HUMAN	leucine-rich single-pass membrane protein 2	139						integral component of membrane (GO:0016021)		p.E139delE(1)									CTCCGCACGCAGGAGGAGACACT	0.601																																					p.137_138del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.410_412del	3						.																																			50299554	SO:0001651	inframe_deletion	132228	exon4			AK095927	CCDS2814.1	3p21.31	2013-03-08	2013-03-08	2013-03-08	ENSG00000179564	ENSG00000179564			26781	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 45"""	C3orf45			Standard	NM_153215		Approved	FLJ38608	uc003cyz.3	Q8N112	OTTHUMG00000156938	ENST00000316436.3:c.410_412delAGG	3.37:g.50324551_50324553delAGG	ENSP00000315081:p.Glu139del	Somatic		Capture	SOLID	Phase_I	50299552	NM_153215		In_Frame_Del	DEL	ENST00000316436.3	37	CCDS2814.1																																																																																				0.601	LSMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346671.1	NM_153215	
TWF2	11344	hgsc.bcm.edu	37	3	52269087	52269087	+	Missense_Mutation	SNP	G	G	A	rs34008749	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:52269087G>A	ENST00000305533.5	-	2	304	c.61C>T	c.(61-63)Cgg>Tgg	p.R21W	TWF2_ENST00000499914.2_Missense_Mutation_p.R21W|TLR9_ENST00000597542.1_De_novo_Start_OutOfFrame	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	21	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)	p.R21W(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GAGCCAGCCCGTGCCTTGGCA	0.572																																					p.R21W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C61T	3						.	G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	118.0	103.0	108.0		61	3.7	0.9	3	dbSNP_126	108	0,8600		0,0,4300	yes	missense	TWF2	NM_007284.3	101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		21/350	52269087	2,13004	2203	4300	6503	52244127	SO:0001583	missense	11344	exon2			Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.61C>T	3.37:g.52269087G>A	ENSP00000303908:p.Arg21Trp	Somatic		Capture	SOLID	Phase_I	52244127	NM_007284	Q9Y3F5	Missense_Mutation	SNP	ENST00000305533.5	37	CCDS2849.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100019	0.76983	4.54E-4	0.0	ENSG00000247596	ENST00000305533;ENST00000499914	T;T	0.35236	1.32;1.32	4.58	3.69	0.42338	Actin-binding, cofilin/tropomyosin type (2);	.	.	.	.	T	0.63581	0.2523	M	0.86573	2.825	0.52501	D	0.999959	D;D	0.89917	1.0;1.0	D;D	0.91635	0.979;0.999	T	0.70908	-0.4744	9	0.87932	D	0	.	13.1313	0.59385	0.0:0.0:0.8388:0.1612	rs34008749	21;21	D6RG15;Q6IBS0	.;TWF2_HUMAN	W	21	ENSP00000303908:R21W;ENSP00000426464:R21W	ENSP00000303908:R21W	R	-	1	2	TWF2	52244127	1.000000	0.71417	0.906000	0.35671	0.995000	0.86356	4.415000	0.59809	1.132000	0.42129	0.561000	0.74099	CGG		0.572	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		
STAB1	23166	hgsc.bcm.edu	37	3	52542302	52542302	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:52542302G>A	ENST00000321725.6	+	21	2238	c.2162G>A	c.(2161-2163)tGc>tAc	p.C721Y		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	721					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.C721Y(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CAAGGCTGCTGCAAAGGTTTT	0.597																																					p.C721Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2162A	3						.						117.0	114.0	115.0					3																	52542302		2203	4300	6503	52517342	SO:0001583	missense	23166	exon21			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.2162G>A	3.37:g.52542302G>A	ENSP00000312946:p.Cys721Tyr	Somatic		Capture	SOLID	Phase_I	52517342	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422023	0.83559	.	.	ENSG00000010327	ENST00000321725	D	0.84944	-1.92	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.92004	0.7467	M	0.73319	2.225	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91443	0.5175	10	0.49607	T	0.09	.	18.6215	0.91322	0.0:0.0:1.0:0.0	.	721;721	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	Y	721	ENSP00000312946:C721Y	ENSP00000312946:C721Y	C	+	2	0	STAB1	52517342	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	8.247000	0.89830	2.697000	0.92050	0.563000	0.77884	TGC		0.597	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
SPCS1	28972	hgsc.bcm.edu	37	3	52741771	52741772	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	CA	CA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:52741771_52741772delCA	ENST00000602728.1	+	4	421_422	c.252_253delCA	c.(250-255)agcacafs	p.T85fs	SPCS1_ENST00000233025.7_Frame_Shift_Del_p.T152fs|GLT8D1_ENST00000407584.3_5'Flank|GLT8D1_ENST00000491606.1_5'Flank|GLT8D1_ENST00000266014.5_5'Flank|SPCS1_ENST00000423431.1_Frame_Shift_Del_p.T63fs|GLT8D1_ENST00000478968.2_5'Flank			Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog (S. cerevisiae)	85					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)	p.T85fs*11(1)|p.T152fs*11(1)		kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		AAGAATCAAGCACAGACGACAA	0.431																																					p.151_152del												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.453_454del	3						.																																			52716812	SO:0001589	frameshift_variant	28972	exon4			AF092138	CCDS33769.2	3p21.31	2005-01-05			ENSG00000114902	ENSG00000114902			23401	protein-coding gene	gene with protein product		610358				8632014	Standard	NM_014041		Approved	SPC12, HSPC033, YJR010C-A, SPC1	uc011bei.2	Q9Y6A9	OTTHUMG00000154930	ENST00000602728.1:c.252_253delCA	3.37:g.52741773_52741774delCA	ENSP00000473265:p.Thr85fs	Somatic		Capture	SOLID	Phase_I	52716811	NM_014041	B3KNF8|Q9BVW1	Frame_Shift_Del	DEL	ENST00000602728.1	37																																																																																					0.431	SPCS1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467759.1	NM_014041	
FLNB	2317	hgsc.bcm.edu	37	3	58109236	58109236	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:58109236T>C	ENST00000295956.4	+	21	3708	c.3543T>C	c.(3541-3543)agT>agC	p.S1181S	FLNB_ENST00000490882.1_Silent_p.S1181S|FLNB_ENST00000493452.1_Silent_p.S1012S|FLNB_ENST00000348383.5_Silent_p.S1181S|FLNB_ENST00000358537.3_Silent_p.S1181S|FLNB_ENST00000357272.4_Silent_p.S1181S|FLNB_ENST00000429972.2_Silent_p.S1181S|FLNB_ENST00000419752.2_Silent_p.S1012S	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1181	Interaction with FBLP1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.S1181S(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CCGAAGTCAGTATTCAGAACA	0.602																																					p.S1181S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3543C	3						.						54.0	53.0	53.0					3																	58109236		2203	4300	6503	58084276	SO:0001819	synonymous_variant	2317	exon21			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.3543T>C	3.37:g.58109236T>C		Somatic		Capture	SOLID	Phase_I	58084276	NM_001164317	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	CCDS2885.1																																																																																				0.602	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
PTPRG	5793	hgsc.bcm.edu	37	3	62177245	62177245	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:62177245T>C	ENST00000474889.1	+	9	1513	c.1136T>C	c.(1135-1137)aTg>aCg	p.M379T	PTPRG_ENST00000295874.10_Missense_Mutation_p.M379T	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	379	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.M379T(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCACCCATCATGAACTACATG	0.537																																					p.M379T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1136C	3						.						127.0	113.0	118.0					3																	62177245		2203	4300	6503	62152285	SO:0001583	missense	5793	exon9			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1136T>C	3.37:g.62177245T>C	ENSP00000418112:p.Met379Thr	Somatic		Capture	SOLID	Phase_I	62152285	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	T	16.03	3.005867	0.54254	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.52295	0.67;0.67	5.57	5.57	0.84162	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.122818	0.85682	D	0.000000	T	0.32071	0.0817	N	0.12182	0.205	0.41280	D	0.986905	B;B	0.10296	0.003;0.002	B;B	0.10450	0.002;0.005	T	0.09378	-1.0677	10	0.29301	T	0.29	.	15.7184	0.77688	0.0:0.0:0.0:1.0	.	379;379	P23470-2;P23470	.;PTPRG_HUMAN	T	379	ENSP00000418112:M379T;ENSP00000295874:M379T	ENSP00000295874:M379T	M	+	2	0	PTPRG	62152285	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.623000	0.54224	2.125000	0.65367	0.443000	0.29094	ATG		0.537	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
CNTN3	5067	hgsc.bcm.edu	37	3	74349082	74349082	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:74349082T>G	ENST00000263665.6	-	16	2130	c.2103A>C	c.(2101-2103)gaA>gaC	p.E701D		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	701					cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.E701D(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AAGGAGGCACTTCTGGAACTA	0.388																																					p.E701D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2103C	3						.						85.0	77.0	80.0					3																	74349082		2203	4300	6503	74431772	SO:0001583	missense	5067	exon16			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2103A>C	3.37:g.74349082T>G	ENSP00000263665:p.Glu701Asp	Somatic		Capture	SOLID	Phase_I	74431772	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562107	0.45590	.	.	ENSG00000113805	ENST00000263665	T	0.52295	0.67	5.86	0.678	0.17969	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.048917	0.85682	D	0.000000	T	0.17492	0.0420	N	0.03194	-0.395	0.30596	N	0.761044	B	0.12013	0.005	B	0.17979	0.02	T	0.22103	-1.0226	10	0.10111	T	0.7	.	5.2293	0.15412	0.1186:0.2641:0.0:0.6173	.	701	Q9P232	CNTN3_HUMAN	D	701	ENSP00000263665:E701D	ENSP00000263665:E701D	E	-	3	2	CNTN3	74431772	1.000000	0.71417	0.995000	0.50966	0.953000	0.61014	1.158000	0.31737	-0.095000	0.12351	0.528000	0.53228	GAA		0.388	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
PCYT1A	5130	hgsc.bcm.edu	37	3	195968927	195968927	+	Silent	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr3:195968927G>T	ENST00000292823.2	-	8	772	c.600C>A	c.(598-600)atC>atA	p.I200I	PCYT1A_ENST00000431016.1_Silent_p.I200I|PCYT1A_ENST00000419333.1_Silent_p.I200I	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	200					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)	p.I200I(1)		cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	CTGATGTGGAGATACCTTCTG	0.468																																					p.I200I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C600A	3						.						143.0	124.0	130.0					3																	195968927		2203	4300	6503	197453324	SO:0001819	synonymous_variant	5130	exon8			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.600C>A	3.37:g.195968927G>T		Somatic		Capture	SOLID	Phase_I	197453324	NM_005017	A9LYK9|D3DXB1|Q86Y88	Silent	SNP	ENST00000292823.2	37	CCDS3315.1																																																																																				0.468	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	NM_005017	
UTP20	27340	hgsc.bcm.edu	37	12	101674945	101674945	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:101674945C>T	ENST00000261637.4	+	2	271	c.97C>T	c.(97-99)Cgg>Tgg	p.R33W		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	33					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.R33W(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TATTATTCACCGGATTGATAG	0.323																																					p.R33W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C97T	12						.						84.0	85.0	85.0					12																	101674945		2203	4298	6501	100199076	SO:0001583	missense	27340	exon2			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.97C>T	12.37:g.101674945C>T	ENSP00000261637:p.Arg33Trp	Somatic		Capture	SOLID	Phase_I	100199076	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771195	0.90108	.	.	ENSG00000120800	ENST00000261637	T	0.22134	1.97	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.51787	0.1695	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59495	-0.7444	10	0.66056	D	0.02	-13.3793	18.0692	0.89400	0.0:1.0:0.0:0.0	.	33	O75691	UTP20_HUMAN	W	33	ENSP00000261637:R33W	ENSP00000261637:R33W	R	+	1	2	UTP20	100199076	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.384000	0.66225	2.257000	0.74773	0.655000	0.94253	CGG		0.323	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
CRY1	1407	hgsc.bcm.edu	37	12	107386774	107386774	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:107386774G>A	ENST00000008527.5	-	11	2493	c.1626C>T	c.(1624-1626)ggC>ggT	p.G542G		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	542					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)	p.G542G(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						GCTGACTGTCGCCATGAGCAT	0.333																																					p.G542G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1626T	12						.						101.0	87.0	92.0					12																	107386774		2203	4300	6503	105910904	SO:0001819	synonymous_variant	1407	exon11			BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.1626C>T	12.37:g.107386774G>A		Somatic		Capture	SOLID	Phase_I	105910904	NM_004075		Silent	SNP	ENST00000008527.5	37	CCDS9112.1																																																																																				0.333	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075	
MAGOHB	55110	hgsc.bcm.edu	37	12	10760470	10760470	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:10760470A>G	ENST00000320756.2	-	4	420	c.330T>C	c.(328-330)atT>atC	p.I110I	MAGOHB_ENST00000539554.1_Silent_p.I64I|MAGOHB_ENST00000381881.2_Silent_p.I73I	NM_018048.3	NP_060518.1	Q96A72	MGN2_HUMAN	mago-nashi homolog B (Drosophila)	110					mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I110I(1)		breast(2)|large_intestine(2)	4						GATTTACATCAATAAGAGAAC	0.299																																					p.I110I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T330C	12						.						71.0	75.0	74.0					12																	10760470		2200	4296	6496	10651737	SO:0001819	synonymous_variant	55110	exon4				CCDS8628.1	12p13.2	2014-02-12	2008-01-24		ENSG00000111196	ENSG00000111196			25504	protein-coding gene	gene with protein product							Standard	NM_018048		Approved	FLJ10292, MGN2	uc001qyq.2	Q96A72	OTTHUMG00000168407	ENST00000320756.2:c.330T>C	12.37:g.10760470A>G		Somatic		Capture	SOLID	Phase_I	10651737	NM_018048		Silent	SNP	ENST00000320756.2	37	CCDS8628.1																																																																																				0.299	MAGOHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399616.1	NM_018048	
BTBD11	121551	hgsc.bcm.edu	37	12	107914362	107914362	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:107914362A>G	ENST00000280758.5	+	2	1762	c.1234A>G	c.(1234-1236)Acc>Gcc	p.T412A	BTBD11_ENST00000490090.2_Missense_Mutation_p.T412A|BTBD11_ENST00000420571.2_Missense_Mutation_p.T412A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	412						integral component of membrane (GO:0016021)		p.T412A(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GGAGCTGAGGACCATCGAGCA	0.557																																					p.T412A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1234G	12						.						140.0	125.0	130.0					12																	107914362		2203	4300	6503	106438492	SO:0001583	missense	121551	exon2			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1234A>G	12.37:g.107914362A>G	ENSP00000280758:p.Thr412Ala	Somatic		Capture	SOLID	Phase_I	106438492	NM_001018072	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	.	.	.	.	.	.	.	.	.	.	A	14.52	2.561268	0.45590	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000415943	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	3.97	3.97	0.46021	.	0.586122	0.17109	N	0.186675	T	0.37839	0.1018	L	0.41573	1.285	0.80722	D	1	P;B;P	0.44281	0.738;0.077;0.831	B;B;B	0.43052	0.392;0.019;0.406	T	0.15521	-1.0434	10	0.33940	T	0.23	.	13.5865	0.61933	1.0:0.0:0.0:0.0	.	412;412;412	A6QL63-2;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	A	412;412;412;46	ENSP00000280758:T412A;ENSP00000413889:T412A;ENSP00000447319:T412A;ENSP00000407416:T46A	ENSP00000280758:T412A	T	+	1	0	BTBD11	106438492	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.670000	0.61583	1.754000	0.51921	0.459000	0.35465	ACC		0.557	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
BTBD11	121551	hgsc.bcm.edu	37	12	108029143	108029143	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:108029143A>G	ENST00000280758.5	+	12	3241	c.2713A>G	c.(2713-2715)Aaa>Gaa	p.K905E	BTBD11_ENST00000490090.2_Missense_Mutation_p.K905E|BTBD11_ENST00000494235.2_5'UTR|BTBD11_ENST00000357167.4_Missense_Mutation_p.K442E|BTBD11_ENST00000420571.2_Missense_Mutation_p.K786E	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	905						integral component of membrane (GO:0016021)		p.K905E(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CACAGAAATCAAACGGAAACA	0.527																																					p.K442E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1324G	12						.						122.0	107.0	112.0					12																	108029143		2203	4300	6503	106553273	SO:0001583	missense	121551	exon10			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2713A>G	12.37:g.108029143A>G	ENSP00000280758:p.Lys905Glu	Somatic		Capture	SOLID	Phase_I	106553273	NM_001017523	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889776	0.91889	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000357167	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27	5.9	5.9	0.94986	BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	D	0.86322	0.5905	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.71674	0.998;0.982;0.997;0.991	D;D;D;P	0.78314	0.991;0.952;0.98;0.671	D	0.84819	0.0795	10	0.32370	T	0.25	.	16.0056	0.80359	1.0:0.0:0.0:0.0	.	786;442;905;905	A6QL63-2;E9PHS4;A6QL63;A6QL63-3	.;.;BTBDB_HUMAN;.	E	905;786;905;442	ENSP00000280758:K905E;ENSP00000413889:K786E;ENSP00000447319:K905E;ENSP00000349690:K442E	ENSP00000280758:K905E	K	+	1	0	BTBD11	106553273	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.984000	0.76186	2.251000	0.74343	0.528000	0.53228	AAA		0.527	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
PWP1	11137	hgsc.bcm.edu	37	12	108082472	108082472	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:108082472G>A	ENST00000412830.3	+	3	380	c.212G>A	c.(211-213)cGc>cAc	p.R71H	PWP1_ENST00000541166.1_Missense_Mutation_p.R9H	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	71					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.R71H(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						ACCCAGGCACGCCCAAGAGAG	0.517																																					p.R71H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G212A	12						.						128.0	121.0	123.0					12																	108082472		2203	4300	6503	106606602	SO:0001583	missense	11137	exon3			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.212G>A	12.37:g.108082472G>A	ENSP00000387365:p.Arg71His	Somatic		Capture	SOLID	Phase_I	106606602	NM_007062	A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	37	CCDS9114.1	.	.	.	.	.	.	.	.	.	.	.	13.26	2.184457	0.38609	.	.	ENSG00000136045	ENST00000412830;ENST00000547995;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.70631	-0.46;-0.5	5.69	2.36	0.29203	.	0.943772	0.08976	N	0.866472	T	0.51669	0.1688	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41822	-0.9487	10	0.48119	T	0.1	.	6.2671	0.20932	0.1476:0.5552:0.2972:0.0	.	71	Q13610	PWP1_HUMAN	H	71;9;71;71;71;9	ENSP00000387365:R71H;ENSP00000445249:R9H	ENSP00000258531:R71H	R	+	2	0	PWP1	106606602	0.000000	0.05858	0.028000	0.17463	0.928000	0.56348	0.170000	0.16663	0.698000	0.31739	0.478000	0.44815	CGC		0.517	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	NM_007062	
UBE3B	89910	hgsc.bcm.edu	37	12	109959258	109959258	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:109959258G>A	ENST00000342494.3	+	21	2861	c.2266G>A	c.(2266-2268)Gat>Aat	p.D756N	UBE3B_ENST00000434735.2_Missense_Mutation_p.D756N	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	756	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.D756N(1)		NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						AACCAGTGGGGATGAGAGGCT	0.537																																					p.D756N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2266A	12						.						86.0	77.0	80.0					12																	109959258		2203	4300	6503	108443641	SO:0001583	missense	89910	exon21			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2266G>A	12.37:g.109959258G>A	ENSP00000340596:p.Asp756Asn	Somatic		Capture	SOLID	Phase_I	108443641	NM_130466	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.987445	0.53934	.	.	ENSG00000151148	ENST00000434735;ENST00000539599;ENST00000342494;ENST00000539584;ENST00000538070	T;T;T	0.55760	0.5;0.5;0.5	5.18	5.18	0.71444	HECT (4);	0.156867	0.56097	D	0.000023	T	0.45856	0.1363	L	0.35414	1.06	0.80722	D	1	B	0.10296	0.003	B	0.16289	0.015	T	0.35674	-0.9779	10	0.52906	T	0.07	-4.1329	17.86	0.88778	0.0:0.0:1.0:0.0	.	756	Q7Z3V4	UBE3B_HUMAN	N	756;756;756;183;51	ENSP00000391529:D756N;ENSP00000443131:D756N;ENSP00000340596:D756N	ENSP00000340596:D756N	D	+	1	0	UBE3B	108443641	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.572000	0.60886	2.684000	0.91462	0.655000	0.94253	GAT		0.537	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
ATP2A2	488	hgsc.bcm.edu	37	12	110778798	110778798	+	Splice_Site	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:110778798T>A	ENST00000539276.2	+	14	2205	c.2096T>A	c.(2095-2097)aTg>aAg	p.M699K	ATP2A2_ENST00000308664.6_Splice_Site_p.M699K|ATP2A2_ENST00000395494.2_Splice_Site_p.M672K			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	699					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.M699K(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						ATTACAGCTATGGTGAGCATG	0.433																																					p.M699K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2096A	12						.						33.0	34.0	34.0					12																	110778798		2203	4300	6503	109263181	SO:0001630	splice_region_variant	488	exon14				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2097+1T>A	12.37:g.110778798T>A		Somatic		Capture	SOLID	Phase_I	109263181	NM_170665	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	CCDS9144.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	30|30	5.056251|5.056251	0.93793|0.93793	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276|ENST00000548169	D;D;D|.	0.97941|.	-4.62;-4.62;-4.62|.	5.81|5.81	5.81|5.81	0.92471|0.92471	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.91449|.	0.7301|.	H|H	0.99573|0.99573	4.635|4.635	0.80722|0.80722	D|D	1|1	D;D;D|.	0.61697|.	0.982;0.988;0.99|.	D;D;D|.	0.68621|.	0.927;0.931;0.959|.	D|.	0.95116|.	0.8242|.	10|.	0.87932|.	D|.	0|.	.|.	16.1668|16.1668	0.81768|0.81768	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	672;699;699|.	P16615-4;P16615-2;P16615|.	.;.;AT2A2_HUMAN|.	K|X	699;672;699|589	ENSP00000311186:M699K;ENSP00000378872:M672K;ENSP00000440045:M699K|.	ENSP00000311186:M699K|.	M|Y	+|+	2|3	0|2	ATP2A2|ATP2A2	109263181|109263181	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.977000|0.977000	0.68977|0.68977	8.040000|8.040000	0.89188|0.89188	2.210000|2.210000	0.71456|0.71456	0.533000|0.533000	0.62120|0.62120	ATG|TAT		0.433	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	Missense_Mutation
SDS	10993	hgsc.bcm.edu	37	12	113835004	113835004	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:113835004C>T	ENST00000257549.4	-	6	741	c.619G>A	c.(619-621)Gca>Aca	p.A207T		NM_006843.2	NP_006834.2	P20132	SDHL_HUMAN	serine dehydratase	207					gluconeogenesis (GO:0006094)|L-serine catabolic process (GO:0006565)|pyruvate biosynthetic process (GO:0042866)|response to amino acid (GO:0043200)|response to cobalamin (GO:0033590)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.A207T(1)		large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(1)	11					L-Serine(DB00133)	AGTTTGCCTGCGGTGGTGGCA	0.652																																					p.A207T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G619A	12						.						65.0	54.0	58.0					12																	113835004		2203	4300	6503	112319387	SO:0001583	missense	10993	exon6			J05037	CCDS9169.1	12q24.13	2014-06-24			ENSG00000135094	ENSG00000135094	4.3.1.17		10691	protein-coding gene	gene with protein product	"""L-serine ammonia-lyase"""	182128				2674117	Standard	NM_006843		Approved	SDH	uc001tvg.3	P20132	OTTHUMG00000169554	ENST00000257549.4:c.619G>A	12.37:g.113835004C>T	ENSP00000257549:p.Ala207Thr	Somatic		Capture	SOLID	Phase_I	112319387	NM_006843	A8K9P5	Missense_Mutation	SNP	ENST00000257549.4	37	CCDS9169.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774014	0.49786	.	.	ENSG00000135094	ENST00000257549;ENST00000446302	D	0.97186	-4.28	4.21	4.21	0.49690	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.058272	0.64402	D	0.000002	D	0.98576	0.9524	M	0.91459	3.21	0.49582	D	0.999802	D;D	0.76494	0.993;0.999	P;D	0.65773	0.854;0.938	D	0.99537	1.0962	10	0.66056	D	0.02	-11.8817	16.37	0.83353	0.0:1.0:0.0:0.0	.	207;207	Q8WW81;P20132	.;SDHL_HUMAN	T	207	ENSP00000257549:A207T	ENSP00000257549:A207T	A	-	1	0	SDS	112319387	1.000000	0.71417	0.143000	0.22291	0.070000	0.16714	7.486000	0.81215	2.196000	0.70406	0.561000	0.74099	GCA		0.652	SDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404790.1	NM_006843	
FBXW8	26259	hgsc.bcm.edu	37	12	117423085	117423085	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:117423085G>A	ENST00000309909.5	+	6	992	c.910G>A	c.(910-912)Gca>Aca	p.A304T	RP11-231I16.1_ENST00000548738.1_RNA|FBXW8_ENST00000551773.1_3'UTR|FBXW8_ENST00000455858.2_Missense_Mutation_p.A238T			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	304					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)		p.A304T(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		AAGAATACAGGCACTAGCCCT	0.488																																					p.A304T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G910A	12						.						149.0	129.0	136.0					12																	117423085		2203	4300	6503	115907468	SO:0001583	missense	26259	exon6			AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.910G>A	12.37:g.117423085G>A	ENSP00000310686:p.Ala304Thr	Somatic		Capture	SOLID	Phase_I	115907468	NM_153348	Q9UK95	Missense_Mutation	SNP	ENST00000309909.5	37	CCDS9182.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.472176	0.84533	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.05319	3.46;3.46	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.116593	0.56097	D	0.000024	T	0.09291	0.0229	M	0.72894	2.215	0.45261	D	0.998267	P;P	0.36874	0.572;0.48	B;B	0.32211	0.085;0.142	T	0.07986	-1.0744	10	0.30854	T	0.27	-13.8563	13.3638	0.60671	0.0716:0.0:0.9284:0.0	.	304;238	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	T	304;238;238	ENSP00000310686:A304T;ENSP00000389144:A238T	ENSP00000310686:A304T	A	+	1	0	FBXW8	115907468	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	5.133000	0.64764	2.767000	0.95098	0.555000	0.69702	GCA		0.488	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174	
MLEC	9761	hgsc.bcm.edu	37	12	121131965	121131965	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:121131965C>T	ENST00000228506.3	+	2	735	c.307C>T	c.(307-309)Cgg>Tgg	p.R103W	MLEC_ENST00000412616.2_Missense_Mutation_p.R103W|RP11-173P15.3_ENST00000541383.1_RNA	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	103					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)	p.R103W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						TCAAACTGAGCGGTACAATGA	0.498																																					p.R103W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C307T	12						.						110.0	93.0	98.0					12																	121131965		2203	4300	6503	119616348	SO:0001583	missense	9761	exon2			BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.307C>T	12.37:g.121131965C>T	ENSP00000228506:p.Arg103Trp	Somatic		Capture	SOLID	Phase_I	119616348	NM_014730		Missense_Mutation	SNP	ENST00000228506.3	37	CCDS9206.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942558	0.73672	.	.	ENSG00000110917	ENST00000228506;ENST00000412616;ENST00000545525	.	.	.	5.5	3.57	0.40892	Malectin (1);	0.000000	0.85682	D	0.000000	D	0.85401	0.5688	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87168	0.2219	9	0.87932	D	0	.	10.7086	0.45969	0.1462:0.7828:0.0:0.071	.	103	Q14165	MLEC_HUMAN	W	103;103;20	.	ENSP00000228506:R103W	R	+	1	2	MLEC	119616348	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.315000	0.33608	0.763000	0.33175	0.655000	0.94253	CGG		0.498	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402781.2	NM_014730	
VPS33A	65082	hgsc.bcm.edu	37	12	122748177	122748177	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:122748177T>A	ENST00000267199.4	-	3	350	c.238A>T	c.(238-240)Att>Ttt	p.I80F	VPS33A_ENST00000451053.2_Missense_Mutation_p.I80F|VPS33A_ENST00000542310.1_5'UTR|RP11-512M8.5_ENST00000535844.1_Missense_Mutation_p.I80F	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	80					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)		p.I80F(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		ACAAAAAAAATTATATTCTTC	0.383																																					p.I80F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A238T	12						.						88.0	85.0	86.0					12																	122748177		2203	4300	6503	121314130	SO:0001583	missense	65082	exon3			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.238A>T	12.37:g.122748177T>A	ENSP00000267199:p.Ile80Phe	Somatic		Capture	SOLID	Phase_I	121314130	NM_022916	Q547V4|Q9H5Q0	Missense_Mutation	SNP	ENST00000267199.4	37	CCDS9231.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.677427	0.88445	.	.	ENSG00000139719	ENST00000267199;ENST00000451053	T;T	0.46819	0.86;0.86	5.05	5.05	0.67936	.	0.053334	0.85682	D	0.000000	T	0.69223	0.3087	M	0.79805	2.47	0.58432	D	0.999998	D;D	0.67145	0.996;0.986	D;D	0.68483	0.923;0.958	T	0.74904	-0.3505	10	0.87932	D	0	-19.9058	15.0976	0.72247	0.0:0.0:0.0:1.0	.	80;80	F5H6Y0;Q96AX1	.;VP33A_HUMAN	F	80	ENSP00000267199:I80F;ENSP00000442951:I80F	ENSP00000446319:I80F	I	-	1	0	VPS33A	121314130	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	5.763000	0.68818	2.035000	0.60131	0.459000	0.35465	ATT		0.383	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2		
DUSP16	80824	hgsc.bcm.edu	37	12	12672853	12672853	+	Missense_Mutation	SNP	G	G	T	rs373837994		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:12672853G>T	ENST00000228862.2	-	3	941	c.310C>A	c.(310-312)Ctc>Atc	p.L104I	DUSP16_ENST00000298573.4_Missense_Mutation_p.L104I	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	104	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L104I(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		AGTACAGTGAGAAAACAGTCT	0.438																																					p.L104I	Ovarian(158;443 1896 15437 36069 46477)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C310A	12						.	G	ILE/LEU	1,4405	2.1+/-5.4	0,1,2202	110.0	98.0	102.0		310	5.8	1.0	12		102	0,8600		0,0,4300	no	missense	DUSP16	NM_030640.2	5	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	possibly-damaging	104/666	12672853	1,13005	2203	4300	6503	12564120	SO:0001583	missense	80824	exon3			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.310C>A	12.37:g.12672853G>T	ENSP00000228862:p.Leu104Ile	Somatic		Capture	SOLID	Phase_I	12564120	NM_030640	Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	ENST00000228862.2	37	CCDS8650.1	.	.	.	.	.	.	.	.	.	.	G	33	5.238296	0.95240	2.27E-4	0.0	ENSG00000111266	ENST00000228862;ENST00000298573	T;T	0.46063	0.88;0.88	5.75	5.75	0.90469	Rhodanese-like (5);	0.000000	0.44902	D	0.000415	T	0.64616	0.2614	M	0.72353	2.195	0.58432	D	0.999998	P	0.36495	0.556	P	0.54460	0.753	T	0.63607	-0.6599	10	0.72032	D	0.01	.	19.9598	0.97242	0.0:0.0:1.0:0.0	.	104	Q9BY84	DUS16_HUMAN	I	104	ENSP00000228862:L104I;ENSP00000298573:L104I	ENSP00000228862:L104I	L	-	1	0	DUSP16	12564120	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.960000	0.76036	2.716000	0.92895	0.655000	0.94253	CTC		0.438	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	NM_030640	
DHX37	57647	hgsc.bcm.edu	37	12	125467168	125467168	+	Splice_Site	SNP	C	C	T	rs575837056		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:125467168C>T	ENST00000308736.2	-	3	376	c.278G>A	c.(277-279)cGa>cAa	p.R93Q	DHX37_ENST00000544745.1_5'Flank	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	93							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.R93Q(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CATCTCTGCTCGCTGGGAAAG	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		21334	0.0		0.001	False		,,,				2504	0.0				p.R93Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G278A	12						.						182.0	169.0	173.0					12																	125467168		2203	4300	6503	124033121	SO:0001630	splice_region_variant	57647	exon3			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.277-1G>A	12.37:g.125467168C>T		Somatic		Capture	SOLID	Phase_I	124033121	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176884	0.78564	.	.	ENSG00000150990	ENST00000308736	T	0.09911	2.93	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.37945	0.1022	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.33701	-0.9858	10	0.87932	D	0	-2.4543	17.3984	0.87452	0.0:1.0:0.0:0.0	.	93	Q8IY37	DHX37_HUMAN	Q	93	ENSP00000311135:R93Q	ENSP00000311135:R93Q	R	-	2	0	DHX37	124033121	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	6.368000	0.73104	2.382000	0.81193	0.462000	0.41574	CGA		0.458	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	Missense_Mutation
EP400	57634	hgsc.bcm.edu	37	12	132508377	132508377	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:132508377C>T	ENST00000333577.4	+	25	4963	c.4854C>T	c.(4852-4854)cgC>cgT	p.R1618R	EP400_ENST00000332482.4_Silent_p.R1545R|EP400_ENST00000330386.6_Silent_p.R1501R|EP400_ENST00000389562.2_Silent_p.R1581R|EP400_ENST00000389561.2_Silent_p.R1582R			Q96L91	EP400_HUMAN	E1A binding protein p400	1618					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R1581R(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CACAGAGCCGCGTGGCTCAGC	0.567																																					p.R1581R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4743T	12						.						49.0	51.0	50.0					12																	132508377		2203	4300	6503	131074330	SO:0001819	synonymous_variant	57634	exon24			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.4854C>T	12.37:g.132508377C>T		Somatic		Capture	SOLID	Phase_I	131074330	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																					0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
POLE	5426	hgsc.bcm.edu	37	12	133202250	133202250	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:133202250G>A	ENST00000320574.5	-	47	6681	c.6638C>T	c.(6637-6639)gCc>gTc	p.A2213V	POLE_ENST00000535270.1_Missense_Mutation_p.A2186V	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	2213			A -> V (found in a colorectal sample; somatic mutation). {ECO:0000269|PubMed:23263490}.		base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.A2213V(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CAGGGTGAAGGCCATCAGCTT	0.637								DNA polymerases (catalytic subunits)																													p.A2213V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6638T	12						.						142.0	132.0	136.0					12																	133202250		2203	4300	6503	131712323	SO:0001583	missense	5426	exon47				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.6638C>T	12.37:g.133202250G>A	ENSP00000322570:p.Ala2213Val	Somatic		Capture	SOLID	Phase_I	131712323	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986103	0.74589	.	.	ENSG00000177084	ENST00000434528;ENST00000320574;ENST00000455752;ENST00000320557;ENST00000535270	T;T;T	0.22945	1.93;1.93;1.93	5.74	5.74	0.90152	.	0.102125	0.64402	D	0.000002	T	0.34774	0.0909	M	0.69823	2.125	0.58432	D	0.999999	B;B	0.29571	0.249;0.193	B;B	0.28385	0.064;0.089	T	0.14364	-1.0475	10	0.62326	D	0.03	.	19.919	0.97077	0.0:0.0:1.0:0.0	.	2213;423	Q07864;B3KS74	DPOE1_HUMAN;.	V	423;2213;2224;128;2186	ENSP00000322570:A2213V;ENSP00000406383:A2224V;ENSP00000445753:A2186V	ENSP00000322473:A128V	A	-	2	0	POLE	131712323	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.318000	0.79029	2.712000	0.92718	0.561000	0.74099	GCC		0.637	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
POLE	5426	hgsc.bcm.edu	37	12	133237591	133237591	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:133237591C>A	ENST00000320574.5	-	25	3067	c.3024G>T	c.(3022-3024)aaG>aaT	p.K1008N	POLE_ENST00000535270.1_Missense_Mutation_p.K981N	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1008			K -> N (found in a colorectal sample; somatic mutation). {ECO:0000269|PubMed:23263490}.		base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.K1008N(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	AGTCAGCCACCTTGGCTACAG	0.572								DNA polymerases (catalytic subunits)																													p.K1008N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3024T	12						.						146.0	137.0	140.0					12																	133237591		2203	4300	6503	131747664	SO:0001583	missense	5426	exon25				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.3024G>T	12.37:g.133237591C>A	ENSP00000322570:p.Lys1008Asn	Somatic		Capture	SOLID	Phase_I	131747664	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559131	0.65538	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	5.08	1.07	0.20283	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.21590	0.0520	M	0.63169	1.94	0.53688	D	0.999978	B;B	0.24823	0.112;0.033	B;B	0.28385	0.054;0.089	T	0.05954	-1.0854	10	0.46703	T	0.11	.	9.901	0.41348	0.0:0.6291:0.0:0.3709	.	981;1008	F5H1D6;Q07864	.;DPOE1_HUMAN	N	1008;1019;981;788;943	ENSP00000322570:K1008N;ENSP00000406383:K1019N;ENSP00000445753:K981N;ENSP00000442519:K788N	ENSP00000322570:K1008N	K	-	3	2	POLE	131747664	0.994000	0.37717	1.000000	0.80357	0.982000	0.71751	0.381000	0.20619	0.256000	0.21614	0.591000	0.81541	AAG		0.572	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
POLE	5426	hgsc.bcm.edu	37	12	133244124	133244124	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:133244124G>A	ENST00000320574.5	-	20	2327	c.2284C>T	c.(2284-2286)Cgg>Tgg	p.R762W	POLE_ENST00000535270.1_Missense_Mutation_p.R735W	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	762			R -> W (found in a colorectal sample; somatic mutation). {ECO:0000269|PubMed:23263490}.		base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.R762W(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CGCCTGTCCCGGAAGGCACGC	0.567								DNA polymerases (catalytic subunits)																													p.R762W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2284T	12						.						224.0	196.0	205.0					12																	133244124		2203	4300	6503	131754197	SO:0001583	missense	5426	exon20				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2284C>T	12.37:g.133244124G>A	ENSP00000322570:p.Arg762Trp	Somatic		Capture	SOLID	Phase_I	131754197	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035212	0.75617	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	5.86	4.95	0.65309	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.54255	0.1847	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69183	-0.5212	10	0.87932	D	0	.	13.9856	0.64334	0.0:0.0:0.5995:0.4005	.	735;762	F5H1D6;Q07864	.;DPOE1_HUMAN	W	762;773;735;542;697	ENSP00000322570:R762W;ENSP00000406383:R773W;ENSP00000445753:R735W;ENSP00000442519:R542W	ENSP00000322570:R762W	R	-	1	2	POLE	131754197	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.282000	0.33226	1.433000	0.47394	0.558000	0.71614	CGG		0.567	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
SLC6A13	6540	hgsc.bcm.edu	37	12	333225	333225	+	Missense_Mutation	SNP	C	C	T	rs145646067	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:333225C>T	ENST00000343164.4	-	11	1296	c.1244G>A	c.(1243-1245)cGg>cAg	p.R415Q	SLC6A13_ENST00000539668.1_5'UTR|SLC6A13_ENST00000445055.2_Missense_Mutation_p.R323Q	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	415					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.R415Q(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GACTTCCCTCCGGTTCTTCTT	0.572													C|||	31	0.0061901	0.0234	0.0	5008	,	,		22435	0.0		0.0	False		,,,				2504	0.0				p.R323Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G968A	12						.	C	GLN/ARG,GLN/ARG	94,4312	75.7+/-113.9	0,94,2109	124.0	105.0	112.0		968,1244	5.5	1.0	12	dbSNP_134	112	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	SLC6A13	NM_001190997.2,NM_016615.4	43,43	0,96,6407	TT,TC,CC		0.0233,2.1335,0.7381	probably-damaging,probably-damaging	323/511,415/603	333225	96,12910	2203	4300	6503	203486	SO:0001583	missense	6540	exon9			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1244G>A	12.37:g.333225C>T	ENSP00000339260:p.Arg415Gln	Somatic		Capture	SOLID	Phase_I	203486	NM_001190997	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	CCDS8502.1	14	0.00641025641025641	14	0.028455284552845527	0	0.0	0	0.0	0	0.0	C	25.5	4.644685	0.87859	0.021335	2.33E-4	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	T;T	0.75050	-0.9;-0.9	5.5	5.5	0.81552	.	0.053671	0.85682	D	0.000000	T	0.75170	0.3813	M	0.85945	2.785	0.80722	D	1	D;P;P	0.89917	1.0;0.953;0.953	D;P;P	0.78314	0.991;0.774;0.774	T	0.83253	-0.0052	10	0.52906	T	0.07	.	19.3766	0.94512	0.0:1.0:0.0:0.0	.	323;394;415	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	Q	323;394;415	ENSP00000407104:R323Q;ENSP00000339260:R415Q	ENSP00000318097:R394Q	R	-	2	0	SLC6A13	203486	1.000000	0.71417	1.000000	0.80357	0.252000	0.25951	4.933000	0.63484	2.596000	0.87737	0.491000	0.48974	CGG		0.572	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
ERC1	23085	hgsc.bcm.edu	37	12	1599351	1599351	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:1599351C>T	ENST00000397203.2	+	19	3712	c.3306C>T	c.(3304-3306)ccC>ccT	p.P1102P	ERC1_ENST00000589028.1_Silent_p.P1102P|ERC1_ENST00000543086.3_Silent_p.P1074P|ERC1_ENST00000355446.5_3'UTR|ERC1_ENST00000546231.2_Silent_p.P1106P|ERC1_ENST00000360905.4_Silent_p.P1102P			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	1102	FIP-RBD. {ECO:0000255|PROSITE- ProRule:PRU00844}.				I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)	p.P1102P(2)		NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			ACCATTGTCCCGACATCCTAG	0.512																																					p.P1074P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C3222T	12						.						90.0	74.0	79.0					12																	1599351		2203	4300	6503	1469612	SO:0001819	synonymous_variant	23085	exon18			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.3306C>T	12.37:g.1599351C>T		Somatic		Capture	SOLID	Phase_I	1469612	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Silent	SNP	ENST00000397203.2	37	CCDS8508.1																																																																																				0.512	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
CCND2	894	hgsc.bcm.edu	37	12	4409173	4409173	+	Nonstop_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:4409173T>C	ENST00000261254.3	+	5	1137	c.868T>C	c.(868-870)Tga>Cga	p.*290R		NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	0					cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.*290R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			TATCGACCTGTGAGGATGCCA	0.507			T	IGL@	"""NHL,CLL"""																																p.X290R			Dom	yes		12	12p13	894	cyclin D2		L	.	.	1	Nonstop extension(1)	large_intestine(1)	c.T868C	12						.						69.0	53.0	58.0					12																	4409173		2203	4300	6503	4279434	SO:0001578	stop_lost	894	exon5			AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.868T>C	12.37:g.4409173T>C	ENSP00000261254:p.*290Argext*13	Somatic		Capture	SOLID	Phase_I	4279434	NM_001759	A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	37	CCDS8524.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098739	0.56183	.	.	ENSG00000118971	ENST00000261254	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8223	0.63329	0.0:0.0:0.0:1.0	.	.	.	.	R	290	.	.	X	+	1	0	CCND2	4279434	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.303000	0.78871	1.865000	0.54081	0.460000	0.39030	TGA		0.507	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	NM_001759	
CLSTN3	9746	hgsc.bcm.edu	37	12	7295517	7295517	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:7295517C>T	ENST00000266546.6	+	11	2043	c.1593C>T	c.(1591-1593)agC>agT	p.S531S	CLSTN3_ENST00000537408.1_Silent_p.S543S	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	531					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.S531S(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CTGGTTTCAGCGTGCGCTCAG	0.592													C|||	1	0.000199681	0.0008	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0				p.S531S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1593T	12						.						122.0	93.0	102.0					12																	7295517		2203	4300	6503	7186784	SO:0001819	synonymous_variant	9746	exon11			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1593C>T	12.37:g.7295517C>T		Somatic		Capture	SOLID	Phase_I	7186784	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	37	CCDS8575.1																																																																																				0.592	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
CD163L1	283316	hgsc.bcm.edu	37	12	7585977	7585977	+	Silent	SNP	G	G	A	rs117072358	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:7585977G>A	ENST00000313599.3	-	3	495	c.438C>T	c.(436-438)aaC>aaT	p.N146N	CD163L1_ENST00000396630.1_Silent_p.N146N|CD163L1_ENST00000416109.2_Silent_p.N146N			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	146	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.N146K(1)|p.N146N(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TACCATAACAGTTCACACCAA	0.428													G|||	40	0.00798722	0.0008	0.0115	5008	,	,		-128	0.0		0.0268	False		,,,				2504	0.0041				p.N146N												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C438T	12						.	G		6,4400	9.9+/-24.2	0,6,2197	106.0	98.0	101.0		438	-3.1	0.0	12	dbSNP_132	101	123,8477	63.1+/-125.2	1,121,4178	no	coding-synonymous	CD163L1	NM_174941.4		1,127,6375	AA,AG,GG		1.4302,0.1362,0.9918		146/1454	7585977	129,12877	2203	4300	6503	7477244	SO:0001819	synonymous_variant	283316	exon3			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.438C>T	12.37:g.7585977G>A		Somatic		Capture	SOLID	Phase_I	7477244	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	ENST00000313599.3	37	CCDS8577.1																																																																																				0.428	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
CLEC2D	29121	hgsc.bcm.edu	37	12	9840599	9840599	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:9840599G>A	ENST00000290855.6	+	3	296	c.274G>A	c.(274-276)Gac>Aac	p.D92N	CLEC2D_ENST00000261340.7_Missense_Mutation_p.D92N|CLEC2D_ENST00000261339.6_Missense_Mutation_p.D55N|CLEC2D_ENST00000543300.1_Missense_Mutation_p.D92N|CLEC2D_ENST00000545918.1_Missense_Mutation_p.D55N	NM_013269.5	NP_037401.1	Q9UHP7	CLC2D_HUMAN	C-type lectin domain family 2, member D	92	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.D92N(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)|stomach(1)	9						TTTTTCTGATGACACCAAGAA	0.413																																					p.D92N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G274A	12						.						84.0	83.0	83.0					12																	9840599		2203	4300	6503	9731866	SO:0001583	missense	29121	exon3			AF133299	CCDS8602.1, CCDS31741.1, CCDS55800.1, CCDS55801.1, CCDS55802.1	12p13.31	2011-05-24	2005-09-29		ENSG00000069493	ENSG00000069493		"""C-type lectin domain containing"""	14351	protein-coding gene	gene with protein product	"""C-type lectin related f"", ""lectin-like transcript 1"""	605659	"""C-type lectin superfamily 2, member D"""				Standard	NM_013269		Approved	LLT1, CLAX, OCIL	uc001qwf.3	Q9UHP7	OTTHUMG00000168369	ENST00000290855.6:c.274G>A	12.37:g.9840599G>A	ENSP00000290855:p.Asp92Asn	Somatic		Capture	SOLID	Phase_I	9731866	NM_001197318	D6CI39|D6CI40|D6CI41|Q6YID5|Q8WUP7|Q9HD37|Q9HD38	Missense_Mutation	SNP	ENST00000290855.6	37	CCDS8602.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675774	0.47781	.	.	ENSG00000069493	ENST00000479410;ENST00000261340;ENST00000290855;ENST00000545918;ENST00000543300;ENST00000261339;ENST00000466035;ENST00000430909;ENST00000544322;ENST00000460309	T;T;T;T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01	3.82	1.95	0.26073	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.481383	0.14761	U	0.299990	T	0.46190	0.1380	M	0.71920	2.185	0.09310	N	1	B;P;P	0.42123	0.383;0.771;0.729	P;P;P	0.47251	0.542;0.449;0.542	T	0.31475	-0.9942	9	.	.	.	-7.3202	6.3486	0.21363	0.2467:0.0:0.7533:0.0	.	92;92;92	Q9UHP7-5;Q9UHP7;Q9UHP7-3	.;CLC2D_HUMAN;.	N	50;92;92;55;92;55;49;71;66;35	ENSP00000442252:D50N;ENSP00000261340:D92N;ENSP00000290855:D92N;ENSP00000444818:D55N;ENSP00000443065:D92N;ENSP00000261339:D55N;ENSP00000446028:D49N;ENSP00000413045:D71N;ENSP00000437861:D66N;ENSP00000443177:D35N	.	D	+	1	0	CLEC2D	9731866	0.000000	0.05858	0.004000	0.12327	0.189000	0.23516	0.356000	0.20181	0.361000	0.24292	0.430000	0.28490	GAC		0.413	CLEC2D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000335424.2	NM_013269	
ABCD2	225	hgsc.bcm.edu	37	12	40013066	40013066	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:40013066T>C	ENST00000308666.3	-	1	487	c.352A>G	c.(352-354)Acc>Gcc	p.T118A		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	118	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.T118A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						GAAAGAAAGGTTCTTGAGATT	0.418																																					p.T118A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A352G	12						.						78.0	80.0	79.0					12																	40013066		2203	4300	6503	38299333	SO:0001583	missense	225	exon1			U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.352A>G	12.37:g.40013066T>C	ENSP00000310688:p.Thr118Ala	Somatic		Capture	SOLID	Phase_I	38299333	NM_005164	B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.298917	0.60195	.	.	ENSG00000173208	ENST00000308666	D	0.99719	-6.52	4.83	3.69	0.42338	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.056275	0.64402	D	0.000001	D	0.99585	0.9850	M	0.86502	2.82	0.51767	D	0.999938	D	0.63880	0.993	D	0.63381	0.914	D	0.98537	1.0630	9	.	.	.	-26.9415	10.4274	0.44387	0.0:0.0763:0.0:0.9237	.	118	Q9UBJ2	ABCD2_HUMAN	A	118	ENSP00000310688:T118A	.	T	-	1	0	ABCD2	38299333	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.684000	0.68197	0.883000	0.36040	0.533000	0.62120	ACC		0.418	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164	
KRT79	338785	hgsc.bcm.edu	37	12	53216897	53216897	+	Missense_Mutation	SNP	G	G	A	rs200262123		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:53216897G>A	ENST00000330553.5	-	7	1304	c.1270C>T	c.(1270-1272)Cgg>Tgg	p.R424W		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	424	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)	p.R424W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CGCAGCAGCCGTGTCAGGTCC	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		18812	0.0		0.001	False		,,,				2504	0.0				p.R424W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1270T	12						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	98.0	90.0	93.0		1270	3.9	1.0	12		93	0,8600		0,0,4300	no	missense	KRT79	NM_175834.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	424/536	53216897	1,13005	2203	4300	6503	51503164	SO:0001583	missense	338785	exon7			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.1270C>T	12.37:g.53216897G>A	ENSP00000328358:p.Arg424Trp	Somatic		Capture	SOLID	Phase_I	51503164	NM_175834	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	CCDS8839.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	15.26	2.780759	0.49891	2.27E-4	0.0	ENSG00000185640	ENST00000330553;ENST00000549255	T;D	0.90444	-0.54;-2.67	3.92	3.92	0.45320	Filament (1);	0.211247	0.24074	N	0.041800	D	0.95573	0.8561	M	0.86953	2.85	0.50171	D	0.999852	D	0.89917	1.0	D	0.74023	0.982	D	0.96269	0.9197	10	0.87932	D	0	.	16.1945	0.82018	0.0:0.0:1.0:0.0	.	424	Q5XKE5	K2C79_HUMAN	W	424;10	ENSP00000328358:R424W;ENSP00000449159:R10W	ENSP00000328358:R424W	R	-	1	2	KRT79	51503164	0.979000	0.34478	0.998000	0.56505	0.063000	0.16089	2.532000	0.45659	2.481000	0.83766	0.555000	0.69702	CGG		0.612	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
SP1	6667	hgsc.bcm.edu	37	12	53777224	53777224	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:53777224G>A	ENST00000327443.4	+	3	1591	c.1493G>A	c.(1492-1494)aGc>aAc	p.S498N	SP1_ENST00000426431.2_Missense_Mutation_p.S491N	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	498	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S498N(1)		breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		ACCAGCAGCAGCAACACCACT	0.557																																					p.S498N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1493A	12						.						198.0	168.0	178.0					12																	53777224		2203	4300	6503	52063491	SO:0001583	missense	6667	exon3			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1493G>A	12.37:g.53777224G>A	ENSP00000329357:p.Ser498Asn	Somatic		Capture	SOLID	Phase_I	52063491	NM_138473	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	37	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350540	0.24512	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.08720	3.08;3.06	4.67	4.67	0.58626	.	0.092717	0.45606	D	0.000359	T	0.05502	0.0145	N	0.19112	0.55	0.32370	N	0.555944	B	0.24963	0.115	B	0.21151	0.033	T	0.17349	-1.0372	10	0.16420	T	0.52	.	11.759	0.51892	0.0:0.2917:0.7083:0.0	.	498	P08047	SP1_HUMAN	N	498;491	ENSP00000329357:S498N;ENSP00000404263:S491N	ENSP00000329357:S498N	S	+	2	0	SP1	52063491	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	3.617000	0.54181	2.595000	0.87683	0.467000	0.42956	AGC		0.557	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1		
CALCOCO1	57658	hgsc.bcm.edu	37	12	54118962	54118962	+	Missense_Mutation	SNP	C	C	T	rs201880686		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:54118962C>T	ENST00000550804.1	-	2	125	c.65G>A	c.(64-66)cGg>cAg	p.R22Q	CALCOCO1_ENST00000547885.1_5'UTR|CALCOCO1_ENST00000262059.4_Missense_Mutation_p.R22Q|CALCOCO1_ENST00000430117.2_Missense_Mutation_p.R22Q|CALCOCO1_ENST00000548263.1_Missense_Mutation_p.R22Q			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	22	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.|p300 KIX-binding. {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.R22Q(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						GATGTAGGTCCGGGCTACATT	0.527																																					p.R22Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G65A	12						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	200.0	154.0	170.0		65,65	4.0	1.0	12		170	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	CALCOCO1	NM_001143682.1,NM_020898.2	43,43	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign,benign	22/607,22/692	54118962	3,13003	2203	4300	6503	52405229	SO:0001583	missense	57658	exon2			AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.65G>A	12.37:g.54118962C>T	ENSP00000449960:p.Arg22Gln	Somatic		Capture	SOLID	Phase_I	52405229	NM_020898	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Missense_Mutation	SNP	ENST00000550804.1	37	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114742	0.77210	2.27E-4	2.33E-4	ENSG00000012822	ENST00000430117;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000551900;ENST00000546619;ENST00000547949;ENST00000553154;ENST00000549784;ENST00000549173;ENST00000548177;ENST00000552623;ENST00000549349;ENST00000549688;ENST00000547885;ENST00000548431	T;T;T;T;T;T;T;T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9	4.86	3.96	0.45880	.	0.000000	0.41097	D	0.000941	T	0.07413	0.0187	N	0.04508	-0.205	0.28414	N	0.918042	D;P;D;P;D	0.69078	0.997;0.888;0.993;0.864;0.994	P;B;P;B;P	0.52109	0.69;0.222;0.506;0.142;0.639	T	0.14035	-1.0487	10	0.32370	T	0.25	-22.52	7.406	0.26991	0.0:0.5861:0.3275:0.0863	.	22;22;22;22;22	B4DG60;E9PAU0;Q9P1Z2-3;Q9P1Z2-2;Q9P1Z2	.;.;.;.;CACO1_HUMAN	Q	22	ENSP00000397189:R22Q;ENSP00000262059:R22Q;ENSP00000447647:R22Q;ENSP00000449960:R22Q;ENSP00000450083:R22Q;ENSP00000448621:R22Q;ENSP00000447117:R22Q;ENSP00000449058:R22Q;ENSP00000446820:R22Q;ENSP00000448026:R22Q;ENSP00000450012:R22Q;ENSP00000449796:R22Q	ENSP00000262059:R22Q	R	-	2	0	CALCOCO1	52405229	0.539000	0.26402	1.000000	0.80357	0.998000	0.95712	1.060000	0.30530	1.413000	0.46997	0.655000	0.94253	CGG		0.527	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
PAN2	9924	hgsc.bcm.edu	37	12	56719182	56719182	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:56719182A>G	ENST00000425394.2	-	9	1792	c.1416T>C	c.(1414-1416)acT>acC	p.T472T	PAN2_ENST00000548043.1_Silent_p.T472T|PAN2_ENST00000440411.3_Silent_p.T472T|PAN2_ENST00000257931.5_Silent_p.T472T	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.T472T(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CTGGTGACTCAGTGACCTGGC	0.493																																					p.T472T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1416C	12						.						187.0	146.0	160.0					12																	56719182		2203	4300	6503	55005449	SO:0001819	synonymous_variant	9924	exon9			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1416T>C	12.37:g.56719182A>G		Somatic		Capture	SOLID	Phase_I	55005449	NM_001166279		Silent	SNP	ENST00000425394.2	37	CCDS44922.1																																																																																				0.493	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
AGAP2	116986	hgsc.bcm.edu	37	12	58124351	58124351	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:58124351C>T	ENST00000547588.1	-	12	2354	c.2355G>A	c.(2353-2355)ctG>ctA	p.L785L	AGAP2_ENST00000257897.3_Silent_p.L449L	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	785	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)	p.L449L(1)		breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GTGGTGGCTGCAGGGAACTGG	0.577																																					p.L449L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1347A	12						.						168.0	167.0	168.0					12																	58124351		2203	4300	6503	56410618	SO:0001819	synonymous_variant	116986	exon12			AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2355G>A	12.37:g.58124351C>T		Somatic		Capture	SOLID	Phase_I	56410618	NM_014770	A8K9F7|O00578|Q548E0|Q8IWU3	Silent	SNP	ENST00000547588.1	37	CCDS44932.1	.	.	.	.	.	.	.	.	.	.	C	7.914	0.737088	0.15574	.	.	ENSG00000135439	ENST00000328568	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	T	0.58495	0.2126	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55276	-0.8166	4	.	.	.	.	8.7219	0.34445	0.0:0.8977:0.0:0.1023	.	.	.	.	T	649	.	.	A	-	1	0	AGAP2	56410618	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.428000	0.34892	2.527000	0.85204	0.561000	0.74099	GCA		0.577	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
SLC16A7	9194	hgsc.bcm.edu	37	12	60168909	60168909	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:60168909A>T	ENST00000261187.4	+	4	997	c.833A>T	c.(832-834)gAt>gTt	p.D278V	SLC16A7_ENST00000547379.1_Missense_Mutation_p.D278V|SLC16A7_ENST00000543448.1_Missense_Mutation_p.D179V|SLC16A7_ENST00000552024.1_Missense_Mutation_p.D278V|SLC16A7_ENST00000552432.1_Missense_Mutation_p.D278V	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	278					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.D278V(1)		endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	CAAGGAATTGATGAGTACTCG	0.383																																					p.D278V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A833T	12						.						94.0	94.0	94.0					12																	60168909		2203	4300	6503	58455176	SO:0001583	missense	9194	exon4			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.833A>T	12.37:g.60168909A>T	ENSP00000261187:p.Asp278Val	Somatic		Capture	SOLID	Phase_I	58455176	NM_004731	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.883099	0.51908	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187;ENST00000543448	D;D;D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56;-1.56;-1.56	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.045639	0.85682	D	0.000000	D	0.91054	0.7185	M	0.86178	2.8	0.80722	D	1	D	0.63880	0.993	P	0.62089	0.898	D	0.91837	0.5480	9	.	.	.	.	16.3786	0.83431	1.0:0.0:0.0:0.0	.	278	O60669	MOT2_HUMAN	V	278;278;278;278;278;179	ENSP00000449547:D278V;ENSP00000448071:D278V;ENSP00000448742:D278V;ENSP00000446722:D278V;ENSP00000261187:D278V;ENSP00000443731:D179V	.	D	+	2	0	SLC16A7	58455176	1.000000	0.71417	0.989000	0.46669	0.008000	0.06430	9.287000	0.95975	2.323000	0.78572	0.528000	0.53228	GAT		0.383	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
LEMD3	23592	hgsc.bcm.edu	37	12	65612390	65612390	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:65612390G>A	ENST00000308330.2	+	4	1712	c.1686G>A	c.(1684-1686)gcG>gcA	p.A562A		NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	562					negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.A562A(1)		breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		AGGCAGCTGCGTATTTAAAAG	0.279																																					p.A562A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1686A	12						.						34.0	33.0	34.0					12																	65612390		2203	4297	6500	63898657	SO:0001819	synonymous_variant	23592	exon4			AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.1686G>A	12.37:g.65612390G>A		Somatic		Capture	SOLID	Phase_I	63898657	NM_014319	Q9NT47|Q9NYA5	Silent	SNP	ENST00000308330.2	37	CCDS8972.1																																																																																				0.279	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2		
DCN	1634	hgsc.bcm.edu	37	12	91572304	91572306	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	AGA	AGA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:91572304_91572306delAGA	ENST00000052754.5	-	2	525_527	c.24_26delTCT	c.(22-27)cttctg>ctg	p.8_9LL>L	DCN_ENST00000550099.1_In_Frame_Del_p.8_9LL>L|DCN_ENST00000425043.1_In_Frame_Del_p.8_9LL>L|DCN_ENST00000228329.5_In_Frame_Del_p.8_9LL>L|DCN_ENST00000303320.3_In_Frame_Del_p.8_9LL>L|DCN_ENST00000548768.1_5'Flank|DCN_ENST00000547568.2_In_Frame_Del_p.8_9LL>L|DCN_ENST00000546370.1_In_Frame_Del_p.8_9LL>L|DCN_ENST00000420120.2_In_Frame_Del_p.8_9LL>L|DCN_ENST00000456569.2_In_Frame_Del_p.8_9LL>L|DCN_ENST00000546745.1_In_Frame_Del_p.8_9LL>L|DCN_ENST00000551354.1_In_Frame_Del_p.8_9LL>L|DCN_ENST00000552962.1_In_Frame_Del_p.8_9LL>L|DCN_ENST00000393155.1_In_Frame_Del_p.8_9LL>L|DCN_ENST00000441303.2_In_Frame_Del_p.8_9LL>L	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	8					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)	p.L10delL(1)		central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						TTGTGCAAGCAGAAGGAGGATGA	0.433											OREG0022021	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.8_9del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.24_26del	12						.																																			90096437	SO:0001651	inframe_deletion	1634	exon2			AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.24_26delTCT	12.37:g.91572304_91572306delAGA	ENSP00000052754:p.Leu10del	Somatic	1283	Capture	SOLID	Phase_I	90096435	NM_001920	Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	In_Frame_Del	DEL	ENST00000052754.5	37	CCDS9039.1																																																																																				0.433	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507	
HAL	3034	hgsc.bcm.edu	37	12	96389491	96389491	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:96389491G>A	ENST00000261208.3	-	2	566	c.198C>T	c.(196-198)aaC>aaT	p.N66N	RP11-256L6.3_ENST00000551849.1_RNA|HAL_ENST00000541929.1_De_novo_Start_OutOfFrame|HAL_ENST00000538703.1_Silent_p.N66N	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	66					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)	p.N66N(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	GCCGGTCCTCGTTGTCCAGCA	0.622																																					p.N66N	NSCLC(169;943 2815 23563 30031)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C198T	12						.						61.0	54.0	56.0					12																	96389491		2203	4300	6503	94913622	SO:0001819	synonymous_variant	3034	exon2				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.198C>T	12.37:g.96389491G>A		Somatic		Capture	SOLID	Phase_I	94913622	NM_002108	B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Silent	SNP	ENST00000261208.3	37	CCDS9058.1																																																																																				0.622	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408644.1		
CHFR	55743	hgsc.bcm.edu	37	12	133435802	133435802	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:133435802C>T	ENST00000432561.2	-	8	872	c.799G>A	c.(799-801)Gac>Aac	p.D267N	CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000266880.7_Missense_Mutation_p.D267N|CHFR_ENST00000443047.2_Missense_Mutation_p.D175N|CHFR_ENST00000315585.7_Missense_Mutation_p.D226N|CHFR_ENST00000450056.2_Missense_Mutation_p.D255N|CHFR_ENST00000537522.1_5'Flank			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	267					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D226N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		CCGTTCAGGTCAAGGTCCCCA	0.552																																					p.D226N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G676A	12						.						172.0	124.0	141.0					12																	133435802		2203	4300	6503	131945875	SO:0001583	missense	55743	exon8			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.799G>A	12.37:g.133435802C>T	ENSP00000392395:p.Asp267Asn	Somatic		Capture	SOLID	Phase_I	131945875	NM_018223	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	37	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	C	7.910	0.736243	0.15574	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000541228;ENST00000432561	T;T;T;T;T	0.18174	2.49;2.23;2.53;2.24;2.51	4.16	-3.67	0.04476	.	1.127760	0.06465	N	0.730052	T	0.07638	0.0192	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.0	B;B;B;B;B	0.12837	0.002;0.003;0.001;0.006;0.008	T	0.36456	-0.9747	10	0.40728	T	0.16	-5.6093	2.0727	0.03617	0.2145:0.1335:0.113:0.5391	.	175;267;267;255;226	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	N	226;175;255;267;67;267	ENSP00000320557:D226N;ENSP00000416431:D175N;ENSP00000398735:D255N;ENSP00000266880:D267N;ENSP00000392395:D267N	ENSP00000266880:D267N	D	-	1	0	CHFR	131945875	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.390000	0.07332	-0.437000	0.07243	0.549000	0.68633	GAC		0.552	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2		
PPP1R14D	54866	hgsc.bcm.edu	37	15	41120653	41120653	+	Missense_Mutation	SNP	G	G	A	rs373800458		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:41120653G>A	ENST00000299174.5	-	1	254	c.187C>T	c.(187-189)Cgg>Tgg	p.R63W	PPP1R14D_ENST00000427255.2_Missense_Mutation_p.R63W	NM_017726.7	NP_060196.1	Q9NXH3	PP14D_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14D	63					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)	p.R63W(1)		breast(1)|large_intestine(2)|lung(2)|skin(1)	6		all_cancers(109;6.29e-14)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.88e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		AGCTGGCCCCGGTCATACTTC	0.592																																					p.R63W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C187T	15						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	73.0	74.0	73.0		187,187	2.6	1.0	15		73	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PPP1R14D	NM_001130143.1,NM_017726.7	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	63/201,63/146	41120653	1,13005	2203	4300	6503	38907945	SO:0001583	missense	54866	exon1			AK000258	CCDS10066.1, CCDS45230.1	15q11.2-q14	2012-04-17			ENSG00000166143	ENSG00000166143		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14953	protein-coding gene	gene with protein product	"""gut and brain phosphatase inhibitor 1"", ""PKC-dependent PP1 inhibitory protein"""	613256				11948623	Standard	NM_017726		Approved	CPI17-like, FLJ20251, GBPI-1, MGC119014, MGC119016	uc001zmz.3	Q9NXH3	OTTHUMG00000130064	ENST00000299174.5:c.187C>T	15.37:g.41120653G>A	ENSP00000299174:p.Arg63Trp	Somatic		Capture	SOLID	Phase_I	38907945	NM_001130143	Q4V773	Missense_Mutation	SNP	ENST00000299174.5	37	CCDS10066.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262650	0.59431	0.0	1.16E-4	ENSG00000166143	ENST00000299174;ENST00000427255	.	.	.	5.58	2.64	0.31445	.	0.462653	0.18342	N	0.144154	T	0.69593	0.3128	M	0.79614	2.46	0.38874	D	0.956754	B;D	0.76494	0.155;0.999	B;D	0.63033	0.019;0.91	T	0.69343	-0.5170	9	0.87932	D	0	-6.0977	6.5831	0.22607	0.0832:0.0:0.5977:0.3191	.	63;63	E9PAT1;Q9NXH3	.;PP14D_HUMAN	W	63	.	ENSP00000299174:R63W	R	-	1	2	PPP1R14D	38907945	0.989000	0.36119	0.990000	0.47175	0.763000	0.43281	2.213000	0.42844	0.310000	0.22990	-0.913000	0.02753	CGG		0.592	PPP1R14D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252355.2	NM_017726	
UBR1	197131	hgsc.bcm.edu	37	15	43276155	43276155	+	Missense_Mutation	SNP	C	C	T	rs557063833		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:43276155C>T	ENST00000290650.4	-	37	4168	c.4090G>A	c.(4090-4092)Gca>Aca	p.A1364T	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1364					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A1364T(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ATCCTCTGTGCAACTGCAAAC	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		12607	0.001		0.0	False		,,,				2504	0.0				p.A1364T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4090A	15						.						79.0	70.0	73.0					15																	43276155		2203	4299	6502	41063447	SO:0001583	missense	197131	exon37				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.4090G>A	15.37:g.43276155C>T	ENSP00000290650:p.Ala1364Thr	Somatic		Capture	SOLID	Phase_I	41063447	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.411164	0.62399	.	.	ENSG00000159459	ENST00000290650	T	0.49139	0.79	5.11	5.11	0.69529	.	0.316286	0.33419	N	0.004935	T	0.46795	0.1411	M	0.72894	2.215	0.80722	D	1	B	0.29909	0.261	B	0.25759	0.063	T	0.41251	-0.9519	10	0.18276	T	0.48	-20.9286	16.9022	0.86117	0.0:1.0:0.0:0.0	.	1364	Q8IWV7	UBR1_HUMAN	T	1364	ENSP00000290650:A1364T	ENSP00000290650:A1364T	A	-	1	0	UBR1	41063447	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.233000	0.51311	2.658000	0.90341	0.655000	0.94253	GCA		0.378	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
UBR1	197131	hgsc.bcm.edu	37	15	43335542	43335542	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:43335542A>G	ENST00000290650.4	-	15	1798	c.1720T>C	c.(1720-1722)Tgc>Cgc	p.C574R	UBR1_ENST00000382177.2_Missense_Mutation_p.C574R	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	574					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C574R(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CTGGTACTGCACCTCATCACA	0.363																																					p.C574R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1720C	15						.						161.0	141.0	147.0					15																	43335542		2203	4299	6502	41122834	SO:0001583	missense	197131	exon15				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.1720T>C	15.37:g.43335542A>G	ENSP00000290650:p.Cys574Arg	Somatic		Capture	SOLID	Phase_I	41122834	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.896634	0.72639	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.46451	0.87;0.87	4.21	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.58694	0.2140	M	0.70595	2.14	0.80722	D	1	B;D	0.89917	0.409;1.0	B;D	0.85130	0.184;0.997	T	0.57323	-0.7831	10	0.11485	T	0.65	-28.835	13.4373	0.61092	1.0:0.0:0.0:0.0	.	574;574	B4DYL2;Q8IWV7	.;UBR1_HUMAN	R	574	ENSP00000290650:C574R;ENSP00000371612:C574R	ENSP00000290650:C574R	C	-	1	0	UBR1	41122834	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.757000	0.91657	1.776000	0.52262	0.254000	0.18369	TGC		0.363	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
COPS2	9318	hgsc.bcm.edu	37	15	49420280	49420280	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:49420280C>T	ENST00000388901.5	-	13	1272	c.1199G>A	c.(1198-1200)gGc>gAc	p.G400D	COPS2_ENST00000542928.1_Missense_Mutation_p.G336D|COPS2_ENST00000299259.6_Missense_Mutation_p.G407D	NM_001143887.1|NM_004236.3	NP_001137359.1|NP_004227.1	P61201	CSN2_HUMAN	COP9 signalosome subunit 2	400	PCI.				cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)	p.G400D(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(2)	18		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		ATCAATTCGGCCATGAATAGT	0.363																																					p.G400D	NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1199A	15						.						121.0	114.0	116.0					15																	49420280		2196	4295	6491	47207572	SO:0001583	missense	9318	exon13			AF212227	CCDS32235.1, CCDS45257.1	15q21.2	2013-03-14	2013-03-14						30747	protein-coding gene	gene with protein product		604508	"""COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)"""			7776974, 9535219	Standard	NM_004236		Approved	TRIP15, ALIEN, CSN2	uc001zxh.3	P61201		ENST00000388901.5:c.1199G>A	15.37:g.49420280C>T	ENSP00000373553:p.Gly400Asp	Somatic		Capture	SOLID	Phase_I	47207572	NM_004236	O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Missense_Mutation	SNP	ENST00000388901.5	37	CCDS32235.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932384	0.73442	.	.	ENSG00000166200	ENST00000299259;ENST00000388901;ENST00000542928	T;T;T	0.55413	0.52;0.52;0.52	5.34	5.34	0.76211	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	T	0.82153	0.4975	H	0.96518	3.835	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.79784	0.993;0.993;0.993	D	0.87480	0.2420	10	0.87932	D	0	-20.3986	19.2367	0.93864	0.0:1.0:0.0:0.0	.	336;408;400	B4DIH5;Q59EL2;P61201	.;.;CSN2_HUMAN	D	407;400;336	ENSP00000299259:G407D;ENSP00000373553:G400D;ENSP00000443664:G336D	ENSP00000299259:G407D	G	-	2	0	COPS2	47207572	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.604000	0.82830	2.776000	0.95493	0.655000	0.94253	GGC		0.363	COPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417840.1	NM_004236	
DMXL2	23312	hgsc.bcm.edu	37	15	51791395	51791395	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:51791395A>G	ENST00000251076.5	-	18	4313	c.4026T>C	c.(4024-4026)ccT>ccC	p.P1342P	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Intron|DMXL2_ENST00000543779.2_Silent_p.P1342P	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1342						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.P1342P(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GTGGAAGAGTAGGGGAAAGTA	0.383																																					p.P1342P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4026C	15						.						78.0	75.0	76.0					15																	51791395		2195	4293	6488	49578687	SO:0001819	synonymous_variant	23312	exon18			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.4026T>C	15.37:g.51791395A>G		Somatic		Capture	SOLID	Phase_I	49578687	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	ENST00000251076.5	37	CCDS10141.1																																																																																				0.383	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
RNF111	54778	hgsc.bcm.edu	37	15	59368182	59368182	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:59368182T>C	ENST00000557998.1	+	7	2003	c.1716T>C	c.(1714-1716)agT>agC	p.S572S	RNF111_ENST00000434298.1_Silent_p.S572S|RNF111_ENST00000348370.4_Silent_p.S572S|RNF111_ENST00000561186.1_Silent_p.S572S|RNF111_ENST00000559209.1_Silent_p.S572S	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	572					gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S572S(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		TGAGCAACAGTGGTATCAGAA	0.413																																					p.S572S	NSCLC(72;983 1365 10746 34387 47081)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1716C	15						.						90.0	79.0	83.0					15																	59368182		2192	4291	6483	57155474	SO:0001819	synonymous_variant	54778	exon7			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1716T>C	15.37:g.59368182T>C		Somatic		Capture	SOLID	Phase_I	57155474	NM_017610	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Silent	SNP	ENST00000557998.1	37	CCDS58366.1																																																																																				0.413	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
BNIP2	663	hgsc.bcm.edu	37	15	59961161	59961161	+	Missense_Mutation	SNP	C	C	T	rs375444414		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:59961161C>T	ENST00000607373.1	-	9	1025	c.823G>A	c.(823-825)Gtg>Atg	p.V275M	BNIP2_ENST00000478981.1_5'Flank|AC092755.4_ENST00000441746.1_RNA|BNIP2_ENST00000267859.3_Missense_Mutation_p.V396M|BNIP2_ENST00000415213.2_Missense_Mutation_p.V337M	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2	275	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)	p.V275M(1)		NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						AAATTAAACACGTATCTAATT	0.308																																					p.V396M	Ovarian(174;1936 1978 6671 8240 38212)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1186A	15						.	C	MET/VAL	0,4380		0,0,2190	74.0	70.0	72.0		1186	4.0	1.0	15		72	1,8579	1.2+/-3.3	0,1,4289	no	missense	BNIP2	NM_004330.2	21	0,1,6479	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging	396/436	59961161	1,12959	2190	4290	6480	57748453	SO:0001583	missense	663	exon9			U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.823G>A	15.37:g.59961161C>T	ENSP00000475320:p.Val275Met	Somatic		Capture	SOLID	Phase_I	57748453	NM_004330	B4DS94	Missense_Mutation	SNP	ENST00000607373.1	37		.	.	.	.	.	.	.	.	.	.	C	21.1	4.104521	0.77096	0.0	1.17E-4	ENSG00000140299	ENST00000267859;ENST00000415213;ENST00000439052	T;T;T	0.66995	-0.24;-0.24;-0.24	5.82	3.96	0.45880	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	T	0.79446	0.4447	M	0.76328	2.33	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.958	T	0.79176	-0.1911	9	.	.	.	-11.603	12.4601	0.55727	0.0:0.8647:0.0:0.1353	.	275;337	Q12982;Q12982-2	BNIP2_HUMAN;.	M	396;337;153	ENSP00000267859:V396M;ENSP00000412767:V337M;ENSP00000393644:V153M	.	V	-	1	0	BNIP2	57748453	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.484000	0.81180	0.810000	0.34279	0.591000	0.81541	GTG		0.308	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470740.1	NM_004330	
VPS13C	54832	hgsc.bcm.edu	37	15	62242584	62242584	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:62242584A>C	ENST00000261517.5	-	41	4642	c.4569T>G	c.(4567-4569)atT>atG	p.I1523M	VPS13C_ENST00000395896.4_Missense_Mutation_p.I1523M|VPS13C_ENST00000249837.3_Missense_Mutation_p.I1480M|VPS13C_ENST00000395898.3_Missense_Mutation_p.I1480M	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.I1523M(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TACTGTCATGAATAGTTTTAA	0.328																																					p.I1480M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4440G	15						.						101.0	97.0	98.0					15																	62242584		2203	4300	6503	60029876	SO:0001583	missense	54832	exon39			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.4569T>G	15.37:g.62242584A>C	ENSP00000261517:p.Ile1523Met	Somatic		Capture	SOLID	Phase_I	60029876	NM_017684		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.324608	0.24080	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.23950	1.88;1.88;1.88	4.78	0.886	0.19194	.	0.759465	0.12620	N	0.453127	T	0.14184	0.0343	N	0.14661	0.345	0.27498	N	0.952065	B;B;B;P	0.44946	0.006;0.014;0.016;0.846	B;B;B;B	0.41271	0.026;0.026;0.026;0.352	T	0.12268	-1.0554	10	0.46703	T	0.11	.	6.9914	0.24758	0.6433:0.2796:0.0771:0.0	.	1480;1523;1480;1523	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	M	1480;1523;1523;1523	ENSP00000249837:I1480M;ENSP00000261517:I1523M;ENSP00000379233:I1523M	ENSP00000249837:I1480M	I	-	3	3	VPS13C	60029876	0.710000	0.27896	0.252000	0.24328	0.784000	0.44337	1.209000	0.32357	-0.044000	0.13491	0.383000	0.25322	ATT		0.328	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
ALPK3	57538	hgsc.bcm.edu	37	15	85399651	85399651	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:85399651C>A	ENST00000258888.5	+	6	2455	c.2288C>A	c.(2287-2289)cCt>cAt	p.P763H		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	763					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P763H(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ACCACGGCTCCTACCATGTCG	0.502																																					p.P763H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2288A	15						.						127.0	119.0	122.0					15																	85399651		2203	4299	6502	83200655	SO:0001583	missense	57538	exon6			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.2288C>A	15.37:g.85399651C>A	ENSP00000258888:p.Pro763His	Somatic		Capture	SOLID	Phase_I	83200655	NM_020778	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448762	0.43531	.	.	ENSG00000136383	ENST00000258888	T	0.61742	0.08	4.18	3.26	0.37387	.	1.776420	0.02870	N	0.131467	T	0.57695	0.2071	L	0.34521	1.04	0.09310	N	1	D	0.63046	0.992	P	0.52710	0.707	T	0.45673	-0.9245	10	0.17832	T	0.49	-0.2	8.0442	0.30540	0.0:0.8848:0.0:0.1152	.	763	Q96L96	ALPK3_HUMAN	H	763	ENSP00000258888:P763H	ENSP00000258888:P763H	P	+	2	0	ALPK3	83200655	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	0.657000	0.24963	0.895000	0.36342	0.563000	0.77884	CCT		0.502	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
HAPLN3	145864	hgsc.bcm.edu	37	15	89424717	89424717	+	Missense_Mutation	SNP	G	G	A	rs371075749		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:89424717G>A	ENST00000359595.3	-	3	578	c.364C>T	c.(364-366)Cgg>Tgg	p.R122W	HAPLN3_ENST00000562889.1_Missense_Mutation_p.R184W	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	122	Ig-like V-type. {ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.R122W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	TTGTCCTGCCGCAGGTGCACG	0.632																																					p.R122W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364T	15						.	G	TRP/ARG	0,4400		0,0,2200	106.0	81.0	89.0		364	-0.3	0.1	15		89	1,8597	1.2+/-3.3	0,1,4298	no	missense	HAPLN3	NM_178232.2	101	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign	122/361	89424717	1,12997	2200	4299	6499	87225721	SO:0001583	missense	145864	exon3			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.364C>T	15.37:g.89424717G>A	ENSP00000352606:p.Arg122Trp	Somatic		Capture	SOLID	Phase_I	87225721	NM_178232	A8K7P0	Missense_Mutation	SNP	ENST00000359595.3	37	CCDS10346.1	.	.	.	.	.	.	.	.	.	.	G	9.873	1.199500	0.22121	0.0	1.16E-4	ENSG00000140511	ENST00000359595	T	0.65549	-0.16	4.21	-0.309	0.12769	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.335774	0.28209	N	0.016183	T	0.45994	0.1370	L	0.42245	1.32	0.09310	N	0.999999	B;B	0.29212	0.237;0.237	B;B	0.30646	0.118;0.083	T	0.30534	-0.9975	10	0.42905	T	0.14	-13.4745	3.8095	0.08791	0.253:0.0:0.4605:0.2866	.	122;122	A8K7T8;Q96S86	.;HPLN3_HUMAN	W	122	ENSP00000352606:R122W	ENSP00000352606:R122W	R	-	1	2	HAPLN3	87225721	0.985000	0.35326	0.145000	0.22337	0.290000	0.27261	1.992000	0.40737	-0.087000	0.12528	0.650000	0.86243	CGG		0.632	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309070.1	NM_178232	
BLM	641	hgsc.bcm.edu	37	15	91290628	91290628	+	Silent	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:91290628T>A	ENST00000355112.3	+	2	124	c.6T>A	c.(4-6)gcT>gcA	p.A2A	BLM_ENST00000560509.1_Silent_p.A2A	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	2					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.A2A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GGATTATGGCTGCTGTTCCTC	0.353			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.A2A		yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T6A	15						.						64.0	57.0	59.0					15																	91290628		2198	4298	6496	89091632	SO:0001819	synonymous_variant	641	exon2	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.6T>A	15.37:g.91290628T>A		Somatic		Capture	SOLID	Phase_I	89091632	NM_000057	Q52M96	Silent	SNP	ENST00000355112.3	37	CCDS10363.1																																																																																				0.353	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
MCTP2	55784	hgsc.bcm.edu	37	15	94983491	94983491	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:94983491T>C	ENST00000357742.4	+	17	2172	c.2172T>C	c.(2170-2172)ccT>ccC	p.P724P	MCTP2_ENST00000451018.3_Intron	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	724					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.P724P(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TCATCAGACCTGTGAAAGGCA	0.418																																					p.P724P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2172C	15						.						175.0	165.0	169.0					15																	94983491		2197	4298	6495	92784495	SO:0001819	synonymous_variant	55784	exon17			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2172T>C	15.37:g.94983491T>C		Somatic		Capture	SOLID	Phase_I	92784495	NM_018349	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Silent	SNP	ENST00000357742.4	37	CCDS32338.1																																																																																				0.418	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
ARRDC4	91947	hgsc.bcm.edu	37	15	98509177	98509177	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:98509177C>T	ENST00000268042.6	+	3	591	c.427C>T	c.(427-429)Cgg>Tgg	p.R143W	ARRDC4_ENST00000538249.1_Missense_Mutation_p.R56W	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	143					positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)		p.R143W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			GTACTGTGTGCGGGCAGTGTT	0.428																																					p.R143W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C427T	15						.						207.0	178.0	188.0					15																	98509177		2197	4298	6495	96310181	SO:0001583	missense	91947	exon3			BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.427C>T	15.37:g.98509177C>T	ENSP00000268042:p.Arg143Trp	Somatic		Capture	SOLID	Phase_I	96310181	NM_183376	Q6NSI9	Missense_Mutation	SNP	ENST00000268042.6	37	CCDS10377.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741407	0.49151	.	.	ENSG00000140450	ENST00000538249;ENST00000268042	T;T	0.15952	2.38;2.38	5.2	1.41	0.22369	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.324668	0.29876	N	0.010976	T	0.26484	0.0647	M	0.76170	2.325	0.29328	N	0.866901	D;D	0.61697	0.99;0.987	P;P	0.50270	0.636;0.528	T	0.16600	-1.0397	10	0.87932	D	0	-14.3127	8.9404	0.35727	0.4764:0.4531:0.0705:0.0	.	143;56	Q8NCT1;F5H824	ARRD4_HUMAN;.	W	56;143	ENSP00000443774:R56W;ENSP00000268042:R143W	ENSP00000268042:R143W	R	+	1	2	ARRDC4	96310181	1.000000	0.71417	0.077000	0.20336	0.690000	0.40134	1.960000	0.40422	-0.022000	0.13986	-0.319000	0.08680	CGG		0.428	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
KIF7	374654	hgsc.bcm.edu	37	15	90177097	90177099	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	CTT	CTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:90177097_90177099delCTT	ENST00000394412.3	-	12	2486_2488	c.2410_2412delAAG	c.(2410-2412)aagdel	p.K804del		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	804					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K291delK(1)|p.K804delK(1)		central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CCGTAGCCTGCTTCTTCTCCTTC	0.64																																					p.804_804del												.	.	2	Deletion - In frame(2)	large_intestine(2)	c.2410_2412del	15						.																																			87978103	SO:0001651	inframe_deletion	374654	exon12			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2410_2412delAAG	15.37:g.90177100_90177102delCTT	ENSP00000377934:p.Lys804del	Somatic		Capture	SOLID	Phase_I	87978101	NM_198525	Q3SXY0|Q6UXE9|Q8IW72	In_Frame_Del	DEL	ENST00000394412.3	37	CCDS32325.2																																																																																				0.640	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
IGF1R	3480	hgsc.bcm.edu	37	15	99442775	99442775	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Visver			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr15:99442775G>A	ENST00000268035.6	+	5	1783	c.1172G>A	c.(1171-1173)cGc>cAc	p.R391H	IGF1R_ENST00000558762.1_Missense_Mutation_p.R391H	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	391					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)	p.R391H(2)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GTGAAGATCCGCCATTCTCAT	0.498																																					p.R391H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1172A	15						.						201.0	192.0	195.0					15																	99442775		2197	4297	6494	97260298	SO:0001583	missense	3480	exon5			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.1172G>A	15.37:g.99442775G>A	ENSP00000268035:p.Arg391His	Somatic		Capture	SOLID	Phase_I	97260298	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.041793	0.93685	.	.	ENSG00000140443	ENST00000268035	T	0.79845	-1.31	5.44	5.44	0.79542	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000017	D	0.83760	0.5324	L	0.42744	1.35	0.80722	D	1	D;B	0.54772	0.968;0.045	P;B	0.54238	0.746;0.046	D	0.84223	0.0462	10	0.54805	T	0.06	.	19.6379	0.95744	0.0:0.0:1.0:0.0	.	391;391	C9J5X1;P08069	.;IGF1R_HUMAN	H	391	ENSP00000268035:R391H	ENSP00000268035:R391H	R	+	2	0	IGF1R	97260298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.085000	0.71343	2.712000	0.92718	0.563000	0.77884	CGC		0.498	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
MANBA	4126	hgsc.bcm.edu	37	4	103585870	103585870	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:103585870A>G	ENST00000226578.4	-	11	1556	c.1457T>C	c.(1456-1458)gTg>gCg	p.V486A	MANBA_ENST00000505239.1_Missense_Mutation_p.V429A	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	486					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)	p.V486A(1)		cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		GATGTTTTTCACATAGAGTGT	0.423																																					p.V486A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1457C	4						.						125.0	123.0	123.0					4																	103585870		2203	4300	6503	103804918	SO:0001583	missense	4126	exon11				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1457T>C	4.37:g.103585870A>G	ENSP00000226578:p.Val486Ala	Somatic		Capture	SOLID	Phase_I	103804918	NM_005908	Q96BC3|Q9NYX9	Missense_Mutation	SNP	ENST00000226578.4	37	CCDS3658.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.243759	0.58995	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	D;D	0.81739	-1.53;-1.53	5.59	4.42	0.53409	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.062767	0.64402	D	0.000005	T	0.76004	0.3927	L	0.57536	1.79	0.48452	D	0.999656	B;B	0.25105	0.118;0.045	B;B	0.31614	0.133;0.104	T	0.67067	-0.5764	10	0.14252	T	0.57	-28.607	11.2423	0.48977	0.9287:0.0:0.0713:0.0	.	429;486	E9PFW2;O00462	.;MANBA_HUMAN	A	486;429	ENSP00000226578:V486A;ENSP00000427322:V429A	ENSP00000226578:V486A	V	-	2	0	MANBA	103804918	1.000000	0.71417	0.444000	0.26895	0.868000	0.49771	6.701000	0.74624	0.963000	0.38082	0.533000	0.62120	GTG		0.423	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
TET2	54790	hgsc.bcm.edu	37	4	106155928	106155928	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:106155928G>A	ENST00000540549.1	+	3	1689	c.829G>A	c.(829-831)Gca>Aca	p.A277T	TET2_ENST00000545826.1_Missense_Mutation_p.A277T|TET2_ENST00000394764.1_Missense_Mutation_p.A277T|TET2_ENST00000513237.1_Missense_Mutation_p.A298T|TET2_ENST00000305737.2_Missense_Mutation_p.A277T|TET2_ENST00000380013.4_Missense_Mutation_p.A277T|TET2_ENST00000413648.2_Missense_Mutation_p.A277T			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	277					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.A277T(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GATCAATTCCGCACAGACCTC	0.483			"""Mis N, F"""		MDS																																p.A277T			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G829A	4						.						83.0	76.0	78.0					4																	106155928		2203	4300	6503	106375377	SO:0001583	missense	54790	exon3			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.829G>A	4.37:g.106155928G>A	ENSP00000442788:p.Ala277Thr	Somatic		Capture	SOLID	Phase_I	106375377	NM_017628	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	ENST00000540549.1	37	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	G	9.531	1.110884	0.20714	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	T;T;T;T;T;T;T	0.03689	3.84;4.47;3.84;4.47;4.47;3.84;3.84	5.15	-1.73	0.08081	.	1.445000	0.05102	U	0.487310	T	0.02012	0.0063	N	0.08118	0	0.19945	N	0.999942	B;B;P	0.34864	0.226;0.226;0.473	B;B;B	0.25614	0.017;0.017;0.062	T	0.44267	-0.9339	10	0.66056	D	0.02	.	6.4403	0.21847	0.0:0.4663:0.121:0.4127	.	298;277;277	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	T	277;277;277;298;277;277;277;277	ENSP00000306705:A277T;ENSP00000442788:A277T;ENSP00000442867:A277T;ENSP00000425443:A298T;ENSP00000369351:A277T;ENSP00000378245:A277T;ENSP00000391448:A277T	ENSP00000265149:A277T	A	+	1	0	TET2	106375377	0.998000	0.40836	0.143000	0.22291	0.244000	0.25665	0.914000	0.28624	-0.458000	0.07023	-0.867000	0.03001	GCA		0.483	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
ANK2	287	hgsc.bcm.edu	37	4	114251533	114251533	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:114251533G>T	ENST00000357077.4	+	27	3085	c.3032G>T	c.(3031-3033)cGc>cTc	p.R1011L	ANK2_ENST00000509550.1_Missense_Mutation_p.R220L|ANK2_ENST00000264366.6_Missense_Mutation_p.R1011L|ANK2_ENST00000394537.3_Missense_Mutation_p.R1011L|ANK2_ENST00000506722.1_Missense_Mutation_p.R1002L	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1011	Interaction with SPTBN1.|ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R1011L(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGGTCAAGCGCCACAGACTG	0.562																																					p.R1011L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3032T	4						.						95.0	79.0	85.0					4																	114251533		2203	4300	6503	114470982	SO:0001583	missense	287	exon27			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3032G>T	4.37:g.114251533G>T	ENSP00000349588:p.Arg1011Leu	Somatic		Capture	SOLID	Phase_I	114470982	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344399	0.82022	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.83	5.83	0.93111	ZU5 (3);	0.104004	0.43110	N	0.000615	T	0.56202	0.1969	L	0.29908	0.895	0.80722	D	1	B;D;P;B;P;D;B	0.89917	0.191;1.0;0.825;0.147;0.93;0.98;0.369	B;D;B;B;P;P;B	0.91635	0.207;0.999;0.339;0.179;0.695;0.9;0.251	T	0.55068	-0.8198	10	0.52906	T	0.07	.	20.1236	0.97970	0.0:0.0:1.0:0.0	.	220;1011;56;1011;1011;1002;1002	E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5;F8WEF9	.;ANK2_HUMAN;.;.;.;.;.	L	990;957;1002;90;1026;1011;1011;1011;1002;220	ENSP00000423799:R990L;ENSP00000421011:R957L;ENSP00000421067:R1002L;ENSP00000424722:R1026L;ENSP00000378044:R1011L;ENSP00000349588:R1011L;ENSP00000264366:R1011L;ENSP00000426944:R220L	ENSP00000264366:R1011L	R	+	2	0	ANK2	114470982	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.864000	0.99589	2.746000	0.94184	0.563000	0.77884	CGC		0.562	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
SYNPO2	171024	hgsc.bcm.edu	37	4	119952572	119952572	+	Missense_Mutation	SNP	C	C	T	rs367711984		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:119952572C>T	ENST00000429713.2	+	4	2824	c.2642C>T	c.(2641-2643)tCg>tTg	p.S881L	SYNPO2_ENST00000307142.4_Missense_Mutation_p.S881L|SYNPO2_ENST00000434046.2_Missense_Mutation_p.S881L|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	881						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.S881L(3)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AAAAGGCAGTCGAGAATGGAG	0.552																																					p.S881L												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.C2642T	4						.	C	LEU/SER,LEU/SER,LEU/SER	0,4406		0,0,2203	128.0	124.0	125.0		2642,2642,2642	5.8	1.0	4		125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	SYNPO2	NM_001128933.1,NM_001128934.1,NM_133477.2	145,145,145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	881/1094,881/1110,881/1262	119952572	1,13005	2203	4300	6503	120172020	SO:0001583	missense	171024	exon4			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2642C>T	4.37:g.119952572C>T	ENSP00000395143:p.Ser881Leu	Somatic		Capture	SOLID	Phase_I	120172020	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937330	0.73557	0.0	1.16E-4	ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046	T;T;T	0.29397	1.57;2.15;1.68	5.76	5.76	0.90799	.	0.000000	0.56097	D	0.000033	T	0.51770	0.1694	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.999;0.998;0.99	T	0.40572	-0.9556	9	.	.	.	-12.6685	15.4425	0.75195	0.0:0.8618:0.1382:0.0	.	881;881;881;881	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.;.;.;SYNP2_HUMAN	L	881	ENSP00000306015:S881L;ENSP00000395143:S881L;ENSP00000390965:S881L	.	S	+	2	0	SYNPO2	120172020	1.000000	0.71417	0.990000	0.47175	0.946000	0.59487	5.999000	0.70665	2.726000	0.93360	0.655000	0.94253	TCG		0.552	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
EXOSC9	5393	hgsc.bcm.edu	37	4	122724116	122724116	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:122724116C>A	ENST00000243498.5	+	4	436	c.328C>A	c.(328-330)Cta>Ata	p.L110I	EXOSC9_ENST00000512454.1_Missense_Mutation_p.L94I|EXOSC9_ENST00000379663.3_Missense_Mutation_p.L110I|EXOSC9_ENST00000509980.1_3'UTR	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	110	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L110I(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						GGAAAGATGTCTAAGAAATTC	0.383																																					p.L110I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C328A	4						.						133.0	126.0	128.0					4																	122724116		2203	4300	6503	122943566	SO:0001583	missense	5393	exon4			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.328C>A	4.37:g.122724116C>A	ENSP00000243498:p.Leu110Ile	Somatic		Capture	SOLID	Phase_I	122943566	NM_001034194	Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	ENST00000243498.5	37	CCDS3722.2	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630230	0.46944	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000509800;ENST00000512454	T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45	5.95	4.23	0.50019	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.53981	0.1830	N	0.25201	0.72	0.54753	D	0.999983	P;P;B	0.36599	0.56;0.56;0.052	B;B;B	0.41894	0.369;0.369;0.244	T	0.48139	-0.9061	10	0.15952	T	0.53	-20.0277	12.2265	0.54463	0.0:0.8635:0.0:0.1365	.	94;110;110	D6RIY6;Q06265;Q06265-2	.;EXOS9_HUMAN;.	I	110;110;110;94	ENSP00000243498:L110I;ENSP00000368984:L110I;ENSP00000422205:L110I;ENSP00000425782:L94I	ENSP00000243498:L110I	L	+	1	2	EXOSC9	122943566	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.727000	0.38095	1.521000	0.48983	0.650000	0.86243	CTA		0.383	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033	
MAEA	10296	hgsc.bcm.edu	37	4	1330694	1330694	+	Missense_Mutation	SNP	C	C	T	rs376435559		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:1330694C>T	ENST00000303400.4	+	7	874	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	MAEA_ENST00000264750.6_Missense_Mutation_p.R230W|MAEA_ENST00000505839.1_Missense_Mutation_p.R223W|MAEA_ENST00000510794.1_Missense_Mutation_p.R270W|MAEA_ENST00000505177.2_Missense_Mutation_p.R309W|MAEA_ENST00000452175.2_Missense_Mutation_p.R192W|MAEA_ENST00000512289.1_3'UTR|MAEA_ENST00000514708.1_Missense_Mutation_p.P204L	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	271					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)	p.R271W(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	CCAGCAGTTCCGGTACGACAA	0.592																																					p.R271W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C811T	4						.	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	101.0	82.0	89.0		811,688	2.8	1.0	4		89	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MAEA	NM_001017405.1,NM_005882.3	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	271/397,230/356	1330694	1,13005	2203	4300	6503	1320694	SO:0001583	missense	10296	exon7			AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.811C>T	4.37:g.1330694C>T	ENSP00000302830:p.Arg271Trp	Somatic		Capture	SOLID	Phase_I	1320694	NM_001017405	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.155944|4.155944	0.78114|0.78114	0.0|0.0	1.16E-4|1.16E-4	ENSG00000090316|ENSG00000090316	ENST00000503653;ENST00000382947;ENST00000514708|ENST00000303400;ENST00000505177;ENST00000264750;ENST00000539495;ENST00000452175;ENST00000510794;ENST00000505839	T;T|T;T;T;T;T	0.57752|0.48522	0.55;0.38|0.81;0.82;0.82;0.84;0.81	5.71|5.71	2.75|2.75	0.32379|0.32379	.|Ran binding protein-like, CRA domain (1);	.|0.109107	.|0.64402	.|D	.|0.000012	T|T	0.61813|0.61813	0.2377|0.2377	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	B|D;D;D;D;D	0.06786|0.89917	0.001|1.0;1.0;1.0;1.0;0.999	B|D;D;D;D;D	0.04013|0.87578	0.001|0.997;0.998;0.988;0.995;0.979	T|T	0.60944|0.60944	-0.7162|-0.7162	9|10	0.66056|0.62326	D|D	0.02|0.03	-27.9646|-27.9646	6.6541|6.6541	0.22979|0.22979	0.2142:0.614:0.0:0.1719|0.2142:0.614:0.0:0.1719	.|.	204|270;309;57;230;271	D6RIB6|B4DVN3;E7ESC7;B3KRN7;Q7L5Y9-3;Q7L5Y9	.|.;.;.;.;MAEA_HUMAN	L|W	245;204;204|271;309;230;250;192;270;223	ENSP00000421644:P245L;ENSP00000427512:P204L|ENSP00000302830:R271W;ENSP00000422215:R309W;ENSP00000264750:R230W;ENSP00000411415:R192W;ENSP00000426807:R270W	ENSP00000372405:P204L|ENSP00000264750:R230W	P|R	+|+	2|1	0|2	MAEA|MAEA	1320694|1320694	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.992000|0.992000	0.81027|0.81027	2.019000|2.019000	0.41001|0.41001	0.766000|0.766000	0.33244|0.33244	0.563000|0.563000	0.77884|0.77884	CCG|CGG		0.592	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
BOD1L1	259282	hgsc.bcm.edu	37	4	13602635	13602635	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:13602635T>C	ENST00000040738.5	-	10	6024	c.5889A>G	c.(5887-5889)tcA>tcG	p.S1963S		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1963						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S1963S(1)									CATCCTTTCCTGAGACTGCAC	0.458																																					p.S1963S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5889G	4						.						142.0	137.0	138.0					4																	13602635		2203	4300	6503	13211733	SO:0001819	synonymous_variant	259282	exon10			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5889A>G	4.37:g.13602635T>C		Somatic		Capture	SOLID	Phase_I	13211733	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																				0.458	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
FAT4	79633	hgsc.bcm.edu	37	4	126373326	126373326	+	Missense_Mutation	SNP	G	G	A	rs557732280	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:126373326G>A	ENST00000394329.3	+	9	11168	c.11155G>A	c.(11155-11157)Gta>Ata	p.V3719I	FAT4_ENST00000335110.5_Missense_Mutation_p.V2017I	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3719					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V3719I(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCGTCTCGGCGTACCAACAGT	0.468													G|||	3	0.000599042	0.0	0.0	5008	,	,		21722	0.0		0.001	False		,,,				2504	0.002				p.V3719I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G11155A	4						.						176.0	164.0	168.0					4																	126373326		2203	4300	6503	126592776	SO:0001583	missense	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11155G>A	4.37:g.126373326G>A	ENSP00000377862:p.Val3719Ile	Somatic		Capture	SOLID	Phase_I	126592776	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	0.078	-1.189252	0.01607	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.47177	0.85;0.85	5.76	2.16	0.27623	.	0.000000	0.31233	U	0.008007	T	0.32436	0.0829	N	0.22421	0.69	0.09310	N	1	B;B;B	0.21381	0.008;0.004;0.055	B;B;B	0.12837	0.004;0.001;0.008	T	0.12426	-1.0548	10	0.37606	T	0.19	.	13.048	0.58937	0.2402:0.0:0.7598:0.0	.	2017;3719;3719	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	I	3719;2017	ENSP00000377862:V3719I;ENSP00000335169:V2017I	ENSP00000335169:V2017I	V	+	1	0	FAT4	126592776	0.165000	0.22948	0.000000	0.03702	0.004000	0.04260	0.937000	0.28951	-0.094000	0.12374	-2.110000	0.00354	GTA		0.468	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
IL15	3600	hgsc.bcm.edu	37	4	142651071	142651071	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:142651071T>G	ENST00000296545.7	+	7	1156	c.312T>G	c.(310-312)gaT>gaG	p.D104E	IL15_ENST00000320650.4_Missense_Mutation_p.D104E|IL15_ENST00000477265.1_Missense_Mutation_p.D77E|IL15_ENST00000529613.1_Missense_Mutation_p.D104E|IL15_ENST00000514653.1_Missense_Mutation_p.D77E|IL15_ENST00000394159.1_Missense_Mutation_p.D77E			P40933	IL15_HUMAN	interleukin 15	104					aging (GO:0007568)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|cellular response to vitamin D (GO:0071305)|extrathymic T cell selection (GO:0045062)|hyaluronan metabolic process (GO:0030212)|immune response (GO:0006955)|inflammatory response (GO:0006954)|lymph node development (GO:0048535)|natural killer cell differentiation (GO:0001779)|negative regulation of smooth muscle cell proliferation (GO:0048662)|NK T cell proliferation (GO:0001866)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immune response (GO:0050778)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of defense response to virus by host (GO:0050691)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D104E(1)		kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_hematologic(180;0.158)					AGTCCGGAGATGCAAGTATTC	0.358																																					p.D104E	Pancreas(10;184 986 25902)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T312G	4						.						115.0	114.0	114.0					4																	142651071		2203	4299	6502	142870521	SO:0001583	missense	3600	exon7			U14407	CCDS3755.1, CCDS3756.1	4q31	2011-07-14			ENSG00000164136	ENSG00000164136		"""Interleukins and interleukin receptors"""	5977	protein-coding gene	gene with protein product		600554				8178155	Standard	NM_000585		Approved	IL-15, MGC9721	uc003iis.3	P40933	OTTHUMG00000133418	ENST00000296545.7:c.312T>G	4.37:g.142651071T>G	ENSP00000296545:p.Asp104Glu	Somatic		Capture	SOLID	Phase_I	142870521	NM_172174	D3DNZ2|O00440|O43512|Q495Z8|Q6FGX7|Q93058|Q9UBA3	Missense_Mutation	SNP	ENST00000296545.7	37	CCDS3755.1	.	.	.	.	.	.	.	.	.	.	T	12.42	1.932691	0.34096	.	.	ENSG00000164136	ENST00000320650;ENST00000296545;ENST00000514653;ENST00000529613;ENST00000477265;ENST00000394159	.	.	.	5.5	-0.984	0.10259	.	0.723385	0.13631	N	0.373714	T	0.25791	0.0628	L	0.29908	0.895	0.09310	N	1	B	0.24823	0.112	B	0.19391	0.025	T	0.19745	-1.0296	9	0.22706	T	0.39	-6.6127	9.0316	0.36262	0.0:0.5074:0.0:0.4926	.	104	P40933	IL15_HUMAN	E	104;104;77;104;77;77	.	ENSP00000296545:D104E	D	+	3	2	IL15	142870521	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.009000	0.13219	-0.081000	0.12662	-0.264000	0.10439	GAT		0.358	IL15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257278.2	NM_172175	
NR3C2	4306	hgsc.bcm.edu	37	4	149116000	149116000	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:149116000A>G	ENST00000358102.3	-	4	2273	c.1911T>C	c.(1909-1911)taT>taC	p.Y637Y	NR3C2_ENST00000503313.1_5'UTR|NR3C2_ENST00000512865.1_Silent_p.Y637Y|NR3C2_ENST00000355292.3_Silent_p.Y641Y|NR3C2_ENST00000511528.1_Silent_p.Y641Y|NR3C2_ENST00000344721.4_Silent_p.Y637Y|RP11-76G10.1_ENST00000514843.1_RNA	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	637					gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.Y637Y(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	CAGCACATAAATAGTTGTGTT	0.303																																					p.Y637Y	Melanoma(27;428 957 40335 51025 51111)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1911C	4						.						84.0	85.0	85.0					4																	149116000		2203	4300	6503	149335450	SO:0001819	synonymous_variant	4306	exon4			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1911T>C	4.37:g.149116000A>G		Somatic		Capture	SOLID	Phase_I	149335450	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	ENST00000358102.3	37	CCDS3772.1																																																																																				0.303	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
FGA	2243	hgsc.bcm.edu	37	4	155506845	155506845	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:155506845T>C	ENST00000302053.3	-	5	1814	c.1736A>G	c.(1735-1737)tAc>tGc	p.Y579C	FGA_ENST00000403106.3_Missense_Mutation_p.Y579C	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	579					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.Y579C(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TTGTTTGCTGTAACTTGAAGA	0.443																																					p.Y579C	NSCLC(143;340 1922 20892 22370 48145)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1736G	4						.						119.0	114.0	116.0					4																	155506845		2203	4300	6503	155726295	SO:0001583	missense	2243	exon5				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1736A>G	4.37:g.155506845T>C	ENSP00000306361:p.Tyr579Cys	Somatic		Capture	SOLID	Phase_I	155726295	NM_021871	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.891|7.891	0.732235|0.732235	0.15507|0.15507	.|.	.|.	ENSG00000171560|ENSG00000171560	ENST00000457487|ENST00000302053;ENST00000403106	.|T;T	.|0.56103	.|0.48;2.95	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|6.421090	.|0.00166	.|N	.|0.000000	T|T	0.40423|0.40423	0.1116|0.1116	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P;B	.|0.42908	.|0.793;0.019	.|B;B	.|0.38712	.|0.28;0.004	T|T	0.50474|0.50474	-0.8824|-0.8824	6|10	0.36615|0.39692	T|T	0.2|0.17	.|.	13.4076|13.4076	0.60922|0.60922	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|579;579	.|P02671-2;P02671	.|.;FIBA_HUMAN	A|C	221|579	.|ENSP00000306361:Y579C;ENSP00000385981:Y579C	ENSP00000407891:T221A|ENSP00000306361:Y579C	T|Y	-|-	1|2	0|0	FGA|FGA	155726295|155726295	0.447000|0.447000	0.25673|0.25673	0.031000|0.031000	0.17742|0.17742	0.279000|0.279000	0.26890|0.26890	1.459000|1.459000	0.35234|0.35234	1.899000|1.899000	0.54978|0.54978	0.533000|0.533000	0.62120|0.62120	ACA|TAC		0.443	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
DDX60	55601	hgsc.bcm.edu	37	4	169215084	169215084	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:169215084C>T	ENST00000393743.3	-	7	1027	c.736G>A	c.(736-738)Gta>Ata	p.V246I		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	246					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.V246I(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		AGCAGAGATACAGTCTTGTGT	0.363																																					p.V246I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G736A	4						.						100.0	95.0	97.0					4																	169215084		2203	4300	6503	169451659	SO:0001583	missense	55601	exon7			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.736G>A	4.37:g.169215084C>T	ENSP00000377344:p.Val246Ile	Somatic		Capture	SOLID	Phase_I	169451659	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.534450	0.00145	.	.	ENSG00000137628	ENST00000393743	T	0.16457	2.34	4.12	-2.94	0.05581	.	1.397950	0.04445	N	0.371673	T	0.04227	0.0117	N	0.00771	-1.2	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36578	-0.9742	10	0.07175	T	0.84	.	5.9565	0.19275	0.0:0.4767:0.1624:0.361	.	246	Q8IY21	DDX60_HUMAN	I	246	ENSP00000377344:V246I	ENSP00000377344:V246I	V	-	1	0	DDX60	169451659	0.000000	0.05858	0.002000	0.10522	0.111000	0.19643	-0.507000	0.06352	-0.493000	0.06678	-0.452000	0.05504	GTA		0.363	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
TRAPPC11	60684	hgsc.bcm.edu	37	4	184606497	184606497	+	Missense_Mutation	SNP	G	G	A	rs147516606		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:184606497G>A	ENST00000334690.6	+	17	1905	c.1703G>A	c.(1702-1704)cGa>cAa	p.R568Q	TRAPPC11_ENST00000512476.1_Missense_Mutation_p.R174Q|TRAPPC11_ENST00000357207.4_Missense_Mutation_p.R568Q	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	568					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.R568Q(2)									TGGGCAGACCGAATTTCTCTG	0.423													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17216	0.0		0.0	False		,,,				2504	0.0				p.R568Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1703A	4						.	G	GLN/ARG,GLN/ARG	4,4402	8.1+/-20.4	0,4,2199	154.0	148.0	150.0		1703,1703	5.6	1.0	4	dbSNP_134	150	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	C4orf41	NM_021942.4,NM_199053.1	43,43	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	benign,benign	568/1134,568/1087	184606497	5,13001	2203	4300	6503	184843491	SO:0001583	missense	60684	exon17				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.1703G>A	4.37:g.184606497G>A	ENSP00000335371:p.Arg568Gln	Somatic		Capture	SOLID	Phase_I	184843491	NM_199053	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512706	0.85389	9.08E-4	1.16E-4	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109;ENST00000512476	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.72179	0.3428	L	0.41236	1.265	0.80722	D	1	D;D;D	0.89917	1.0;0.964;0.979	D;B;P	0.79108	0.992;0.381;0.585	T	0.64228	-0.6457	9	0.19147	T	0.46	.	19.9595	0.97236	0.0:0.0:1.0:0.0	.	174;568;568	D6RHE5;Q7Z392;Q7Z392-3	.;TPC11_HUMAN;.	Q	568;568;568;174	.	ENSP00000335371:R568Q	R	+	2	0	C4orf41	184843491	1.000000	0.71417	0.968000	0.41197	0.993000	0.82548	9.696000	0.98695	2.797000	0.96272	0.563000	0.77884	CGA		0.423	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942	
SORBS2	8470	hgsc.bcm.edu	37	4	186544295	186544295	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:186544295C>T	ENST00000284776.7	-	13	2785	c.2276G>A	c.(2275-2277)cGc>cAc	p.R759H	SORBS2_ENST00000418609.1_Missense_Mutation_p.R663H|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.R759H|SORBS2_ENST00000355634.5_Missense_Mutation_p.R859H|SORBS2_ENST00000498125.1_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	759					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.R759H(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ACTGATGAGGCGGTGCAGGAT	0.567																																					p.R759H	Esophageal Squamous(153;41 2433 9491 36028)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2276A	4						.						147.0	166.0	160.0					4																	186544295		2203	4300	6503	186781289	SO:0001583	missense	8470	exon13				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2276G>A	4.37:g.186544295C>T	ENSP00000284776:p.Arg759His	Somatic		Capture	SOLID	Phase_I	186781289	NM_021069	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262946	0.59431	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.56103	0.56;0.56;0.48;0.49	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.72187	0.3429	M	0.61703	1.905	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.991;0.994	T	0.73145	-0.4075	10	0.87932	D	0	-15.934	19.982	0.97329	0.0:1.0:0.0:0.0	.	663;859;759	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	H	759;759;663;859	ENSP00000284776:R759H;ENSP00000411764:R759H;ENSP00000397482:R663H;ENSP00000347852:R859H	ENSP00000284776:R759H	R	-	2	0	SORBS2	186781289	1.000000	0.71417	0.998000	0.56505	0.282000	0.26991	6.089000	0.71384	2.737000	0.93849	0.561000	0.74099	CGC		0.567	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
GRK4	2868	hgsc.bcm.edu	37	4	3021465	3021465	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:3021465G>T	ENST00000398052.4	+	9	1182	c.839G>T	c.(838-840)gGc>gTc	p.G280V	GRK4_ENST00000345167.6_Missense_Mutation_p.G248V|GRK4_ENST00000504933.1_Missense_Mutation_p.G280V|GRK4_ENST00000398051.4_Missense_Mutation_p.G248V	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)	p.G280V(1)		lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TACAACCTGGGCAATCCCGGC	0.443																																					p.G280V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G839T	4						.						177.0	165.0	169.0					4																	3021465		2203	4300	6503	2991263	SO:0001583	missense	2868	exon9				CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.839G>T	4.37:g.3021465G>T	ENSP00000381129:p.Gly280Val	Somatic		Capture	SOLID	Phase_I	2991263	NM_182982	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Missense_Mutation	SNP	ENST00000398052.4	37	CCDS33946.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586057	0.86748	.	.	ENSG00000125388	ENST00000398051;ENST00000398052;ENST00000345167;ENST00000504933	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.78381	0.4274	M	0.71036	2.16	0.80722	D	1	D;P;D;D	0.71674	0.998;0.925;0.997;0.998	P;P;D;D	0.69307	0.894;0.746;0.938;0.963	T	0.80694	-0.1268	10	0.87932	D	0	-17.6311	18.1402	0.89637	0.0:0.0:1.0:0.0	.	248;248;280;280	P32298-3;P32298-2;P32298-4;P32298	.;.;.;GRK4_HUMAN	V	248;280;248;280	ENSP00000381128:G248V;ENSP00000381129:G280V;ENSP00000264764:G248V;ENSP00000427445:G280V	ENSP00000264764:G248V	G	+	2	0	GRK4	2991263	1.000000	0.71417	0.958000	0.39756	0.928000	0.56348	9.569000	0.98170	2.597000	0.87782	0.549000	0.68633	GGC		0.443	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358176.2	NM_005307	
EVC2	132884	hgsc.bcm.edu	37	4	5586448	5586448	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:5586448C>T	ENST00000344408.5	-	17	3012	c.2959G>A	c.(2959-2961)Gcc>Acc	p.A987T	EVC2_ENST00000344938.1_Missense_Mutation_p.A987T|EVC2_ENST00000310917.2_Missense_Mutation_p.A907T	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	987					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A987T(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CTGAGGAGGGCGGTGTAGGCC	0.617																																					p.A907T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2719A	4						.						62.0	61.0	61.0					4																	5586448		2203	4300	6503	5637349	SO:0001583	missense	132884	exon17			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2959G>A	4.37:g.5586448C>T	ENSP00000342144:p.Ala987Thr	Somatic		Capture	SOLID	Phase_I	5637349	NM_001166136	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675942	0.67928	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	D;D;D	0.85088	-1.94;-1.94;-1.94	4.8	3.68	0.42216	.	0.247450	0.34200	N	0.004173	T	0.68357	0.2992	N	0.16656	0.425	0.34979	D	0.753892	P	0.47409	0.895	B	0.37239	0.244	T	0.73972	-0.3814	10	0.30078	T	0.28	-16.869	8.482	0.33049	0.0:0.8469:0.0:0.1531	.	987	Q86UK5	LBN_HUMAN	T	987;907;987	ENSP00000339954:A987T;ENSP00000311683:A907T;ENSP00000342144:A987T	ENSP00000311683:A907T	A	-	1	0	EVC2	5637349	0.950000	0.32346	0.972000	0.41901	0.960000	0.62799	1.523000	0.35932	2.377000	0.81083	0.543000	0.68304	GCC		0.617	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
KLB	152831	hgsc.bcm.edu	37	4	39450013	39450013	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:39450013G>A	ENST00000257408.4	+	5	2939	c.2842G>A	c.(2842-2844)Gat>Aat	p.D948N		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	948	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.D948N(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CTTCACATCTGATTTTAAAGC	0.373																																					p.D948N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2842A	4						.						44.0	47.0	46.0					4																	39450013		2203	4300	6503	39126408	SO:0001583	missense	152831	exon5			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2842G>A	4.37:g.39450013G>A	ENSP00000257408:p.Asp948Asn	Somatic		Capture	SOLID	Phase_I	39126408	NM_175737	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241625	0.39598	.	.	ENSG00000134962	ENST00000257408	T	0.44482	0.92	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.330944	0.36519	N	0.002548	T	0.38480	0.1042	L	0.49778	1.585	0.37691	D	0.923869	P;P	0.37781	0.608;0.608	B;B	0.41036	0.346;0.325	T	0.21759	-1.0236	10	0.08599	T	0.76	-19.9357	13.2427	0.60006	0.0724:0.0:0.9276:0.0	.	939;948	B7ZL50;Q86Z14	.;KLOTB_HUMAN	N	948	ENSP00000257408:D948N	ENSP00000257408:D948N	D	+	1	0	KLB	39126408	1.000000	0.71417	0.967000	0.41034	0.960000	0.62799	6.485000	0.73625	2.740000	0.93945	0.313000	0.20887	GAT		0.373	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
ATP10D	57205	hgsc.bcm.edu	37	4	47537547	47537547	+	Silent	SNP	C	C	T	rs141284146	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:47537547C>T	ENST00000273859.3	+	6	1067	c.798C>T	c.(796-798)cgC>cgT	p.R266R	ATP10D_ENST00000504445.1_Silent_p.R266R	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	266					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R266R(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ACAAAGAACGCGTGGGTCTCA	0.378													C|||	3	0.000599042	0.0023	0.0	5008	,	,		17873	0.0		0.0	False		,,,				2504	0.0				p.R266R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C798T	4						.	C		3,4403	4.2+/-10.8	0,3,2200	150.0	140.0	143.0		798	-11.5	0.6	4	dbSNP_134	143	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ATP10D	NM_020453.3		0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308		266/1427	47537547	4,13002	2203	4300	6503	47232304	SO:0001819	synonymous_variant	57205	exon6			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.798C>T	4.37:g.47537547C>T		Somatic		Capture	SOLID	Phase_I	47232304	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	ENST00000273859.3	37	CCDS3476.1																																																																																				0.378	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
KDR	3791	hgsc.bcm.edu	37	4	55968146	55968146	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:55968146C>T	ENST00000263923.4	-	15	2479	c.2184G>A	c.(2182-2184)agG>agA	p.R728R		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	728	Ig-like C2-type 7.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R728R(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CGTCCTCCTTCCTCACTCTGC	0.448			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.R728R			Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2184A	4						.						134.0	126.0	129.0					4																	55968146		2203	4300	6503	55662903	SO:0001819	synonymous_variant	3791	exon15			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2184G>A	4.37:g.55968146C>T		Somatic		Capture	SOLID	Phase_I	55662903	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	CCDS3497.1																																																																																				0.448	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
PPAT	5471	hgsc.bcm.edu	37	4	57267500	57267500	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:57267500G>T	ENST00000264220.2	-	7	1019	c.882C>A	c.(880-882)ttC>ttA	p.F294L	PPAT_ENST00000507648.1_5'Flank	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	294					'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)	p.F294L(1)		cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	ACTTACCTTCGAACATACTGT	0.348																																					p.F294L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C882A	4						.						104.0	106.0	105.0					4																	57267500		2203	4300	6503	56962257	SO:0001583	missense	5471	exon7				CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.882C>A	4.37:g.57267500G>T	ENSP00000264220:p.Phe294Leu	Somatic		Capture	SOLID	Phase_I	56962257	NM_002703		Missense_Mutation	SNP	ENST00000264220.2	37	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.312377	0.23908	.	.	ENSG00000128059	ENST00000264220	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.36744	0.0978	N	0.05574	-0.02	0.80722	D	1	B	0.15473	0.013	B	0.11329	0.006	T	0.10177	-1.0641	9	0.34782	T	0.22	-24.6146	11.3473	0.49567	0.928:0.0:0.072:0.0	.	294	Q06203	PUR1_HUMAN	L	294	.	ENSP00000264220:F294L	F	-	3	2	PPAT	56962257	1.000000	0.71417	1.000000	0.80357	0.447000	0.32167	5.254000	0.65457	0.936000	0.37367	-0.381000	0.06696	TTC		0.348	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
MOB1B	92597	hgsc.bcm.edu	37	4	71840925	71840925	+	Missense_Mutation	SNP	G	G	A	rs377705076		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:71840925G>A	ENST00000309395.2	+	4	532	c.331G>A	c.(331-333)Gca>Aca	p.A111T	MOB1B_ENST00000511449.1_Intron|MOB1B_ENST00000396051.2_Missense_Mutation_p.A116T	NM_001244766.1|NM_173468.3	NP_001231695.1|NP_775739.1	Q7L9L4	MOB1B_HUMAN	MOB kinase activator 1B	111					hippo signaling (GO:0035329)|positive regulation of phosphorylation (GO:0042327)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	kinase activator activity (GO:0019209)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)	p.A111T(1)									TAAGTGCTCTGCACCAAAGTA	0.353																																					p.A111T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G331A	4						.						99.0	100.0	100.0					4																	71840925		2203	4300	6503	72059789	SO:0001583	missense	92597	exon4			BC038112	CCDS34002.1, CCDS58903.1	4q13.3	2011-09-28	2011-09-28	2011-09-27	ENSG00000173542	ENSG00000173542		"""MOB kinase activators"""	29801	protein-coding gene	gene with protein product	"""Mob4A protein"""	609282	"""MOB1, Mps One Binder kinase activator-like 1A (yeast)"", ""MOB1 Mps One Binder homolog B (yeast)"""	MOBKL1A		15067004	Standard	NM_173468		Approved	MOB4A	uc003hfw.3	Q7L9L4	OTTHUMG00000160844	ENST00000309395.2:c.331G>A	4.37:g.71840925G>A	ENSP00000310189:p.Ala111Thr	Somatic		Capture	SOLID	Phase_I	72059789	NM_173468	B2R8U6|B4DRY3|Q8IY23	Missense_Mutation	SNP	ENST00000309395.2	37	CCDS34002.1	.	.	.	.	.	.	.	.	.	.	G	36	5.912179	0.97099	.	.	ENSG00000173542	ENST00000502869;ENST00000309395;ENST00000396051	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.91355	0.7273	H	0.98276	4.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93753	0.7060	9	0.87932	D	0	-41.0358	20.5792	0.99380	0.0:0.0:1.0:0.0	.	116;111;111	B4DRY3;Q7L9L4;B3KSH6	.;MOB1B_HUMAN;.	T	116;111;116	.	ENSP00000310189:A111T	A	+	1	0	MOBKL1A	72059789	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.675000	0.98638	2.873000	0.98535	0.561000	0.74099	GCA		0.353	MOB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362634.1	NM_173468	
ANKRD17	26057	hgsc.bcm.edu	37	4	73963799	73963799	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:73963799G>T	ENST00000358602.4	-	26	5128	c.5012C>A	c.(5011-5013)gCt>gAt	p.A1671D	ANKRD17_ENST00000330838.6_Missense_Mutation_p.A1420D|ANKRD17_ENST00000509867.2_Missense_Mutation_p.A1558D	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1671	Ser-rich.				blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.A1671D(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTTTATTGAAGCCTTGCCAGA	0.343																																					p.A1420D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4259A	4						.						108.0	106.0	106.0					4																	73963799		2203	4300	6503	74182663	SO:0001583	missense	26057	exon25			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.5012C>A	4.37:g.73963799G>T	ENSP00000351416:p.Ala1671Asp	Somatic		Capture	SOLID	Phase_I	74182663	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061823	0.55432	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.23754	1.89;1.89;1.89	5.18	5.18	0.71444	.	0.659654	0.14514	N	0.314935	T	0.27349	0.0671	L	0.40543	1.245	0.41589	D	0.988786	B;B;B;B	0.21905	0.062;0.062;0.037;0.01	B;B;B;B	0.16289	0.015;0.015;0.007;0.007	T	0.07654	-1.0761	10	0.72032	D	0.01	.	19.0519	0.93050	0.0:0.0:1.0:0.0	.	1670;1420;1671;1558	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	D	1671;1078;1420;1558;55	ENSP00000351416:A1671D;ENSP00000332265:A1420D;ENSP00000427151:A1558D	ENSP00000332265:A1420D	A	-	2	0	ANKRD17	74182663	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	6.722000	0.74735	2.587000	0.87381	0.591000	0.81541	GCT		0.343	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
GRID2	2895	hgsc.bcm.edu	37	4	94032029	94032029	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:94032029G>A	ENST00000282020.4	+	4	918	c.660G>A	c.(658-660)ctG>ctA	p.L220L	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Silent_p.L125L	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	220					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.L220L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TAGAAGAACTGAATCGCTATC	0.413																																					p.L220L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G660A	4						.						149.0	145.0	146.0					4																	94032029		2203	4300	6503	94251052	SO:0001819	synonymous_variant	2895	exon4			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.660G>A	4.37:g.94032029G>A		Somatic		Capture	SOLID	Phase_I	94251052	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	ENST00000282020.4	37	CCDS3637.1																																																																																				0.413	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
GRID2	2895	hgsc.bcm.edu	37	4	94137901	94137901	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:94137901G>C	ENST00000282020.4	+	6	1060	c.802G>C	c.(802-804)Gtg>Ctg	p.V268L	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Missense_Mutation_p.V173L	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	268					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.V268L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		AATAAACGATGTGGACGTACA	0.378																																					p.V268L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G802C	4						.						118.0	114.0	115.0					4																	94137901		2203	4300	6503	94356924	SO:0001583	missense	2895	exon6			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.802G>C	4.37:g.94137901G>C	ENSP00000282020:p.Val268Leu	Somatic		Capture	SOLID	Phase_I	94356924	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	G	0.656	-0.807595	0.02819	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.81247	-1.47;-1.47	4.86	1.17	0.20885	Extracellular ligand-binding receptor (1);	0.787412	0.11884	N	0.520210	T	0.51550	0.1681	N	0.08118	0	0.18873	N	0.999985	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41770	-0.9490	10	0.02654	T	1	.	1.2407	0.01962	0.2225:0.1213:0.4148:0.2414	.	173;268	E9PH24;O43424	.;GRID2_HUMAN	L	268;173	ENSP00000282020:V268L;ENSP00000421257:V173L	ENSP00000282020:V268L	V	+	1	0	GRID2	94356924	0.003000	0.15002	0.992000	0.48379	0.927000	0.56198	-0.277000	0.08502	-0.024000	0.13941	-0.229000	0.12294	GTG		0.378	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
PDHA2	5161	hgsc.bcm.edu	37	4	96761974	96761974	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:96761974T>C	ENST00000295266.4	+	1	736	c.673T>C	c.(673-675)Tat>Cat	p.Y225H		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	225					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)	p.Y225H(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		GAATAACCTATATGGAATGGG	0.458																																					p.Y225H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T673C	4						.						88.0	91.0	90.0					4																	96761974		2203	4300	6503	96980997	SO:0001583	missense	5161	exon1				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.673T>C	4.37:g.96761974T>C	ENSP00000295266:p.Tyr225His	Somatic		Capture	SOLID	Phase_I	96980997	NM_005390	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.535437	0.45176	.	.	ENSG00000163114	ENST00000295266	D	0.97161	-4.27	4.7	3.52	0.40303	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98975	0.9651	H	0.99211	4.47	0.58432	D	0.999996	D	0.71674	0.998	D	0.80764	0.994	D	0.97960	1.0337	10	0.87932	D	0	-7.875	8.5307	0.33333	0.0:0.0929:0.0:0.9071	.	225	P29803	ODPAT_HUMAN	H	225	ENSP00000295266:Y225H	ENSP00000295266:Y225H	Y	+	1	0	PDHA2	96980997	1.000000	0.71417	0.839000	0.33178	0.324000	0.28378	5.504000	0.66968	0.945000	0.37605	0.383000	0.25322	TAT		0.458	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1		
PLK4	10733	hgsc.bcm.edu	37	4	128808625	128808626	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:128808625_128808626delAG	ENST00000270861.5	+	6	1707_1708	c.1433_1434delAG	c.(1432-1434)cagfs	p.Q478fs	PLK4_ENST00000513090.1_Frame_Shift_Del_p.Q446fs|PLK4_ENST00000507249.1_Frame_Shift_Del_p.Q444fs|PLK4_ENST00000515069.1_Frame_Shift_Del_p.Q478fs|PLK4_ENST00000514379.1_Frame_Shift_Del_p.Q437fs	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	478					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q478fs*16(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						ACCGTACAACAGTGGTTTGGGA	0.361																																					p.437_437del	Colon(135;508 1718 19061 31832 42879)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1310_1311del	4						.																																			129028076	SO:0001589	frameshift_variant	10733	exon6			Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.1433_1434delAG	4.37:g.128808625_128808626delAG	ENSP00000270861:p.Gln478fs	Somatic		Capture	SOLID	Phase_I	129028075	NM_001190801	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Frame_Shift_Del	DEL	ENST00000270861.5	37	CCDS3735.1																																																																																				0.361	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
KLKB1	3818	hgsc.bcm.edu	37	4	187178437	187178437	+	Missense_Mutation	SNP	G	G	A	rs121964951	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr4:187178437G>A	ENST00000264690.6	+	14	1830	c.1643G>A	c.(1642-1644)tGc>tAc	p.C548Y	KLKB1_ENST00000513864.1_Intron	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	548	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		C -> Y (in PKK deficiency). {ECO:0000269|PubMed:14652634}.		blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.C548Y(2)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		AATGAAGAATGCCAGAAAAGA	0.338																																					p.C548Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1643A	4	GRCh37	CM033394	KLKB1	M	rs121964951	.	G	TYR/CYS	0,4402		0,0,2201	72.0	84.0	80.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1643	5.8	1.0	4	dbSNP_133	80	4,8590	3.7+/-12.6	0,4,4293	yes	missense	KLKB1	NM_000892.3	194	0,4,6494	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging	548/639	187178437	4,12992	2201	4297	6498	187415431	SO:0001583	missense	3818	exon14			M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.1643G>A	4.37:g.187178437G>A	ENSP00000264690:p.Cys548Tyr	Somatic		Capture	SOLID	Phase_I	187415431	NM_000892	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	ENST00000264690.6	37	CCDS34120.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.165611|4.165611	0.78339|0.78339	0.0|0.0	4.65E-4|4.65E-4	ENSG00000164344|ENSG00000164344	ENST00000511608|ENST00000264690	.|D	.|0.96992	.|-4.2	5.75|5.75	5.75|5.75	0.90469|0.90469	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99102|0.99102	0.9691|0.9691	H|H	0.99042|0.99042	4.41|4.41	0.80722|0.80722	A|A	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.997	D|D	0.98891|0.98891	1.0773|1.0773	4|9	.|0.87932	.|D	.|0	.|.	19.9525|19.9525	0.97208|0.97208	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|548;548	.|A8K9A9;P03952	.|.;KLKB1_HUMAN	T|Y	596|548	.|ENSP00000264690:C548Y	.|ENSP00000264690:C548Y	A|C	+|+	1|2	0|0	KLKB1|KLKB1	187415431|187415431	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.898000|0.898000	0.52572|0.52572	6.062000|6.062000	0.71155|0.71155	2.719000|2.719000	0.93026|0.93026	0.655000|0.655000	0.94253|0.94253	GCC|TGC		0.338	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892	
CAPN6	827	hgsc.bcm.edu	37	X	110490676	110490676	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:110490676G>A	ENST00000324068.1	-	12	1830	c.1663C>T	c.(1663-1665)Cag>Tag	p.Q555*	CAPN6_ENST00000541758.1_Nonsense_Mutation_p.Q300*	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	555	C2.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.Q555K(1)|p.Q555*(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						GTATTCTTCTGGACAGGAGAA	0.408																																					p.Q555X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(1)|lung(1)	c.C1663T	X						.						154.0	132.0	140.0					X																	110490676		2203	4300	6503	110377332	SO:0001587	stop_gained	827	exon12			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1663C>T	X.37:g.110490676G>A	ENSP00000317214:p.Gln555*	Somatic		Capture	SOLID	Phase_I	110377332	NM_014289	D3DUY7|Q9UEQ1|Q9UJA8	Nonsense_Mutation	SNP	ENST00000324068.1	37	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	G	38	6.968373	0.97971	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	.	.	.	4.99	4.99	0.66335	.	0.861308	0.10258	N	0.696376	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	9.7844	0.40666	0.0974:0.0:0.9026:0.0	.	.	.	.	X	555;300	.	ENSP00000317214:Q555X	Q	-	1	0	CAPN6	110377332	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.618000	0.46393	2.308000	0.77769	0.517000	0.50305	CAG		0.408	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
IGSF1	3547	hgsc.bcm.edu	37	X	130408763	130408763	+	Silent	SNP	C	C	T	rs373571972		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:130408763C>T	ENST00000361420.3	-	18	3640	c.3561G>A	c.(3559-3561)ctG>ctA	p.L1187L	IGSF1_ENST00000370903.3_Silent_p.L1192L|IGSF1_ENST00000370910.1_Silent_p.L1178L|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370904.1_Silent_p.L1178L			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1187	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.L1187L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						CAACACCTGGCAGGGGTCCTC	0.502																																					p.L1178L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3534A	X						.						141.0	141.0	141.0					X																	130408763		2203	4300	6503	130236444	SO:0001819	synonymous_variant	3547	exon17			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3561G>A	X.37:g.130408763C>T		Somatic		Capture	SOLID	Phase_I	130236444	NM_001170962	B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	ENST00000361420.3	37	CCDS14629.1																																																																																				0.502	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		
AFF2	2334	hgsc.bcm.edu	37	X	148039901	148039901	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:148039901A>C	ENST00000370460.2	+	12	3082	c.2603A>C	c.(2602-2604)aAg>aCg	p.K868T	AFF2_ENST00000342251.3_Missense_Mutation_p.K835T|AFF2_ENST00000370457.5_Missense_Mutation_p.K835T|AFF2_ENST00000286437.5_Missense_Mutation_p.K509T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	868					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.K868T(1)|p.K868M(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGAGAAGAAGCAGCGCCTG	0.488																																					p.K868T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2603C	X						.						197.0	184.0	189.0					X																	148039901		2203	4300	6503	147847601	SO:0001583	missense	2334	exon12			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2603A>C	X.37:g.148039901A>C	ENSP00000359489:p.Lys868Thr	Somatic		Capture	SOLID	Phase_I	147847601	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.094352	0.76870	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.81	5.81	0.92471	.	0.367614	0.27384	N	0.019617	T	0.79028	0.4377	M	0.78049	2.395	0.44227	D	0.997062	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.72982	0.979;0.964;0.964;0.964;0.964;0.979	T	0.78966	-0.1995	10	0.38643	T	0.18	.	8.8274	0.35063	0.9165:0.0:0.0835:0.0	.	509;833;835;829;858;868	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	T	868;835;835;509	ENSP00000359489:K868T;ENSP00000359486:K835T;ENSP00000345459:K835T;ENSP00000286437:K509T	ENSP00000286437:K509T	K	+	2	0	AFF2	147847601	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.299000	0.65716	1.949000	0.56562	0.486000	0.48141	AAG		0.488	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
ARSH	347527	hgsc.bcm.edu	37	X	2951350	2951350	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:2951350G>T	ENST00000381130.2	+	9	1613	c.1613G>T	c.(1612-1614)tGg>tTg	p.W538L		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	538					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TGGAAACCATGGCTGCAGCCT	0.527																																					p.W538L												.	.	0			c.G1613T	X						.						92.0	59.0	70.0					X																	2951350		2203	4300	6503	2961350	SO:0001583	missense	347527	exon9			AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.1613G>T	X.37:g.2951350G>T	ENSP00000370522:p.Trp538Leu	Somatic		Capture	SOLID	Phase_I	2961350	NM_001011719		Missense_Mutation	SNP	ENST00000381130.2	37	CCDS35198.1	.	.	.	.	.	.	.	.	.	.	g	15.31	2.796880	0.50208	.	.	ENSG00000205667	ENST00000381130	D	0.90620	-2.7	3.24	3.24	0.37175	Alkaline-phosphatase-like, core domain (1);	0.077138	0.56097	U	0.000031	D	0.95033	0.8392	M	0.85197	2.74	0.50171	D	0.999859	D	0.89917	1.0	D	0.74023	0.982	D	0.95030	0.8168	10	0.48119	T	0.1	.	14.1941	0.65659	0.0:0.0:1.0:0.0	.	538	Q5FYA8	ARSH_HUMAN	L	538	ENSP00000370522:W538L	ENSP00000370522:W538L	W	+	2	0	ARSH	2961350	1.000000	0.71417	0.921000	0.36526	0.302000	0.27658	8.024000	0.88770	1.395000	0.46643	0.513000	0.50165	TGG		0.527	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356489.1	NM_001011719	
MAOA	4128	hgsc.bcm.edu	37	X	43592002	43592002	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:43592002G>A	ENST00000338702.3	+	9	1135	c.1012G>A	c.(1012-1014)Gat>Aat	p.D338N	MAOA_ENST00000542639.1_Missense_Mutation_p.D205N	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	338					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)	p.D338N(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	AATAACCTTGGATGACACCAA	0.443																																					p.D338N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1012A	X						.						150.0	131.0	138.0					X																	43592002		2203	4300	6503	43476946	SO:0001583	missense	4128	exon9				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1012G>A	X.37:g.43592002G>A	ENSP00000340684:p.Asp338Asn	Somatic		Capture	SOLID	Phase_I	43476946	NM_000240	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	37	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673703	0.88445	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	T;T	0.53857	0.6;0.6	5.87	4.12	0.48240	Amine oxidase (1);	0.000000	0.85682	D	0.000000	T	0.79215	0.4408	H	0.96333	3.805	0.80722	D	1	D	0.71674	0.998	D	0.70716	0.97	T	0.83107	-0.0125	10	0.62326	D	0.03	.	11.9961	0.53204	0.143:0.0:0.857:0.0	.	338	P21397	AOFA_HUMAN	N	338;205	ENSP00000340684:D338N;ENSP00000440846:D205N	ENSP00000340684:D338N	D	+	1	0	MAOA	43476946	1.000000	0.71417	0.906000	0.35671	0.941000	0.58515	9.146000	0.94640	0.640000	0.30582	0.538000	0.68166	GAT		0.443	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
SUV39H1	6839	hgsc.bcm.edu	37	X	48564909	48564909	+	Silent	SNP	G	G	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:48564909G>C	ENST00000376687.3	+	5	1186	c.996G>C	c.(994-996)gtG>gtC	p.V332V	SUV39H1_ENST00000482260.1_3'UTR|SUV39H1_ENST00000337852.6_Silent_p.V343V|AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000453214.2_Missense_Mutation_p.C180S	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	332	Mediates interaction with MECOM. {ECO:0000250}.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.V332V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						ACCTGCAGGTGTACAACGTCT	0.607																																					p.V332V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G996C	X						.						49.0	39.0	42.0					X																	48564909		2200	4296	6496	48449853	SO:0001819	synonymous_variant	6839	exon5			AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.996G>C	X.37:g.48564909G>C		Somatic		Capture	SOLID	Phase_I	48449853	NM_003173	B2R6E8|B4DST0|Q53G60|Q6FHK6	Silent	SNP	ENST00000376687.3	37	CCDS14304.1	.	.	.	.	.	.	.	.	.	.	G	9.502	1.103546	0.20632	.	.	ENSG00000101945	ENST00000453214	.	.	.	4.65	-0.591	0.11675	.	.	.	.	.	T	0.18509	0.0444	.	.	.	0.23483	N	0.997583	.	.	.	.	.	.	T	0.22730	-1.0208	4	.	.	.	.	0.1758	0.00118	0.2964:0.1463:0.256:0.3014	.	.	.	.	S	180	.	.	C	+	2	0	SUV39H1	48449853	0.951000	0.32395	0.999000	0.59377	0.987000	0.75469	0.034000	0.13776	0.067000	0.16545	0.464000	0.42555	TGT		0.607	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058909.1	NM_003173	
FAAH2	158584	hgsc.bcm.edu	37	X	57473466	57473466	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:57473466T>A	ENST00000374900.4	+	9	1342	c.1222T>A	c.(1222-1224)Tcc>Acc	p.S408T	FAAH2_ENST00000491179.1_Intron	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	408						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)	p.S408T(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						CACCATCCCTTCCATTGGTAT	0.393										HNSCC(52;0.14)																											p.S408T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1222A	X						.						108.0	77.0	88.0					X																	57473466		2203	4300	6503	57490191	SO:0001583	missense	158584	exon9			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.1222T>A	X.37:g.57473466T>A	ENSP00000364035:p.Ser408Thr	Somatic		Capture	SOLID	Phase_I	57490191	NM_174912	Q86VT2|Q96N98	Missense_Mutation	SNP	ENST00000374900.4	37	CCDS14375.1	.	.	.	.	.	.	.	.	.	.	t	10.43	1.348357	0.24426	.	.	ENSG00000165591	ENST00000374900	T	0.53857	0.6	2.87	1.64	0.23874	Amidase signature domain (2);	0.226728	0.35262	U	0.003339	T	0.41534	0.1163	L	0.46157	1.445	0.21527	N	0.999656	B	0.19445	0.036	B	0.26310	0.068	T	0.32322	-0.9911	10	0.44086	T	0.13	.	5.8179	0.18506	0.0:0.0:0.3181:0.6819	.	408	Q6GMR7	FAAH2_HUMAN	T	408	ENSP00000364035:S408T	ENSP00000364035:S408T	S	+	1	0	FAAH2	57490191	1.000000	0.71417	0.638000	0.29380	0.738000	0.42128	1.230000	0.32612	0.068000	0.16574	0.441000	0.28932	TCC		0.393	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
GDPD2	54857	hgsc.bcm.edu	37	X	69647197	69647197	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:69647197C>T	ENST00000374382.3	+	10	1071	c.820C>T	c.(820-822)Cac>Tac	p.H274Y	GDPD2_ENST00000472623.1_3'UTR|GDPD2_ENST00000538649.1_Missense_Mutation_p.H195Y|GDPD2_ENST00000453994.2_Missense_Mutation_p.H274Y|GDPD2_ENST00000536730.1_Missense_Mutation_p.H195Y	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	274	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)	p.H274Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					GCATGATGAGCACCTCAGCAG	0.577																																					p.H195Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C583T	X						.						93.0	67.0	76.0					X																	69647197		2203	4300	6503	69563922	SO:0001583	missense	54857	exon9			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.820C>T	X.37:g.69647197C>T	ENSP00000363503:p.His274Tyr	Somatic		Capture	SOLID	Phase_I	69563922	NM_001171193	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.388713	0.25118	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.26	2.44	0.29823	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	1.362360	0.04188	N	0.327843	T	0.09113	0.0225	N	0.13003	0.285	0.09310	N	1	B;B;B	0.30973	0.302;0.046;0.277	B;B;B	0.31442	0.113;0.015;0.13	T	0.46721	-0.9171	9	.	.	.	-0.0052	12.992	0.58625	0.6854:0.3146:0.0:0.0	.	274;60;274	B4DVC9;B3KUI6;Q9HCC8	.;.;GDPD2_HUMAN	Y	274;195;195;274	ENSP00000414019:H274Y;ENSP00000445982:H195Y;ENSP00000444601:H195Y;ENSP00000363503:H274Y	.	H	+	1	0	GDPD2	69563922	0.003000	0.15002	0.915000	0.36163	0.887000	0.51463	0.393000	0.20817	0.182000	0.20032	-0.490000	0.04691	CAC		0.577	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711	
ATP7A	538	hgsc.bcm.edu	37	X	77243951	77243951	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:77243951G>A	ENST00000341514.6	+	3	489	c.334G>A	c.(334-336)Ggt>Agt	p.G112S	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Missense_Mutation_p.G112S	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	112					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)	p.G112S(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GAAGACCAAGGGTGTGACAGA	0.433																																					p.G112S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G334A	X						.						238.0	215.0	223.0					X																	77243951		2203	4296	6499	77130607	SO:0001583	missense	538	exon3			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.334G>A	X.37:g.77243951G>A	ENSP00000345728:p.Gly112Ser	Somatic		Capture	SOLID	Phase_I	77130607	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924640	0.73213	.	.	ENSG00000165240	ENST00000343533;ENST00000341514;ENST00000400860;ENST00000355691	D;D	0.91945	-2.94;-2.94	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.94062	0.8097	L	0.32530	0.975	0.80722	D	1	D;B	0.89917	1.0;0.167	D;B	0.97110	1.0;0.093	D	0.94878	0.8036	10	0.87932	D	0	-11.6754	18.9069	0.92466	0.0:0.0:1.0:0.0	.	112;122	Q04656;Q59HD1	ATP7A_HUMAN;.	S	112;112;112;122	ENSP00000343026:G112S;ENSP00000345728:G112S	ENSP00000345728:G112S	G	+	1	0	ATP7A	77130607	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	9.107000	0.94261	2.413000	0.81919	0.600000	0.82982	GGT		0.433	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
P2RY10	27334	hgsc.bcm.edu	37	X	78216491	78216491	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:78216491C>T	ENST00000171757.2	+	4	754	c.474C>T	c.(472-474)atC>atT	p.I158I	P2RY10_ENST00000475374.1_3'UTR|P2RY10_ENST00000544091.1_Silent_p.I158I	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.I158I(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						CCATCTGGATCGTTGTGGGGA	0.493																																					p.I158I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C474T	X						.						115.0	99.0	104.0					X																	78216491		2203	4300	6503	78103147	SO:0001819	synonymous_variant	27334	exon2			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.474C>T	X.37:g.78216491C>T		Somatic		Capture	SOLID	Phase_I	78103147	NM_198333	D3DTE5|Q4VBN7|Q86V16	Silent	SNP	ENST00000171757.2	37	CCDS14442.1																																																																																				0.493	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1		
F8	2157	hgsc.bcm.edu	37	X	154088761	154088761	+	Silent	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chrX:154088761G>T	ENST00000360256.4	-	25	7046	c.6846C>A	c.(6844-6846)tcC>tcA	p.S2282S	F8_ENST00000330287.6_Silent_p.S147S	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2282	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.S2282S(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CTTGACTGCTGGAGATGAGGA	0.418																																					p.S2282S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C6846A	X						.						151.0	137.0	142.0					X																	154088761		2203	4300	6503	153741955	SO:0001819	synonymous_variant	2157	exon25			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6846C>A	X.37:g.154088761G>T		Somatic		Capture	SOLID	Phase_I	153741955	NM_000132	Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	CCDS35457.1																																																																																				0.418	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
IL18R1	8809	hgsc.bcm.edu	37	2	102984292	102984292	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:102984292T>C	ENST00000409599.1	+	4	422	c.66T>C	c.(64-66)tgT>tgC	p.C22C	IL18R1_ENST00000233957.1_Silent_p.C22C|IL18R1_ENST00000334376.3_Silent_p.C22C			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	22					immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)	p.C22C(1)		breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						AAGAATCTTGTACTTCACGTC	0.358																																					p.C22C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T66C	2						.						46.0	44.0	45.0					2																	102984292		2203	4300	6503	102350724	SO:0001819	synonymous_variant	8809	exon2			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.66T>C	2.37:g.102984292T>C		Somatic		Capture	SOLID	Phase_I	102350724	NM_003855	B2R9Y5|Q52LC9	Silent	SNP	ENST00000409599.1	37	CCDS2060.1																																																																																				0.358	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855	
ATP6V1C2	245973	hgsc.bcm.edu	37	2	10894131	10894131	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:10894131C>T	ENST00000272238.4	+	4	331	c.222C>T	c.(220-222)agC>agT	p.S74S	ATP6V1C2_ENST00000381661.3_Silent_p.S74S	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	74					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.S74S(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		TGGCTCAGAGCGTGGTGGAAG	0.542																																					p.S74S	NSCLC(188;1042 2136 10807 16813 47705)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C222T	2						.						65.0	50.0	55.0					2																	10894131		2203	4300	6503	10811582	SO:0001819	synonymous_variant	245973	exon4			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.222C>T	2.37:g.10894131C>T		Somatic		Capture	SOLID	Phase_I	10811582	NM_001039362	Q96EL8	Silent	SNP	ENST00000272238.4	37	CCDS42653.1																																																																																				0.542	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583	
GREB1	9687	hgsc.bcm.edu	37	2	11696772	11696772	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:11696772C>T	ENST00000381486.2	+	2	332	c.32C>T	c.(31-33)aCg>aTg	p.T11M	GREB1_ENST00000263834.5_Missense_Mutation_p.T11M|GREB1_ENST00000389825.3_Intron|GREB1_ENST00000381483.2_Missense_Mutation_p.T11M|GREB1_ENST00000234142.5_Missense_Mutation_p.T11M	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	11						integral component of membrane (GO:0016021)		p.T11M(3)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CAGCTGAAGACGACACGCTTT	0.517																																					p.T11M	Ovarian(39;850 945 2785 23371 33093)											.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C32T	2						.						110.0	103.0	105.0					2																	11696772		2203	4300	6503	11614223	SO:0001583	missense	9687	exon2				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.32C>T	2.37:g.11696772C>T	ENSP00000370896:p.Thr11Met	Somatic		Capture	SOLID	Phase_I	11614223	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546019	0.65198	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000381483;ENST00000234142	T;T;T;T	0.21734	3.06;1.99;2.02;3.06	4.71	3.64	0.41730	.	0.141721	0.47093	D	0.000250	T	0.37433	0.1003	L	0.47716	1.5	0.42923	D	0.99429	D;D;D	0.89917	1.0;0.999;0.979	D;P;P	0.65874	0.939;0.88;0.721	T	0.19192	-1.0313	10	0.87932	D	0	-1.8296	14.4816	0.67587	0.0:0.769:0.231:0.0	.	11;11;11	Q4ZG55-2;Q4ZG55-3;Q4ZG55	.;.;GREB1_HUMAN	M	11	ENSP00000370896:T11M;ENSP00000263834:T11M;ENSP00000370892:T11M;ENSP00000234142:T11M	ENSP00000234142:T11M	T	+	2	0	GREB1	11614223	0.912000	0.30974	0.851000	0.33527	0.973000	0.67179	1.776000	0.38594	0.760000	0.33108	0.655000	0.94253	ACG		0.517	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
SLC5A7	60482	hgsc.bcm.edu	37	2	108608625	108608625	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:108608625G>A	ENST00000264047.2	+	3	518	c.242G>A	c.(241-243)gGc>gAc	p.G81D	SLC5A7_ENST00000409059.1_Missense_Mutation_p.G81D|SLC5A7_ENST00000540517.1_5'UTR	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	81					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.G81D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	CCAGGTTATGGCCTAGCTTGG	0.438																																					p.G81D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G242A	2						.						175.0	149.0	158.0					2																	108608625		2203	4300	6503	107975057	SO:0001583	missense	60482	exon3			AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.242G>A	2.37:g.108608625G>A	ENSP00000264047:p.Gly81Asp	Somatic		Capture	SOLID	Phase_I	107975057	NM_021815	Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	33	5.232182	0.95207	.	.	ENSG00000115665	ENST00000409059;ENST00000264047	D;D	0.97888	-4.59;-4.59	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.99130	0.9700	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99075	1.0835	10	0.72032	D	0.01	-18.3848	20.8598	0.99761	0.0:0.0:1.0:0.0	.	81	Q9GZV3	SC5A7_HUMAN	D	81	ENSP00000387346:G81D;ENSP00000264047:G81D	ENSP00000264047:G81D	G	+	2	0	SLC5A7	107975057	1.000000	0.71417	0.953000	0.39169	0.898000	0.52572	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGC		0.438	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
WDR33	55339	hgsc.bcm.edu	37	2	128526526	128526526	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:128526526T>C	ENST00000322313.4	-	3	412	c.254A>G	c.(253-255)gAt>gGt	p.D85G	WDR33_ENST00000393006.1_Missense_Mutation_p.D85G|WDR33_ENST00000409658.3_Missense_Mutation_p.D85G	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	85					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D85G(2)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		ATAACCTGCATCAGGCTGAAT	0.313																																					p.D85G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A254G	2						.						152.0	138.0	143.0					2																	128526526		2203	4300	6503	128242996	SO:0001583	missense	55339	exon3				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.254A>G	2.37:g.128526526T>C	ENSP00000325377:p.Asp85Gly	Somatic		Capture	SOLID	Phase_I	128242996	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	T	17.96	3.516353	0.64634	.	.	ENSG00000136709	ENST00000322313;ENST00000436787;ENST00000393006;ENST00000409658;ENST00000408998	T;T;T;T;T	0.67523	4.84;-0.27;4.84;4.84;0.64	5.29	5.29	0.74685	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78947	0.4364	L	0.59436	1.845	0.80722	D	1	D;P;D	0.67145	0.996;0.791;0.993	D;B;D	0.79784	0.993;0.368;0.984	T	0.80903	-0.1174	10	0.66056	D	0.02	-14.4761	15.5146	0.75812	0.0:0.0:0.0:1.0	.	85;85;85	Q9C0J8-2;Q6NUQ0;Q9C0J8	.;.;WDR33_HUMAN	G	85;7;85;85;85	ENSP00000325377:D85G;ENSP00000397547:D7G;ENSP00000376730:D85G;ENSP00000387186:D85G;ENSP00000386861:D85G	ENSP00000325377:D85G	D	-	2	0	WDR33	128242996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.719000	0.84751	2.123000	0.65237	0.533000	0.62120	GAT		0.313	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
SAP130	79595	hgsc.bcm.edu	37	2	128757912	128757912	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:128757912G>A	ENST00000259235.3	-	8	1193	c.1064C>T	c.(1063-1065)aCg>aTg	p.T355M	SAP130_ENST00000259234.6_Missense_Mutation_p.T329M|SAP130_ENST00000357702.5_Missense_Mutation_p.T355M	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	355					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.T355M(1)		NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		CTGTTTTGGCGTCCCTAATGC	0.473																																					p.T355M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1064T	2						.						311.0	276.0	288.0					2																	128757912		2203	4300	6503	128474382	SO:0001583	missense	79595	exon8			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1064C>T	2.37:g.128757912G>A	ENSP00000259235:p.Thr355Met	Somatic		Capture	SOLID	Phase_I	128474382	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	37	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453655	0.63290	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.68	5.68	0.88126	.	0.099373	0.64402	D	0.000002	T	0.57446	0.2054	N	0.14661	0.345	0.41530	D	0.98845	D;P;D	0.71674	0.998;0.872;0.981	P;P;P	0.55615	0.78;0.534;0.736	T	0.61637	-0.7022	9	0.48119	T	0.1	-17.0935	19.8003	0.96504	0.0:0.0:1.0:0.0	.	355;328;355	B7ZLM3;Q96DP1;Q9H0E3	.;.;SP130_HUMAN	M	355;355;329	.	ENSP00000259234:T329M	T	-	2	0	SAP130	128474382	1.000000	0.71417	0.202000	0.23494	0.954000	0.61252	7.108000	0.77055	2.672000	0.90937	0.650000	0.86243	ACG		0.473	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
LRP1B	53353	hgsc.bcm.edu	37	2	141093243	141093243	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:141093243G>A	ENST00000389484.3	-	78	13028	c.12057C>T	c.(12055-12057)acC>acT	p.T4019T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4019					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.T4019T(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTAAGAGTCTGGTGCAGTTGG	0.413										TSP Lung(27;0.18)																											p.T4019T	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C12057T	2						.						132.0	131.0	132.0					2																	141093243		2203	4300	6503	140809713	SO:0001819	synonymous_variant	53353	exon78			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12057C>T	2.37:g.141093243G>A		Somatic		Capture	SOLID	Phase_I	140809713	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	9.622	1.134010	0.21123	.	.	ENSG00000168702	ENST00000437977	.	.	.	5.49	3.65	0.41850	.	.	.	.	.	T	0.54382	0.1855	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48603	-0.9021	4	.	.	.	.	5.5736	0.17210	0.0685:0.1098:0.5124:0.3093	.	.	.	.	L	251	.	.	P	-	2	0	LRP1B	140809713	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	0.486000	0.22340	0.758000	0.33059	0.585000	0.79938	CCA		0.413	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ARL6IP6	151188	hgsc.bcm.edu	37	2	153591540	153591540	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:153591540G>A	ENST00000326446.5	+	3	1198	c.487G>A	c.(487-489)Gct>Act	p.A163T	ARL6IP6_ENST00000463690.1_3'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6	163						integral component of membrane (GO:0016021)		p.A163T(1)		kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						ATCCCTAACTGCTGGATTCTC	0.378																																					p.A163T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G487A	2						.						160.0	161.0	160.0					2																	153591540		2203	4300	6503	153299786	SO:0001583	missense	151188	exon3			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.487G>A	2.37:g.153591540G>A	ENSP00000315357:p.Ala163Thr	Somatic		Capture	SOLID	Phase_I	153299786	NM_152522	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	ENST00000326446.5	37	CCDS2197.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545656	0.86022	.	.	ENSG00000177917	ENST00000326446	.	.	.	5.87	5.87	0.94306	.	0.148818	0.43579	D	0.000547	T	0.64046	0.2563	M	0.69823	2.125	0.53688	D	0.999972	B;P	0.51537	0.141;0.946	B;P	0.48677	0.041;0.586	T	0.66356	-0.5944	9	0.51188	T	0.08	-18.1985	13.0113	0.58733	0.0772:0.0:0.9228:0.0	.	163;163	B3KMZ5;Q8N6S5	.;AR6P6_HUMAN	T	163	.	ENSP00000315357:A163T	A	+	1	0	ARL6IP6	153299786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.745000	0.47459	2.780000	0.95670	0.655000	0.94253	GCT		0.378	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522	
RPRM	56475	hgsc.bcm.edu	37	2	154334900	154334900	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:154334900C>T	ENST00000325926.3	-	1	422	c.180G>A	c.(178-180)gcG>gcA	p.A60A	AC012501.2_ENST00000424322.1_RNA	NM_019845.2	NP_062819.1	Q9NS64	RPRM_HUMAN	reprimo, TP53 dependent G2 arrest mediator candidate	60					cell cycle arrest (GO:0007050)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.A60A(1)		large_intestine(2)|lung(1)|prostate(1)	4						CGCACATGACCGCGATCTGCA	0.617																																					p.A60A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G180A	2						.						130.0	92.0	105.0					2																	154334900		2203	4300	6503	154043146	SO:0001819	synonymous_variant	56475	exon1			AK074808	CCDS2198.1	2q24.1	2011-01-26	2005-12-01		ENSG00000177519	ENSG00000177519			24201	protein-coding gene	gene with protein product	"""candidate mediator of the p53 dependent G2 arrest"", ""REPRIMO"""	612171	"""reprimo, TP53 dependant G2 arrest mediator candidate"""			10930422	Standard	NM_019845		Approved	FLJ90327, REPRIMO	uc002tyq.1	Q9NS64	OTTHUMG00000131905	ENST00000325926.3:c.180G>A	2.37:g.154334900C>T		Somatic		Capture	SOLID	Phase_I	154043146	NM_019845	B2R4V1	Silent	SNP	ENST00000325926.3	37	CCDS2198.1																																																																																				0.617	RPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254856.1	NM_019845	
UPP2	151531	hgsc.bcm.edu	37	2	158974431	158974431	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:158974431C>T	ENST00000005756.4	+	4	629	c.435C>T	c.(433-435)atC>atT	p.I145I	UPP2_ENST00000409859.4_Silent_p.I202I|UPP2_ENST00000605860.1_Silent_p.I202I|UPP2_ENST00000460456.1_Intron	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	145					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)	p.I145I(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	TTATTAGAATCGGTACATCAG	0.428																																					p.I202I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C606T	2						.						165.0	151.0	156.0					2																	158974431		2203	4299	6502	158682677	SO:0001819	synonymous_variant	151531	exon6			AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.435C>T	2.37:g.158974431C>T		Somatic		Capture	SOLID	Phase_I	158682677	NM_001135098	B3KV87	Silent	SNP	ENST00000005756.4	37	CCDS2207.1																																																																																				0.428	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254929.2	NM_173355	
ITGB6	3694	hgsc.bcm.edu	37	2	161052804	161052804	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:161052804A>T	ENST00000283249.2	-	3	506	c.269T>A	c.(268-270)cTc>cAc	p.L90H	ITGB6_ENST00000428609.2_Missense_Mutation_p.L48H|ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000409872.1_Missense_Mutation_p.L90H|ITGB6_ENST00000409967.2_Missense_Mutation_p.L90H	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	90					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)	p.L90H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GCCTACACTGAGAGGCTTATT	0.398																																					p.L90H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T269A	2						.						175.0	176.0	176.0					2																	161052804		2203	4300	6503	160761050	SO:0001583	missense	3694	exon3				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.269T>A	2.37:g.161052804A>T	ENSP00000283249:p.Leu90His	Somatic		Capture	SOLID	Phase_I	160761050	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.225628	0.79576	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	5.67	5.67	0.87782	Integrin beta subunit, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96923	0.8995	M	0.85777	2.775	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97598	1.0121	10	0.87932	D	0	.	15.9054	0.79423	1.0:0.0:0.0:0.0	.	48;90	E9PEE8;P18564	.;ITB6_HUMAN	H	90;48;90;90	ENSP00000283249:L90H;ENSP00000408024:L48H;ENSP00000386828:L90H;ENSP00000386367:L90H	ENSP00000283249:L90H	L	-	2	0	ITGB6	160761050	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.258000	0.89853	2.157000	0.67596	0.533000	0.62120	CTC		0.398	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
PPIG	9360	hgsc.bcm.edu	37	2	170493494	170493494	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:170493494C>T	ENST00000260970.3	+	14	1946	c.1726C>T	c.(1726-1728)Cga>Tga	p.R576*	PPIG_ENST00000448752.2_Nonsense_Mutation_p.R576*|PPIG_ENST00000409714.3_Nonsense_Mutation_p.R561*	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	576	Arg/Ser-rich (RS domain).				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)	p.R576*(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	CAGAAGAGTGCGATCAAGAAC	0.448																																					p.R576X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1726T	2						.						145.0	138.0	140.0					2																	170493494		2202	4300	6502	170201740	SO:0001587	stop_gained	9360	exon14			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1726C>T	2.37:g.170493494C>T	ENSP00000260970:p.Arg576*	Somatic		Capture	SOLID	Phase_I	170201740	NM_004792	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Nonsense_Mutation	SNP	ENST00000260970.3	37	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082793	0.55861	.	.	ENSG00000138398	ENST00000260970;ENST00000409714;ENST00000448752	.	.	.	5.74	1.39	0.22231	.	0.233426	0.35262	N	0.003325	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.9424	8.9443	0.35749	0.6327:0.288:0.0:0.0792	.	.	.	.	X	576;561;576	.	ENSP00000260970:R576X	R	+	1	2	PPIG	170201740	0.213000	0.23551	0.999000	0.59377	0.142000	0.21351	0.587000	0.23909	0.323000	0.23307	-0.119000	0.15052	CGA		0.448	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
OLA1	29789	hgsc.bcm.edu	37	2	175094161	175094161	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:175094161A>C	ENST00000409546.1	-	3	810	c.180T>G	c.(178-180)aaT>aaG	p.N60K	OLA1_ENST00000428402.2_Missense_Mutation_p.N40K|OLA1_ENST00000284719.3_Missense_Mutation_p.N40K|OLA1_ENST00000344357.5_5'UTR					Obg-like ATPase 1									p.N40K(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						TGGTTAACACATTGAAGAAAG	0.348																																					p.N40K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T120G	2						.						58.0	58.0	58.0					2																	175094161		2203	4300	6503	174802407	SO:0001583	missense	29789	exon3				CCDS2255.1, CCDS42779.1	2q31.1	2014-06-24	2007-07-27	2007-07-27	ENSG00000138430	ENSG00000138430			28833	protein-coding gene	gene with protein product		611175	"""GTP-binding protein 9 (putative)"""	GTPBP9		17430889, 24486488	Standard	NM_013341		Approved	PTD004	uc002uih.3	Q9NTK5	OTTHUMG00000132335	ENST00000409546.1:c.180T>G	2.37:g.175094161A>C	ENSP00000386350:p.Asn60Lys	Somatic		Capture	SOLID	Phase_I	174802407	NM_013341		Missense_Mutation	SNP	ENST00000409546.1	37		.	.	.	.	.	.	.	.	.	.	A	19.55	3.848442	0.71603	.	.	ENSG00000138430	ENST00000284719;ENST00000428402;ENST00000409546;ENST00000427472	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.6	5.6	0.85130	GTP1/OBG (1);GTP-binding domain, HSR1-related (1);	0.041685	0.85682	D	0.000000	T	0.63698	0.2533	M	0.89840	3.065	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77004	0.987;0.989;0.989	T	0.72286	-0.4338	10	0.87932	D	0	.	16.0858	0.81049	1.0:0.0:0.0:0.0	.	40;40;40	Q9NTK5-3;D7EHM2;Q9NTK5	.;.;OLA1_HUMAN	K	40;40;60;40	ENSP00000284719:N40K;ENSP00000410385:N40K;ENSP00000386350:N60K;ENSP00000414568:N40K	ENSP00000284719:N40K	N	-	3	2	OLA1	174802407	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.316000	0.59178	2.264000	0.75181	0.533000	0.62120	AAT		0.348	OLA1-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333877.1	NM_013341	
PDE1A	5136	hgsc.bcm.edu	37	2	183032981	183032981	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:183032981T>C	ENST00000410103.1	-	15	1684	c.1601A>G	c.(1600-1602)cAt>cGt	p.H534R	PDE1A_ENST00000358139.2_Missense_Mutation_p.H534R|PDE1A_ENST00000351439.5_Missense_Mutation_p.H518R|PDE1A_ENST00000435564.1_Intron|PDE1A_ENST00000409365.1_Intron|PDE1A_ENST00000331935.6_Intron|PDE1A_ENST00000536095.1_Intron|PDE1A_ENST00000346717.4_Intron	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	534					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.H534R(1)		endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TGTTTACTGATGAATAAACTC	0.338																																					p.H534R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1601G	2						.						94.0	91.0	92.0					2																	183032981		2203	4300	6503	182741226	SO:0001583	missense	5136	exon15				CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.1601A>G	2.37:g.183032981T>C	ENSP00000387037:p.His534Arg	Somatic		Capture	SOLID	Phase_I	182741226	NM_001003683	D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Missense_Mutation	SNP	ENST00000410103.1	37	CCDS33344.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.336928	0.24253	.	.	ENSG00000115252	ENST00000351439;ENST00000410103;ENST00000358139	T;T;T	0.70282	-0.46;-0.47;-0.47	3.12	0.477	0.16784	.	.	.	.	.	T	0.46483	0.1395	N	0.08118	0	0.09310	N	0.999993	B;B;B	0.22683	0.073;0.072;0.036	B;B;B	0.20577	0.03;0.013;0.029	T	0.36261	-0.9755	9	0.56958	D	0.05	.	5.5472	0.17071	0.4821:0.0:0.0:0.5179	.	500;534;518	P54750-3;P54750;P54750-2	.;PDE1A_HUMAN;.	R	518;534;534	ENSP00000309269:H518R;ENSP00000387037:H534R;ENSP00000350858:H534R	ENSP00000309269:H518R	H	-	2	0	PDE1A	182741226	0.021000	0.18746	0.043000	0.18650	0.086000	0.17979	-0.228000	0.09114	0.079000	0.16929	0.533000	0.62120	CAT		0.338	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334356.1		
WDR35	57539	hgsc.bcm.edu	37	2	20145686	20145686	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:20145686G>A	ENST00000345530.3	-	17	1854	c.1739C>T	c.(1738-1740)aCg>aTg	p.T580M	WDR35_ENST00000281405.4_Missense_Mutation_p.T569M|WDR35_ENST00000416055.2_Missense_Mutation_p.T145M	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	580					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)		p.T580M(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGCTGTCCCGTACTGTCCGT	0.413																																					p.T580M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1739T	2						.						174.0	160.0	165.0					2																	20145686		2203	4300	6503	20009167	SO:0001583	missense	57539	exon17			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.1739C>T	2.37:g.20145686G>A	ENSP00000314444:p.Thr580Met	Somatic		Capture	SOLID	Phase_I	20009167	NM_001006657	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	37	CCDS33152.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889176	0.72524	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055;ENST00000453014	D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01	5.7	4.79	0.61399	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.363374	0.30043	N	0.010560	D	0.93314	0.7869	M	0.62723	1.935	0.40896	D	0.984116	P;P;B;D	0.64830	0.914;0.95;0.024;0.994	B;P;B;P	0.53549	0.429;0.493;0.007;0.729	D	0.93350	0.6717	10	0.48119	T	0.1	-14.3343	15.8182	0.78621	0.0:0.1355:0.8645:0.0	.	580;569;580;145	F8WB94;Q9P2L0-2;Q9P2L0;B3KR94	.;.;WDR35_HUMAN;.	M	580;569;145;115	ENSP00000314444:T580M;ENSP00000281405:T569M;ENSP00000399159:T145M;ENSP00000404409:T115M	ENSP00000281405:T569M	T	-	2	0	WDR35	20009167	1.000000	0.71417	0.985000	0.45067	0.958000	0.62258	5.543000	0.67225	2.690000	0.91761	0.650000	0.86243	ACG		0.413	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
MYO1B	4430	hgsc.bcm.edu	37	2	192246226	192246226	+	Silent	SNP	C	C	T	rs147109563		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:192246226C>T	ENST00000392318.3	+	14	1471	c.1224C>T	c.(1222-1224)aaC>aaT	p.N408N	MYO1B_ENST00000392316.1_Silent_p.N408N|MYO1B_ENST00000339514.4_Silent_p.N408N|MYO1B_ENST00000496992.1_3'UTR|MYO1B_ENST00000304164.4_Silent_p.N408N	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	408	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.N408N(2)		NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ATTATTGTAACGAAAAGCTGC	0.343													T|||	1	0.000199681	0.0	0.0	5008	,	,		19904	0.0		0.0	False		,,,				2504	0.001				p.N408N												MYO1B,central_nervous_system,brain,Substitution - coding silent,0	.	2	Substitution - coding silent(2)	large_intestine(1)|central_nervous_system(1)	c.C1224T	2						.	T	,,	0,4406		0,0,2203	91.0	89.0	90.0		1224,1224,1224	0.7	1.0	2	dbSNP_134	90	1,8599	818.5+/-406.9	0,1,4299	yes	coding-synonymous,coding-synonymous,coding-synonymous	MYO1B	NM_001130158.1,NM_001161819.1,NM_012223.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	408/1137,408/1137,408/1079	192246226	1,13005	2203	4300	6503	191954471	SO:0001819	synonymous_variant	4430	exon14			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.1224C>T	2.37:g.192246226C>T		Somatic		Capture	SOLID	Phase_I	191954471	NM_012223	O43794|Q7Z6L5	Silent	SNP	ENST00000392318.3	37	CCDS46477.1																																																																																				0.343	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
BMPR2	659	hgsc.bcm.edu	37	2	203383560	203383560	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:203383560C>T	ENST00000374580.4	+	6	1176	c.637C>T	c.(637-639)Cga>Tga	p.R213*	BMPR2_ENST00000374574.2_Nonsense_Mutation_p.R213*	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	213	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.R213*(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						TGGCCGAGGTCGATATGGAGC	0.343																																					p.R213X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C637T	2	GRCh37	CM041256	BMPR2	M		.						83.0	76.0	78.0					2																	203383560		2203	4300	6503	203091805	SO:0001587	stop_gained	659	exon6			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.637C>T	2.37:g.203383560C>T	ENSP00000363708:p.Arg213*	Somatic		Capture	SOLID	Phase_I	203091805	NM_001204	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Nonsense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	C	34	5.380854	0.95945	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	.	.	.	6.05	4.19	0.49359	.	0.115223	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3342	0.74238	0.2713:0.7287:0.0:0.0	.	.	.	.	X	213	.	ENSP00000363702:R213X	R	+	1	2	BMPR2	203091805	0.988000	0.35896	1.000000	0.80357	0.992000	0.81027	1.460000	0.35244	0.813000	0.34350	-0.284000	0.09977	CGA		0.343	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	
CTLA4	1493	hgsc.bcm.edu	37	2	204735457	204735457	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:204735457G>A	ENST00000302823.3	+	2	415	c.258G>A	c.(256-258)gcG>gcA	p.A86A	CTLA4_ENST00000472206.1_Intron|CTLA4_ENST00000427473.2_Silent_p.A49A|CTLA4_ENST00000487393.1_Intron|CTLA4_ENST00000295854.6_Silent_p.A86A	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	86	Ig-like V-type.				B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.A86A(1)		large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	AAGTCTGTGCGGCAACCTACA	0.537																																					p.A86A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G258A	2						.						149.0	131.0	137.0					2																	204735457		2203	4300	6503	204443702	SO:0001819	synonymous_variant	1493	exon2				CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.258G>A	2.37:g.204735457G>A		Somatic		Capture	SOLID	Phase_I	204443702	NM_005214	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Silent	SNP	ENST00000302823.3	37	CCDS2362.1																																																																																				0.537	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256365.1	NM_005214	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209168946	209168946	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:209168946G>A	ENST00000264380.4	+	11	1530	c.1372G>A	c.(1372-1374)Gtg>Atg	p.V458M	PIKFYVE_ENST00000407449.1_Missense_Mutation_p.V458M|PIKFYVE_ENST00000392202.3_Missense_Mutation_p.V361M|PIKFYVE_ENST00000308862.6_Missense_Mutation_p.V372M	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	458					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.V458M(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGTGAACTCCGTGGAAGGACA	0.448																																					p.V458M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1372A	2						.						128.0	122.0	124.0					2																	209168946		2203	4300	6503	208877191	SO:0001583	missense	200576	exon11			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.1372G>A	2.37:g.209168946G>A	ENSP00000264380:p.Val458Met	Somatic		Capture	SOLID	Phase_I	208877191	NM_001178000	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881155	0.51801	.	.	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000392200;ENST00000407449;ENST00000308862;ENST00000452564	T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48	5.4	4.52	0.55395	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.163508	0.39985	N	0.001218	T	0.14270	0.0345	N	0.19112	0.55	0.41372	D	0.987496	B;B;P;D;D	0.59767	0.076;0.076;0.642;0.968;0.986	B;B;B;B;P	0.50490	0.02;0.012;0.13;0.312;0.642	T	0.06935	-1.0799	10	0.34782	T	0.22	-9.5533	14.2124	0.65773	0.072:0.0:0.928:0.0	.	458;458;372;458;361	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	M	361;458;90;458;372;458	ENSP00000376038:V361M;ENSP00000264380:V458M;ENSP00000384356:V458M;ENSP00000308715:V372M;ENSP00000405736:V458M	ENSP00000264380:V458M	V	+	1	0	PIKFYVE	208877191	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.679000	0.54634	1.420000	0.47138	0.455000	0.32223	GTG		0.448	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209182622	209182622	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:209182622T>C	ENST00000264380.4	+	16	2197	c.2039T>C	c.(2038-2040)gTt>gCt	p.V680A		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	680					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.V680A(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GATTCTGTGGTTGTCAATGGC	0.363																																					p.V680A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2039C	2						.						205.0	194.0	198.0					2																	209182622		2203	4300	6503	208890867	SO:0001583	missense	200576	exon16			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2039T>C	2.37:g.209182622T>C	ENSP00000264380:p.Val680Ala	Somatic		Capture	SOLID	Phase_I	208890867	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.921187	0.92249	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.80566	-1.39;-1.39	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000003	D	0.90010	0.6881	M	0.80847	2.515	0.80722	D	1	D;D	0.69078	0.997;0.985	D;D	0.79108	0.992;0.981	D	0.91144	0.4948	10	0.72032	D	0.01	-19.0031	16.3158	0.82923	0.0:0.0:0.0:1.0	.	680;624	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	A	680;256;624	ENSP00000264380:V680A;ENSP00000405736:V624A	ENSP00000264380:V680A	V	+	2	0	PIKFYVE	208890867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.254000	0.74563	0.533000	0.62120	GTT		0.363	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209190265	209190265	+	Silent	SNP	C	C	A	rs143279377		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:209190265C>A	ENST00000264380.4	+	20	2888	c.2730C>A	c.(2728-2730)tcC>tcA	p.S910S		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	910					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.S910S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GTGGAGGTTCCATCCCCTGGG	0.512																																					p.S910S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2730A	2						.						86.0	79.0	82.0					2																	209190265		2203	4300	6503	208898510	SO:0001819	synonymous_variant	200576	exon20			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2730C>A	2.37:g.209190265C>A		Somatic		Capture	SOLID	Phase_I	208898510	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	37	CCDS2382.1																																																																																				0.512	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
APOB	338	hgsc.bcm.edu	37	2	21236152	21236152	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:21236152A>G	ENST00000233242.1	-	25	4223	c.4096T>C	c.(4096-4098)Ttg>Ctg	p.L1366L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1366					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.L1366L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGTTGTACAAGTTGCTGTAG	0.512																																					p.L1366L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4096C	2						.						209.0	191.0	197.0					2																	21236152		2203	4300	6503	21089657	SO:0001819	synonymous_variant	338	exon25			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4096T>C	2.37:g.21236152A>G		Somatic		Capture	SOLID	Phase_I	21089657	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				0.512	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOB	338	hgsc.bcm.edu	37	2	21236190	21236190	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:21236190A>G	ENST00000233242.1	-	25	4185	c.4058T>C	c.(4057-4059)cTg>cCg	p.L1353P		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1353					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.L1353P(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAGAACACCCAGGAGAGGCAC	0.517																																					p.L1353P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4058C	2						.						182.0	168.0	173.0					2																	21236190		2203	4300	6503	21089695	SO:0001583	missense	338	exon25			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4058T>C	2.37:g.21236190A>G	ENSP00000233242:p.Leu1353Pro	Somatic		Capture	SOLID	Phase_I	21089695	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522732	0.85600	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01304	5.03	5.18	5.18	0.71444	.	0.336114	0.22672	N	0.057043	T	0.07279	0.0184	M	0.70595	2.14	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.02877	-1.1099	10	0.87932	D	0	.	15.3478	0.74355	1.0:0.0:0.0:0.0	.	1353	P04114	APOB_HUMAN	P	1353	ENSP00000233242:L1353P	ENSP00000233242:L1353P	L	-	2	0	APOB	21089695	0.995000	0.38212	0.673000	0.29887	0.972000	0.66771	8.985000	0.93487	2.087000	0.62958	0.460000	0.39030	CTG		0.517	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOB	338	hgsc.bcm.edu	37	2	21250885	21250885	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:21250885T>G	ENST00000233242.1	-	14	2009	c.1882A>C	c.(1882-1884)Atg>Ctg	p.M628L	APOB_ENST00000399256.4_Missense_Mutation_p.M628L	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	628	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.M628L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGAAGTCCATGACAGTTGGA	0.368																																					p.M628L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1882C	2						.						118.0	123.0	121.0					2																	21250885		2203	4300	6503	21104390	SO:0001583	missense	338	exon14			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1882A>C	2.37:g.21250885T>G	ENSP00000233242:p.Met628Leu	Somatic		Capture	SOLID	Phase_I	21104390	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.972589	0.53614	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.04275	5.93;3.66	5.85	4.7	0.59300	Lipid transport protein, N-terminal (1);Vitellinogen, superhelical (2);	0.258232	0.36815	N	0.002383	T	0.04770	0.0129	L	0.49126	1.545	0.41168	D	0.986141	P	0.39782	0.688	B	0.24974	0.057	T	0.44605	-0.9317	10	0.41790	T	0.15	.	11.8748	0.52541	0.0:0.0677:0.0:0.9323	.	628	P04114	APOB_HUMAN	L	628	ENSP00000233242:M628L;ENSP00000382200:M628L	ENSP00000233242:M628L	M	-	1	0	APOB	21104390	0.992000	0.36948	0.995000	0.50966	0.940000	0.58332	0.772000	0.26647	1.165000	0.42670	0.533000	0.62120	ATG		0.368	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
MAP2	4133	hgsc.bcm.edu	37	2	210558891	210558891	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:210558891T>G	ENST00000360351.4	+	7	2503	c.1997T>G	c.(1996-1998)gTg>gGg	p.V666G	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.V662G	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	666					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.V666G(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GATCCAAAAGTGTATGGAGAG	0.433																																					p.V666G	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1997G	2						.						109.0	107.0	108.0					2																	210558891		2203	4300	6503	210267136	SO:0001583	missense	4133	exon7				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.1997T>G	2.37:g.210558891T>G	ENSP00000353508:p.Val666Gly	Somatic		Capture	SOLID	Phase_I	210267136	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.990593	0.54041	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.26223	1.75;1.75	6.16	6.16	0.99307	MAP2/Tau projection (1);	0.000000	0.56097	D	0.000027	T	0.48642	0.1511	L	0.56769	1.78	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.69824	0.943;0.966	T	0.44726	-0.9309	10	0.72032	D	0.01	-16.7922	16.8061	0.85666	0.0:0.0:0.0:1.0	.	662;666	P11137-3;P11137	.;MAP2_HUMAN	G	666;662	ENSP00000353508:V666G;ENSP00000392164:V662G	ENSP00000353508:V666G	V	+	2	0	MAP2	210267136	1.000000	0.71417	0.956000	0.39512	0.984000	0.73092	5.904000	0.69886	2.367000	0.80283	0.528000	0.53228	GTG		0.433	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
ERBB4	2066	hgsc.bcm.edu	37	2	213403195	213403195	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:213403195G>A	ENST00000342788.4	-	1	370	c.60C>T	c.(58-60)gtC>gtT	p.V20V	ERBB4_ENST00000436443.1_Silent_p.V20V|ERBB4_ENST00000402597.1_Silent_p.V20V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	20					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V20V(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CGCTGGGCTGGACGGTCCCCG	0.632										TSP Lung(8;0.080)																											p.V20V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C60T	2						.						63.0	76.0	72.0					2																	213403195		2203	4300	6503	213111440	SO:0001819	synonymous_variant	2066	exon1			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.60C>T	2.37:g.213403195G>A		Somatic		Capture	SOLID	Phase_I	213111440	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.458491	0.26248	.	.	ENSG00000178568	ENST00000260943	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	T	0.72120	0.3421	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69423	-0.5149	4	.	.	.	.	15.7752	0.78209	0.0:0.0:1.0:0.0	.	.	.	.	F	20	.	.	S	-	2	0	ERBB4	213111440	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.035000	0.41155	2.800000	0.96347	0.456000	0.33151	TCC		0.632	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ABCA12	26154	hgsc.bcm.edu	37	2	215876263	215876263	+	Silent	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:215876263G>T	ENST00000272895.7	-	17	2451	c.2232C>A	c.(2230-2232)ccC>ccA	p.P744P	ABCA12_ENST00000389661.4_Silent_p.P426P	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	744					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.P744P(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCTGGGAAGAGGGCAGCATGG	0.393																																					p.P744P	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2232A	2						.						134.0	136.0	135.0					2																	215876263		2203	4300	6503	215584508	SO:0001819	synonymous_variant	26154	exon17			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2232C>A	2.37:g.215876263G>T		Somatic		Capture	SOLID	Phase_I	215584508	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	CCDS33372.1																																																																																				0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
XRCC5	7520	hgsc.bcm.edu	37	2	217055040	217055040	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:217055040C>T	ENST00000392133.3	+	19	2388	c.1927C>T	c.(1927-1929)Cgg>Tgg	p.R643W	XRCC5_ENST00000392132.2_Missense_Mutation_p.R643W			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	643					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.R643W(1)		endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		CCGAGCCTTCCGGGAAGAAGC	0.418								Non-homologous end-joining																													p.R643W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1927T	2						.						85.0	82.0	83.0					2																	217055040		2203	4300	6503	216763285	SO:0001583	missense	7520	exon17			AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1927C>T	2.37:g.217055040C>T	ENSP00000375978:p.Arg643Trp	Somatic		Capture	SOLID	Phase_I	216763285	NM_021141	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	37	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144264	0.57044	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	T;T	0.66995	-0.24;-0.24	4.78	2.79	0.32731	Ku, C-terminal (3);	0.056216	0.64402	D	0.000001	T	0.81456	0.4826	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83324	-0.0016	10	0.87932	D	0	.	10.0058	0.41957	0.4794:0.5206:0.0:0.0	.	643	P13010	XRCC5_HUMAN	W	643	ENSP00000375978:R643W;ENSP00000375977:R643W	ENSP00000375977:R643W	R	+	1	2	XRCC5	216763285	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	1.460000	0.35244	1.219000	0.43474	0.655000	0.94253	CGG		0.418	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	
PAX3	5077	hgsc.bcm.edu	37	2	223085034	223085034	+	Missense_Mutation	SNP	G	G	A	rs551614431		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:223085034G>A	ENST00000350526.4	-	7	1134	c.998C>T	c.(997-999)cCg>cTg	p.P333L	PAX3_ENST00000392069.2_Missense_Mutation_p.P333L|PAX3_ENST00000392070.2_Missense_Mutation_p.P333L|PAX3_ENST00000344493.4_Missense_Mutation_p.P333L|PAX3_ENST00000409551.3_Missense_Mutation_p.P332L|PAX3_ENST00000336840.6_Missense_Mutation_p.P333L|PAX3_ENST00000464706.1_5'UTR	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	333					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P333L(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGAGGAAGCGGTTGAGGTCT	0.498			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						G|||	1	0.000199681	0.0	0.0	5008	,	,		20256	0.0		0.0	False		,,,				2504	0.001				p.P333L			Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C998T	2						.						242.0	199.0	213.0					2																	223085034		2203	4300	6503	222793278	SO:0001583	missense	5077	exon7				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.998C>T	2.37:g.223085034G>A	ENSP00000343052:p.Pro333Leu	Somatic		Capture	SOLID	Phase_I	222793278	NM_181461	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841378	0.91197	.	.	ENSG00000135903	ENST00000392069;ENST00000344493;ENST00000350526;ENST00000392070;ENST00000336840;ENST00000409551;ENST00000464706;ENST00000555548	D;D;D;D;D;D	0.94828	-3.53;-3.52;-3.52;-3.51;-3.53;-3.52	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.96697	0.8922	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.996;0.998;0.999;1.0;0.999	D	0.96239	0.9174	10	0.49607	T	0.09	.	19.7917	0.96461	0.0:0.0:1.0:0.0	.	333;332;333;333;333	P23760;Q494Z4;P23760-4;P23760-5;G5E9C1	PAX3_HUMAN;.;.;.;.	L	333;333;333;333;333;332;50;50	ENSP00000375921:P333L;ENSP00000342092:P333L;ENSP00000343052:P333L;ENSP00000375922:P333L;ENSP00000338767:P333L;ENSP00000386750:P332L	ENSP00000338767:P333L	P	-	2	0	PAX3	222793278	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.439000	0.97543	2.685000	0.91497	0.650000	0.86243	CCG		0.498	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
MRPL44	65080	hgsc.bcm.edu	37	2	224824385	224824385	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:224824385G>A	ENST00000258383.3	+	2	383	c.314G>A	c.(313-315)cGc>cAc	p.R105H		NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	105	RNase III.				mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.R105H(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		GAGGCCAAACGCCAACAACTT	0.373																																					p.R105H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G314A	2						.						67.0	71.0	70.0					2																	224824385		2203	4300	6503	224532629	SO:0001583	missense	65080	exon2			AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.314G>A	2.37:g.224824385G>A	ENSP00000258383:p.Arg105His	Somatic		Capture	SOLID	Phase_I	224532629	NM_022915	Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	ENST00000258383.3	37	CCDS2459.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148696	0.78001	.	.	ENSG00000135900	ENST00000258383	T	0.43688	0.94	5.59	5.59	0.84812	Ribonuclease III (3);	0.000000	0.85682	D	0.000000	T	0.67088	0.2856	M	0.82323	2.585	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	T	0.70378	-0.4888	10	0.56958	D	0.05	-0.182	17.0966	0.86637	0.0:0.0:1.0:0.0	.	105	Q9H9J2	RM44_HUMAN	H	105	ENSP00000258383:R105H	ENSP00000258383:R105H	R	+	2	0	MRPL44	224532629	1.000000	0.71417	0.971000	0.41717	0.572000	0.35998	6.202000	0.72131	2.625000	0.88918	0.650000	0.86243	CGC		0.373	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256866.2	NM_022915	
DGKD	8527	hgsc.bcm.edu	37	2	234368406	234368406	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:234368406C>T	ENST00000264057.2	+	23	2710	c.2698C>T	c.(2698-2700)Cgc>Tgc	p.R900C	DGKD_ENST00000409813.3_Missense_Mutation_p.R856C	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	900					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R900C(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TGCTCAGTGTCGCACGGTGAA	0.567																																					p.R900C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2698T	2						.						84.0	72.0	76.0					2																	234368406		2203	4300	6503	234033145	SO:0001583	missense	8527	exon23			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2698C>T	2.37:g.234368406C>T	ENSP00000264057:p.Arg900Cys	Somatic		Capture	SOLID	Phase_I	234033145	NM_152879	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471422	0.84533	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.48836	0.8;0.8	4.35	4.35	0.52113	Diacylglycerol kinase, accessory domain (2);	0.000000	0.64402	D	0.000001	T	0.70011	0.3175	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.75499	-0.3296	10	0.87932	D	0	.	17.4273	0.87529	0.0:1.0:0.0:0.0	.	856;900	Q16760-2;Q16760	.;DGKD_HUMAN	C	900;856	ENSP00000264057:R900C;ENSP00000386455:R856C	ENSP00000264057:R900C	R	+	1	0	DGKD	234033145	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	7.562000	0.82300	2.442000	0.82660	0.462000	0.41574	CGC		0.567	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
OTOF	9381	hgsc.bcm.edu	37	2	26682921	26682921	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:26682921T>C	ENST00000272371.2	-	46	6092	c.5966A>G	c.(5965-5967)tAc>tGc	p.Y1989C	OTOF_ENST00000403946.3_Intron|OTOF_ENST00000402415.3_Missense_Mutation_p.Y1299C|OTOF_ENST00000338581.6_Missense_Mutation_p.Y1222C|OTOF_ENST00000339598.3_Intron	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1989					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.Y1989C(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGACCAGGTAGCCAGGCAC	0.577																																					p.Y1989C	GBM(102;732 1451 20652 24062 31372)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5966G	2						.						44.0	35.0	38.0					2																	26682921		2193	4292	6485	26536425	SO:0001583	missense	9381	exon46			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5966A>G	2.37:g.26682921T>C	ENSP00000272371:p.Tyr1989Cys	Somatic		Capture	SOLID	Phase_I	26536425	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	t	15.19	2.760608	0.49468	.	.	ENSG00000115155	ENST00000338581;ENST00000402415;ENST00000272371	T;T;D	0.81739	-1.26;-1.27;-1.53	4.64	2.15	0.27550	.	0.000000	0.85682	D	0.000000	D	0.89584	0.6757	M	0.92738	3.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.969;0.991;0.982	D	0.86677	0.1914	10	0.62326	D	0.03	-19.4137	6.4293	0.21788	0.0:0.0861:0.1579:0.756	.	1989;1299;1222	Q9HC10;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.	C	1222;1299;1989	ENSP00000345137:Y1222C;ENSP00000383906:Y1299C;ENSP00000272371:Y1989C	ENSP00000272371:Y1989C	Y	-	2	0	OTOF	26536425	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	3.394000	0.52551	0.154000	0.19237	0.375000	0.23000	TAC		0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
SLC35F6	54978	hgsc.bcm.edu	37	2	26997948	26997948	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:26997948G>A	ENST00000344420.5	+	3	249	c.187G>A	c.(187-189)Gct>Act	p.A63T	SLC35F6_ENST00000416475.2_Intron|CENPA_ENST00000475662.1_Intron|SLC35F6_ENST00000482746.1_Intron	NM_017877.3	NP_060347.2	Q8N357	S35F6_HUMAN	solute carrier family 35, member F6	63					negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)		p.A63T(1)									CTCCTGCCTGGCTGCCTTCTA	0.572																																					p.A63T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G187A	2						.						67.0	62.0	64.0					2																	26997948		2203	4300	6503	26851452	SO:0001583	missense	54978	exon3			AK075164	CCDS1728.1	2p24.1	2012-12-13	2012-12-07	2012-12-07	ENSG00000213699	ENSG00000213699			26055	protein-coding gene	gene with protein product	"""ANT2-binding protein"", ""transport and golgi organization 9 homolog (Drosophila)"""		"""chromosome 2 open reading frame 18"""	C2orf18		15911612, 19154410	Standard	NM_017877		Approved	FLJ20555, ANT2BP, TANGO9	uc002rhp.1	Q8N357	OTTHUMG00000128407	ENST00000344420.5:c.187G>A	2.37:g.26997948G>A	ENSP00000345528:p.Ala63Thr	Somatic		Capture	SOLID	Phase_I	26851452	NM_017877	D6W543|Q53GK2|Q8NBX6|Q9NWX0	Missense_Mutation	SNP	ENST00000344420.5	37	CCDS1728.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.920067	0.92249	.	.	ENSG00000213699	ENST00000344420	.	.	.	5.2	5.2	0.72013	.	0.215605	0.47852	D	0.000203	T	0.62684	0.2448	M	0.75264	2.295	0.80722	D	1	B	0.31968	0.349	B	0.24006	0.05	T	0.66921	-0.5801	9	0.59425	D	0.04	.	17.3219	0.87238	0.0:0.0:1.0:0.0	.	63	Q8N357	CB018_HUMAN	T	63	.	ENSP00000345528:A63T	A	+	1	0	C2orf18	26851452	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.567000	0.67378	2.424000	0.82194	0.655000	0.94253	GCT		0.572	SLC35F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250187.2	NM_017877	
RBKS	64080	hgsc.bcm.edu	37	2	28050494	28050494	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:28050494T>C	ENST00000302188.3	-	7	1487	c.735A>G	c.(733-735)tcA>tcG	p.S245S	RBKS_ENST00000444339.2_Silent_p.S245S	NM_022128.1	NP_071411.1	Q9H477	RBSK_HUMAN	ribokinase	245					D-ribose catabolic process (GO:0019303)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ribokinase activity (GO:0004747)	p.S245S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7	Acute lymphoblastic leukemia(172;0.155)					GTTCTGTCTGTGACAGCACCA	0.478																																					p.S245S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A735G	2						.						132.0	128.0	129.0					2																	28050494		2203	4300	6503	27903998	SO:0001819	synonymous_variant	64080	exon7			BC017425	CCDS1762.1	2p23.3	2008-02-05			ENSG00000171174	ENSG00000171174	2.7.1.15		30325	protein-coding gene	gene with protein product		611132				8382990	Standard	NM_022128		Approved	DKFZp686G13268, RBSK	uc002rlo.1	Q9H477	OTTHUMG00000097833	ENST00000302188.3:c.735A>G	2.37:g.28050494T>C		Somatic		Capture	SOLID	Phase_I	27903998	NM_022128	A9UK04|B4DV96	Silent	SNP	ENST00000302188.3	37	CCDS1762.1	.	.	.	.	.	.	.	.	.	.	T	1.961	-0.438930	0.04636	.	.	ENSG00000171174	ENST00000458185	.	.	.	5.51	-5.85	0.02311	.	.	.	.	.	T	0.34919	0.0914	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35968	-0.9767	4	.	.	.	-7.282	0.9563	0.01386	0.1781:0.1867:0.2726:0.3627	.	.	.	.	A	106	.	.	T	-	1	0	RBKS	27903998	0.002000	0.14202	0.075000	0.20258	0.404000	0.30871	-0.413000	0.07123	-1.401000	0.02058	-1.751000	0.00678	ACA		0.478	RBKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215118.1	NM_022128	
LTBP1	4052	hgsc.bcm.edu	37	2	33585830	33585830	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:33585830C>T	ENST00000404816.2	+	27	4520	c.4167C>T	c.(4165-4167)tgC>tgT	p.C1389C	LTBP1_ENST00000404525.1_Silent_p.C1010C|LTBP1_ENST00000418533.2_Silent_p.C1021C|LTBP1_ENST00000390003.4_Silent_p.C1064C|LTBP1_ENST00000354476.3_Silent_p.C1390C|LTBP1_ENST00000402934.1_Silent_p.C1008C|LTBP1_ENST00000407925.1_Silent_p.C1063C|LTBP1_ENST00000272273.5_Silent_p.C287C			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1389	TB 3.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.C1390C(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCTTCCCCTGCCCGGTCTTGG	0.502																																					p.C1063C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3189T	2						.						92.0	84.0	87.0					2																	33585830		2203	4300	6503	33439334	SO:0001819	synonymous_variant	4052	exon23				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4167C>T	2.37:g.33585830C>T		Somatic		Capture	SOLID	Phase_I	33439334	NM_000627	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	CCDS33177.2																																																																																				0.502	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
CEBPZ	10153	hgsc.bcm.edu	37	2	37441043	37441043	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:37441043C>A	ENST00000234170.5	-	10	2654	c.2509G>T	c.(2509-2511)Gaa>Taa	p.E837*	RP11-423P10.2_ENST00000606229.1_RNA|AC007390.5_ENST00000438935.2_Intron	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	837					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E837*(1)		breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TCCACGTCTTCTATACTTTCT	0.279																																					p.E837X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2509T	2						.						236.0	228.0	231.0					2																	37441043		2202	4300	6502	37294547	SO:0001587	stop_gained	10153	exon10			M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.2509G>T	2.37:g.37441043C>A	ENSP00000234170:p.Glu837*	Somatic		Capture	SOLID	Phase_I	37294547	NM_005760	Q8NE75	Nonsense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	C	41	8.629491	0.98892	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	.	.	.	5.63	4.73	0.59995	.	0.109129	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.6609	0.77188	0.1382:0.8618:0.0:0.0	.	.	.	.	X	837	.	ENSP00000234170:E837X	E	-	1	0	CEBPZ	37294547	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.769000	0.74985	1.305000	0.44909	0.655000	0.94253	GAA		0.279	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43970992	43970992	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:43970992C>T	ENST00000282406.4	+	23	3529	c.3419C>T	c.(3418-3420)tCt>tTt	p.S1140F		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1140	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)	p.S1140F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTTGACGCATCTACCACAGTG	0.388																																					p.S1140F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3419T	2						.						101.0	96.0	98.0					2																	43970992		2203	4300	6503	43824496	SO:0001583	missense	130271	exon23			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3419C>T	2.37:g.43970992C>T	ENSP00000282406:p.Ser1140Phe	Somatic		Capture	SOLID	Phase_I	43824496	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.921006	0.92249	.	.	ENSG00000152527	ENST00000282406	T	0.76968	-1.06	5.76	5.76	0.90799	Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.89185	0.6643	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.89353	0.3662	10	0.62326	D	0.03	-17.6047	19.9857	0.97347	0.0:1.0:0.0:0.0	.	1140	Q8IVE3	PKHH2_HUMAN	F	1140	ENSP00000282406:S1140F	ENSP00000282406:S1140F	S	+	2	0	PLEKHH2	43824496	1.000000	0.71417	0.983000	0.44433	0.985000	0.73830	7.487000	0.81328	2.706000	0.92434	0.655000	0.94253	TCT		0.388	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43971019	43971019	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:43971019C>T	ENST00000282406.4	+	23	3556	c.3446C>T	c.(3445-3447)aCt>aTt	p.T1149I		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1149	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)	p.T1149I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTTTTGAATACTTTGAACCAG	0.393																																					p.T1149I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3446T	2						.						105.0	101.0	102.0					2																	43971019		2203	4300	6503	43824523	SO:0001583	missense	130271	exon23			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3446C>T	2.37:g.43971019C>T	ENSP00000282406:p.Thr1149Ile	Somatic		Capture	SOLID	Phase_I	43824523	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076099	0.76415	.	.	ENSG00000152527	ENST00000282406	T	0.49432	0.78	5.76	5.76	0.90799	Band 4.1 domain (1);FERM domain (1);	0.054268	0.85682	D	0.000000	T	0.62780	0.2456	M	0.72894	2.215	0.58432	D	0.999993	D	0.56968	0.978	P	0.53722	0.733	T	0.60403	-0.7270	10	0.38643	T	0.18	-25.7631	19.9857	0.97347	0.0:1.0:0.0:0.0	.	1149	Q8IVE3	PKHH2_HUMAN	I	1149	ENSP00000282406:T1149I	ENSP00000282406:T1149I	T	+	2	0	PLEKHH2	43824523	1.000000	0.71417	0.964000	0.40570	0.999000	0.98932	4.133000	0.57983	2.706000	0.92434	0.655000	0.94253	ACT		0.393	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43973007	43973007	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:43973007T>C	ENST00000282406.4	+	24	3668	c.3558T>C	c.(3556-3558)atT>atC	p.I1186I		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1186	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)	p.I1186I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTTTCTAGATTTGTGACATTA	0.363																																					p.I1186I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3558C	2						.						63.0	58.0	60.0					2																	43973007		2203	4300	6503	43826511	SO:0001819	synonymous_variant	130271	exon24			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3558T>C	2.37:g.43973007T>C		Somatic		Capture	SOLID	Phase_I	43826511	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	ENST00000282406.4	37	CCDS1812.1																																																																																				0.363	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
SRBD1	55133	hgsc.bcm.edu	37	2	45774701	45774701	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:45774701G>A	ENST00000263736.4	-	13	1788	c.1726C>T	c.(1726-1728)Cga>Tga	p.R576*	SRBD1_ENST00000535761.1_Nonsense_Mutation_p.R95*	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	576					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)	p.R576fs*6(1)|p.R576*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TCCGCCTCTCGGAAGCCTTGT	0.333																																					p.R576X												.	.	2	Substitution - Nonsense(1)|Deletion - Frameshift(1)	large_intestine(1)|breast(1)	c.C1726T	2						.						66.0	66.0	66.0					2																	45774701		2203	4299	6502	45628205	SO:0001587	stop_gained	55133	exon13			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1726C>T	2.37:g.45774701G>A	ENSP00000263736:p.Arg576*	Somatic		Capture	SOLID	Phase_I	45628205	NM_018079	Q53T56|Q96TA4|Q9NW11	Nonsense_Mutation	SNP	ENST00000263736.4	37	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	G	38	6.826473	0.97869	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	.	.	.	5.24	4.35	0.52113	.	0.204155	0.41500	D	0.000866	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4365	0.75152	0.0:0.0:0.8598:0.1402	.	.	.	.	X	576;95	.	ENSP00000263736:R576X	R	-	1	2	SRBD1	45628205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.773000	0.55333	1.299000	0.44798	0.655000	0.94253	CGA		0.333	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
MSH6	2956	hgsc.bcm.edu	37	2	48030670	48030670	+	Missense_Mutation	SNP	G	G	A	rs63750253		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:48030670G>A	ENST00000234420.5	+	5	3436	c.3284G>A	c.(3283-3285)cGc>cAc	p.R1095H	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000538136.1_Missense_Mutation_p.R793H|MSH6_ENST00000540021.1_Missense_Mutation_p.R965H	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1095			R -> H (in CRC; unknown pathological significance; mismatch repair proficient). {ECO:0000269|PubMed:12522549}.		ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.R1095H(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AAAGGATCACGCCATCCTTGC	0.458			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.R1095H		yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	.	4	Substitution - Missense(2)|Whole gene deletion(2)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)	c.G3284A	2	GRCh37	CM030237	MSH6	M	rs63750253	.						135.0	118.0	124.0					2																	48030670		2203	4300	6503	47884174	SO:0001583	missense	2956	exon5	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3284G>A	2.37:g.48030670G>A	ENSP00000234420:p.Arg1095His	Somatic		Capture	SOLID	Phase_I	47884174	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804382	0.90623	.	.	ENSG00000116062	ENST00000234420;ENST00000543270;ENST00000540021;ENST00000538136	D;D;D	0.87334	-2.24;-2.24;-2.24	5.38	5.38	0.77491	DNA mismatch repair protein MutS, core (1);DNA mismatch repair protein MutS, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96420	0.8832	H	0.98559	4.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.978	D	0.97321	0.9944	10	0.51188	T	0.08	-10.4918	19.1221	0.93367	0.0:0.0:1.0:0.0	rs63750253	965;1095	B4DF41;P52701	.;MSH6_HUMAN	H	1095;63;965;793	ENSP00000234420:R1095H;ENSP00000446475:R965H;ENSP00000438580:R793H	ENSP00000234420:R1095H	R	+	2	0	MSH6	47884174	1.000000	0.71417	0.993000	0.49108	0.880000	0.50808	9.835000	0.99442	2.528000	0.85240	0.491000	0.48974	CGC		0.458	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
ETAA1	54465	hgsc.bcm.edu	37	2	67630870	67630870	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:67630870G>A	ENST00000272342.5	+	5	1186	c.1056G>A	c.(1054-1056)atG>atA	p.M352I	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	352						cytoplasm (GO:0005737)		p.M352I(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						CACCCATAATGACAAAATCAT	0.348																																					p.M352I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1056A	2						.						67.0	68.0	67.0					2																	67630870		2203	4299	6502	67484374	SO:0001583	missense	54465	exon5			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1056G>A	2.37:g.67630870G>A	ENSP00000272342:p.Met352Ile	Somatic		Capture	SOLID	Phase_I	67484374	NM_019002	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	G	6.638	0.486247	0.12641	.	.	ENSG00000143971	ENST00000272342	T	0.17691	2.26	5.86	3.08	0.35506	.	0.555420	0.20084	N	0.099595	T	0.13114	0.0318	L	0.42245	1.32	0.09310	N	0.999999	B	0.16802	0.019	B	0.14578	0.011	T	0.35400	-0.9790	10	0.11794	T	0.64	-40.841	9.9688	0.41741	0.2201:0.0:0.7799:0.0	.	352	Q9NY74	ETAA1_HUMAN	I	352	ENSP00000272342:M352I	ENSP00000272342:M352I	M	+	3	0	ETAA1	67484374	0.006000	0.16342	0.380000	0.26093	0.709000	0.40893	1.436000	0.34980	0.383000	0.24910	0.655000	0.94253	ATG		0.348	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
WDR92	116143	hgsc.bcm.edu	37	2	68361857	68361857	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:68361857G>A	ENST00000295121.6	-	7	959	c.843C>T	c.(841-843)gcC>gcT	p.A281A	WDR92_ENST00000492039.2_5'UTR|WDR92_ENST00000406245.2_Silent_p.A180A|RP11-474G23.1_ENST00000406334.3_3'UTR|WDR92_ENST00000409164.1_Silent_p.A281A	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	281					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)	p.A281A(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						GAAGGCCGCCGGCGCCTCCAG	0.483																																					p.A281A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C843T	2						.						48.0	52.0	51.0					2																	68361857		2203	4300	6503	68215361	SO:0001819	synonymous_variant	116143	exon7			AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.843C>T	2.37:g.68361857G>A		Somatic		Capture	SOLID	Phase_I	68215361	NM_138458	Q96CR6	Silent	SNP	ENST00000295121.6	37	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.313756	0.23908	.	.	ENSG00000243667	ENST00000457114	.	.	.	5.35	-5.63	0.02474	.	.	.	.	.	T	0.44603	0.1301	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45234	-0.9275	4	.	.	.	.	4.6371	0.12530	0.5945:0.1107:0.183:0.1118	.	.	.	.	L	85	.	.	P	-	2	0	WDR92	68215361	0.000000	0.05858	0.805000	0.32314	0.991000	0.79684	-2.960000	0.00673	-0.768000	0.04626	0.655000	0.94253	CCG		0.483	WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	
ASPRV1	151516	hgsc.bcm.edu	37	2	70188639	70188639	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:70188639G>A	ENST00000320256.4	-	1	758	c.182C>T	c.(181-183)gCg>gTg	p.A61V	PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1									p.A61V(1)		endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						CAGTGTCGGCGCAATCACGCT	0.642																																					p.A61V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C182T	2						.						41.0	39.0	40.0					2																	70188639		2203	4300	6503	70042143	SO:0001583	missense	151516	exon1			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.182C>T	2.37:g.70188639G>A	ENSP00000315383:p.Ala61Val	Somatic		Capture	SOLID	Phase_I	70042143	NM_152792		Missense_Mutation	SNP	ENST00000320256.4	37	CCDS1897.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508748	0.85282	.	.	ENSG00000244617	ENST00000320256	T	0.55234	0.53	5.79	3.91	0.45181	.	0.229752	0.22316	N	0.061670	T	0.30008	0.0751	L	0.27053	0.805	0.32902	D	0.513352	P	0.48911	0.917	B	0.32624	0.149	T	0.50338	-0.8840	10	0.72032	D	0.01	-18.9485	6.7018	0.23229	0.0887:0.0:0.7339:0.1774	.	61	Q53RT3	APRV1_HUMAN	V	61	ENSP00000315383:A61V	ENSP00000315383:A61V	A	-	2	0	ASPRV1	70042143	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.092000	0.41700	2.733000	0.93635	0.655000	0.94253	GCG		0.642	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792	
INO80B	83444	hgsc.bcm.edu	37	2	74682576	74682576	+	Silent	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:74682576A>T	ENST00000233331.7	+	2	196	c.102A>T	c.(100-102)ggA>ggT	p.G34G	WBP1_ENST00000393972.3_5'Flank|WBP1_ENST00000233615.2_5'Flank|INO80B_ENST00000469849.1_Intron|INO80B_ENST00000409917.1_Silent_p.G34G	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	34					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.G21G(1)		endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						ATGGCCATGGAGTGcacaaga	0.587																																					p.G34G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A102T	2						.						58.0	69.0	65.0					2																	74682576		2203	4300	6503	74536084	SO:0001819	synonymous_variant	83444	exon2			AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.102A>T	2.37:g.74682576A>T		Somatic		Capture	SOLID	Phase_I	74536084	NM_031288		Silent	SNP	ENST00000233331.7	37	CCDS1942.2																																																																																				0.587	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252223.2	NM_031288	
LRRTM1	347730	hgsc.bcm.edu	37	2	80529599	80529599	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:80529599G>T	ENST00000295057.3	-	2	2002	c.1346C>A	c.(1345-1347)tCc>tAc	p.S449Y	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000540488.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.S449Y	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	449					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.S449Y(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						ACACTTCCAGGACACGTAGAG	0.592										HNSCC(69;0.2)																											p.S449Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1346A	2						.						101.0	89.0	93.0					2																	80529599		2203	4300	6503	80383110	SO:0001583	missense	347730	exon2			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1346C>A	2.37:g.80529599G>T	ENSP00000295057:p.Ser449Tyr	Somatic		Capture	SOLID	Phase_I	80383110	NM_178839	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995549	0.54147	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.50548	0.74;0.74	5.18	4.3	0.51218	.	0.076855	0.53938	U	0.000046	T	0.58538	0.2129	L	0.52011	1.625	0.58432	D	0.999997	D	0.65815	0.995	P	0.62491	0.903	T	0.57039	-0.7879	9	.	.	.	.	13.606	0.62048	0.0755:0.0:0.9245:0.0	.	449	Q86UE6	LRRT1_HUMAN	Y	449	ENSP00000295057:S449Y;ENSP00000386646:S449Y	.	S	-	2	0	LRRTM1	80383110	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.864000	0.99589	1.147000	0.42369	0.561000	0.74099	TCC		0.592	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
TCF7L1	83439	hgsc.bcm.edu	37	2	85529625	85529625	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:85529625G>A	ENST00000282111.3	+	5	819	c.544G>A	c.(544-546)Gtt>Att	p.V182I		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	182	Pro-rich.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V182I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						AGTTCCTGTCGTTCAGCACCC	0.502																																					p.V182I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G544A	2						.						173.0	177.0	176.0					2																	85529625		2203	4300	6503	85383136	SO:0001583	missense	83439	exon5			X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.544G>A	2.37:g.85529625G>A	ENSP00000282111:p.Val182Ile	Somatic		Capture	SOLID	Phase_I	85383136	NM_031283	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	37	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.832945	0.71258	.	.	ENSG00000152284	ENST00000282111	D	0.98996	-5.31	4.53	3.65	0.41850	CTNNB1 binding, N-teminal (1);	0.063724	0.64402	D	0.000008	D	0.98369	0.9458	M	0.81497	2.545	0.37415	D	0.913391	P	0.51653	0.947	P	0.45998	0.5	D	0.99208	1.0875	10	0.87932	D	0	.	12.4857	0.55871	0.0:0.1692:0.8308:0.0	.	182	Q9HCS4	TF7L1_HUMAN	I	182	ENSP00000282111:V182I	ENSP00000282111:V182I	V	+	1	0	TCF7L1	85383136	1.000000	0.71417	0.834000	0.33040	0.665000	0.39181	7.771000	0.85420	1.083000	0.41159	0.655000	0.94253	GTT		0.502	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
KDM3A	55818	hgsc.bcm.edu	37	2	86693578	86693578	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:86693578G>A	ENST00000409556.1	+	11	1456	c.1091G>A	c.(1090-1092)tGc>tAc	p.C364Y	KDM3A_ENST00000312912.5_Missense_Mutation_p.C364Y|KDM3A_ENST00000409064.1_Missense_Mutation_p.C364Y|KDM3A_ENST00000542128.1_Missense_Mutation_p.C312Y			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	364					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.C364Y(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						CCAGATGTCTGCAAAGCAGGG	0.388																																					p.C364Y	NSCLC(96;1150 1523 6936 46253 49736)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1091A	2						.						101.0	115.0	110.0					2																	86693578		2203	4300	6503	86547089	SO:0001583	missense	55818	exon10			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.1091G>A	2.37:g.86693578G>A	ENSP00000386660:p.Cys364Tyr	Somatic		Capture	SOLID	Phase_I	86547089	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	37	CCDS1990.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043978	0.36085	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.61	4.67	0.58626	.	0.600012	0.16824	N	0.198060	T	0.35998	0.0951	N	0.14661	0.345	0.31797	N	0.628948	D;P	0.54964	0.969;0.947	B;B	0.41036	0.346;0.254	T	0.47522	-0.9111	10	0.59425	D	0.04	.	12.6776	0.56903	0.0:0.2423:0.7577:0.0	.	312;364	F5H070;Q9Y4C1	.;KDM3A_HUMAN	Y	364;364;364;364;312	ENSP00000386660:C364Y;ENSP00000323659:C364Y;ENSP00000386516:C364Y;ENSP00000438324:C312Y	ENSP00000323659:C364Y	C	+	2	0	KDM3A	86547089	0.966000	0.33281	1.000000	0.80357	0.910000	0.53928	0.941000	0.29005	2.808000	0.96608	0.655000	0.94253	TGC		0.388	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
SMYD1	150572	hgsc.bcm.edu	37	2	88405872	88405872	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:88405872A>T	ENST00000419482.2	+	8	1095	c.1010A>T	c.(1009-1011)gAg>gTg	p.E337V	SMYD1_ENST00000444564.2_Missense_Mutation_p.E324V|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	337					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.E337V(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GAGTGCCTGGAGAAGCAGGAG	0.532																																					p.E337V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1010T	2						.						151.0	113.0	126.0					2																	88405872		2203	4300	6503	88186987	SO:0001583	missense	150572	exon8			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.1010A>T	2.37:g.88405872A>T	ENSP00000393453:p.Glu337Val	Somatic		Capture	SOLID	Phase_I	88186987	NM_198274	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	A	16.86	3.238874	0.58995	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.26067	1.76;1.77	5.03	5.03	0.67393	.	0.613940	0.18351	N	0.143894	T	0.23249	0.0562	L	0.36672	1.1	0.80722	D	1	B	0.09022	0.002	B	0.15052	0.012	T	0.02751	-1.1115	10	0.46703	T	0.11	-3.9944	14.2602	0.66080	1.0:0.0:0.0:0.0	.	337	Q8NB12	SMYD1_HUMAN	V	337;324;158	ENSP00000393453:E337V;ENSP00000407888:E324V	ENSP00000295833:E158V	E	+	2	0	SMYD1	88186987	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.641000	0.67881	2.016000	0.59253	0.433000	0.28618	GAG		0.532	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
AGAP1	116987	hgsc.bcm.edu	37	2	236649676	236649676	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr2:236649676G>C	ENST00000304032.8	+	4	960	c.380G>C	c.(379-381)gGc>gCc	p.G127A	AGAP1_ENST00000409538.1_Missense_Mutation_p.G392A|AGAP1_ENST00000409457.1_Missense_Mutation_p.G127A|AGAP1_ENST00000336665.5_Missense_Mutation_p.G127A	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	127	Small GTPase-like.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)	p.G127A(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						GATGAAGGGGGCCCCCCGGAG	0.488																																					p.G127A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G380C	2						.						84.0	84.0	84.0					2																	236649676		2203	4300	6503	236314415	SO:0001583	missense	116987	exon4			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.380G>C	2.37:g.236649676G>C	ENSP00000307634:p.Gly127Ala	Somatic		Capture	SOLID	Phase_I	236314415	NM_001037131	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	CCDS33408.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506957	0.85282	.	.	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665;ENST00000402604;ENST00000409538	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	4.8	4.8	0.61643	Mitochondrial Rho-like (1);	0.000000	0.85682	D	0.000000	T	0.81108	0.4754	H	0.97783	4.075	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.85130	0.919;0.997	D	0.88806	0.3288	10	0.72032	D	0.01	.	18.2419	0.89970	0.0:0.0:1.0:0.0	.	127;127	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	A	127;127;127;74;392	ENSP00000387174:G127A;ENSP00000307634:G127A;ENSP00000338378:G127A;ENSP00000385492:G74A;ENSP00000386897:G392A	ENSP00000307634:G127A	G	+	2	0	AGAP1	236314415	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.687000	0.98667	2.357000	0.79964	0.561000	0.74099	GGC		0.488	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914	
TMEM38B	55151	hgsc.bcm.edu	37	9	108483857	108483857	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:108483857G>T	ENST00000374692.3	+	3	426	c.309G>T	c.(307-309)caG>caT	p.Q103H	TMEM38B_ENST00000374688.1_Missense_Mutation_p.Q49H	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	103						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)	p.Q103H(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						TAGTTTCCCAGGGCTATTCAT	0.348																																					p.Q103H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G309T	9						.						83.0	77.0	79.0					9																	108483857		2203	4300	6503	107523678	SO:0001583	missense	55151	exon3			BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.309G>T	9.37:g.108483857G>T	ENSP00000363824:p.Gln103His	Somatic		Capture	SOLID	Phase_I	107523678	NM_018112	Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Missense_Mutation	SNP	ENST00000374692.3	37	CCDS6768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.40|13.40	2.226317|2.226317	0.39300|0.39300	.|.	.|.	ENSG00000095209|ENSG00000095209	ENST00000374692;ENST00000374688|ENST00000435034	T;T|.	0.44881|.	0.91;0.91|.	5.74|5.74	0.412|0.412	0.16397|0.16397	.|.	0.715101|.	0.14682|.	N|.	0.304701|.	T|T	0.36880|0.36880	0.0983|0.0983	L|L	0.54323|0.54323	1.7|1.7	0.26438|0.26438	N|N	0.975821|0.975821	B|.	0.12630|.	0.006|.	B|.	0.12156|.	0.007|.	T|T	0.32295|0.32295	-0.9912|-0.9912	10|5	0.66056|.	D|.	0.02|.	-0.2009|-0.2009	3.013|3.013	0.06051|0.06051	0.1335:0.1114:0.2997:0.4555|0.1335:0.1114:0.2997:0.4555	.|.	103|.	Q9NVV0|.	TM38B_HUMAN|.	H|M	103;49|40	ENSP00000363824:Q103H;ENSP00000363820:Q49H|.	ENSP00000363820:Q49H|.	Q|R	+|+	3|2	2|0	TMEM38B|TMEM38B	107523678|107523678	0.004000|0.004000	0.15560|0.15560	0.979000|0.979000	0.43373|0.43373	0.216000|0.216000	0.24613|0.24613	-0.394000|-0.394000	0.07296|0.07296	-0.189000|-0.189000	0.10482|0.10482	0.655000|0.655000	0.94253|0.94253	CAG|AGG		0.348	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053517.1	NM_018112	
CTNNAL1	8727	hgsc.bcm.edu	37	9	111755000	111755000	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:111755000G>C	ENST00000325551.4	-	3	517	c.431C>G	c.(430-432)gCt>gGt	p.A144G	CTNNAL1_ENST00000374593.4_Missense_Mutation_p.A144G|RNA5-8SP3_ENST00000364357.1_RNA|CTNNAL1_ENST00000374595.4_Missense_Mutation_p.A144G|CTNNAL1_ENST00000325580.6_Missense_Mutation_p.A144G	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	144					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.A144G(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		TAATCTTGCAGCCTTTATCAC	0.378																																					p.A144G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C431G	9						.						130.0	122.0	125.0					9																	111755000		2203	4300	6503	110794821	SO:0001583	missense	8727	exon3			AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.431C>G	9.37:g.111755000G>C	ENSP00000320434:p.Ala144Gly	Somatic		Capture	SOLID	Phase_I	110794821	NM_003798	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	ENST00000325551.4	37	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722793	0.89298	.	.	ENSG00000119326	ENST00000374595;ENST00000325551;ENST00000325580;ENST00000374593	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.75474	0.3854	M	0.86651	2.83	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.998	T	0.74003	-0.3804	10	0.25106	T	0.35	-13.3653	17.1374	0.86743	0.0:0.0:1.0:0.0	.	144;144;144	B2RBI4;Q9UBT7-2;Q9UBT7	.;.;CTNL1_HUMAN	G	144	ENSP00000363723:A144G;ENSP00000320434:A144G;ENSP00000323351:A144G;ENSP00000363721:A144G	ENSP00000320434:A144G	A	-	2	0	CTNNAL1	110794821	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.199000	0.95003	2.621000	0.88768	0.650000	0.86243	GCT		0.378	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
PRPF4	9128	hgsc.bcm.edu	37	9	116045417	116045417	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:116045417G>A	ENST00000374198.4	+	5	591	c.489G>A	c.(487-489)caG>caA	p.Q163Q	PRPF4_ENST00000374199.4_Silent_p.Q162Q|PRPF4_ENST00000488937.1_3'UTR	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	163					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)		p.Q163Q(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						TTCAGTATCAGCAAACCTGGT	0.408																																					p.Q163Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G489A	9						.						192.0	195.0	194.0					9																	116045417		2203	4300	6503	115085238	SO:0001819	synonymous_variant	9128	exon5			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.489G>A	9.37:g.116045417G>A		Somatic		Capture	SOLID	Phase_I	115085238	NM_004697	O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Silent	SNP	ENST00000374198.4	37	CCDS6791.1																																																																																				0.408	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	NM_004697	
C9orf43	257169	hgsc.bcm.edu	37	9	116181394	116181394	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:116181394G>A	ENST00000288462.4	+	4	740	c.294G>A	c.(292-294)ccG>ccA	p.P98P	C9orf43_ENST00000374165.1_Silent_p.P98P|C9orf43_ENST00000490544.1_3'UTR	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	98								p.P98P(1)		breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						TTAGGCCTCCGAAGGGTTTAC	0.328																																					p.P98P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G294A	9						.						101.0	100.0	101.0					9																	116181394		2203	4300	6503	115221215	SO:0001819	synonymous_variant	257169	exon4			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.294G>A	9.37:g.116181394G>A		Somatic		Capture	SOLID	Phase_I	115221215	NM_152786		Silent	SNP	ENST00000288462.4	37	CCDS6796.1																																																																																				0.328	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053739.1	NM_152786	
ASTN2	23245	hgsc.bcm.edu	37	9	119976817	119976817	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:119976817C>T	ENST00000313400.4	-	3	935	c.835G>A	c.(835-837)Gtc>Atc	p.V279I	ASTN2_ENST00000361209.2_Missense_Mutation_p.V279I|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.V279I			O75129	ASTN2_HUMAN	astrotactin 2	279					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.V279I(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACGCCAATGACGGAATTGTGG	0.602																																					p.V279I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G835A	9						.						95.0	85.0	88.0					9																	119976817		2203	4300	6503	119016638	SO:0001583	missense	23245	exon3			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.835G>A	9.37:g.119976817C>T	ENSP00000314038:p.Val279Ile	Somatic		Capture	SOLID	Phase_I	119016638	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	C	18.50	3.637933	0.67130	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.13196	2.85;2.85;2.61;2.8	5.34	5.34	0.76211	.	0.362910	0.25909	N	0.027511	T	0.19327	0.0464	N	0.08118	0	0.53688	D	0.999972	D;D;D	0.76494	0.996;0.999;0.991	P;D;P	0.71184	0.654;0.972;0.625	T	0.34104	-0.9842	9	.	.	.	-29.2293	18.6589	0.91465	0.0:1.0:0.0:0.0	.	279;279;279	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	I	279;279;6;279	ENSP00000314038:V279I;ENSP00000363108:V279I;ENSP00000363098:V6I;ENSP00000354504:V279I	.	V	-	1	0	ASTN2	119016638	1.000000	0.71417	0.990000	0.47175	0.991000	0.79684	7.452000	0.80683	2.491000	0.84063	0.655000	0.94253	GTC		0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
TLR4	7099	hgsc.bcm.edu	37	9	120474956	120474956	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:120474956A>G	ENST00000355622.6	+	3	651	c.550A>G	c.(550-552)Agc>Ggc	p.S184G	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.S144G	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	184					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S184G(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GGACCTTTCCAGCAACAAGAT	0.383																																					p.S184G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A550G	9						.						87.0	95.0	92.0					9																	120474956		2203	4298	6501	119514777	SO:0001583	missense	7099	exon3			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.550A>G	9.37:g.120474956A>G	ENSP00000363089:p.Ser184Gly	Somatic		Capture	SOLID	Phase_I	119514777	NM_138554	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	A	1.500	-0.552242	0.03996	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.07688	3.17;3.17	5.25	1.12	0.20585	.	1.132960	0.06465	N	0.730097	T	0.05960	0.0155	L	0.41492	1.28	0.09310	N	1	B	0.30793	0.295	B	0.30716	0.119	T	0.41413	-0.9510	10	0.09843	T	0.71	.	0.7136	0.00928	0.4219:0.1164:0.1683:0.2935	.	184	O00206	TLR4_HUMAN	G	144;184	ENSP00000377997:S144G;ENSP00000363089:S184G	ENSP00000363089:S184G	S	+	1	0	TLR4	119514777	0.000000	0.05858	0.409000	0.26459	0.062000	0.15995	0.724000	0.25954	0.295000	0.22570	0.533000	0.62120	AGC		0.383	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
OR1J1	347168	hgsc.bcm.edu	37	9	125239668	125239668	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:125239668C>A	ENST00000259357.2	-	1	567	c.538G>T	c.(538-540)Gac>Tac	p.D180Y	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D180Y(1)		endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						GCACCAAGGTCACAGAAGTAG	0.522																																					p.D180Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G538T	9						.						95.0	81.0	86.0					9																	125239668		2203	4300	6503	124279489	SO:0001583	missense	347168	exon1			AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.538G>T	9.37:g.125239668C>A	ENSP00000259357:p.Asp180Tyr	Somatic		Capture	SOLID	Phase_I	124279489	NM_001004451	A3KFL8|Q6IF10|Q96R88	Missense_Mutation	SNP	ENST00000259357.2	37	CCDS35120.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.718907	0.68844	.	.	ENSG00000136834	ENST00000259357	T	0.00207	8.55	4.66	4.66	0.58398	GPCR, rhodopsin-like superfamily (1);	0.094614	0.46145	D	0.000318	T	0.01287	0.0042	H	0.99225	4.475	0.47698	D	0.999493	D	0.89917	1.0	D	0.83275	0.996	T	0.17531	-1.0366	10	0.87932	D	0	.	16.943	0.86223	0.0:1.0:0.0:0.0	.	180	Q8NGS3	OR1J1_HUMAN	Y	180	ENSP00000259357:D180Y	ENSP00000259357:D180Y	D	-	1	0	OR1J1	124279489	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	7.482000	0.81143	2.605000	0.88082	0.597000	0.82753	GAC		0.522	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053931.1		
RALGPS1	9649	hgsc.bcm.edu	37	9	129974455	129974455	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:129974455G>A	ENST00000259351.5	+	15	1560	c.1293G>A	c.(1291-1293)gtG>gtA	p.V431V	RALGPS1_ENST00000424082.2_Silent_p.V389V|RP13-225O21.2_ENST00000453199.1_RNA|RALGPS1_ENST00000373434.1_Silent_p.V389V	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	431	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.V431V(1)|p.V389V(1)		kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						CCGCAGCTGTGCCCACCATGG	0.627																																					p.V431V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1293A	9						.						50.0	45.0	47.0					9																	129974455		2203	4300	6503	129014276	SO:0001819	synonymous_variant	9649	exon15			AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.1293G>A	9.37:g.129974455G>A		Somatic		Capture	SOLID	Phase_I	129014276	NM_014636	B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Silent	SNP	ENST00000259351.5	37	CCDS35143.1	.	.	.	.	.	.	.	.	.	.	G	7.182	0.589854	0.13812	.	.	ENSG00000136828	ENST00000438723	.	.	.	4.12	2.1	0.27182	.	.	.	.	.	T	0.54822	0.1882	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48969	-0.8987	4	.	.	.	.	6.862	0.24072	0.1091:0.4831:0.4078:0.0	.	.	.	.	Y	27	.	.	C	+	2	0	RALGPS1	129014276	0.998000	0.40836	0.914000	0.36105	0.710000	0.40934	0.495000	0.22483	0.911000	0.36747	0.561000	0.74099	TGC		0.627	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054133.1	NM_014636	
ODF2	4957	hgsc.bcm.edu	37	9	131233605	131233605	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:131233605G>A	ENST00000434106.3	+	6	802	c.439G>A	c.(439-441)Gag>Aag	p.E147K	RP11-339B21.9_ENST00000420801.1_RNA|ODF2_ENST00000393533.2_Missense_Mutation_p.E147K|ODF2_ENST00000444119.2_Missense_Mutation_p.E123K|ODF2_ENST00000535026.1_Intron|ODF2_ENST00000372791.3_Missense_Mutation_p.E128K|ODF2_ENST00000546203.1_Missense_Mutation_p.E128K|ODF2_ENST00000448249.3_Missense_Mutation_p.E66K|ODF2_ENST00000393527.3_Missense_Mutation_p.E123K|ODF2_ENST00000372807.5_Missense_Mutation_p.E142K|ODF2_ENST00000351030.3_Missense_Mutation_p.E142K|ODF2_ENST00000604420.1_Missense_Mutation_p.E147K|ODF2_ENST00000372814.3_Missense_Mutation_p.E191K	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	147					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.E123K(1)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						GCAAAAAGGTGAGCGCCAGAT	0.577																																					p.E172K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G514A	9						.						109.0	101.0	104.0					9																	131233605		2203	4300	6503	130273426	SO:0001583	missense	4957	exon5			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.439G>A	9.37:g.131233605G>A	ENSP00000403453:p.Glu147Lys	Somatic		Capture	SOLID	Phase_I	130273426	NM_153439	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785098	0.70222	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000421776;ENST00000444119;ENST00000434106;ENST00000546203;ENST00000446274;ENST00000432065;ENST00000372791	T;T;T;T;T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;1.52;0.05;0.05;0.05;0.05;0.05	5.84	4.89	0.63831	.	0.195175	0.52532	D	0.000069	T	0.62684	0.2448	L	0.50333	1.59	0.80722	D	1	B;P;B;P;P;P;P;P;P;P	0.52316	0.023;0.89;0.356;0.952;0.801;0.801;0.831;0.759;0.922;0.903	B;P;B;P;B;P;B;B;P;P	0.49528	0.007;0.495;0.115;0.591;0.231;0.471;0.284;0.164;0.614;0.51	T	0.59295	-0.7481	10	0.31617	T	0.26	-25.9796	13.5062	0.61485	0.0:0.1564:0.8436:0.0	.	128;142;66;81;147;191;142;128;147;123	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;.;ODFP2_HUMAN;.	K	147;191;142;147;123;66;66;123;147;128;128;71;128	ENSP00000377166:E147K;ENSP00000361901:E191K;ENSP00000342581:E142K;ENSP00000361882:E147K;ENSP00000307781:E123K;ENSP00000396687:E66K;ENSP00000394506:E123K;ENSP00000403453:E147K;ENSP00000437579:E128K;ENSP00000415290:E128K;ENSP00000361877:E128K	ENSP00000307781:E123K	E	+	1	0	ODF2	130273426	1.000000	0.71417	0.996000	0.52242	0.549000	0.35272	3.642000	0.54367	2.768000	0.95171	0.491000	0.48974	GAG		0.577	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
SPTAN1	6709	hgsc.bcm.edu	37	9	131367448	131367448	+	Silent	SNP	C	C	T	rs370435310		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:131367448C>T	ENST00000372731.4	+	30	3965	c.3855C>T	c.(3853-3855)ctC>ctT	p.L1285L	SPTAN1_ENST00000358161.5_Silent_p.L1285L|SPTAN1_ENST00000372739.3_Silent_p.L1285L	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1285					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L1285L(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TTGCGGCTCTCGGTGACAAGG	0.517																																					p.L1265L	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3795T	9						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	78.0	76.0	77.0		3855,3795,3855	-11.7	0.0	9		77	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	SPTAN1	NM_001130438.2,NM_001195532.1,NM_003127.3	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	1285/2478,1265/2453,1285/2473	131367448	1,13005	2203	4300	6503	130407269	SO:0001819	synonymous_variant	6709	exon29			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3855C>T	9.37:g.131367448C>T		Somatic		Capture	SOLID	Phase_I	130407269	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																				0.517	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
VLDLR	7436	hgsc.bcm.edu	37	9	2643743	2643743	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:2643743C>A	ENST00000382100.3	+	6	1292	c.936C>A	c.(934-936)tgC>tgA	p.C312*	RP11-125B21.2_ENST00000599229.1_RNA|VLDLR_ENST00000382099.2_Nonsense_Mutation_p.C312*	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	312	LDL-receptor class A 7. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.C312*(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		AAGTCAACTGCAAAAATGGTA	0.453																																					p.C312X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C936A	9						.						152.0	134.0	140.0					9																	2643743		2203	4300	6503	2633743	SO:0001587	stop_gained	7436	exon6				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.936C>A	9.37:g.2643743C>A	ENSP00000371532:p.Cys312*	Somatic		Capture	SOLID	Phase_I	2633743	NM_001018056	B2RMZ7|D3DRH6|Q5VVF6	Nonsense_Mutation	SNP	ENST00000382100.3	37	CCDS6446.1	.	.	.	.	.	.	.	.	.	.	C	39	7.686422	0.98431	.	.	ENSG00000147852	ENST00000382100;ENST00000382099;ENST00000382092	.	.	.	5.83	4.91	0.64330	.	0.105638	0.43416	D	0.000579	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.1884	0.15197	0.0:0.6376:0.1872:0.1752	.	.	.	.	X	312;312;191	.	ENSP00000371524:C191X	C	+	3	2	VLDLR	2633743	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.380000	0.44327	1.427000	0.47276	0.655000	0.94253	TGC		0.453	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383	
IFNA10	3446	hgsc.bcm.edu	37	9	21206958	21206958	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:21206958T>A	ENST00000357374.2	-	1	184	c.139A>T	c.(139-141)Atc>Ttc	p.I47F		NM_002171.1	NP_002162.1	P01566	IFN10_HUMAN	interferon, alpha 10	47					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.I47F(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		AAAGGAGAGATTCTTCCCATT	0.517																																					p.I47F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A139T	9						.						106.0	111.0	109.0					9																	21206958		2203	4300	6503	21196958	SO:0001583	missense	3446	exon1				CCDS6499.1	9p22	2010-08-24			ENSG00000186803	ENSG00000186803		"""Interferons"""	5418	protein-coding gene	gene with protein product		147577				1385305	Standard	NM_002171		Approved	IFN-alphaC	uc003zoq.1	P01566	OTTHUMG00000019658	ENST00000357374.2:c.139A>T	9.37:g.21206958T>A	ENSP00000369566:p.Ile47Phe	Somatic		Capture	SOLID	Phase_I	21196958	NM_002171	Q5VV13	Missense_Mutation	SNP	ENST00000357374.2	37	CCDS6499.1	.	.	.	.	.	.	.	.	.	.	-	18.97	3.734989	0.69189	.	.	ENSG00000186803	ENST00000357374	T	0.03580	3.88	3.65	-7.3	0.01446	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.291500	0.05153	N	0.496436	T	0.08935	0.0221	M	0.72894	2.215	0.09310	N	1	P	0.49635	0.926	P	0.53518	0.728	T	0.12218	-1.0556	10	0.62326	D	0.03	.	6.2725	0.20963	0.0:0.2686:0.4445:0.2869	.	47	P01566	IFN10_HUMAN	F	47	ENSP00000369566:I47F	ENSP00000369566:I47F	I	-	1	0	IFNA10	21196958	0.000000	0.05858	0.001000	0.08648	0.552000	0.35366	-1.800000	0.01744	-1.902000	0.01094	0.409000	0.27619	ATC		0.517	IFNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051887.1	NM_002171	
KLHL9	55958	hgsc.bcm.edu	37	9	21333693	21333693	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:21333693C>T	ENST00000359039.4	-	1	1686	c.1166G>A	c.(1165-1167)cGc>cAc	p.R389H	KLHL9_ENST00000537938.1_Missense_Mutation_p.R321H			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	389					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.R389H(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		AAAGAATGTGCGCTTTTCATT	0.408																																					p.R389H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1166A	9						.						86.0	80.0	82.0					9																	21333693		2203	4300	6503	21323693	SO:0001583	missense	55958	exon1			AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.1166G>A	9.37:g.21333693C>T	ENSP00000351933:p.Arg389His	Somatic		Capture	SOLID	Phase_I	21323693	NM_018847	Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	37	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719507	0.68844	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.79554	-1.28;-1.28	4.68	4.68	0.58851	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	U	0.000000	D	0.91462	0.7305	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93392	0.6752	10	0.87932	D	0	.	15.4894	0.75593	0.0:1.0:0.0:0.0	.	389	Q9P2J3	KLHL9_HUMAN	H	389;321	ENSP00000351933:R389H;ENSP00000437733:R321H	ENSP00000351933:R389H	R	-	2	0	KLHL9	21323693	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.739000	0.84976	2.323000	0.78572	0.655000	0.94253	CGC		0.408	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847	
DDX58	23586	hgsc.bcm.edu	37	9	32526077	32526077	+	Missense_Mutation	SNP	C	C	T	rs141881816		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:32526077C>T	ENST00000379883.2	-	1	245	c.88G>A	c.(88-90)Gcc>Acc	p.A30T	DDX58_ENST00000379882.1_Missense_Mutation_p.A30T|DDX58_ENST00000379868.1_5'UTR|DDX58_ENST00000545044.1_5'UTR	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	30	CARD 1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.A30T(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		AACCAGGGGGCCATGTAGCTC	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17020	0.0		0.0	False		,,,				2504	0.0				p.A30T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G88A	9						.	C	THR/ALA	3,4403	6.2+/-15.9	0,3,2200	77.0	69.0	72.0		88	-7.4	0.0	9	dbSNP_134	72	0,8600		0,0,4300	no	missense	DDX58	NM_014314.3	58	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	30/926	32526077	3,13003	2203	4300	6503	32516077	SO:0001583	missense	23586	exon1			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.88G>A	9.37:g.32526077C>T	ENSP00000369213:p.Ala30Thr	Somatic		Capture	SOLID	Phase_I	32516077	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.859009	0.00552	6.81E-4	0.0	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000542960	T;T	0.05025	3.51;3.63	4.02	-7.36	0.01417	.	1.618540	0.03841	N	0.270592	T	0.03220	0.0094	N	0.19112	0.55	0.45676	D	0.998599	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.49021	-0.8982	10	0.02654	T	1	0.9416	7.5689	0.27896	0.2096:0.155:0.0:0.6354	.	30;30	O95786-2;O95786	.;DDX58_HUMAN	T	30	ENSP00000369212:A30T;ENSP00000369213:A30T	ENSP00000369212:A30T	A	-	1	0	DDX58	32516077	0.135000	0.22499	0.030000	0.17652	0.164000	0.22412	-1.357000	0.02607	-1.877000	0.01129	-0.251000	0.11542	GCC		0.552	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
B4GALT1	2683	hgsc.bcm.edu	37	9	33120603	33120603	+	Splice_Site	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:33120603G>A	ENST00000379731.4	-	3	836	c.650C>T	c.(649-651)gCg>gTg	p.A217V	B4GALT1_ENST00000535206.1_Intron|B4GALT1_ENST00000541851.1_5'UTR	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	217					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)	p.A217V(1)		endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	AGTGTCTCCCGCCTGGTGCAG	0.463																																					p.A217V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C650T	9						.						89.0	77.0	81.0					9																	33120603		2203	4300	6503	33110603	SO:0001630	splice_region_variant	2683	exon3			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.649-1C>T	9.37:g.33120603G>A		Somatic		Capture	SOLID	Phase_I	33110603	NM_001497	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Missense_Mutation	SNP	ENST00000379731.4	37	CCDS6535.1	.	.	.	.	.	.	.	.	.	.	G	5.196	0.221761	0.09863	.	.	ENSG00000086062	ENST00000379731;ENST00000541701	T	0.32515	1.45	5.58	-0.64	0.11493	.	0.137592	0.64402	D	0.000004	T	0.11495	0.0280	N	0.21508	0.67	0.80722	D	1	P	0.39157	0.662	B	0.20577	0.03	T	0.30208	-0.9986	10	0.13108	T	0.6	-19.0042	8.4225	0.32710	0.0:0.2111:0.2136:0.5753	.	217	P15291	B4GT1_HUMAN	V	217;174	ENSP00000369055:A217V	ENSP00000369055:A217V	A	-	2	0	B4GALT1	33110603	0.996000	0.38824	0.915000	0.36163	0.009000	0.06853	0.871000	0.28023	-0.022000	0.13986	-0.302000	0.09304	GCG		0.463	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052039.1	NM_001497	Missense_Mutation
DNAJB5	25822	hgsc.bcm.edu	37	9	34996633	34996633	+	Missense_Mutation	SNP	C	C	T	rs377313197		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:34996633C>T	ENST00000541010.1	+	2	3595	c.583C>T	c.(583-585)Cgt>Tgt	p.R195C	DNAJB5_ENST00000312316.5_Missense_Mutation_p.R195C|DNAJB5_ENST00000454002.2_Missense_Mutation_p.R267C|DNAJB5_ENST00000453597.3_Missense_Mutation_p.R309C|DNAJB5_ENST00000545841.1_Missense_Mutation_p.R195C|DNAJB5_ENST00000335998.3_Missense_Mutation_p.R229C			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	195				MKITRRR -> IEDHKAS (in Ref. 2; AAM10498). {ECO:0000305}.	negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)	p.R195C(1)		kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			GATCACAAGGCGTCGCCTCAA	0.612																																					p.R267C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C799T	9						.	C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	50.0	46.0	48.0		925,799,583	3.2	1.0	9		48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	DNAJB5	NM_001135004.2,NM_001135005.2,NM_012266.5	180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	309/463,267/421,195/349	34996633	1,13005	2203	4300	6503	34986633	SO:0001583	missense	25822	exon3			AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.583C>T	9.37:g.34996633C>T	ENSP00000443151:p.Arg195Cys	Somatic		Capture	SOLID	Phase_I	34986633	NM_001135005	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	ENST00000541010.1	37	CCDS35007.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.398973	0.62177	0.0	1.16E-4	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000378751;ENST00000312316;ENST00000541010;ENST00000454002;ENST00000545841	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	5.1	3.18	0.36537	HSP40/DnaJ peptide-binding (1);	0.307142	0.34245	N	0.004133	T	0.55940	0.1952	M	0.73753	2.245	0.80722	D	1	D;D	0.89917	1.0;0.998	P;P	0.60286	0.872;0.786	T	0.60010	-0.7346	10	0.87932	D	0	.	8.5397	0.33384	0.2296:0.6903:0.0:0.08	.	267;195	B4DSA6;O75953	.;DNJB5_HUMAN	C	309;229;195;195;195;267;195	ENSP00000404079:R309C;ENSP00000337626:R229C;ENSP00000312517:R195C;ENSP00000443151:R195C;ENSP00000413684:R267C;ENSP00000441999:R195C	ENSP00000312517:R195C	R	+	1	0	DNAJB5	34986633	0.999000	0.42202	0.998000	0.56505	0.718000	0.41266	0.790000	0.26900	1.398000	0.46701	0.561000	0.74099	CGT		0.612	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401397.1		
UNC13B	10497	hgsc.bcm.edu	37	9	35397686	35397686	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:35397686G>A	ENST00000378495.3	+	29	3706	c.3484G>A	c.(3484-3486)Gcc>Acc	p.A1162T	UNC13B_ENST00000378496.4_Missense_Mutation_p.A1162T|UNC13B_ENST00000481299.1_3'UTR|UNC13B_ENST00000396787.1_Missense_Mutation_p.A1174T	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1162					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.A1162T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GGACTTCCCAGCCTATTGCAC	0.468																																					p.A1162T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3484A	9						.						78.0	66.0	70.0					9																	35397686		2203	4300	6503	35387686	SO:0001583	missense	10497	exon29			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.3484G>A	9.37:g.35397686G>A	ENSP00000367756:p.Ala1162Thr	Somatic		Capture	SOLID	Phase_I	35387686	NM_006377	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208019	0.39003	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.12255	2.7;2.7;2.7	5.33	3.32	0.38043	.	0.378221	0.33110	N	0.005261	T	0.04679	0.0127	N	0.02539	-0.55	0.28076	N	0.932372	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.26815	-1.0092	10	0.31617	T	0.26	-0.0676	6.1063	0.20075	0.0987:0.0:0.5411:0.3601	.	1162;1162	F8W8M9;O14795	.;UN13B_HUMAN	T	1174;1162;1162;749	ENSP00000380006:A1174T;ENSP00000367756:A1162T;ENSP00000367757:A1162T	ENSP00000367756:A1162T	A	+	1	0	UNC13B	35387686	0.739000	0.28196	0.994000	0.49952	0.915000	0.54546	2.326000	0.43849	1.245000	0.43885	0.563000	0.77884	GCC		0.468	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
NPR2	4882	hgsc.bcm.edu	37	9	35792836	35792836	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:35792836C>T	ENST00000342694.2	+	1	686	c.431C>T	c.(430-432)cCc>cTc	p.P144L		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	144					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.P144L(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CGCACTGGCCCCTCTGCTCCC	0.582																																					p.P144L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C431T	9						.						136.0	109.0	118.0					9																	35792836		2203	4300	6503	35782836	SO:0001583	missense	4882	exon1			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.431C>T	9.37:g.35792836C>T	ENSP00000341083:p.Pro144Leu	Somatic		Capture	SOLID	Phase_I	35782836	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714329	0.48622	.	.	ENSG00000159899	ENST00000342694	D	0.87887	-2.31	3.9	3.9	0.45041	Extracellular ligand-binding receptor (1);	0.000000	0.44902	D	0.000417	D	0.84160	0.5411	L	0.56199	1.76	0.80722	D	1	B;B	0.27679	0.185;0.091	B;B	0.29176	0.099;0.037	D	0.83703	0.0183	10	0.49607	T	0.09	.	13.5579	0.61770	0.0:1.0:0.0:0.0	.	144;144	P20594-2;P20594	.;ANPRB_HUMAN	L	144	ENSP00000341083:P144L	ENSP00000341083:P144L	P	+	2	0	NPR2	35782836	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.525000	0.67110	2.173000	0.68751	0.462000	0.41574	CCC		0.582	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
MELK	9833	hgsc.bcm.edu	37	9	36671004	36671004	+	Silent	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:36671004A>C	ENST00000298048.2	+	16	1699	c.1515A>C	c.(1513-1515)tcA>tcC	p.S505S	MELK_ENST00000538311.1_Silent_p.S311S|MELK_ENST00000536860.1_Silent_p.S457S|MELK_ENST00000536329.1_Silent_p.S434S|MELK_ENST00000536987.1_Silent_p.S374S|MELK_ENST00000543751.1_Silent_p.S473S|MELK_ENST00000541717.1_Silent_p.S464S|MELK_ENST00000545008.1_Silent_p.S434S	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	505	Autoinhibitory region.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)	p.S505S(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GGTGCCGCTCAGTGGAATTGG	0.483																																					p.S505S	Ovarian(82;980 1317 7225 14391 18624)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1515C	9						.						102.0	100.0	101.0					9																	36671004		2203	4300	6503	36661004	SO:0001819	synonymous_variant	9833	exon16			D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1515A>C	9.37:g.36671004A>C		Somatic		Capture	SOLID	Phase_I	36661004	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Silent	SNP	ENST00000298048.2	37	CCDS6606.1																																																																																				0.483	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
FRMPD1	22844	hgsc.bcm.edu	37	9	37740494	37740494	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:37740494T>G	ENST00000539465.1	+	15	2562	c.1969T>G	c.(1969-1971)Tgt>Ggt	p.C657G	FRMPD1_ENST00000541302.1_Missense_Mutation_p.C526G|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.C657G|FRMPD1_ENST00000536622.1_Missense_Mutation_p.C479G			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	657						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.C657G(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TGGCTTCCTCTGTCTCCTGGA	0.577																																					p.C657G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1969G	9						.						28.0	29.0	29.0					9																	37740494		2202	4300	6502	37730494	SO:0001583	missense	22844	exon15			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1969T>G	9.37:g.37740494T>G	ENSP00000444411:p.Cys657Gly	Somatic		Capture	SOLID	Phase_I	37730494	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.600120	0.46423	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.19105	3.09;3.09;2.17;2.18	5.95	5.95	0.96441	.	0.202582	0.43260	D	0.000593	T	0.25344	0.0616	M	0.63843	1.955	0.50171	D	0.999855	P;P	0.40250	0.546;0.709	B;B	0.40410	0.1;0.328	T	0.03000	-1.1084	10	0.21014	T	0.42	-2.6319	14.3566	0.66742	0.0:0.0:0.0:1.0	.	526;657	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	G	657;657;479;526	ENSP00000366995:C657G;ENSP00000444411:C657G;ENSP00000437762:C479G;ENSP00000444804:C526G	ENSP00000366995:C657G	C	+	1	0	FRMPD1	37730494	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	2.416000	0.44644	2.277000	0.76020	0.533000	0.62120	TGT		0.577	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
TJP2	9414	hgsc.bcm.edu	37	9	71863039	71863039	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:71863039G>A	ENST00000377245.4	+	19	2987	c.2779G>A	c.(2779-2781)Ggt>Agt	p.G927S	TJP2_ENST00000453658.2_Missense_Mutation_p.G904S|TJP2_ENST00000539225.1_Missense_Mutation_p.G958S|TJP2_ENST00000265384.7_Missense_Mutation_p.G927S|TJP2_ENST00000535702.1_Missense_Mutation_p.G931S|TJP2_ENST00000348208.4_Missense_Mutation_p.G927S	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	927					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)	p.G927S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						AGACACGGACGGTGAAGGAGG	0.612																																					p.G927S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2779A	9						.						61.0	56.0	58.0					9																	71863039		2203	4300	6503	71052859	SO:0001583	missense	9414	exon19			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.2779G>A	9.37:g.71863039G>A	ENSP00000366453:p.Gly927Ser	Somatic		Capture	SOLID	Phase_I	71052859	NM_201629	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	ENST00000377245.4	37	CCDS6627.1	.	.	.	.	.	.	.	.	.	.	G	35	5.556731	0.96514	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.11169	2.81;2.88;2.8;2.86;2.88;2.92	6.16	6.16	0.99307	.	0.171773	0.51477	D	0.000085	T	0.35537	0.0935	M	0.65975	2.015	0.48511	D	0.999665	D;D;D;D;D;D	0.89917	1.0;0.993;0.995;0.998;0.99;0.999	D;D;P;P;P;D	0.91635	0.999;0.922;0.645;0.777;0.645;0.936	T	0.00252	-1.1876	10	0.54805	T	0.06	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	958;931;904;927;927;927	F5H301;F5H886;B7Z2R3;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;.;ZO2_HUMAN;.	S	904;927;927;927;931;958	ENSP00000392178:G904S;ENSP00000366453:G927S;ENSP00000345893:G927S;ENSP00000265384:G927S;ENSP00000442090:G931S;ENSP00000438262:G958S	ENSP00000265384:G927S	G	+	1	0	TJP2	71052859	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	6.836000	0.75349	2.937000	0.99478	0.650000	0.86243	GGT		0.612	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
TRPM3	80036	hgsc.bcm.edu	37	9	73376518	73376518	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:73376518A>G	ENST00000377101.1	-	8	1160	c.812T>C	c.(811-813)tTg>tCg	p.L271S	TRPM3_ENST00000396280.5_Splice_Site_p.L271S|TRPM3_ENST00000377111.2_Splice_Site_p.L424S|TRPM3_ENST00000408909.2_Splice_Site_p.L271S|TRPM3_ENST00000377110.3_Splice_Site_p.L424S|TRPM3_ENST00000357533.2_Splice_Site_p.L426S|TRPM3_ENST00000377106.1_Splice_Site_p.L296S|TRPM3_ENST00000396285.1_Splice_Site_p.L271S|TRPM3_ENST00000423814.3_Splice_Site_p.L451S|TRPM3_ENST00000396292.4_Splice_Site_p.L296S|TRPM3_ENST00000360823.2_Splice_Site_p.L296S|TRPM3_ENST00000358082.3_Splice_Site_p.L296S|TRPM3_ENST00000377105.1_Splice_Site_p.L271S			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	449					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.L296S(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						ATTACCTACCAATTCCTTCTT	0.428																																					p.L424S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1271C	9						.						118.0	102.0	107.0					9																	73376518		2203	4300	6503	72566338	SO:0001583	missense	80036	exon8			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377101.1:c.812T>C	9.37:g.73376518A>G	ENSP00000366305:p.Leu271Ser	Somatic		Capture	SOLID	Phase_I	72566338	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377101.1	37		.	.	.	.	.	.	.	.	.	.	A	17.44	3.390472	0.62066	.	.	ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101	T;T;T;T;T;T;T;T;T;T;T;T	0.68479	1.62;1.62;0.01;-0.01;1.62;1.62;1.62;1.62;0.01;-0.01;0.03;-0.33	6.17	6.17	0.99709	.	0.157403	0.42682	D	0.000675	D	0.82435	0.5036	M	0.78801	2.425	0.58432	D	0.999994	D;P;B;P;D;B;B;D;P;P	0.76494	0.998;0.932;0.17;0.69;0.999;0.397;0.397;0.999;0.943;0.529	D;P;B;B;D;B;B;D;P;B	0.83275	0.954;0.612;0.253;0.379;0.996;0.119;0.171;0.996;0.844;0.403	T	0.83287	-0.0035	10	0.52906	T	0.07	-13.5469	16.8222	0.85835	1.0:0.0:0.0:0.0	.	449;271;424;424;424;426;296;271;424;271	Q9HCF6;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	TRPM3_HUMAN;.;.;.;.;.;.;.;.;.	S	424;424;296;296;271;426;271;271;296;296;451;271	ENSP00000366315:L424S;ENSP00000366314:L424S;ENSP00000366310:L296S;ENSP00000354066:L296S;ENSP00000366309:L271S;ENSP00000350140:L426S;ENSP00000386127:L271S;ENSP00000379581:L271S;ENSP00000379587:L296S;ENSP00000350791:L296S;ENSP00000389542:L451S;ENSP00000366305:L271S	ENSP00000350140:L426S	L	-	2	0	TRPM3	72566338	1.000000	0.71417	0.963000	0.40424	0.946000	0.59487	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	TTG		0.428	TRPM3-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000214160.1	NM_206945	
TRPM6	140803	hgsc.bcm.edu	37	9	77353502	77353502	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:77353502C>T	ENST00000360774.1	-	36	5834	c.5597G>A	c.(5596-5598)tGc>tAc	p.C1866Y	TRPM6_ENST00000376871.3_Missense_Mutation_p.C703Y|TRPM6_ENST00000376864.4_Missense_Mutation_p.C1870Y|TRPM6_ENST00000376872.3_Missense_Mutation_p.C821Y|TRPM6_ENST00000361255.3_Missense_Mutation_p.C1861Y|TRPM6_ENST00000449912.2_Missense_Mutation_p.C1861Y|TRPM6_ENST00000451710.3_Missense_Mutation_p.C1870Y	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1866	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.C1866Y(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GGCTGAATGGCAGTAGATTAA	0.453																																					p.C1861Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5582A	9						.						100.0	94.0	96.0					9																	77353502		2203	4300	6503	76543322	SO:0001583	missense	140803	exon36			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5597G>A	9.37:g.77353502C>T	ENSP00000354006:p.Cys1866Tyr	Somatic		Capture	SOLID	Phase_I	76543322	NM_001177310	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796708	0.90453	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864	T;T;T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59;2.59;2.59	5.94	5.94	0.96194	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.089436	0.85682	D	0.000000	T	0.37999	0.1024	L	0.58810	1.83	0.80722	D	1	P;D;D;D;D;D	0.89917	0.509;1.0;1.0;1.0;1.0;1.0	B;D;D;D;D;D	0.97110	0.258;0.995;0.995;1.0;0.993;0.999	T	0.01956	-1.1240	10	0.87932	D	0	.	20.3591	0.98849	0.0:1.0:0.0:0.0	.	413;699;817;1866;1861;1861	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	Y	1866;1870;821;703;1861;1861;412;1870	ENSP00000354006:C1866Y;ENSP00000407341:C1870Y;ENSP00000366068:C821Y;ENSP00000366067:C703Y;ENSP00000396672:C1861Y;ENSP00000354962:C1861Y;ENSP00000366060:C1870Y	ENSP00000354006:C1866Y	C	-	2	0	TRPM6	76543322	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.898000	0.69838	2.816000	0.96949	0.561000	0.74099	TGC		0.453	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
SHC3	53358	hgsc.bcm.edu	37	9	91653197	91653197	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:91653197A>G	ENST00000375835.4	-	11	1673	c.1367T>C	c.(1366-1368)tTt>tCt	p.F456S	SHC3_ENST00000375831.1_Missense_Mutation_p.F4S|SHC3_ENST00000375830.1_Missense_Mutation_p.F4S	NM_016848.5	NP_058544.3	Q92529	SHC3_HUMAN	SHC (Src homology 2 domain containing) transforming protein 3	456	CH1.				central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|insulin receptor signaling pathway (GO:0008286)|learning or memory (GO:0007611)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	signal transducer activity (GO:0004871)	p.F456S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|skin(3)	28						AGCATCTTCAAAAGGTTCTGT	0.448																																					p.F456S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1367C	9						.						50.0	54.0	53.0					9																	91653197		2203	4300	6503	90843017	SO:0001583	missense	53358	exon11			D84361	CCDS6681.1	9q22.1	2013-02-14	2005-05-24		ENSG00000148082	ENSG00000148082		"""SH2 domain containing"""	18181	protein-coding gene	gene with protein product		605263	"""src homology 2 domain containing transforming protein C3"""			8808684	Standard	NM_016848		Approved	N-Shc, NSHC, SHCC	uc004aqf.2	Q92529	OTTHUMG00000020179	ENST00000375835.4:c.1367T>C	9.37:g.91653197A>G	ENSP00000364995:p.Phe456Ser	Somatic		Capture	SOLID	Phase_I	90843017	NM_016848	Q5T7I7|Q8TAP2|Q9UCX5	Missense_Mutation	SNP	ENST00000375835.4	37	CCDS6681.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.050331	0.75846	.	.	ENSG00000148082	ENST00000375835;ENST00000375831;ENST00000375830	T;T;T	0.51817	1.4;0.69;0.69	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.59865	0.2225	M	0.80982	2.52	0.80722	D	1	P	0.46512	0.879	P	0.48089	0.566	T	0.66304	-0.5957	10	0.56958	D	0.05	-12.0312	15.4256	0.75048	1.0:0.0:0.0:0.0	.	456	Q92529	SHC3_HUMAN	S	456;4;4	ENSP00000364995:F456S;ENSP00000364991:F4S;ENSP00000364990:F4S	ENSP00000364990:F4S	F	-	2	0	SHC3	90843017	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	8.509000	0.90529	2.288000	0.76882	0.482000	0.46254	TTT		0.448	SHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052986.1	NM_016848	
PTCH1	5727	hgsc.bcm.edu	37	9	98220430	98220430	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:98220430G>A	ENST00000331920.6	-	18	3332	c.3033C>T	c.(3031-3033)aaC>aaT	p.N1011N	PTCH1_ENST00000430669.2_Silent_p.N945N|PTCH1_ENST00000375274.2_Silent_p.N1010N|PTCH1_ENST00000418258.1_Silent_p.N860N|PTCH1_ENST00000429896.2_Silent_p.N860N|PTCH1_ENST00000421141.1_Silent_p.N860N|PTCH1_ENST00000437951.1_Silent_p.N945N	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1011					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.N1011N(2)|p.I963fs*2(1)|p.N1010N(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AGGGGTAGCCGTTGGGGTAAC	0.572																																					p.N860N												.	.	4	Substitution - coding silent(3)|Deletion - Frameshift(1)	large_intestine(3)|central_nervous_system(1)	c.C2580T	9						.						86.0	76.0	79.0					9																	98220430		2203	4300	6503	97260251	SO:0001819	synonymous_variant	5727	exon18			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.3033C>T	9.37:g.98220430G>A		Somatic		Capture	SOLID	Phase_I	97260251	NM_001083605	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1																																																																																				0.572	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
LRRC8A	56262	hgsc.bcm.edu	37	9	131671311	131671313	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	ACA	ACA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:131671311_131671313delACA	ENST00000259324.5	+	3	2391_2393	c.1868_1870delACA	c.(1867-1872)gacaac>gac	p.N625del	LRRC8A_ENST00000372600.4_In_Frame_Del_p.N625del|LRRC8A_ENST00000372599.3_In_Frame_Del_p.N625del	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	625					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.N625delN(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						GACCTCAAGGACAACAACCTCAA	0.567																																					p.623_624del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.1868_1870del	9						.																																			130711134	SO:0001651	inframe_deletion	56262	exon3			AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1868_1870delACA	9.37:g.131671314_131671316delACA	ENSP00000259324:p.Asn625del	Somatic		Capture	SOLID	Phase_I	130711132	NM_019594	Q6UXM2|Q8NCI0|Q9P2B1	In_Frame_Del	DEL	ENST00000259324.5	37	CCDS35155.1																																																																																				0.567	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
SNAPC4	6621	hgsc.bcm.edu	37	9	139290205	139290205	+	Silent	SNP	G	G	A	rs202101215		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr9:139290205G>A	ENST00000298532.2	-	3	563	c.195C>T	c.(193-195)ggC>ggT	p.G65G		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa									p.G65G(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		TGCTGGCTTCGCCCCACCTTT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		17761	0.001		0.0	False		,,,				2504	0.0				p.G65G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C195T	9						.						145.0	142.0	143.0					9																	139290205		2203	4300	6503	138410026	SO:0001819	synonymous_variant	6621	exon3			AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.195C>T	9.37:g.139290205G>A		Somatic		Capture	SOLID	Phase_I	138410026	NM_003086		Silent	SNP	ENST00000298532.2	37	CCDS6998.1																																																																																				0.577	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
LATS2	26524	hgsc.bcm.edu	37	13	21555628	21555628	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:21555628G>A	ENST00000382592.4	-	6	3047	c.2642C>T	c.(2641-2643)gCa>gTa	p.A881V	LATS2_ENST00000542899.1_Missense_Mutation_p.A881V	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.A881V(1)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CACCTCGGGTGCGATGTAGTT	0.627																																					p.A881V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2642T	13						.						79.0	65.0	70.0					13																	21555628		2203	4300	6503	20453628	SO:0001583	missense	26524	exon6			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.2642C>T	13.37:g.21555628G>A	ENSP00000372035:p.Ala881Val	Somatic		Capture	SOLID	Phase_I	20453628	NM_014572		Missense_Mutation	SNP	ENST00000382592.4	37	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	G	35	5.547769	0.96488	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.23552	1.9;1.9	5.93	5.93	0.95920	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.68430	0.3000	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78770	-0.2074	10	0.87932	D	0	.	20.3887	0.98946	0.0:0.0:1.0:0.0	.	881	Q9NRM7	LATS2_HUMAN	V	881	ENSP00000372035:A881V;ENSP00000441817:A881V	ENSP00000372035:A881V	A	-	2	0	LATS2	20453628	1.000000	0.71417	0.965000	0.40720	0.746000	0.42486	9.807000	0.99171	2.828000	0.97474	0.644000	0.83932	GCA		0.627	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1		
SACS	26278	hgsc.bcm.edu	37	13	23932526	23932526	+	Silent	SNP	A	A	G	rs140637560		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:23932526A>G	ENST00000382292.3	-	6	825	c.552T>C	c.(550-552)ccT>ccC	p.P184P	SACS_ENST00000402364.1_5'UTR|SACS_ENST00000382298.3_Silent_p.P184P			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	184					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.P37P(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CGACCTTCAGAGGATCATCCT	0.413																																					p.P184P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T552C	13						.						176.0	173.0	174.0					13																	23932526		2203	4300	6503	22830526	SO:0001819	synonymous_variant	26278	exon7			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.552T>C	13.37:g.23932526A>G		Somatic		Capture	SOLID	Phase_I	22830526	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	A	8.782	0.928542	0.18131	.	.	ENSG00000151835	ENST00000455470	.	.	.	5.51	-3.49	0.04724	.	.	.	.	.	T	0.38401	0.1039	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38824	-0.9643	4	.	.	.	.	1.5946	0.02661	0.4315:0.0998:0.2732:0.1955	.	.	.	.	P	84	.	.	S	-	1	0	SACS	22830526	0.002000	0.14202	0.214000	0.23707	0.912000	0.54170	-0.017000	0.12590	-0.158000	0.11040	-0.371000	0.07208	TCT		0.413	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
PABPC3	5042	hgsc.bcm.edu	37	13	25671836	25671836	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:25671836G>A	ENST00000281589.3	+	1	1537	c.1500G>A	c.(1498-1500)gtG>gtA	p.V500V		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	500					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.V500V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		cccctgctgTGCGCACGGTTC	0.532																																					p.V500V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1500A	13						.						50.0	47.0	48.0					13																	25671836		2203	4300	6503	24569836	SO:0001819	synonymous_variant	5042	exon1			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1500G>A	13.37:g.25671836G>A		Somatic		Capture	SOLID	Phase_I	24569836	NM_030979	Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																				0.532	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
TRPC4	7223	hgsc.bcm.edu	37	13	38225439	38225439	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:38225439T>G	ENST00000379705.3	-	8	2899	c.2042A>C	c.(2041-2043)aAg>aCg	p.K681T	TRPC4_ENST00000338947.5_Missense_Mutation_p.K508T|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000379681.3_Missense_Mutation_p.K681T|TRPC4_ENST00000358477.2_Missense_Mutation_p.K681T|TRPC4_ENST00000379679.1_Missense_Mutation_p.K508T|TRPC4_ENST00000447043.1_Missense_Mutation_p.K681T|TRPC4_ENST00000355779.2_Missense_Mutation_p.K681T|TRPC4_ENST00000379673.2_Intron			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	681	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.K681T(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TCTTCTCATCTTTTTCTTGCA	0.388																																					p.K681T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2042C	13						.						134.0	132.0	133.0					13																	38225439		2203	4300	6503	37123439	SO:0001583	missense	7223	exon8			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2042A>C	13.37:g.38225439T>G	ENSP00000369027:p.Lys681Thr	Somatic		Capture	SOLID	Phase_I	37123439	NM_001135957	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	T	13.24	2.179042	0.38511	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000447043	T;T;T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.7	5.7	0.88788	.	0.129348	0.64402	D	0.000001	T	0.73916	0.3648	L	0.39326	1.205	0.80722	D	1	B;B;B;B;B	0.18310	0.007;0.0;0.027;0.013;0.0	B;B;B;B;B	0.17098	0.006;0.002;0.017;0.009;0.001	T	0.68330	-0.5437	10	0.22109	T	0.4	-24.1172	15.9668	0.79979	0.0:0.0:0.0:1.0	.	681;681;508;681;681	Q9UBN4-3;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	T	681;681;508;508;681;681;681	ENSP00000369027:K681T;ENSP00000369003:K681T;ENSP00000342580:K508T;ENSP00000369001:K508T;ENSP00000348025:K681T;ENSP00000351264:K681T;ENSP00000414316:K681T	ENSP00000342580:K508T	K	-	2	0	TRPC4	37123439	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.002000	0.49496	2.182000	0.69389	0.459000	0.35465	AAG		0.388	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
VWA8	23078	hgsc.bcm.edu	37	13	42440142	42440142	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:42440142G>A	ENST00000379310.3	-	11	1311	c.1243C>T	c.(1243-1245)Cct>Tct	p.P415S	VWA8_ENST00000281496.6_Missense_Mutation_p.P415S	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	415						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P415S(1)									GACGCACAAGGTTGACTTAAT	0.443																																					p.P415S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1243T	13						.						105.0	105.0	105.0					13																	42440142		2203	4300	6503	41338142	SO:0001583	missense	23078	exon11			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1243C>T	13.37:g.42440142G>A	ENSP00000368612:p.Pro415Ser	Somatic		Capture	SOLID	Phase_I	41338142	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.277891	0.23307	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496;ENST00000398857	T;T	0.12879	2.9;2.64	5.29	4.43	0.53597	.	0.238485	0.33290	N	0.005065	T	0.12347	0.0300	L	0.38838	1.175	0.09310	N	0.999997	B	0.06786	0.001	B	0.10450	0.005	T	0.19745	-1.0296	10	0.16896	T	0.51	.	16.0438	0.80704	0.0:0.1347:0.8653:0.0	.	415	A3KMH1	K0564_HUMAN	S	319;415;415;415	ENSP00000368612:P415S;ENSP00000281496:P415S	ENSP00000251030:P319S	P	-	1	0	KIAA0564	41338142	0.994000	0.37717	0.122000	0.21767	0.958000	0.62258	2.311000	0.43717	1.317000	0.45149	0.557000	0.71058	CCT		0.443	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
AKAP11	11215	hgsc.bcm.edu	37	13	42877913	42877913	+	Silent	SNP	C	C	T	rs181261991	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:42877913C>T	ENST00000025301.2	+	8	5206	c.5031C>T	c.(5029-5031)atC>atT	p.I1677I		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1677					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.I1677I(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ACAGTGGGATCGGACAGGAGG	0.512													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18949	0.0		0.0	False		,,,				2504	0.0				p.I1677I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5031T	13						.	C		1,4405		0,1,2202	38.0	36.0	36.0		5031	-1.2	0.8	13		36	1,8599		0,1,4299	no	coding-synonymous	AKAP11	NM_016248.3		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		1677/1902	42877913	2,13004	2203	4300	6503	41775913	SO:0001819	synonymous_variant	11215	exon8			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5031C>T	13.37:g.42877913C>T		Somatic		Capture	SOLID	Phase_I	41775913	NM_016248	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	37	CCDS9383.1																																																																																				0.512	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
ZC3H13	23091	hgsc.bcm.edu	37	13	46543162	46543162	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:46543162C>T	ENST00000242848.4	-	14	3865	c.3517G>A	c.(3517-3519)Gtg>Atg	p.V1173M	ZC3H13_ENST00000282007.3_Missense_Mutation_p.V1173M|ZC3H13_ENST00000378921.2_Missense_Mutation_p.V129M			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1173							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.V1173M(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TCTATAGTCACGTGAGGCGTC	0.488																																					p.V1173M	Esophageal Squamous(187;747 2077 11056 31291 44172)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3517A	13						.						178.0	175.0	176.0					13																	46543162		2203	4300	6503	45441163	SO:0001583	missense	23091	exon14			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3517G>A	13.37:g.46543162C>T	ENSP00000242848:p.Val1173Met	Somatic		Capture	SOLID	Phase_I	45441163	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	C	2.331	-0.353333	0.05173	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	T;T;T	0.37058	2.22;1.99;1.22	5.63	2.07	0.26955	.	0.110423	0.39909	N	0.001237	T	0.25644	0.0624	L	0.27053	0.805	0.35099	D	0.765039	B;B	0.22003	0.037;0.063	B;B	0.20955	0.014;0.032	T	0.19031	-1.0318	10	0.54805	T	0.06	.	12.0583	0.53548	0.0:0.7919:0.0:0.2081	.	1173;1173	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	M	1173;129;1173	ENSP00000242848:V1173M;ENSP00000368201:V129M;ENSP00000282007:V1173M	ENSP00000242848:V1173M	V	-	1	0	ZC3H13	45441163	0.983000	0.35010	0.964000	0.40570	0.073000	0.16967	2.130000	0.42064	0.156000	0.19299	-0.710000	0.03640	GTG		0.488	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
CYSLTR2	57105	hgsc.bcm.edu	37	13	49281359	49281359	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:49281359C>T	ENST00000282018.3	+	1	409	c.406C>T	c.(406-408)Cgt>Tgt	p.R136C		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	136					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)	p.R136C(1)		endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	GAGTGTTGTGCGTTTCCTGGC	0.473																																					p.R136C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C406T	13						.						223.0	213.0	216.0					13																	49281359		2203	4300	6503	48179360	SO:0001583	missense	57105	exon1			AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.406C>T	13.37:g.49281359C>T	ENSP00000282018:p.Arg136Cys	Somatic		Capture	SOLID	Phase_I	48179360	NM_020377	Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	37	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207421	0.95033	.	.	ENSG00000152207	ENST00000282018	D	0.97186	-4.28	6.08	6.08	0.98989	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	D	0.99230	0.9732	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98771	1.0728	10	0.87932	D	0	.	19.6516	0.95815	0.0:1.0:0.0:0.0	.	136	Q9NS75	CLTR2_HUMAN	C	136	ENSP00000282018:R136C	ENSP00000282018:R136C	R	+	1	0	CYSLTR2	48179360	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.783000	0.85696	2.894000	0.99253	0.655000	0.94253	CGT		0.473	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1		
TDRD3	81550	hgsc.bcm.edu	37	13	61103154	61103154	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:61103154C>T	ENST00000196169.3	+	11	2304	c.1516C>T	c.(1516-1518)Cga>Tga	p.R506*	TDRD3_ENST00000535286.1_Nonsense_Mutation_p.R599*|TDRD3_ENST00000377881.2_Nonsense_Mutation_p.R506*|TDRD3_ENST00000377894.2_Nonsense_Mutation_p.R506*	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	506					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.R506*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		GAAAGGAAGACGAATAGGACC	0.378																																					p.R506X	Colon(36;164 906 35820 50723)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1516T	13						.						52.0	51.0	51.0					13																	61103154		2203	4300	6503	60001155	SO:0001587	stop_gained	81550	exon11			AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1516C>T	13.37:g.61103154C>T	ENSP00000196169:p.Arg506*	Somatic		Capture	SOLID	Phase_I	60001155	NM_001146071	B2MWP9|Q53XA6|Q6P992	Nonsense_Mutation	SNP	ENST00000196169.3	37	CCDS9441.1	.	.	.	.	.	.	.	.	.	.	C	40	7.997645	0.98602	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286	.	.	.	5.84	4.05	0.47172	.	0.116689	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3627	14.6852	0.69044	0.3787:0.6213:0.0:0.0	.	.	.	.	X	506;506;506;599	.	ENSP00000196169:R506X	R	+	1	2	TDRD3	60001155	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	1.306000	0.33505	0.868000	0.35678	0.650000	0.86243	CGA		0.378	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
MYCBP2	23077	hgsc.bcm.edu	37	13	77740558	77740558	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:77740558T>C	ENST00000544440.2	-	41	6149	c.6132A>G	c.(6130-6132)aaA>aaG	p.K2044K	MYCBP2_ENST00000357337.6_Silent_p.K2044K|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Silent_p.K2082K					MYC binding protein 2, E3 ubiquitin protein ligase									p.K2082K(1)|p.K2044K(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CAGATGTCAATTTTGGTCCAT	0.398																																					p.K2082K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A6246G	13						.						98.0	97.0	97.0					13																	77740558		2203	4300	6503	76638559	SO:0001819	synonymous_variant	23077	exon41			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.6132A>G	13.37:g.77740558T>C		Somatic		Capture	SOLID	Phase_I	76638559	NM_015057		Silent	SNP	ENST00000544440.2	37																																																																																					0.398	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
MYCBP2	23077	hgsc.bcm.edu	37	13	77842067	77842067	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:77842067A>G	ENST00000544440.2	-	8	1169	c.1152T>C	c.(1150-1152)taT>taC	p.Y384Y	MYCBP2_ENST00000357337.6_Silent_p.Y384Y|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Silent_p.Y422Y					MYC binding protein 2, E3 ubiquitin protein ligase									p.Y422Y(1)|p.Y384Y(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TATATAATAAATAACCCTGAT	0.363																																					p.Y422Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1266C	13						.						77.0	74.0	75.0					13																	77842067		2203	4300	6503	76740068	SO:0001819	synonymous_variant	23077	exon8			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1152T>C	13.37:g.77842067A>G		Somatic		Capture	SOLID	Phase_I	76740068	NM_015057		Silent	SNP	ENST00000544440.2	37																																																																																					0.363	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
DZIP1	22873	hgsc.bcm.edu	37	13	96239925	96239925	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:96239925C>T	ENST00000376829.2	-	20	2937	c.2086G>A	c.(2086-2088)Gca>Aca	p.A696T	DZIP1_ENST00000361396.2_Missense_Mutation_p.A677T|DZIP1_ENST00000361156.3_Missense_Mutation_p.A677T|DZIP1_ENST00000347108.3_Missense_Mutation_p.A696T	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	696					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.A677T(1)		endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			CCTGGGGATGCGTATGCCCGG	0.567																																					p.A677T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2029A	13						.						115.0	95.0	102.0					13																	96239925		2203	4300	6503	95037926	SO:0001583	missense	22873	exon19			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.2086G>A	13.37:g.96239925C>T	ENSP00000366025:p.Ala696Thr	Somatic		Capture	SOLID	Phase_I	95037926	NM_014934	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	ENST00000376829.2	37	CCDS9478.1	.	.	.	.	.	.	.	.	.	.	C	7.905	0.735220	0.15574	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.35	-5.81	0.02340	.	2.040690	0.02590	N	0.099838	T	0.20740	0.0499	L	0.51422	1.61	0.09310	N	1	B;B	0.13145	0.007;0.004	B;B	0.08055	0.003;0.001	T	0.14008	-1.0488	10	0.13853	T	0.58	5.1213	1.8019	0.03073	0.2114:0.2172:0.1092:0.4622	.	677;696	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	T	696;677;677;696	ENSP00000257312:A696T;ENSP00000355018:A677T;ENSP00000355175:A677T;ENSP00000366025:A696T	ENSP00000257312:A696T	A	-	1	0	DZIP1	95037926	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.017000	0.00644	-1.232000	0.02554	-0.768000	0.03414	GCA		0.567	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
ANKRD10	55608	hgsc.bcm.edu	37	13	111532172	111532172	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr13:111532172C>T	ENST00000267339.2	-	6	1209	c.1075G>A	c.(1075-1077)Gcc>Acc	p.A359T	ANKRD10_ENST00000375758.5_3'UTR	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	359								p.A359T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			GGCCTACTGGCTATGCAGCTA	0.537																																					p.A359T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1075A	13						.						124.0	96.0	106.0					13																	111532172		2203	4300	6503	110330173	SO:0001583	missense	55608	exon6			AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.1075G>A	13.37:g.111532172C>T	ENSP00000267339:p.Ala359Thr	Somatic		Capture	SOLID	Phase_I	110330173	NM_017664	Q5VW12|Q9BV12	Missense_Mutation	SNP	ENST00000267339.2	37	CCDS9520.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028029	0.35797	.	.	ENSG00000088448	ENST00000267339	T	0.70399	-0.48	5.41	5.41	0.78517	.	0.690557	0.15047	N	0.283529	T	0.68686	0.3028	M	0.67953	2.075	0.80722	D	1	P	0.42456	0.78	B	0.38106	0.265	T	0.73212	-0.4054	10	0.72032	D	0.01	-5.5315	12.3599	0.55197	0.2846:0.7154:0.0:0.0	.	359	Q9NXR5	ANR10_HUMAN	T	359	ENSP00000267339:A359T	ENSP00000267339:A359T	A	-	1	0	ANKRD10	110330173	0.957000	0.32711	0.039000	0.18376	0.099000	0.18886	1.677000	0.37576	2.535000	0.85469	0.650000	0.86243	GCC		0.537	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045783.1		
NPM3	10360	hgsc.bcm.edu	37	10	103543125	103543125	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:103543125G>A	ENST00000370110.5	-	1	45	c.23C>T	c.(22-24)gCc>gTc	p.A8V	MGEA5_ENST00000482611.1_5'Flank|NPM3_ENST00000474993.1_5'UTR	NM_006993.2	NP_008924.1	O75607	NPM3_HUMAN	nucleophosmin/nucleoplasmin 3	8	Ala-rich.				rRNA processing (GO:0006364)|rRNA transcription (GO:0009303)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.A8V(1)		large_intestine(3)|lung(1)|skin(1)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		AAACGCTAAGGCAGCTGCAGT	0.642																																					p.A8V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C23T	10						.						28.0	32.0	31.0					10																	103543125		2202	4300	6502	103533115	SO:0001583	missense	10360	exon1			AY049737	CCDS7519.1	10q24.31	2009-08-27	2009-08-27		ENSG00000107833	ENSG00000107833			7931	protein-coding gene	gene with protein product		606456				11722795	Standard	NM_006993		Approved		uc001ktt.3	O75607	OTTHUMG00000018942	ENST00000370110.5:c.23C>T	10.37:g.103543125G>A	ENSP00000359128:p.Ala8Val	Somatic		Capture	SOLID	Phase_I	103533115	NM_006993	Q9UNY6	Missense_Mutation	SNP	ENST00000370110.5	37	CCDS7519.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268990	0.40095	.	.	ENSG00000107833	ENST00000370110	T	0.35421	1.31	5.55	4.64	0.57946	.	0.768931	0.12108	N	0.498805	T	0.23492	0.0568	N	0.19112	0.55	0.09310	N	1	B	0.29037	0.231	B	0.19666	0.026	T	0.08785	-1.0705	10	0.87932	D	0	-20.8531	9.3362	0.38051	0.0953:0.0:0.9047:0.0	.	8	O75607	NPM3_HUMAN	V	8	ENSP00000359128:A8V	ENSP00000359128:A8V	A	-	2	0	NPM3	103533115	0.953000	0.32496	0.244000	0.24202	0.007000	0.05969	2.857000	0.48349	2.616000	0.88540	0.650000	0.86243	GCC		0.642	NPM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050003.2	NM_006993	
GBF1	8729	hgsc.bcm.edu	37	10	104142055	104142055	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:104142055C>T	ENST00000369983.3	+	40	5802	c.5542C>T	c.(5542-5544)Cgc>Tgc	p.R1848C		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1848	Pro-rich.				COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R1848C(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GGCCACACCCCGCCCCACAGA	0.617																																					p.R1845C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5533T	10						.						83.0	82.0	82.0					10																	104142055		2203	4300	6503	104132045	SO:0001583	missense	8729	exon40			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.5542C>T	10.37:g.104142055C>T	ENSP00000359000:p.Arg1848Cys	Somatic		Capture	SOLID	Phase_I	104132045	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592106	0.86953	.	.	ENSG00000107862	ENST00000369983	T	0.11712	2.75	5.17	5.17	0.71159	.	0.053383	0.85682	D	0.000000	T	0.31040	0.0784	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.985;0.985;0.985	T	0.00563	-1.1669	10	0.52906	T	0.07	-12.6612	18.8623	0.92278	0.0:1.0:0.0:0.0	.	1844;1844;1848	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	C	1848	ENSP00000359000:R1848C	ENSP00000359000:R1848C	R	+	1	0	GBF1	104132045	0.999000	0.42202	0.996000	0.52242	0.992000	0.81027	5.301000	0.65727	2.684000	0.91462	0.650000	0.86243	CGC		0.617	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
SORCS1	114815	hgsc.bcm.edu	37	10	108439083	108439083	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:108439083T>C	ENST00000263054.6	-	12	1678	c.1671A>G	c.(1669-1671)atA>atG	p.I557M	SORCS1_ENST00000369698.1_Missense_Mutation_p.I92M|SORCS1_ENST00000344440.6_Missense_Mutation_p.I557M	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	557					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.I557M(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ATTCAGAACCTATATTACCTA	0.418																																					p.I557M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1671G	10						.						80.0	80.0	80.0					10																	108439083		2203	4300	6503	108429073	SO:0001583	missense	114815	exon12			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1671A>G	10.37:g.108439083T>C	ENSP00000263054:p.Ile557Met	Somatic		Capture	SOLID	Phase_I	108429073	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.349328	0.61183	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.44881	0.91;0.91;0.91	5.67	-4.53	0.03462	VPS10 (1);	0.098255	0.64402	D	0.000001	T	0.55178	0.1904	M	0.84326	2.69	0.36069	D	0.842026	D;D;D;D;D	0.58268	0.97;0.982;0.982;0.97;0.982	P;D;D;P;D	0.67725	0.899;0.953;0.953;0.899;0.953	T	0.61598	-0.7030	9	.	.	.	-19.3591	7.4089	0.27006	0.4206:0.0:0.2473:0.3321	.	557;557;557;557;557	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	M	92;557;557	ENSP00000358712:I92M;ENSP00000263054:I557M;ENSP00000345964:I557M	.	I	-	3	3	SORCS1	108429073	0.089000	0.21612	0.979000	0.43373	0.991000	0.79684	-0.695000	0.05109	-0.481000	0.06792	0.533000	0.62120	ATA		0.418	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
PNLIPRP1	5407	hgsc.bcm.edu	37	10	118357358	118357358	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:118357358C>T	ENST00000528052.1	+	7	664	c.593C>T	c.(592-594)gCa>gTa	p.A198V	PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.A198V|PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.A198V			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	198					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.A198V(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		CCTGTAGAAGCAAGTTTCGAG	0.498																																					p.A198V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C593T	10						.						165.0	143.0	150.0					10																	118357358		2203	4300	6503	118347348	SO:0001583	missense	5407	exon7			BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.593C>T	10.37:g.118357358C>T	ENSP00000433933:p.Ala198Val	Somatic		Capture	SOLID	Phase_I	118347348	NM_006229	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225737	0.58668	.	.	ENSG00000187021	ENST00000358834;ENST00000528052;ENST00000530319;ENST00000527980;ENST00000534537	D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72	5.17	5.17	0.71159	Lipase, N-terminal (1);	0.158884	0.43416	D	0.000571	D	0.86045	0.5839	N	0.16166	0.38	0.80722	D	1	D	0.52996	0.957	P	0.49683	0.619	D	0.87826	0.2641	10	0.87932	D	0	-5.4347	12.0136	0.53301	0.0:0.9156:0.0:0.0844	.	198	P54315	LIPR1_HUMAN	V	198;198;153;125;198	ENSP00000351695:A198V;ENSP00000433933:A198V;ENSP00000437263:A153V;ENSP00000433785:A125V;ENSP00000434159:A198V	ENSP00000351695:A198V	A	+	2	0	PNLIPRP1	118347348	0.998000	0.40836	0.852000	0.33557	0.842000	0.47809	5.048000	0.64238	2.560000	0.86352	0.561000	0.74099	GCA		0.498	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229	
UPF2	26019	hgsc.bcm.edu	37	10	11990443	11990443	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:11990443T>A	ENST00000356352.2	-	15	3572	c.3099A>T	c.(3097-3099)gaA>gaT	p.E1033D	UPF2_ENST00000357604.5_Missense_Mutation_p.E1033D|UPF2_ENST00000397053.2_Missense_Mutation_p.E1033D			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	1033	Glu-rich.|Sufficient for interaction with EIF4A1 and EIF1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.E1033D(2)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				cttcttcttcttcatcctctt	0.363																																					p.E1033D												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.A3099T	10						.						138.0	120.0	126.0					10																	11990443		2203	4300	6503	12030449	SO:0001583	missense	26019	exon16			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.3099A>T	10.37:g.11990443T>A	ENSP00000348708:p.Glu1033Asp	Somatic		Capture	SOLID	Phase_I	12030449	NM_080599	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	T	6.745	0.506292	0.12883	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.05580	3.42;3.42;3.42	5.47	0.331	0.15933	.	0.246207	0.40222	N	0.001153	T	0.01835	0.0058	N	0.02539	-0.55	0.29614	N	0.84671	B	0.06786	0.001	B	0.09377	0.004	T	0.42120	-0.9470	10	0.13853	T	0.58	.	3.3971	0.07310	0.2842:0.2284:0.0:0.4874	.	1033	Q9HAU5	RENT2_HUMAN	D	1033	ENSP00000348708:E1033D;ENSP00000350221:E1033D;ENSP00000380244:E1033D	ENSP00000348708:E1033D	E	-	3	2	UPF2	12030449	0.999000	0.42202	0.997000	0.53966	0.974000	0.67602	0.243000	0.18106	-0.115000	0.11915	-0.361000	0.07541	GAA		0.363	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
RAB11FIP2	22841	hgsc.bcm.edu	37	10	119799724	119799724	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:119799724T>C	ENST00000355624.3	-	2	1145	c.706A>G	c.(706-708)Atg>Gtg	p.M236V	RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.M236V|RP11-354M20.3_ENST00000417968.4_RNA|RP11-354M20.3_ENST00000451610.2_RNA	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	236					establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.M236V(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		TCAGAAGACATATGGGACCCA	0.443																																					p.M236V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A706G	10						.						145.0	147.0	146.0					10																	119799724		2203	4299	6502	119789714	SO:0001583	missense	22841	exon2			AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.706A>G	10.37:g.119799724T>C	ENSP00000347839:p.Met236Val	Somatic		Capture	SOLID	Phase_I	119789714	NM_014904	A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	ENST00000355624.3	37	CCDS7602.1	.	.	.	.	.	.	.	.	.	.	T	6.901	0.535799	0.13188	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	T;T	0.61742	0.08;0.09	5.5	-8.94	0.00768	.	1.762490	0.02139	N	0.057038	T	0.21841	0.0526	N	0.00677	-1.265	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31392	-0.9945	10	0.12430	T	0.62	3.4723	11.7396	0.51786	0.2093:0.6766:0.0:0.1141	.	236;236	Q3I768;Q7L804	.;RFIP2_HUMAN	V	236	ENSP00000347839:M236V;ENSP00000358200:M236V	ENSP00000347839:M236V	M	-	1	0	RAB11FIP2	119789714	0.000000	0.05858	0.001000	0.08648	0.966000	0.64601	-0.211000	0.09332	-1.707000	0.01402	0.533000	0.62120	ATG		0.443	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050583.1	NM_014904	
ITIH5	80760	hgsc.bcm.edu	37	10	7608128	7608128	+	Missense_Mutation	SNP	C	C	T	rs375493607	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:7608128C>T	ENST00000256861.6	-	13	2470	c.2392G>A	c.(2392-2394)Gtc>Atc	p.V798I	ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000298441.6_Missense_Mutation_p.V584I|ITIH5_ENST00000446830.2_Missense_Mutation_p.V580I	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	798					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V798I(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGGATGGTGACGGTGACATTG	0.597													C|||	2	0.000399361	0.0008	0.0	5008	,	,		15199	0.0		0.0	False		,,,				2504	0.001				p.V798I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2392A	10						.	C	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	110.0	88.0	96.0		1750,2392	3.2	1.0	10		96	0,8600		0,0,4300	no	missense,missense	ITIH5	NM_032817.5,NM_030569.6	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	584/729,798/943	7608128	1,13005	2203	4300	6503	7648134	SO:0001583	missense	80760	exon13					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2392G>A	10.37:g.7608128C>T	ENSP00000256861:p.Val798Ile	Somatic		Capture	SOLID	Phase_I	7648134	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	C	12.02	1.813750	0.32053	2.27E-4	0.0	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.16196	2.36;2.36;2.36	5.98	3.15	0.36227	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.050600	0.85682	N	0.000000	T	0.15219	0.0367	.	.	.	0.80722	D	1	B;B	0.32302	0.363;0.112	B;B	0.34489	0.184;0.115	T	0.04467	-1.0949	9	0.32370	T	0.25	-40.493	11.898	0.52667	0.0:0.81:0.0:0.19	.	798;584	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	I	798;584;580	ENSP00000256861:V798I;ENSP00000298441:V584I;ENSP00000387969:V580I	ENSP00000256861:V798I	V	-	1	0	ITIH5	7648134	0.978000	0.34361	0.994000	0.49952	0.463000	0.32649	2.396000	0.44468	0.430000	0.26230	-0.812000	0.03155	GTC		0.597	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
FAM107B	83641	hgsc.bcm.edu	37	10	14563262	14563262	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:14563262G>T	ENST00000378470.1	-	4	609	c.323C>A	c.(322-324)gCc>gAc	p.A108D	FAM107B_ENST00000478076.1_Missense_Mutation_p.A108D|FAM107B_ENST00000181796.2_Missense_Mutation_p.A283D|FAM107B_ENST00000479731.1_Missense_Mutation_p.A108D|FAM107B_ENST00000378458.2_Missense_Mutation_p.A108D|FAM107B_ENST00000378465.3_Missense_Mutation_p.A108D|FAM107B_ENST00000496330.1_Missense_Mutation_p.A108D|FAM107B_ENST00000378462.1_Missense_Mutation_p.A108D|FAM107B_ENST00000378467.4_Missense_Mutation_p.A108D|FAM107B_ENST00000468747.1_Missense_Mutation_p.A108D	NM_001282695.1|NM_001282696.1|NM_001282697.1|NM_001282698.1|NM_001282700.1|NM_001282701.1|NM_001282702.1|NM_001282703.1	NP_001269624.1|NP_001269625.1|NP_001269626.1|NP_001269627.1|NP_001269629.1|NP_001269630.1|NP_001269631.1|NP_001269632.1	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	108					sensory perception of sound (GO:0007605)			p.A283D(1)		breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAACTCGGGGGCATTTTCTTG	0.453																																					p.A283D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C848A	10						.						139.0	126.0	131.0					10																	14563262		2203	4300	6503	14603268	SO:0001583	missense	83641	exon5			AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000378470.1:c.323C>A	10.37:g.14563262G>T	ENSP00000367731:p.Ala108Asp	Somatic		Capture	SOLID	Phase_I	14603268	NM_031453	A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Missense_Mutation	SNP	ENST00000378470.1	37		.	.	.	.	.	.	.	.	.	.	G	19.28	3.797069	0.70567	.	.	ENSG00000065809	ENST00000378470;ENST00000181796;ENST00000468747;ENST00000378467;ENST00000378465;ENST00000378458;ENST00000478076;ENST00000378462;ENST00000378461;ENST00000496330;ENST00000479731;ENST00000468492;ENST00000452706;ENST00000489100;ENST00000494865	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.62	5.62	0.85841	.	0.104249	0.64402	D	0.000002	T	0.51753	0.1693	L	0.34521	1.04	0.40693	D	0.982414	D;P	0.89917	1.0;0.611	D;B	0.74674	0.984;0.249	T	0.49725	-0.8909	10	0.44086	T	0.13	.	13.2192	0.59877	0.0:0.0:0.8408:0.1592	.	283;108	Q9H098-2;Q9H098	.;F107B_HUMAN	D	108;283;108;108;108;108;108;108;108;108;108;108;108;108;108	ENSP00000367731:A108D;ENSP00000181796:A283D;ENSP00000418120:A108D;ENSP00000367728:A108D;ENSP00000367726:A108D;ENSP00000367719:A108D;ENSP00000417782:A108D;ENSP00000367723:A108D;ENSP00000418330:A108D;ENSP00000419603:A108D;ENSP00000420444:A108D;ENSP00000413676:A108D;ENSP00000420249:A108D;ENSP00000418395:A108D	ENSP00000181796:A283D	A	-	2	0	FAM107B	14603268	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	7.203000	0.77864	2.642000	0.89623	0.563000	0.77884	GCC		0.453	FAM107B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046899.1	NM_031453	
SLC39A12	221074	hgsc.bcm.edu	37	10	18250620	18250620	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:18250620T>A	ENST00000377369.2	+	3	645	c.372T>A	c.(370-372)caT>caA	p.H124Q	SLC39A12_ENST00000377371.3_Missense_Mutation_p.H124Q|SLC39A12_ENST00000377374.4_Missense_Mutation_p.H124Q|SLC39A12_ENST00000539911.1_5'UTR	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	124					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.H124Q(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						ACATTATTCATCAGGAAGAGA	0.383																																					p.H124Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T372A	10						.						93.0	99.0	97.0					10																	18250620		2203	4300	6503	18290626	SO:0001583	missense	221074	exon3				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.372T>A	10.37:g.18250620T>A	ENSP00000366586:p.His124Gln	Somatic		Capture	SOLID	Phase_I	18290626	NM_001145195	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.291337	0.59976	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000425219	T;T;T	0.24908	1.83;1.83;1.83	5.43	-1.63	0.08345	.	0.499150	0.21704	N	0.070379	T	0.40694	0.1127	M	0.72118	2.19	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.68765	0.96;0.913;0.96	T	0.28396	-1.0045	10	0.66056	D	0.02	-15.1072	7.2574	0.26183	0.1198:0.4748:0.0:0.4054	.	124;124;124	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	Q	124;124;124;44	ENSP00000366586:H124Q;ENSP00000366591:H124Q;ENSP00000366588:H124Q	ENSP00000366586:H124Q	H	+	3	2	SLC39A12	18290626	0.471000	0.25862	0.994000	0.49952	0.887000	0.51463	-0.628000	0.05515	-0.282000	0.09128	-0.280000	0.10049	CAT		0.383	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725	
SLC39A12	221074	hgsc.bcm.edu	37	10	18276506	18276506	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:18276506C>T	ENST00000377369.2	+	7	1468	c.1195C>T	c.(1195-1197)Ctt>Ttt	p.L399F	SLC39A12_ENST00000377371.3_Missense_Mutation_p.L399F|SLC39A12_ENST00000377374.4_Missense_Mutation_p.L399F|SLC39A12_ENST00000539911.1_Missense_Mutation_p.L265F	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	399					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.L399F(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GAACTACAGGCTTATCTTACA	0.542																																					p.L399F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1195T	10						.						174.0	145.0	155.0					10																	18276506		2203	4300	6503	18316512	SO:0001583	missense	221074	exon7				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1195C>T	10.37:g.18276506C>T	ENSP00000366586:p.Leu399Phe	Somatic		Capture	SOLID	Phase_I	18316512	NM_001145195	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842898	0.71488	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	6.08	6.08	0.98989	.	0.063503	0.64402	D	0.000005	T	0.58864	0.2152	L	0.28740	0.885	0.80722	D	1	D;D;D	0.76494	0.998;0.986;0.999	D;D;D	0.68353	0.957;0.943;0.957	T	0.50792	-0.8786	10	0.32370	T	0.25	-7.5485	20.6634	0.99662	0.0:1.0:0.0:0.0	.	399;399;399	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	F	399;399;399;265;319	ENSP00000366586:L399F;ENSP00000366591:L399F;ENSP00000366588:L399F;ENSP00000440445:L265F	ENSP00000366586:L399F	L	+	1	0	SLC39A12	18316512	1.000000	0.71417	0.234000	0.24042	0.617000	0.37484	7.215000	0.77966	2.894000	0.99253	0.655000	0.94253	CTT		0.542	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725	
NEBL	10529	hgsc.bcm.edu	37	10	21108382	21108383	+	Frame_Shift_Del	DEL	CT	CT	-	rs149878829		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	CT	CT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:21108382_21108383delCT	ENST00000377122.4	-	20	2421_2422	c.2025_2026delAG	c.(2023-2028)agagtgfs	p.RV675fs	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	675					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.R675fs*14(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTTCGCCTCACTCTCTCTATCT	0.426																																					p.675_676del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2025_2026del	10						.																																			21148389	SO:0001589	frameshift_variant	10529	exon20			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2025_2026delAG	10.37:g.21108388_21108389delCT	ENSP00000366326:p.Arg675fs	Somatic		Capture	SOLID	Phase_I	21148388	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Frame_Shift_Del	DEL	ENST00000377122.4	37	CCDS7134.1																																																																																				0.426	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	
THNSL1	79896	hgsc.bcm.edu	37	10	25314167	25314167	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:25314167C>A	ENST00000524413.1	+	3	2362	c.2015C>A	c.(2014-2016)gCa>gAa	p.A672E	THNSL1_ENST00000376356.4_Missense_Mutation_p.A672E			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	672						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.A672E(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	TCAAAGTTTGCACCTGCTATC	0.418																																					p.A672E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2015A	10						.						82.0	81.0	81.0					10																	25314167		2203	4300	6503	25354173	SO:0001583	missense	79896	exon3			AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.2015C>A	10.37:g.25314167C>A	ENSP00000434887:p.Ala672Glu	Somatic		Capture	SOLID	Phase_I	25354173	NM_024838	B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	ENST00000524413.1	37	CCDS7147.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513072	0.64522	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	T;T	0.11930	2.73;2.73	5.94	5.94	0.96194	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (1);	0.115131	0.64402	D	0.000019	T	0.40094	0.1103	M	0.69823	2.125	0.53005	D	0.999967	D	0.89917	1.0	D	0.71414	0.973	T	0.04635	-1.0937	10	0.66056	D	0.02	-31.6425	20.3633	0.98874	0.0:1.0:0.0:0.0	.	672	Q8IYQ7	THNS1_HUMAN	E	672	ENSP00000434887:A672E;ENSP00000365534:A672E	ENSP00000365534:A672E	A	+	2	0	THNSL1	25354173	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.345000	0.65987	2.826000	0.97356	0.561000	0.74099	GCA		0.418	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394913.1	NM_024838	
ACBD5	91452	hgsc.bcm.edu	37	10	27493440	27493440	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:27493440C>T	ENST00000375888.1	-	12	1585	c.1521G>A	c.(1519-1521)gtG>gtA	p.V507V	ACBD5_ENST00000375901.1_Silent_p.V389V|ACBD5_ENST00000396271.3_Silent_p.V498V|ACBD5_ENST00000375897.3_Silent_p.V321V|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375905.4_Silent_p.V463V			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	507					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)	p.V463V(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CAAACGTTAGCACACCAGGAG	0.383																																					p.V498V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1494A	10						.						97.0	89.0	91.0					10																	27493440		2203	4300	6503	27533446	SO:0001819	synonymous_variant	91452	exon12			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1521G>A	10.37:g.27493440C>T		Somatic		Capture	SOLID	Phase_I	27533446	NM_145698	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Silent	SNP	ENST00000375888.1	37																																																																																					0.383	ACBD5-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000047314.1	NM_145698	
MPP7	143098	hgsc.bcm.edu	37	10	28347489	28347489	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:28347489T>A	ENST00000375732.1	-	15	1601	c.1342A>T	c.(1342-1344)Agt>Tgt	p.S448C	MPP7_ENST00000540098.1_Missense_Mutation_p.S448C|MPP7_ENST00000337532.5_Missense_Mutation_p.S448C|MPP7_ENST00000375719.3_Missense_Mutation_p.S448C|MPP7_ENST00000445954.2_Missense_Mutation_p.S323C			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	448	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)	p.S448C(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						GAGTCTATACTTGTGCCGTAG	0.328																																					p.S448C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1342T	10						.						231.0	223.0	225.0					10																	28347489		2203	4300	6503	28387495	SO:0001583	missense	143098	exon17			BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.1342A>T	10.37:g.28347489T>A	ENSP00000364884:p.Ser448Cys	Somatic		Capture	SOLID	Phase_I	28387495	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	ENST00000375732.1	37	CCDS7158.1	.	.	.	.	.	.	.	.	.	.	T	19.24	3.788866	0.70337	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000441595;ENST00000445954	T;T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03;2.03	6.01	4.87	0.63330	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.075174	0.85682	D	0.000000	T	0.56277	0.1974	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.67952	-0.5537	10	0.87932	D	0	.	13.5426	0.61684	0.0:0.0:0.1299:0.8701	.	448	Q5T2T1	MPP7_HUMAN	C	448;448;448;448;209;323	ENSP00000364884:S448C;ENSP00000337907:S448C;ENSP00000438693:S448C;ENSP00000364871:S448C;ENSP00000398319:S209C;ENSP00000405397:S323C	ENSP00000337907:S448C	S	-	1	0	MPP7	28387495	1.000000	0.71417	0.643000	0.29450	0.944000	0.59088	6.288000	0.72679	1.082000	0.41137	0.528000	0.53228	AGT		0.328	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
ANK3	288	hgsc.bcm.edu	37	10	61819683	61819683	+	Intron	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:61819683T>C	ENST00000280772.2	-	41	12787				ANK3_ENST00000373827.2_Missense_Mutation_p.Y1607C|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000503366.1_Missense_Mutation_p.Y1614C|ANK3_ENST00000355288.2_Missense_Mutation_p.Y747C	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)						axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.Y747C(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ATCACTAAAATAATCATCTTG	0.473																																					p.Y747C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2240G	10						.						73.0	74.0	73.0					10																	61819683		2203	4300	6503	61489689	SO:0001627	intron_variant	288	exon17			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12596-495A>G	10.37:g.61819683T>C		Somatic		Capture	SOLID	Phase_I	61489689	NM_001149	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.95|16.95	3.263225|3.263225	0.59431|0.59431	.|.	.|.	ENSG00000151150|ENSG00000151150	ENST00000514197|ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817	.|T;T;T;T	.|0.57436	.|0.4;0.4;0.4;0.4	5.77|5.77	1.76|1.76	0.24704|0.24704	.|.	.|.	.|.	.|.	.|.	T|T	0.44030|0.44030	0.1274|0.1274	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|P;P;P;D;P;P	.|0.56968	.|0.704;0.758;0.805;0.978;0.758;0.926	.|B;B;B;P;B;B	.|0.53401	.|0.06;0.156;0.312;0.725;0.156;0.371	T|T	0.31752|0.31752	-0.9932|-0.9932	5|9	.|0.44086	.|T	.|0.13	.|.	10.7537|10.7537	0.46223|0.46223	0.624:0.0:0.0:0.376|0.624:0.0:0.0:0.376	.|.	.|1614;747;1607;848;747;146	.|E9PE32;A8KA62;Q5CZH9;F5GXK0;B1AQT2;B1AQT0	.|.;.;.;.;.;.	V|C	129|1607;205;747;747;1614;1593;848	.|ENSP00000362933:Y1607C;ENSP00000362926:Y205C;ENSP00000347436:Y747C;ENSP00000425236:Y1614C	.|ENSP00000347436:Y747C	I|Y	-|-	1|2	0|0	ANK3|ANK3	61489689|61489689	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	4.102000|4.102000	0.57776|0.57776	0.390000|0.390000	0.25115|0.25115	0.459000|0.459000	0.35465|0.35465	ATT|TAT		0.473	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ZNF365	22891	hgsc.bcm.edu	37	10	64136078	64136078	+	Silent	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:64136078C>A	ENST00000395254.3	+	2	406	c.126C>A	c.(124-126)tcC>tcA	p.S42S	ZNF365_ENST00000395255.3_Silent_p.S42S|ZNF365_ENST00000410046.3_Silent_p.S42S|ZNF365_ENST00000466727.1_Intron	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0								p.S42S(2)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					GCTTGTCATCCTTGAGGGCCC	0.498																																					p.S42S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C126A	10						.						88.0	86.0	87.0					10																	64136078		2203	4300	6503	63806084	SO:0001819	synonymous_variant	22891	exon2			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.126C>A	10.37:g.64136078C>A		Somatic		Capture	SOLID	Phase_I	63806084	NM_199451		Silent	SNP	ENST00000395254.3	37	CCDS31209.1																																																																																				0.498	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951	
DDX21	9188	hgsc.bcm.edu	37	10	70742458	70742458	+	Missense_Mutation	SNP	C	C	T	rs61755356	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:70742458C>T	ENST00000354185.4	+	15	2340	c.2242C>T	c.(2242-2244)Cgg>Tgg	p.R748W		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	748	3 X 5 AA repeats.				ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.R748W(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CAGAGGACAGCGGGAAGGCAG	0.557													C|||	2	0.000399361	0.0	0.0	5008	,	,		16493	0.0		0.001	False		,,,				2504	0.001				p.R748W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2242T	10						.	C	TRP/ARG	0,4406		0,0,2203	129.0	123.0	125.0		2242	-0.5	0.9	10	dbSNP_129	125	2,8598	2.2+/-6.3	0,2,4298	no	missense	DDX21	NM_004728.2	101	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	748/784	70742458	2,13004	2203	4300	6503	70412464	SO:0001583	missense	9188	exon15			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.2242C>T	10.37:g.70742458C>T	ENSP00000346120:p.Arg748Trp	Somatic		Capture	SOLID	Phase_I	70412464	NM_004728	B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	ENST00000354185.4	37	CCDS31211.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.75	3.210373	0.58343	0.0	2.33E-4	ENSG00000165732	ENST00000354185	T	0.19394	2.15	5.35	-0.492	0.12041	.	0.833639	0.11042	N	0.605957	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.28744	-1.0034	10	0.72032	D	0.01	-39.8307	2.6191	0.04911	0.3517:0.3952:0.1015:0.1516	rs61755356	748	Q9NR30	DDX21_HUMAN	W	748	ENSP00000346120:R748W	ENSP00000346120:R748W	R	+	1	2	DDX21	70412464	0.823000	0.29233	0.913000	0.36048	0.045000	0.14185	0.719000	0.25881	0.253000	0.21552	-0.251000	0.11542	CGG		0.557	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048374.1	NM_004728	
LRRC20	55222	hgsc.bcm.edu	37	10	72100404	72100404	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:72100404C>T	ENST00000355790.4	-	3	614	c.137G>A	c.(136-138)cGg>cAg	p.R46Q	LRRC20_ENST00000358141.2_Intron|LRRC20_ENST00000395011.1_Intron|LRRC20_ENST00000373224.1_Missense_Mutation_p.R46Q|LRRC20_ENST00000395010.1_Missense_Mutation_p.R46Q	NM_001278212.1|NM_001278214.1|NM_207119.1	NP_001265141.1|NP_001265143.1|NP_997002.1	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20	46								p.R46Q(1)		endometrium(2)|large_intestine(4)|lung(2)|urinary_tract(1)	9						AGAGACATTCCGCAGGACCTT	0.527																																					p.R46Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G137A	10						.						213.0	173.0	186.0					10																	72100404		2203	4300	6503	71770410	SO:0001583	missense	55222	exon3			BC024001	CCDS7300.1, CCDS7301.1, CCDS7302.1, CCDS73145.1	10q22.2	2004-04-15			ENSG00000172731	ENSG00000172731			23421	protein-coding gene	gene with protein product							Standard	NM_207119		Approved	FLJ10751, FLJ10844	uc031pvr.1	Q8TCA0	OTTHUMG00000018407	ENST00000355790.4:c.137G>A	10.37:g.72100404C>T	ENSP00000348043:p.Arg46Gln	Somatic		Capture	SOLID	Phase_I	71770410	NM_207119	Q5T6D4|Q5T6D6|Q9NVA6|Q9NVG3	Missense_Mutation	SNP	ENST00000355790.4	37	CCDS7302.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.636231	0.67130	.	.	ENSG00000172731	ENST00000373224;ENST00000355790;ENST00000395010;ENST00000357631;ENST00000446961	T;T;T;T;T	0.52057	1.2;1.2;0.68;0.68;1.18	5.74	5.74	0.90152	.	0.106857	0.64402	D	0.000012	T	0.66015	0.2747	M	0.68593	2.085	0.53688	D	0.999971	P;D	0.89917	0.9;1.0	B;D	0.68765	0.269;0.96	T	0.62746	-0.6789	10	0.37606	T	0.19	-21.6993	16.6472	0.85179	0.0:1.0:0.0:0.0	.	46;46	Q8TCA0-3;Q8TCA0	.;LRC20_HUMAN	Q	46	ENSP00000362321:R46Q;ENSP00000348043:R46Q;ENSP00000378457:R46Q;ENSP00000350255:R46Q;ENSP00000413745:R46Q	ENSP00000348043:R46Q	R	-	2	0	LRRC20	71770410	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	4.756000	0.62205	2.715000	0.92844	0.655000	0.94253	CGG		0.527	LRRC20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048510.1	NM_018239	
ADAMTS14	140766	hgsc.bcm.edu	37	10	72511950	72511950	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:72511950G>A	ENST00000373207.1	+	18	2696	c.2696G>A	c.(2695-2697)cGg>cAg	p.R899Q	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.R902Q	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	899	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R902Q(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CCCATCCGCCGGCGCTGCAAC	0.662																																					p.R899Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2696A	10						.						57.0	52.0	53.0					10																	72511950		2203	4300	6503	72181956	SO:0001583	missense	140766	exon18			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2696G>A	10.37:g.72511950G>A	ENSP00000362303:p.Arg899Gln	Somatic		Capture	SOLID	Phase_I	72181956	NM_080722	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002558	0.93227	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.61274	0.12;0.12	4.53	4.53	0.55603	.	0.068310	0.56097	D	0.000034	T	0.67297	0.2878	L	0.61218	1.895	0.40679	D	0.982282	P;P	0.52692	0.955;0.955	P;P	0.53490	0.658;0.727	T	0.70970	-0.4727	10	0.48119	T	0.1	.	17.0627	0.86551	0.0:0.0:1.0:0.0	.	899;902	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	Q	902;899	ENSP00000362304:R902Q;ENSP00000362303:R899Q	ENSP00000362303:R899Q	R	+	2	0	ADAMTS14	72181956	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.013000	0.76373	2.344000	0.79699	0.655000	0.94253	CGG		0.662	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
IFIT3	3437	hgsc.bcm.edu	37	10	91099434	91099434	+	Missense_Mutation	SNP	C	C	T	rs552290967		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:91099434C>T	ENST00000371818.4	+	2	1202	c.1022C>T	c.(1021-1023)aCg>aTg	p.T341M	LIPA_ENST00000371837.1_Intron|IFIT3_ENST00000371811.4_Missense_Mutation_p.T341M|LIPA_ENST00000487618.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	341					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)	p.T341M(1)		breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						TTCCTGGAGACGGAATGTTAT	0.433													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22809	0.0		0.0	False		,,,				2504	0.0				p.T341M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1022T	10						.						92.0	84.0	87.0					10																	91099434		2203	4300	6503	91089414	SO:0001583	missense	3437	exon2			U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.1022C>T	10.37:g.91099434C>T	ENSP00000360883:p.Thr341Met	Somatic		Capture	SOLID	Phase_I	91089414	NM_001549	Q99634|Q9BSK7	Missense_Mutation	SNP	ENST00000371818.4	37	CCDS7402.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864362	0.32977	.	.	ENSG00000119917	ENST00000371818;ENST00000371811;ENST00000543062	T;T	0.11930	2.73;2.73	4.48	-3.78	0.04333	.	0.838503	0.09733	U	0.762956	T	0.05227	0.0139	N	0.08118	0	0.58432	D	0.999997	P	0.46457	0.878	B	0.40636	0.335	T	0.46442	-0.9191	10	0.56958	D	0.05	1.3211	1.9241	0.03313	0.3576:0.2941:0.2119:0.1363	.	341	O14879	IFIT3_HUMAN	M	341;341;162	ENSP00000360883:T341M;ENSP00000360876:T341M	ENSP00000360876:T341M	T	+	2	0	IFIT3	91089414	0.031000	0.19500	0.026000	0.17262	0.023000	0.10783	-0.260000	0.08708	-0.751000	0.04734	-0.842000	0.03052	ACG		0.433	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049294.1	NM_001549	
CPEB3	22849	hgsc.bcm.edu	37	10	93812116	93812116	+	Silent	SNP	C	C	T	rs147464061		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:93812116C>T	ENST00000265997.4	-	10	2122	c.1950G>A	c.(1948-1950)ccG>ccA	p.P650P	CPEB3_ENST00000412050.4_Silent_p.P636P	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	650					3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)	p.P650P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				CACAGAAGAACGGGGCAAACT	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19495	0.0		0.0	False		,,,				2504	0.0				p.P650P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1950A	10						.	C	,	7,4399	11.4+/-27.6	0,7,2196	136.0	117.0	123.0		1908,1950	-2.9	1.0	10	dbSNP_134	123	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CPEB3	NM_001178137.1,NM_014912.4	,	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	,	636/685,650/699	93812116	7,12999	2203	4300	6503	93802096	SO:0001819	synonymous_variant	22849	exon10			AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.1950G>A	10.37:g.93812116C>T		Somatic		Capture	SOLID	Phase_I	93802096	NM_014912	Q5T389|Q9NQJ7|Q9Y2E9	Silent	SNP	ENST00000265997.4	37	CCDS31246.1																																																																																				0.537	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
TLL2	7093	hgsc.bcm.edu	37	10	98182356	98182356	+	Missense_Mutation	SNP	C	C	T	rs200756241		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:98182356C>T	ENST00000357947.3	-	6	992	c.767G>A	c.(766-768)cGg>cAg	p.R256Q	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	256	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R256Q(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TCTGTCTGGCCGGGTGTGTTC	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		19249	0.0		0.001	False		,,,				2504	0.0				p.R256Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G767A	10						.						195.0	150.0	166.0					10																	98182356		2203	4300	6503	98172346	SO:0001583	missense	7093	exon6			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.767G>A	10.37:g.98182356C>T	ENSP00000350630:p.Arg256Gln	Somatic		Capture	SOLID	Phase_I	98172346	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	36	5.715862	0.96830	.	.	ENSG00000095587	ENST00000357947	T	0.80653	-1.4	5.64	5.64	0.86602	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (2);Metallopeptidase, catalytic domain (1);	0.000000	0.41938	D	0.000789	D	0.94391	0.8196	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95900	0.8914	10	0.54805	T	0.06	.	18.6895	0.91578	0.0:1.0:0.0:0.0	.	256	Q9Y6L7	TLL2_HUMAN	Q	256	ENSP00000350630:R256Q	ENSP00000350630:R256Q	R	-	2	0	TLL2	98172346	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.768000	0.85345	2.657000	0.90304	0.655000	0.94253	CGG		0.557	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
MKI67	4288	hgsc.bcm.edu	37	10	129901811	129901811	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr10:129901811C>A	ENST00000368654.3	-	13	8668	c.8293G>T	c.(8293-8295)Gca>Tca	p.A2765S	MKI67_ENST00000368653.3_Missense_Mutation_p.A2405S	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2765	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.A2765S(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TCCTTCAATGCTTTGATGCCT	0.498																																					p.A2405S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7213T	10						.						163.0	147.0	153.0					10																	129901811		2203	4300	6503	129791801	SO:0001583	missense	4288	exon12			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.8293G>T	10.37:g.129901811C>A	ENSP00000357643:p.Ala2765Ser	Somatic		Capture	SOLID	Phase_I	129791801	NM_001145966	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	9.173	1.021579	0.19433	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02552	4.25;4.25	3.93	-1.58	0.08479	.	.	.	.	.	T	0.04543	0.0124	L	0.56769	1.78	0.09310	N	1	P;P;D	0.53619	0.928;0.898;0.961	P;P;P	0.54140	0.588;0.626;0.743	T	0.29458	-1.0011	9	0.08837	T	0.75	.	2.5995	0.04863	0.3583:0.3167:0.0:0.325	.	2764;2405;2765	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	S	2765;2405;2764	ENSP00000357643:A2765S;ENSP00000357642:A2405S	ENSP00000357642:A2405S	A	-	1	0	MKI67	129791801	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.900000	0.01599	-0.187000	0.10516	0.655000	0.94253	GCA		0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
MARCH6	10299	hgsc.bcm.edu	37	5	10400942	10400942	+	Silent	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:10400942A>G	ENST00000274140.5	+	11	1092	c.960A>G	c.(958-960)ggA>ggG	p.G320G	MARCH6_ENST00000449913.2_Silent_p.G272G|MARCH6_ENST00000503788.1_Silent_p.G215G|MARCH6_ENST00000510792.1_5'Flank	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	320					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G320G(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						TTGGTTTGGGATTTGAAGAAC	0.318																																					p.G320G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A960G	5						.						132.0	124.0	127.0					5																	10400942		2203	4299	6502	10453942	SO:0001819	synonymous_variant	10299	exon11			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.960A>G	5.37:g.10400942A>G		Somatic		Capture	SOLID	Phase_I	10453942	NM_005885	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Silent	SNP	ENST00000274140.5	37	CCDS34135.1																																																																																				0.318	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	
MAN2A1	4124	hgsc.bcm.edu	37	5	109106066	109106066	+	Silent	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:109106066T>G	ENST00000261483.4	+	7	2072	c.1020T>G	c.(1018-1020)tcT>tcG	p.S340S		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	340					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.S340S(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		ATCTGGGATCTGTCACAGATA	0.348																																					p.S340S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1020G	5						.						94.0	92.0	92.0					5																	109106066		2202	4300	6502	109133965	SO:0001819	synonymous_variant	4124	exon7				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.1020T>G	5.37:g.109106066T>G		Somatic		Capture	SOLID	Phase_I	109133965	NM_002372	Q16767	Silent	SNP	ENST00000261483.4	37	CCDS34209.1																																																																																				0.348	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
DNAH5	1767	hgsc.bcm.edu	37	5	13862840	13862840	+	Missense_Mutation	SNP	G	G	A	rs201165908		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:13862840G>A	ENST00000265104.4	-	29	4717	c.4613C>T	c.(4612-4614)gCg>gTg	p.A1538V	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1538	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A1538V(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTCTTTCACCGCACTGATACA	0.428									Kartagener syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		12914	0.0		0.001	False		,,,				2504	0.0				p.A1538V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4613T	5						.						185.0	168.0	173.0					5																	13862840		2203	4300	6503	13915840	SO:0001583	missense	1767	exon29	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4613C>T	5.37:g.13862840G>A	ENSP00000265104:p.Ala1538Val	Somatic		Capture	SOLID	Phase_I	13915840	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	34	5.379199	0.95945	.	.	ENSG00000039139	ENST00000265104	T	0.78364	-1.17	5.47	5.47	0.80525	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.93566	0.7946	H	0.99042	4.41	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95999	0.8992	10	0.87932	D	0	.	19.3325	0.94297	0.0:0.0:1.0:0.0	.	1538	Q8TE73	DYH5_HUMAN	V	1538	ENSP00000265104:A1538V	ENSP00000265104:A1538V	A	-	2	0	DNAH5	13915840	1.000000	0.71417	0.956000	0.39512	0.995000	0.86356	9.835000	0.99442	2.583000	0.87209	0.650000	0.86243	GCG		0.428	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DNAH5	1767	hgsc.bcm.edu	37	5	13883123	13883123	+	Missense_Mutation	SNP	C	C	T	rs375218798	byFrequency	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:13883123C>T	ENST00000265104.4	-	20	3168	c.3064G>A	c.(3064-3066)Gtc>Atc	p.V1022I	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1022	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V1022I(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGGGCCATGACGATGTTGGGA	0.522									Kartagener syndrome				C|||	2	0.000399361	0.0008	0.0	5008	,	,		17355	0.001		0.0	False		,,,				2504	0.0				p.V1022I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3064A	5						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	160.0	144.0	149.0		3064	-9.3	0.0	5		149	0,8600		0,0,4300	no	missense	DNAH5	NM_001369.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	1022/4625	13883123	1,13005	2203	4300	6503	13936123	SO:0001583	missense	1767	exon20	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3064G>A	5.37:g.13883123C>T	ENSP00000265104:p.Val1022Ile	Somatic		Capture	SOLID	Phase_I	13936123	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631363	0.28978	2.27E-4	0.0	ENSG00000039139	ENST00000265104	T	0.24151	1.87	6.03	-9.3	0.00649	.	0.729551	0.14036	N	0.345798	T	0.14270	0.0345	L	0.42632	1.34	0.09310	N	0.999997	B	0.06786	0.001	B	0.08055	0.003	T	0.10451	-1.0629	10	0.30078	T	0.28	.	8.1755	0.31278	0.2176:0.2961:0.0:0.4864	.	1022	Q8TE73	DYH5_HUMAN	I	1022	ENSP00000265104:V1022I	ENSP00000265104:V1022I	V	-	1	0	DNAH5	13936123	0.000000	0.05858	0.001000	0.08648	0.579000	0.36224	-1.551000	0.02178	-1.598000	0.01607	-1.038000	0.02383	GTC		0.522	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
FTMT	94033	hgsc.bcm.edu	37	5	121187914	121187914	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:121187914C>A	ENST00000321339.1	+	1	265	c.256C>A	c.(256-258)Ctc>Atc	p.L86I		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	86	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)	p.L86I(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CCAGATCAACCTCGAGCTCTA	0.622																																					p.L86I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C256A	5						.						80.0	63.0	69.0					5																	121187914		2203	4300	6503	121215813	SO:0001583	missense	94033	exon1			BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.256C>A	5.37:g.121187914C>A	ENSP00000313691:p.Leu86Ile	Somatic		Capture	SOLID	Phase_I	121215813	NM_177478		Missense_Mutation	SNP	ENST00000321339.1	37	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778130	0.70107	.	.	ENSG00000181867	ENST00000321339	T	0.65364	-0.15	3.57	2.69	0.31865	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.289604	0.29737	N	0.011328	T	0.70272	0.3205	M	0.78285	2.405	0.35775	D	0.821188	P	0.34662	0.462	P	0.48270	0.572	T	0.77153	-0.2692	10	0.66056	D	0.02	.	8.6908	0.34264	0.4105:0.5895:0.0:0.0	.	86	Q8N4E7	FTMT_HUMAN	I	86	ENSP00000313691:L86I	ENSP00000313691:L86I	L	+	1	0	FTMT	121215813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.156000	0.31712	1.051000	0.40369	0.655000	0.94253	CTC		0.622	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
PCDHB5	26167	hgsc.bcm.edu	37	5	140516391	140516391	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:140516391G>A	ENST00000231134.5	+	1	1592	c.1375G>A	c.(1375-1377)Gtc>Atc	p.V459I		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	459	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V459I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCCTGTTCGTCCGAGAGAA	0.622																																					p.V459I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1375A	5						.						114.0	105.0	108.0					5																	140516391		2202	4296	6498	140496575	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1375G>A	5.37:g.140516391G>A	ENSP00000231134:p.Val459Ile	Somatic		Capture	SOLID	Phase_I	140496575	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	G	6.631	0.484924	0.12641	.	.	ENSG00000113209	ENST00000231134;ENST00000537936	T	0.53857	0.6	4.81	1.78	0.24846	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.33876	0.0878	N	0.15975	0.35	0.09310	N	1	B	0.26363	0.147	B	0.34824	0.19	T	0.32903	-0.9889	9	0.23302	T	0.38	.	5.596	0.17327	0.0737:0.2546:0.5408:0.1309	.	459	Q9Y5E4	PCDB5_HUMAN	I	459;243	ENSP00000231134:V459I	ENSP00000231134:V459I	V	+	1	0	PCDHB5	140496575	0.079000	0.21365	0.004000	0.12327	0.444000	0.32077	0.343000	0.19944	0.548000	0.28955	0.556000	0.70494	GTC		0.622	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHB15	56121	hgsc.bcm.edu	37	5	140625688	140625688	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:140625688C>T	ENST00000231173.3	+	1	542	c.542C>T	c.(541-543)tCc>tTc	p.S181F		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	181	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S181F(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCATGTTTCCACTCGCACC	0.507																																					p.S181F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C542T	5						.						42.0	44.0	43.0					5																	140625688		2203	4300	6503	140605872	SO:0001583	missense	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.542C>T	5.37:g.140625688C>T	ENSP00000231173:p.Ser181Phe	Somatic		Capture	SOLID	Phase_I	140605872	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	A	8.095	0.775296	0.16051	.	.	ENSG00000113248	ENST00000231173	T	0.53423	0.62	4.92	1.96	0.26148	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.34803	0.0910	L	0.41079	1.255	0.09310	N	1	B	0.02656	0.0	B	0.15052	0.012	T	0.27905	-1.0060	9	0.54805	T	0.06	.	4.2597	0.10735	0.3409:0.4626:0.0:0.1965	.	181	Q9Y5E8	PCDBF_HUMAN	F	181	ENSP00000231173:S181F	ENSP00000231173:S181F	S	+	2	0	PCDHB15	140605872	0.000000	0.05858	0.946000	0.38457	0.560000	0.35617	-1.657000	0.01979	1.192000	0.43071	0.491000	0.48974	TCC		0.507	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
ARAP3	64411	hgsc.bcm.edu	37	5	141039397	141039397	+	Silent	SNP	G	G	A	rs184163620		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:141039397G>A	ENST00000239440.4	-	22	3281	c.3216C>T	c.(3214-3216)caC>caT	p.H1072H	ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000508305.1_Silent_p.H903H|ARAP3_ENST00000513878.1_Silent_p.H734H	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1072	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.H1072H(1)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CTCGCACCTCGTGCTCCCCTC	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		17403	0.0		0.001	False		,,,				2504	0.0				p.H1072H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3216T	5						.						70.0	61.0	64.0					5																	141039397		2203	4300	6503	141019581	SO:0001819	synonymous_variant	64411	exon22			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3216C>T	5.37:g.141039397G>A		Somatic		Capture	SOLID	Phase_I	141019581	NM_022481	B4DIT1|D3DQE3	Silent	SNP	ENST00000239440.4	37	CCDS4266.1																																																																																				0.567	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
TRIO	7204	hgsc.bcm.edu	37	5	14290949	14290949	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:14290949A>G	ENST00000344204.4	+	5	689	c.665A>G	c.(664-666)gAc>gGc	p.D222G	TRIO_ENST00000537187.1_Missense_Mutation_p.D222G|TRIO_ENST00000509967.2_Missense_Mutation_p.D173G	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	222					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D222G(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GCTTTTGAAGACTACATTAGC	0.473																																					p.D222G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A665G	5						.						72.0	70.0	70.0					5																	14290949		2203	4300	6503	14343949	SO:0001583	missense	7204	exon5			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.665A>G	5.37:g.14290949A>G	ENSP00000339299:p.Asp222Gly	Somatic		Capture	SOLID	Phase_I	14343949	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.119221	0.56505	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967	T;T;T	0.65364	-0.15;-0.15;0.47	5.32	5.32	0.75619	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.270324	0.37437	N	0.002092	T	0.59059	0.2166	L	0.60455	1.87	0.50039	D	0.999843	B;B	0.33694	0.101;0.421	B;B	0.31946	0.138;0.118	T	0.60424	-0.7266	10	0.41790	T	0.15	.	15.272	0.73708	1.0:0.0:0.0:0.0	.	173;222	F5H228;O75962	.;TRIO_HUMAN	G	222;222;173	ENSP00000339299:D222G;ENSP00000446348:D222G;ENSP00000445592:D173G	ENSP00000339299:D222G	D	+	2	0	TRIO	14343949	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	4.902000	0.63266	2.023000	0.59567	0.455000	0.32223	GAC		0.473	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
ARHGAP26	23092	hgsc.bcm.edu	37	5	142273829	142273829	+	Silent	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:142273829G>A	ENST00000274498.4	+	6	891	c.513G>A	c.(511-513)cgG>cgA	p.R171R	ARHGAP26_ENST00000378004.3_Silent_p.R171R	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	171					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.R171R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCTGGTCCGGCAGCATTTCT	0.433																																					p.R171R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G513A	5						.						88.0	86.0	86.0					5																	142273829		2203	4300	6503	142254013	SO:0001819	synonymous_variant	23092	exon6			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.513G>A	5.37:g.142273829G>A		Somatic		Capture	SOLID	Phase_I	142254013	NM_015071	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Silent	SNP	ENST00000274498.4	37	CCDS4277.1																																																																																				0.433	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
FBXW11	23291	hgsc.bcm.edu	37	5	171299942	171299942	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:171299942C>T	ENST00000265094.5	-	9	1348	c.1211G>A	c.(1210-1212)cGg>cAg	p.R404Q	FBXW11_ENST00000393802.2_Missense_Mutation_p.R370Q|FBXW11_ENST00000425623.2_Missense_Mutation_p.R372Q|FBXW11_ENST00000296933.6_Missense_Mutation_p.R391Q	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	404					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R404Q(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGCAATGCCCCGCTTGTGCCC	0.463																																					p.R370Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1109A	5						.						97.0	85.0	89.0					5																	171299942		2203	4300	6503	171232547	SO:0001583	missense	23291	exon8			AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.1211G>A	5.37:g.171299942C>T	ENSP00000265094:p.Arg404Gln	Somatic		Capture	SOLID	Phase_I	171232547	NM_033645	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001121	0.93227	.	.	ENSG00000072803	ENST00000296933;ENST00000265094;ENST00000393802;ENST00000425623	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.48095	0.1481	L	0.37850	1.14	0.80722	D	1	D;D;D;D	0.63046	0.992;0.959;0.982;0.991	P;B;P;B	0.51297	0.665;0.306;0.451;0.322	T	0.48328	-0.9045	10	0.72032	D	0.01	-5.4396	19.3047	0.94157	0.0:1.0:0.0:0.0	.	372;370;404;391	B4DH70;Q9UKB1-2;Q9UKB1;Q9UKB1-3	.;.;FBW1B_HUMAN;.	Q	391;404;370;372	ENSP00000296933:R391Q;ENSP00000265094:R404Q;ENSP00000377391:R370Q;ENSP00000444929:R372Q	ENSP00000265094:R404Q	R	-	2	0	FBXW11	171232547	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.770000	0.85390	2.652000	0.90054	0.655000	0.94253	CGG		0.463	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
HRH2	3274	hgsc.bcm.edu	37	5	175110949	175110949	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:175110949C>T	ENST00000231683.2	+	1	2486	c.713C>T	c.(712-714)gCc>gTc	p.A238V	HRH2_ENST00000377291.2_Missense_Mutation_p.A238V	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	238					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.A238V(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	ACACTGGCCGCCGTCATGGGG	0.562																																					p.A238V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C713T	5						.						92.0	86.0	88.0					5																	175110949		2203	4300	6503	175043555	SO:0001583	missense	3274	exon1				CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.713C>T	5.37:g.175110949C>T	ENSP00000231683:p.Ala238Val	Somatic		Capture	SOLID	Phase_I	175043555	NM_022304	B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	ENST00000231683.2	37	CCDS4395.1	.	.	.	.	.	.	.	.	.	.	C	1.385	-0.582298	0.03827	.	.	ENSG00000113749	ENST00000377291;ENST00000231683	T;T	0.33654	1.4;1.4	5.09	1.85	0.25348	GPCR, rhodopsin-like superfamily (1);	0.257726	0.37955	N	0.001870	T	0.13713	0.0332	N	0.03304	-0.355	0.09310	N	0.999999	B;B	0.12630	0.001;0.006	B;B	0.18871	0.016;0.023	T	0.30592	-0.9973	10	0.10902	T	0.67	.	9.0234	0.36213	0.0:0.6587:0.0:0.3413	.	238;238	P25021;Q7Z5R9	HRH2_HUMAN;.	V	238	ENSP00000366506:A238V;ENSP00000231683:A238V	ENSP00000231683:A238V	A	+	2	0	HRH2	175043555	0.389000	0.25205	0.134000	0.22075	0.968000	0.65278	1.189000	0.32114	0.553000	0.29044	0.455000	0.32223	GCC		0.562	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1		
BRD9	65980	hgsc.bcm.edu	37	5	864593	864593	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:864593G>A	ENST00000467963.1	-	16	1950	c.1784C>T	c.(1783-1785)gCc>gTc	p.A595V	BRD9_ENST00000483173.1_Missense_Mutation_p.A542V|BRD9_ENST00000323510.4_Missense_Mutation_p.A499V|BRD9_ENST00000388890.4_Missense_Mutation_p.A479V	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	595					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)	p.A499V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			TTAGGTCTTGGCAGAGGCCGC	0.468																																					p.A595V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1784T	5						.						63.0	67.0	65.0					5																	864593		2203	4300	6503	917593	SO:0001583	missense	65980	exon16			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1784C>T	5.37:g.864593G>A	ENSP00000419765:p.Ala595Val	Somatic		Capture	SOLID	Phase_I	917593	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	37	CCDS34127.2	.	.	.	.	.	.	.	.	.	.	g	12.51	1.958973	0.34565	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.28	3.46	0.39613	.	0.993996	0.08181	N	0.985426	T	0.33352	0.0860	L	0.36672	1.1	0.29528	N	0.853013	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.001;0.0;0.003;0.003	T	0.32134	-0.9918	10	0.56958	D	0.05	.	6.0399	0.19728	0.0751:0.1354:0.6495:0.14	.	542;595;499;479	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	V	499;479;542;595	ENSP00000323557:A499V;ENSP00000373542:A479V;ENSP00000419845:A542V;ENSP00000419765:A595V	ENSP00000323557:A499V	A	-	2	0	BRD9	917593	0.121000	0.22262	0.000000	0.03702	0.003000	0.03518	1.584000	0.36589	0.585000	0.29608	0.561000	0.74099	GCC		0.468	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	
ADCY2	108	hgsc.bcm.edu	37	5	7802384	7802384	+	Silent	SNP	G	G	A	rs201615098		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:7802384G>A	ENST00000338316.4	+	21	2771	c.2682G>A	c.(2680-2682)ccG>ccA	p.P894P	ADCY2_ENST00000537121.1_Silent_p.P714P	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	894					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.P894P(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCTCCATTCCGGATTTCAAAG	0.473																																					p.P894P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2682A	5						.	G		0,4406		0,0,2203	79.0	78.0	79.0		2682	0.3	1.0	5		79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADCY2	NM_020546.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		894/1092	7802384	1,13005	2203	4300	6503	7855384	SO:0001819	synonymous_variant	108	exon21			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2682G>A	5.37:g.7802384G>A		Somatic		Capture	SOLID	Phase_I	7855384	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																				0.473	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
SEMA5A	9037	hgsc.bcm.edu	37	5	9190576	9190576	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:9190576G>A	ENST00000382496.5	-	11	1741	c.1076C>T	c.(1075-1077)aCc>aTc	p.T359I		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	359	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.T359I(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CTGGTCCACGGTGCCACACTG	0.567																																					p.T359I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1076T	5						.						76.0	63.0	67.0					5																	9190576		2203	4300	6503	9243576	SO:0001583	missense	9037	exon11			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1076C>T	5.37:g.9190576G>A	ENSP00000371936:p.Thr359Ile	Somatic		Capture	SOLID	Phase_I	9243576	NM_003966	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494627	0.85069	.	.	ENSG00000112902	ENST00000382496	T	0.11169	2.8	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.047653	0.85682	D	0.000000	T	0.23054	0.0557	M	0.71296	2.17	0.80722	D	1	P	0.50156	0.932	P	0.52758	0.708	T	0.00177	-1.1952	10	0.66056	D	0.02	.	10.8158	0.46575	0.085:0.0:0.915:0.0	.	359	Q13591	SEM5A_HUMAN	I	359	ENSP00000371936:T359I	ENSP00000371936:T359I	T	-	2	0	SEMA5A	9243576	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	6.494000	0.73661	2.716000	0.92895	0.655000	0.94253	ACC		0.567	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
CDH12	1010	hgsc.bcm.edu	37	5	21817114	21817114	+	Silent	SNP	T	T	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:21817114T>C	ENST00000382254.1	-	9	2028	c.942A>G	c.(940-942)ggA>ggG	p.G314G	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Silent_p.G274G|CDH12_ENST00000504376.2_Silent_p.G314G	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	314	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G314G(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CAAACAAATTTCCCCCATCTC	0.373										HNSCC(59;0.17)																											p.G314G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A942G	5						.						152.0	151.0	151.0					5																	21817114		2203	4300	6503	21852871	SO:0001819	synonymous_variant	1010	exon9			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.942A>G	5.37:g.21817114T>C		Somatic		Capture	SOLID	Phase_I	21852871	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	ENST00000382254.1	37	CCDS3890.1																																																																																				0.373	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
CDH10	1008	hgsc.bcm.edu	37	5	24498554	24498554	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:24498554C>A	ENST00000264463.4	-	9	1975	c.1468G>T	c.(1468-1470)Gct>Tct	p.A490S	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	490	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A490S(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TAGAACACAGCAAACTGTGGG	0.398										HNSCC(23;0.051)																											p.A490S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1468T	5						.						74.0	72.0	73.0					5																	24498554		2203	4300	6503	24534311	SO:0001583	missense	1008	exon9			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1468G>T	5.37:g.24498554C>A	ENSP00000264463:p.Ala490Ser	Somatic		Capture	SOLID	Phase_I	24534311	NM_006727	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612986	0.66672	.	.	ENSG00000040731	ENST00000264463	T	0.60171	0.21	5.53	5.53	0.82687	Cadherin (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.56934	0.2019	L	0.56340	1.77	0.54753	D	0.999983	P	0.39759	0.687	B	0.39503	0.301	T	0.56643	-0.7945	10	0.36615	T	0.2	.	18.4486	0.90695	0.0:1.0:0.0:0.0	.	490	Q9Y6N8	CAD10_HUMAN	S	490	ENSP00000264463:A490S	ENSP00000264463:A490S	A	-	1	0	CDH10	24534311	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.441000	0.80485	2.613000	0.88420	0.655000	0.94253	GCT		0.398	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33549441	33549441	+	Silent	SNP	G	G	A	rs532835414		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:33549441G>A	ENST00000504830.1	-	21	4508	c.4173C>T	c.(4171-4173)tgC>tgT	p.C1391C	ADAMTS12_ENST00000352040.3_Silent_p.C1306C	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1391	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C1391C(2)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGCTGTCCACGCACTGAATCT	0.567										HNSCC(64;0.19)			G|||	1	0.000199681	0.0	0.0	5008	,	,		18860	0.0		0.0	False		,,,				2504	0.001				p.C1391C												.	.	2	Substitution - coding silent(2)	large_intestine(1)|NS(1)	c.C4173T	5						.						86.0	95.0	92.0					5																	33549441		2203	4300	6503	33585198	SO:0001819	synonymous_variant	81792	exon21			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4173C>T	5.37:g.33549441G>A		Somatic		Capture	SOLID	Phase_I	33585198	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	CCDS34140.1																																																																																				0.567	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
RAI14	26064	hgsc.bcm.edu	37	5	34812010	34812010	+	Silent	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:34812010A>T	ENST00000265109.3	+	9	983	c.696A>T	c.(694-696)ggA>ggT	p.G232G	RAI14_ENST00000397449.1_Silent_p.G225G|RAI14_ENST00000503673.1_Silent_p.G232G|RAI14_ENST00000428746.2_Silent_p.G232G|RAI14_ENST00000515799.1_Silent_p.G235G|RAI14_ENST00000512629.1_Silent_p.G232G|RAI14_ENST00000506376.1_Silent_p.G224G	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	232						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.G232G(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					AAAATGCAGGAATTCAAAGCC	0.368																																					p.G232G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A696T	5						.						78.0	83.0	81.0					5																	34812010		2203	4300	6503	34847767	SO:0001819	synonymous_variant	26064	exon9			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.696A>T	5.37:g.34812010A>T		Somatic		Capture	SOLID	Phase_I	34847767	NM_001145522	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Silent	SNP	ENST00000265109.3	37	CCDS34142.1																																																																																				0.368	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
RAI14	26064	hgsc.bcm.edu	37	5	34830834	34830834	+	Silent	SNP	C	C	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:34830834C>T	ENST00000265109.3	+	18	3194	c.2907C>T	c.(2905-2907)atC>atT	p.I969I	RAI14_ENST00000397449.1_Silent_p.I962I|RAI14_ENST00000503673.1_Silent_p.I969I|RAI14_ENST00000428746.2_Silent_p.I969I|RAI14_ENST00000515799.1_Silent_p.I972I|RAI14_ENST00000512629.1_Silent_p.I940I|RAI14_ENST00000506376.1_Silent_p.I961I	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	969						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.I969I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					TGAAGCAAATCCTTACCATGT	0.413																																					p.I940I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2820T	5						.						144.0	134.0	137.0					5																	34830834		2203	4300	6503	34866591	SO:0001819	synonymous_variant	26064	exon17			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.2907C>T	5.37:g.34830834C>T		Somatic		Capture	SOLID	Phase_I	34866591	NM_001145522	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Silent	SNP	ENST00000265109.3	37	CCDS34142.1																																																																																				0.413	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
UGT3A2	167127	hgsc.bcm.edu	37	5	36039772	36039772	+	Silent	SNP	A	A	C			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:36039772A>C	ENST00000282507.3	-	5	983	c.882T>G	c.(880-882)ggT>ggG	p.G294G	UGT3A2_ENST00000545528.1_5'UTR|UGT3A2_ENST00000504954.1_5'UTR|UGT3A2_ENST00000513300.1_Silent_p.G260G	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	294					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.G294G(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAAGGACAAAACCAGAGTCCC	0.468																																					p.G260G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T780G	5						.						79.0	74.0	76.0					5																	36039772		2203	4300	6503	36075529	SO:0001819	synonymous_variant	167127	exon4				CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.882T>G	5.37:g.36039772A>C		Somatic		Capture	SOLID	Phase_I	36075529	NM_001168316	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Silent	SNP	ENST00000282507.3	37	CCDS3914.1																																																																																				0.468	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914	
RICTOR	253260	hgsc.bcm.edu	37	5	38945637	38945637	+	Missense_Mutation	SNP	C	C	T	rs145530926		TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:38945637C>T	ENST00000357387.3	-	34	4619	c.4589G>A	c.(4588-4590)gGt>gAt	p.G1530D	RICTOR_ENST00000296782.5_Missense_Mutation_p.G1554D	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.G1530D(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					GGGCTGGAAACCCAGAATTTC	0.413																																					p.G1530D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4589A	5						.	C	ASP/GLY	0,4406		0,0,2203	138.0	128.0	131.0		4589	4.9	1.0	5	dbSNP_134	131	1,8599	1.2+/-3.3	0,1,4299	no	missense	RICTOR	NM_152756.3	94	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1530/1709	38945637	1,13005	2203	4300	6503	38981394	SO:0001583	missense	253260	exon34				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4589G>A	5.37:g.38945637C>T	ENSP00000349959:p.Gly1530Asp	Somatic		Capture	SOLID	Phase_I	38981394	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701333	0.88924	0.0	1.16E-4	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.53640	0.64;0.61	5.76	4.89	0.63831	.	0.044893	0.85682	N	0.000000	T	0.46619	0.1402	L	0.54323	1.7	0.80722	D	1	B;B	0.14805	0.011;0.011	B;B	0.19391	0.025;0.025	T	0.46569	-0.9182	10	0.87932	D	0	-20.1615	14.8613	0.70384	0.0:0.9313:0.0:0.0687	.	1530;1554	Q6R327;Q6R327-3	RICTR_HUMAN;.	D	1530;1554	ENSP00000349959:G1530D;ENSP00000296782:G1554D	ENSP00000296782:G1554D	G	-	2	0	RICTOR	38981394	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.903000	0.75703	1.579000	0.49836	0.655000	0.94253	GGT		0.413	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
FBXO4	26272	hgsc.bcm.edu	37	5	41939553	41939553	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:41939553G>A	ENST00000281623.3	+	6	965	c.909G>A	c.(907-909)tgG>tgA	p.W303*	FBXO4_ENST00000509134.1_Intron	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	303					positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)	p.W303*(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				GACATGAATGGCAAGATGAAT	0.333																																					p.W303X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G909A	5						.						139.0	143.0	142.0					5																	41939553		2203	4300	6503	41975310	SO:0001587	stop_gained	26272	exon6			AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.909G>A	5.37:g.41939553G>A	ENSP00000281623:p.Trp303*	Somatic		Capture	SOLID	Phase_I	41975310	NM_012176	Q68CU8|Q86VT8|Q9UK98	Nonsense_Mutation	SNP	ENST00000281623.3	37	CCDS3938.1	.	.	.	.	.	.	.	.	.	.	G	35	5.459620	0.96240	.	.	ENSG00000151876	ENST00000281623	.	.	.	5.29	4.4	0.53042	.	0.378425	0.28499	N	0.015124	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-8.6449	6.7938	0.23715	0.0876:0.0:0.6096:0.3028	.	.	.	.	X	303	.	ENSP00000281623:W303X	W	+	3	0	FBXO4	41975310	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.706000	0.47135	2.636000	0.89361	0.561000	0.74099	TGG		0.333	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211614.1		
HCN1	348980	hgsc.bcm.edu	37	5	45353286	45353286	+	Silent	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:45353286T>G	ENST00000303230.4	-	5	1350	c.1293A>C	c.(1291-1293)atA>atC	p.I431I		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	431					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.I431I(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						AGTAATCATGTATCTTCTGAC	0.333																																					p.I431I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1293C	5						.						158.0	145.0	149.0					5																	45353286		2203	4299	6502	45389043	SO:0001819	synonymous_variant	348980	exon5			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1293A>C	5.37:g.45353286T>G		Somatic		Capture	SOLID	Phase_I	45389043	NM_021072		Silent	SNP	ENST00000303230.4	37	CCDS3952.1																																																																																				0.333	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
MCCC2	64087	hgsc.bcm.edu	37	5	70900197	70900197	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:70900197G>A	ENST00000340941.6	+	6	655	c.526G>A	c.(526-528)Gca>Aca	p.A176T	MCCC2_ENST00000509358.2_Missense_Mutation_p.A176T|MCCC2_ENST00000510895.2_3'UTR|MCCC2_ENST00000323375.8_Missense_Mutation_p.A176T	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	176	Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)	p.A176T(1)		endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	TTCGGGAGGAGCATACTTACC	0.403																																					p.A176T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G526A	5						.						168.0	144.0	152.0					5																	70900197		2203	4300	6503	70935953	SO:0001583	missense	64087	exon6			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.526G>A	5.37:g.70900197G>A	ENSP00000343657:p.Ala176Thr	Somatic		Capture	SOLID	Phase_I	70935953	NM_022132	A6NIY9|Q96C27|Q9Y4L7	Missense_Mutation	SNP	ENST00000340941.6	37	CCDS34184.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410521	0.83340	.	.	ENSG00000131844	ENST00000340941;ENST00000509358;ENST00000323375	D;D;D	0.98717	-5.09;-5.09;-5.09	5.5	5.5	0.81552	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.097261	0.64402	D	0.000001	D	0.99609	0.9858	H	0.99732	4.735	0.80722	D	1	D;D;P	0.67145	0.982;0.996;0.942	P;D;P	0.71184	0.856;0.972;0.861	D	0.97472	1.0041	10	0.87932	D	0	-7.9652	18.5908	0.91212	0.0:0.0:1.0:0.0	.	176;45;176	D6RDF7;B3KR24;Q9HCC0	.;.;MCCB_HUMAN	T	176	ENSP00000343657:A176T;ENSP00000420994:A176T;ENSP00000327308:A176T	ENSP00000327308:A176T	A	+	1	0	MCCC2	70935953	1.000000	0.71417	0.932000	0.37286	0.183000	0.23260	9.041000	0.93788	2.747000	0.94245	0.558000	0.71614	GCA		0.403	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4		
MSH3	4437	hgsc.bcm.edu	37	5	79968651	79968651	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:79968651A>T	ENST00000265081.6	+	6	1081	c.1001A>T	c.(1000-1002)tAt>tTt	p.Y334F		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	334					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ACTGCCCTTTATACAAAATCT	0.393								Mismatch excision repair (MMR)																													p.Y334F	Melanoma(88;1010 1399 13793 26548 36275)											.	.	0			c.A1001T	5						.						108.0	110.0	109.0					5																	79968651		2203	4300	6503	80004407	SO:0001583	missense	4437	exon6			U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.1001A>T	5.37:g.79968651A>T	ENSP00000265081:p.Tyr334Phe	Somatic		Capture	SOLID	Phase_I	80004407	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.743614	0.89663	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.88741	-2.42	5.32	5.32	0.75619	DNA mismatch repair protein MutS, N-terminal (2);DNA mismatch repair protein MutS-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92312	0.7561	L	0.52759	1.655	0.46011	D	0.998819	D	0.89917	1.0	D	0.91635	0.999	D	0.91836	0.5479	9	.	.	.	-19.2183	14.9488	0.71054	1.0:0.0:0.0:0.0	.	334	P20585	MSH3_HUMAN	F	334;325	ENSP00000265081:Y334F	.	Y	+	2	0	MSH3	80004407	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.581000	0.90788	2.003000	0.58678	0.482000	0.46254	TAT		0.393	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
TRIM7	81786	hgsc.bcm.edu	37	5	180625205	180625205	+	Silent	SNP	T	T	G			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr5:180625205T>G	ENST00000274773.7	-	6	1063	c.1002A>C	c.(1000-1002)ggA>ggC	p.G334G	TRIM7_ENST00000422067.2_Silent_p.G126G|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000361809.3_Silent_p.G126G|TRIM7_ENST00000393319.3_Silent_p.G152G|CTC-338M12.6_ENST00000511517.1_RNA|TRIM7_ENST00000504241.1_5'UTR|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000393315.1_Silent_p.G126G|CTC-338M12.6_ENST00000514784.1_RNA|CTC-338M12.6_ENST00000419707.2_RNA|CTC-338M12.6_ENST00000502812.2_RNA	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	334	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.G334G(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		TCTCCAGCTCTCCCCGAAGGT	0.532																																					p.G126G	Esophageal Squamous(128;2258 2308 35507 48647)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A378C	5						.						224.0	177.0	193.0					5																	180625205		2203	4300	6503	180557811	SO:0001819	synonymous_variant	81786	exon6			AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.1002A>C	5.37:g.180625205T>G		Somatic		Capture	SOLID	Phase_I	180557811	NM_203295	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Silent	SNP	ENST00000274773.7	37	CCDS4462.1																																																																																				0.532	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253569.3	NM_203296	
KLRAP1	10748	hgsc.bcm.edu	37	12	10750707	10750707	+	RNA	SNP	G	G	A			TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3525-01A-02W-0833-10	TCGA-AA-3525-10A-01W-0833-10	g.chr12:10750707G>A	ENST00000510134.2	-	0	249									killer cell lectin-like receptor subfamily A pseudogene 1									p.P17L(1)		breast(1)|large_intestine(1)|lung(1)	3						TGACTCTGAAGGAGACTGCAA	0.378																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	12						.						170.0	175.0	174.0					12																	10750707		2203	4300	6503	10641974			10748	.			AF047445		12p13.2	2012-01-16	2010-10-28	2010-10-28	ENSG00000256667	ENSG00000256667		"""Killer cell lectin-like receptors"""	6372	pseudogene	pseudogene		604274	"""killer cell lectin-like receptor subfamily A, member 1"""	KLRA1		9645365	Standard	NR_028045		Approved	Ly49, LY49L	uc009zho.3		OTTHUMG00000160127		12.37:g.10750707G>A		Somatic		Capture	SOLID	Phase_I	10641974	.		Missense_Mutation	SNP	ENST00000510134.2	37																																																																																					0.378	KLRAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000359305.2	NR_028045	
