#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BBS9	27241	hgsc.bcm.edu	37	7	33397555	33397555	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr7:33397555A>T	ENST00000242067.6	+	16	2162	c.1641A>T	c.(1639-1641)aaA>aaT	p.K547N	BBS9_ENST00000350941.3_Missense_Mutation_p.K507N|BBS9_ENST00000354265.4_Missense_Mutation_p.K512N|BBS9_ENST00000396127.2_Missense_Mutation_p.K512N|BBS9_ENST00000355070.2_Missense_Mutation_p.K542N	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	547					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.K547N(2)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			CAAGCCACAAAATTACTATTG	0.378									Bardet-Biedl syndrome																												p.K542N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1626T	7						.						101.0	102.0	102.0					7																	33397555		2203	4299	6502	33364080	SO:0001583	missense	27241	exon15	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1641A>T	7.37:g.33397555A>T	ENSP00000242067:p.Lys547Asn	Somatic		Capture	SOLID	Phase_I	33364080	NM_001033605	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	CCDS43566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.09|18.09	3.547310|3.547310	0.65311|0.65311	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132|ENST00000434373	T;T;T;T;T|.	0.28069|.	1.63;1.63;1.63;1.63;1.63|.	5.94|5.94	1.98|1.98	0.26296|0.26296	.|.	0.046679|.	0.85682|.	D|.	0.000000|.	T|T	0.73745|0.73745	0.3626|0.3626	M|M	0.85462|0.85462	2.755|2.755	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.61697|.	0.99;0.99;0.99;0.99;0.99|.	D;D;D;D;D|.	0.70227|.	0.968;0.968;0.939;0.968;0.939|.	T|T	0.72953|0.72953	-0.4135|-0.4135	10|5	0.72032|.	D|.	0.01|.	-21.5014|-21.5014	9.6677|9.6677	0.39994|0.39994	0.6001:0.0:0.3999:0.0|0.6001:0.0:0.3999:0.0	.|.	547;507;542;512;547|.	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;.;PTHB1_HUMAN|.	N|Y	547;507;512;542;512;547|114	ENSP00000242067:K547N;ENSP00000313122:K507N;ENSP00000379433:K512N;ENSP00000347182:K542N;ENSP00000346214:K512N|.	ENSP00000242067:K547N|.	K|N	+|+	3|1	2|0	BBS9|BBS9	33364080|33364080	0.553000|0.553000	0.26513|0.26513	0.983000|0.983000	0.44433|0.44433	0.929000|0.929000	0.56500|0.56500	0.739000|0.739000	0.26173|0.26173	0.406000|0.406000	0.25560|0.25560	0.523000|0.523000	0.50628|0.50628	AAA|AAT		0.378	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
HERPUD2	64224	hgsc.bcm.edu	37	7	35673973	35673973	+	Silent	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr7:35673973G>A	ENST00000396081.1	-	7	1812	c.1008C>T	c.(1006-1008)gcC>gcT	p.A336A	HERPUD2_ENST00000426180.1_5'UTR|HERPUD2_ENST00000311350.3_Silent_p.A336A	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	336					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.A336A(1)		kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						TGTTAACTTCGGCATTATTGT	0.373																																					p.A336A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1008T	7						.						201.0	187.0	191.0					7																	35673973		2203	4300	6503	35640498	SO:0001819	synonymous_variant	64224	exon8			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.1008C>T	7.37:g.35673973G>A		Somatic		Capture	SOLID	Phase_I	35640498	NM_022373	A4D1Y8|Q9H6F9	Silent	SNP	ENST00000396081.1	37	CCDS5446.1																																																																																				0.373	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373	
IRF5	3663	hgsc.bcm.edu	37	7	128587094	128587094	+	Silent	SNP	A	A	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr7:128587094A>T	ENST00000402030.2	+	5	537	c.465A>T	c.(463-465)ccA>ccT	p.P155P	IRF5_ENST00000473745.1_Silent_p.P155P|IRF5_ENST00000249375.4_Silent_p.P155P|IRF5_ENST00000477535.1_Silent_p.P155P|IRF5_ENST00000357234.5_Silent_p.P155P	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	155					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P155P(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						GGATGTTGCCAAGCCTGAGCC	0.577																																					p.P155P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A465T	7						.						93.0	94.0	94.0					7																	128587094		2203	4300	6503	128374330	SO:0001819	synonymous_variant	3663	exon5				CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.465A>T	7.37:g.128587094A>T		Somatic		Capture	SOLID	Phase_I	128374330	NM_001098627	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Silent	SNP	ENST00000402030.2	37	CCDS5808.1																																																																																				0.577	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
SLC7A8	23428	hgsc.bcm.edu	37	14	23608644	23608644	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr14:23608644C>T	ENST00000316902.7	-	6	1626	c.901G>A	c.(901-903)Gcc>Acc	p.A301T	SLC7A8_ENST00000422941.2_Missense_Mutation_p.A77T|SLC7A8_ENST00000532568.1_5'UTR|SLC7A8_ENST00000469263.1_Intron|SLC7A8_ENST00000453702.1_Missense_Mutation_p.A98T|SLC7A8_ENST00000529705.2_Missense_Mutation_p.A196T	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	301					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)	p.A301T(1)		autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	ACAGCGACGGCGTTGGATGCC	0.512																																					p.A98T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G292A	14						.						139.0	132.0	135.0					14																	23608644		2203	4300	6503	22678484	SO:0001583	missense	23428	exon4			Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.901G>A	14.37:g.23608644C>T	ENSP00000320378:p.Ala301Thr	Somatic		Capture	SOLID	Phase_I	22678484	NM_182728	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	37	CCDS9590.1	.	.	.	.	.	.	.	.	.	.	C	34	5.403077	0.96030	.	.	ENSG00000092068	ENST00000316902;ENST00000334354;ENST00000453702;ENST00000529705;ENST00000422941;ENST00000206514	D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61	5.06	5.06	0.68205	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.94046	0.8092	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.996;1.0	D	0.94387	0.7610	10	0.87932	D	0	.	18.0892	0.89469	0.0:1.0:0.0:0.0	.	196;77;301	B4DKT4;B4DTV6;Q9UHI5	.;.;LAT2_HUMAN	T	301;98;98;196;77;98	ENSP00000320378:A301T;ENSP00000391577:A98T;ENSP00000434345:A196T;ENSP00000416398:A77T	ENSP00000206514:A98T	A	-	1	0	SLC7A8	22678484	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.119000	0.77145	2.733000	0.93635	0.655000	0.94253	GCC		0.512	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
IRF9	10379	hgsc.bcm.edu	37	14	24635112	24635112	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr14:24635112A>C	ENST00000396864.3	+	8	1335	c.1048A>C	c.(1048-1050)Aat>Cat	p.N350H	IRF9_ENST00000557894.1_Missense_Mutation_p.E290A|RP11-468E2.4_ENST00000558468.1_3'UTR	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	350					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N350H(1)		NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		GGTAACACTGAATTTCTGGGA	0.507																																					p.N350H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1048C	14						.						38.0	40.0	39.0					14																	24635112		2203	4300	6503	23704952	SO:0001583	missense	10379	exon8			M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.1048A>C	14.37:g.24635112A>C	ENSP00000380073:p.Asn350His	Somatic		Capture	SOLID	Phase_I	23704952	NM_006084	D3DS61	Missense_Mutation	SNP	ENST00000396864.3	37	CCDS9615.1	.	.	.	.	.	.	.	.	.	.	A	7.419	0.636424	0.14386	.	.	ENSG00000213928	ENST00000396864;ENST00000324076	D;D	0.93763	-3.28;-3.28	5.82	1.2	0.21068	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.533313	0.18315	N	0.144979	D	0.84701	0.5530	N	0.22421	0.69	0.21984	N	0.999438	B	0.15141	0.012	B	0.14578	0.011	T	0.72527	-0.4266	10	0.38643	T	0.18	-10.4744	4.6599	0.12637	0.4872:0.2212:0.2916:0.0	.	350	Q00978	IRF9_HUMAN	H	350;166	ENSP00000380073:N350H;ENSP00000313529:N166H	ENSP00000313529:N166H	N	+	1	0	IRF9	23704952	0.999000	0.42202	0.998000	0.56505	0.040000	0.13550	1.064000	0.30579	0.194000	0.20326	0.459000	0.35465	AAT		0.507	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071927.2		
MLH3	27030	hgsc.bcm.edu	37	14	75509168	75509168	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr14:75509168C>T	ENST00000556740.1	-	2	3328	c.3293G>A	c.(3292-3294)aGg>aAg	p.R1098K	MLH3_ENST00000555671.1_Intron|MLH3_ENST00000556257.1_Intron|MLH3_ENST00000355774.2_Missense_Mutation_p.R1098K|MLH3_ENST00000238662.7_Missense_Mutation_p.R1098K|MLH3_ENST00000380968.2_Missense_Mutation_p.R44K|MLH3_ENST00000544985.1_Missense_Mutation_p.R93K			Q9UHC1	MLH3_HUMAN	mutL homolog 3	1098					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)	p.R1098K(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		AGGTTGACACCTGTACTGAGA	0.388								Mismatch excision repair (MMR)																													p.R1098K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3293A	14						.						105.0	101.0	102.0					14																	75509168		2203	4300	6503	74578921	SO:0001583	missense	27030	exon3			AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.3293G>A	14.37:g.75509168C>T	ENSP00000452316:p.Arg1098Lys	Somatic		Capture	SOLID	Phase_I	74578921	NM_001040108	P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	37	CCDS32123.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425192	0.62733	.	.	ENSG00000119684	ENST00000355774;ENST00000380968;ENST00000238662;ENST00000556740;ENST00000544985	D;T;D;D;T	0.83673	-1.6;0.67;-1.75;-1.6;0.38	5.81	3.03	0.35002	.	0.264904	0.36482	N	0.002569	T	0.79233	0.4411	M	0.65975	2.015	0.29903	N	0.824254	B;P	0.36027	0.234;0.533	B;B	0.35240	0.198;0.123	T	0.77225	-0.2666	10	0.87932	D	0	-9.7152	8.8678	0.35298	0.0:0.7195:0.0:0.2805	.	1098;1098	Q9UHC1-2;Q9UHC1	.;MLH3_HUMAN	K	1098;44;1098;1098;93	ENSP00000348020:R1098K;ENSP00000370355:R44K;ENSP00000238662:R1098K;ENSP00000452316:R1098K;ENSP00000441371:R93K	ENSP00000238662:R1098K	R	-	2	0	MLH3	74578921	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.070000	0.41491	0.809000	0.34255	0.591000	0.81541	AGG		0.388	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
GAB4	128954	hgsc.bcm.edu	37	22	17449261	17449261	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr22:17449261T>A	ENST00000400588.1	-	5	1057	c.950A>T	c.(949-951)aAg>aTg	p.K317M	GAB4_ENST00000523144.1_5'UTR	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	317								p.K317M(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				CTGGGTGTACTTGCCGGAGGA	0.582																																					p.K317M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A950T	22						.						108.0	110.0	109.0					22																	17449261		2203	4300	6503	15829261	SO:0001583	missense	128954	exon5			AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.950A>T	22.37:g.17449261T>A	ENSP00000383431:p.Lys317Met	Somatic		Capture	SOLID	Phase_I	15829261	NM_001037814		Missense_Mutation	SNP	ENST00000400588.1	37	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	T	9.846	1.192270	0.21954	.	.	ENSG00000215568	ENST00000400588	T	0.32515	1.45	1.97	1.97	0.26223	.	0.501252	0.21841	N	0.068338	T	0.16599	0.0399	N	0.08118	0	0.22017	N	0.999412	P	0.52316	0.952	P	0.45071	0.468	T	0.07328	-1.0778	10	0.59425	D	0.04	.	7.8748	0.29586	0.0:0.0:0.0:1.0	.	317	Q2WGN9	GAB4_HUMAN	M	317	ENSP00000383431:K317M	ENSP00000383431:K317M	K	-	2	0	GAB4	15829261	1.000000	0.71417	0.213000	0.23690	0.010000	0.07245	3.396000	0.52565	1.148000	0.42385	0.338000	0.21704	AAG		0.582	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	
RBM42	79171	hgsc.bcm.edu	37	19	36128414	36128414	+	Silent	SNP	C	C	G			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr19:36128414C>G	ENST00000262633.4	+	10	1506	c.1401C>G	c.(1399-1401)gtC>gtG	p.V467V	RBM42_ENST00000588161.1_Silent_p.V437V|RBM42_ENST00000592202.1_Silent_p.V413V|RBM42_ENST00000589871.1_Silent_p.V445V|RBM42_ENST00000589559.1_Silent_p.V373V|RBM42_ENST00000586618.1_Silent_p.V171V|RBM42_ENST00000360475.4_Silent_p.V438V	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	467	Necessary for interaction with HNRNPK. {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V467V(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TGGACGTGGTCCGCAAGAAGC	0.612																																					p.V467V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1401G	19						.						109.0	109.0	109.0					19																	36128414		2203	4300	6503	40820254	SO:0001819	synonymous_variant	79171	exon10			BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.1401C>G	19.37:g.36128414C>G		Somatic		Capture	SOLID	Phase_I	40820254	NM_024321	O00320|Q8N5R7|Q9BU66	Silent	SNP	ENST00000262633.4	37	CCDS12468.1																																																																																				0.612	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459057.2	NM_024321	
ZFP14	57677	hgsc.bcm.edu	37	19	36832466	36832466	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr19:36832466T>C	ENST00000270001.7	-	5	377	c.262A>G	c.(262-264)Act>Gct	p.T88A		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	88					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T88A(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					GGAGATAAAGTATTGGTCCTG	0.318																																					p.T88A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A262G	19						.						31.0	33.0	32.0					19																	36832466		2203	4293	6496	41524306	SO:0001583	missense	57677	exon5			AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.262A>G	19.37:g.36832466T>C	ENSP00000270001:p.Thr88Ala	Somatic		Capture	SOLID	Phase_I	41524306	NM_020917	A7MD23	Missense_Mutation	SNP	ENST00000270001.7	37	CCDS33002.1	.	.	.	.	.	.	.	.	.	.	t	4.633	0.117688	0.08881	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	T	0.06218	3.33	4.4	1.08	0.20341	.	0.363007	0.20219	N	0.096736	T	0.03564	0.0102	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.46952	-0.9154	10	0.14252	T	0.57	.	7.4972	0.27496	0.0:0.2864:0.0:0.7136	.	88;88	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	A	88	ENSP00000270001:T88A	ENSP00000270001:T88A	T	-	1	0	ZFP14	41524306	0.000000	0.05858	0.070000	0.20053	0.906000	0.53458	-0.046000	0.11983	0.245000	0.21373	-0.389000	0.06534	ACT		0.318	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917	
LGALS14	56891	hgsc.bcm.edu	37	19	40197278	40197278	+	Silent	SNP	C	C	T	rs143548297		TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr19:40197278C>T	ENST00000392052.3	+	2	280	c.57C>T	c.(55-57)tgC>tgT	p.C19C	LGALS14_ENST00000360675.3_Silent_p.C48C	NM_020129.2	NP_064514.1	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14	19	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)	nucleus (GO:0005634)	carbohydrate binding (GO:0030246)	p.C48C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|stomach(2)	14	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			TTGGTTCGTGCGTGATAATCA	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		22898	0.0		0.001	False		,,,				2504	0.0				p.C19C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C57T	19						.						279.0	214.0	236.0					19																	40197278		2203	4300	6503	44889118	SO:0001819	synonymous_variant	56891	exon2			AF267852	CCDS12542.1, CCDS46073.1	19q13.2	2014-03-19			ENSG00000006659	ENSG00000006659		"""Lectins, galactoside-binding"""	30054	protein-coding gene	gene with protein product		607260				11997112	Standard	NM_020129		Approved	PPL13, CLC2	uc002omg.3	Q8TCE9	OTTHUMG00000183143	ENST00000392052.3:c.57C>T	19.37:g.40197278C>T		Somatic		Capture	SOLID	Phase_I	44889118	NM_020129	A8MPV8|B2R530|C5HZ19|Q7Z4X8|Q96KD4|Q96KD5|Q96KD6|Q9NR03	Silent	SNP	ENST00000392052.3	37	CCDS46073.1																																																																																				0.498	LGALS14-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465222.1	NM_020129	
SHANK1	50944	hgsc.bcm.edu	37	19	51217546	51217546	+	Splice_Site	SNP	G	G	A	rs552283055		TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr19:51217546G>A	ENST00000293441.1	-	4	551	c.533C>T	c.(532-534)aCg>aTg	p.T178M	SHANK1_ENST00000391814.1_Splice_Site_p.T178M|SHANK1_ENST00000359082.3_Splice_Site_p.T178M	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	178					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.T178M(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CTTCAACCCCGTCTGAGCCAT	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		19033	0.0		0.001	False		,,,				2504	0.0				p.T178M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C533T	19						.						46.0	37.0	40.0					19																	51217546		2203	4300	6503	55909358	SO:0001630	splice_region_variant	50944	exon4			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.532-1C>T	19.37:g.51217546G>A		Somatic		Capture	SOLID	Phase_I	55909358	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873291	0.51695	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.18810	2.19;2.19;2.19	3.97	3.97	0.46021	Ankyrin repeat-containing domain (3);	0.100795	0.39834	U	0.001242	T	0.32971	0.0847	L	0.42245	1.32	0.38392	D	0.945428	D	0.76494	0.999	P	0.57101	0.813	T	0.25082	-1.0142	10	0.87932	D	0	-15.0125	15.9929	0.80220	0.0:0.0:1.0:0.0	.	178	Q9Y566	SHAN1_HUMAN	M	178	ENSP00000293441:T178M;ENSP00000351984:T178M;ENSP00000375690:T178M	ENSP00000293441:T178M	T	-	2	0	SHANK1	55909358	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.216000	0.77974	2.516000	0.84829	0.561000	0.74099	ACG		0.557	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	Missense_Mutation
NLRP8	126205	hgsc.bcm.edu	37	19	56465998	56465998	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr19:56465998C>A	ENST00000291971.3	+	3	645	c.574C>A	c.(574-576)Ctg>Atg	p.L192M	NLRP8_ENST00000590542.1_Missense_Mutation_p.L192M	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	192					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.L192M(2)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTTACCATGTCTGCTTCTGCC	0.512																																					p.L192M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C574A	19						.						102.0	92.0	95.0					19																	56465998		2203	4300	6503	61157810	SO:0001583	missense	126205	exon3			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.574C>A	19.37:g.56465998C>A	ENSP00000291971:p.Leu192Met	Somatic		Capture	SOLID	Phase_I	61157810	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707160	0.30232	.	.	ENSG00000179709	ENST00000291971	T	0.76448	-1.02	1.94	-2.41	0.06562	.	.	.	.	.	T	0.67627	0.2913	N	0.24115	0.695	0.09310	N	1	D;D	0.54047	0.962;0.964	P;P	0.54889	0.763;0.737	T	0.57763	-0.7755	9	0.59425	D	0.04	.	0.456	0.00509	0.2451:0.3189:0.2429:0.1931	.	192;192	Q86W28-2;Q86W28	.;NALP8_HUMAN	M	192	ENSP00000291971:L192M	ENSP00000291971:L192M	L	+	1	2	NLRP8	61157810	0.018000	0.18449	0.000000	0.03702	0.144000	0.21451	0.270000	0.18607	-0.514000	0.06488	0.514000	0.50259	CTG		0.512	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
ASAP1	50807	hgsc.bcm.edu	37	8	131179811	131179811	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr8:131179811T>A	ENST00000518721.1	-	11	1107	c.880A>T	c.(880-882)Aaa>Taa	p.K294*	ASAP1_ENST00000357668.1_Nonsense_Mutation_p.K294*	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	294					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.K294*(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						AGAGAGGATTTTATTAAGTCT	0.353																																					p.K294X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A880T	8						.						250.0	255.0	254.0					8																	131179811		2203	4300	6503	131248993	SO:0001587	stop_gained	50807	exon10			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.880A>T	8.37:g.131179811T>A	ENSP00000429900:p.Lys294*	Somatic		Capture	SOLID	Phase_I	131248993	NM_018482	B2RNV3	Nonsense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	40|40	8.271150|8.271150	0.98735|0.98735	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000524124|ENST00000343135;ENST00000357668;ENST00000518721;ENST00000524367	.|.	.|.	.|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.35770|.	0.0943|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36212|.	-0.9757|.	4|.	.|0.02654	.|T	.|1	.|.	14.3518|14.3518	0.66708|0.66708	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	I|X	111|294;294;294;264	.|.	.|ENSP00000344591:K294X	K|K	-|-	2|1	0|0	ASAP1|ASAP1	131248993|131248993	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.040000|7.040000	0.76551|0.76551	2.275000|2.275000	0.75901|0.75901	0.528000|0.528000	0.53228|0.53228	AAA|AAA		0.353	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
RDH10	157506	hgsc.bcm.edu	37	8	74233173	74233173	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr8:74233173T>C	ENST00000240285.5	+	4	1309	c.631T>C	c.(631-633)Tgt>Cgt	p.C211R	RP11-434I12.2_ENST00000517475.1_RNA|RP11-434I12.2_ENST00000514599.1_RNA|RDH10_ENST00000519380.1_Missense_Mutation_p.C46R	NM_172037.4	NP_742034.1	Q8IZV5	RDH10_HUMAN	retinol dehydrogenase 10 (all-trans)	211					bud elongation involved in lung branching (GO:0060449)|ear development (GO:0043583)|embryonic camera-type eye development (GO:0031076)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|gonad development (GO:0008406)|in utero embryonic development (GO:0001701)|metanephros development (GO:0001656)|neural crest cell development (GO:0014032)|nose development (GO:0043584)|phototransduction, visible light (GO:0007603)|primary lung bud formation (GO:0060431)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)	p.C211R(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	11	Breast(64;0.0954)		Epithelial(68;0.0105)|all cancers(69;0.0465)|BRCA - Breast invasive adenocarcinoma(89;0.0608)			TCAGGATTACTGTGCCAGTAA	0.413																																					p.C211R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T631C	8						.						140.0	134.0	136.0					8																	74233173		2203	4300	6503	74395727	SO:0001583	missense	157506	exon4			AF456765	CCDS6213.1	8q21.11	2011-09-20			ENSG00000121039	ENSG00000121039	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	19975	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 4"""	607599				12407145, 19027726	Standard	NM_172037		Approved	SDR16C4	uc003xzi.3	Q8IZV5	OTTHUMG00000164492	ENST00000240285.5:c.631T>C	8.37:g.74233173T>C	ENSP00000240285:p.Cys211Arg	Somatic		Capture	SOLID	Phase_I	74395727	NM_172037		Missense_Mutation	SNP	ENST00000240285.5	37	CCDS6213.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.372951	0.82573	.	.	ENSG00000121039	ENST00000240285;ENST00000521928;ENST00000519380	D;D;D	0.87334	-2.24;-2.24;-2.24	5.35	5.35	0.76521	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93766	0.8007	M	0.84948	2.725	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	D	0.94692	0.7875	10	0.87932	D	0	.	15.4927	0.75624	0.0:0.0:0.0:1.0	.	211	Q8IZV5	RDH10_HUMAN	R	211;46;46	ENSP00000240285:C211R;ENSP00000429727:C46R;ENSP00000428132:C46R	ENSP00000240285:C211R	C	+	1	0	RDH10	74395727	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.832000	0.86757	2.246000	0.74042	0.533000	0.62120	TGT		0.413	RDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378982.1		
UQCRB	7381	hgsc.bcm.edu	37	8	97247744	97247744	+	Silent	SNP	C	C	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr8:97247744C>T	ENST00000287022.5	-	1	118	c.15G>A	c.(13-15)caG>caA	p.Q5Q	UQCRB_ENST00000517523.1_5'Flank|UQCRB_ENST00000523920.1_Silent_p.Q5Q|UQCRB_ENST00000518406.1_Silent_p.Q5Q|KB-1043D8.6_ENST00000520575.1_RNA	NM_001199975.2|NM_006294.4	NP_001186904.1|NP_006285.1	P14927	QCR7_HUMAN	ubiquinol-cytochrome c reductase binding protein	5					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)		p.Q5Q(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10	Breast(36;5.16e-05)					ACTTACCGGCCTGCTTACCAG	0.542																																					p.Q5Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G15A	8						.						117.0	108.0	111.0					8																	97247744		2203	4300	6503	97316920	SO:0001819	synonymous_variant	7381	exon1			X13585	CCDS6269.1, CCDS59107.1	8q22	2011-07-04			ENSG00000156467	ENSG00000156467		"""Mitochondrial respiratory chain complex / Complex III"""	12582	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VI"", ""cytochrome b-c1 complex subunit 7"""	191330		UQBP		2167087, 2543413, 3056408	Standard	NM_006294		Approved	QP-C, QCR7, UQCR6	uc022ayx.1	P14927	OTTHUMG00000164711	ENST00000287022.5:c.15G>A	8.37:g.97247744C>T		Somatic		Capture	SOLID	Phase_I	97316920	NM_006294	E5RJU0|Q6FGD1	Silent	SNP	ENST00000287022.5	37	CCDS6269.1																																																																																				0.542	UQCRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379863.1	NM_006294	
DENND3	22898	hgsc.bcm.edu	37	8	142190927	142190927	+	Missense_Mutation	SNP	C	C	T	rs201075864	byFrequency	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr8:142190927C>T	ENST00000262585.2	+	17	2956	c.2678C>T	c.(2677-2679)gCg>gTg	p.A893V	DENND3_ENST00000424248.1_Missense_Mutation_p.A841V|DENND3_ENST00000519811.1_Missense_Mutation_p.A973V|DENND3_ENST00000518806.1_3'UTR	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	893					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.A893V(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TTCCCACAAGCGGTGGACGTG	0.577													C|||	2	0.000399361	0.0	0.0	5008	,	,		17918	0.0		0.0	False		,,,				2504	0.002				p.A893V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2678T	8						.						62.0	58.0	59.0					8																	142190927		2203	4300	6503	142260109	SO:0001583	missense	22898	exon17			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.2678C>T	8.37:g.142190927C>T	ENSP00000262585:p.Ala893Val	Somatic		Capture	SOLID	Phase_I	142260109	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390099	0.82902	.	.	ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811;ENST00000517985	T;T;T	0.15834	2.84;2.39;2.82	4.61	3.74	0.42951	WD40 repeat-like-containing domain (1);	0.207546	0.45361	D	0.000370	T	0.27594	0.0678	M	0.64997	1.995	0.37300	D	0.908673	D;D	0.69078	0.997;0.997	P;P	0.51055	0.657;0.657	T	0.26849	-1.0091	10	0.72032	D	0.01	-25.6476	12.675	0.56889	0.0:0.9196:0.0:0.0804	.	973;893	E9PF32;A2RUS2	.;DEND3_HUMAN	V	893;841;973;53	ENSP00000262585:A893V;ENSP00000410594:A841V;ENSP00000428714:A973V	ENSP00000262585:A893V	A	+	2	0	DENND3	142260109	0.993000	0.37304	0.010000	0.14722	0.001000	0.01503	3.643000	0.54374	0.936000	0.37367	0.563000	0.77884	GCG		0.577	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
CELSR2	1952	hgsc.bcm.edu	37	1	109814914	109814914	+	Silent	SNP	C	C	G			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr1:109814914C>G	ENST00000271332.3	+	29	8002	c.7941C>G	c.(7939-7941)ccC>ccG	p.P2647P	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2647					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.P2647P(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ACAACTGCCCCAGCCCCTACG	0.642																																					p.P2647P	NSCLC(158;1285 2011 34800 34852 42084)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7941G	1						.						89.0	100.0	96.0					1																	109814914		2203	4300	6503	109616437	SO:0001819	synonymous_variant	1952	exon29			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7941C>G	1.37:g.109814914C>G		Somatic		Capture	SOLID	Phase_I	109616437	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																				0.642	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CELSR2	1952	hgsc.bcm.edu	37	1	109814917	109814917	+	Silent	SNP	C	C	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr1:109814917C>T	ENST00000271332.3	+	29	8005	c.7944C>T	c.(7942-7944)agC>agT	p.S2648S	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2648					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S2648S(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ACTGCCCCAGCCCCTACGCAG	0.637																																					p.S2648S	NSCLC(158;1285 2011 34800 34852 42084)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7944T	1						.						89.0	99.0	96.0					1																	109814917		2203	4300	6503	109616440	SO:0001819	synonymous_variant	1952	exon29			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7944C>T	1.37:g.109814917C>T		Somatic		Capture	SOLID	Phase_I	109616440	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																				0.637	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
KCNT2	343450	hgsc.bcm.edu	37	1	196303082	196303082	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr1:196303082G>T	ENST00000294725.9	-	17	2807	c.1892C>A	c.(1891-1893)cCt>cAt	p.P631H	KCNT2_ENST00000367433.5_Missense_Mutation_p.P631H|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.P581H|KCNT2_ENST00000451324.2_Missense_Mutation_p.P242H|KCNT2_ENST00000367431.4_Missense_Mutation_p.P581H			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	631					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.P631H(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CTCTAAAACAGGAGCAATGCT	0.413																																					p.P631H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1892A	1						.						165.0	150.0	155.0					1																	196303082		2203	4300	6503	194569705	SO:0001583	missense	343450	exon17			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1892C>A	1.37:g.196303082G>T	ENSP00000294725:p.Pro631His	Somatic		Capture	SOLID	Phase_I	194569705	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310888	0.81358	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000451324;ENST00000294725	T;T;T;T	0.74421	-0.84;-0.84;-0.84;2.25	4.67	4.67	0.58626	.	0.000000	0.56097	D	0.000023	D	0.87869	0.6286	M	0.87827	2.91	0.80722	D	1	B;D;D;D;B	0.76494	0.35;0.999;0.999;0.999;0.35	B;D;D;D;B	0.72625	0.129;0.959;0.978;0.959;0.129	D	0.90297	0.4327	10	0.87932	D	0	-9.8742	17.7575	0.88453	0.0:0.0:1.0:0.0	.	631;613;631;581;631	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	H	631;581;452;242;631	ENSP00000356403:P631H;ENSP00000356401:P581H;ENSP00000405474:P242H;ENSP00000294725:P631H	ENSP00000294725:P631H	P	-	2	0	KCNT2	194569705	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.947000	0.93000	2.418000	0.82041	0.655000	0.94253	CCT		0.413	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
CYP2J2	1573	hgsc.bcm.edu	37	1	60377912	60377912	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr1:60377912C>G	ENST00000371204.3	-	3	488	c.445G>C	c.(445-447)Ggt>Cgt	p.G149R	CYP2J2_ENST00000492633.1_5'UTR	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	149					arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)	p.G149R(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	TTTCCTAAACCAAAGTTCCTT	0.448																																					p.G149R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G445C	1						.						201.0	163.0	176.0					1																	60377912		2203	4300	6503	60150500	SO:0001583	missense	1573	exon3			BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.445G>C	1.37:g.60377912C>G	ENSP00000360247:p.Gly149Arg	Somatic		Capture	SOLID	Phase_I	60150500	NM_000775	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923301	0.92319	.	.	ENSG00000134716	ENST00000371204	T	0.81078	-1.45	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.93442	0.7908	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94873	0.8032	10	0.87932	D	0	.	18.9481	0.92630	0.0:1.0:0.0:0.0	.	149	P51589	CP2J2_HUMAN	R	149	ENSP00000360247:G149R	ENSP00000360247:G149R	G	-	1	0	CYP2J2	60150500	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.082000	0.76851	2.772000	0.95346	0.655000	0.94253	GGT		0.448	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775	
LRRIQ3	127255	hgsc.bcm.edu	37	1	74649190	74649190	+	Missense_Mutation	SNP	T	T	A	rs147213330		TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr1:74649190T>A	ENST00000395089.1	-	1	178	c.179A>T	c.(178-180)aAt>aTt	p.N60I	LRRIQ3_ENST00000370909.2_Missense_Mutation_p.N60I|LRRIQ3_ENST00000354431.4_Missense_Mutation_p.N60I|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.N60I			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	60								p.N60I(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TGTAATAAaattgtttgagaa	0.308																																					p.N60I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A179T	1						.						51.0	54.0	53.0					1																	74649190		2200	4298	6498	74421778	SO:0001583	missense	127255	exon2			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.179A>T	1.37:g.74649190T>A	ENSP00000378524:p.Asn60Ile	Somatic		Capture	SOLID	Phase_I	74421778	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	CCDS41350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.23|19.23	3.787351|3.787351	0.70337|0.70337	.|.	.|.	ENSG00000162620|ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000370909;ENST00000388972;ENST00000370911|ENST00000444984	T;T;T;T|.	0.49432|.	1.24;1.24;0.78;1.24|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.000000|.	0.64402|.	D|.	0.000006|.	T|T	0.41949|0.41949	0.1181|0.1181	L|L	0.32530|0.32530	0.975|0.975	0.36616|0.36616	D|D	0.875462|0.875462	D|.	0.89917|.	1.0|.	D|.	0.81914|.	0.995|.	T|T	0.40924|0.40924	-0.9537|-0.9537	10|5	0.87932|.	D|.	0|.	.|.	14.0821|14.0821	0.64932|0.64932	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	60|.	A6PVS8|.	LRIQ3_HUMAN|.	I|H	60|2	ENSP00000378524:N60I;ENSP00000346414:N60I;ENSP00000359946:N60I;ENSP00000359948:N60I|.	ENSP00000346414:N60I|.	N|Q	-|-	2|3	0|2	LRRIQ3|LRRIQ3	74421778|74421778	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	5.224000|5.224000	0.65288|0.65288	2.015000|2.015000	0.59207|0.59207	0.533000|0.533000	0.62120|0.62120	AAT|CAA		0.308	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
GNPAT	8443	hgsc.bcm.edu	37	1	231374703	231374703	+	5'Flank	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr1:231374703G>A	ENST00000366647.4	+	0	0				GNPAT_ENST00000366646.3_5'Flank|C1orf131_ENST00000366651.3_Missense_Mutation_p.P117L|C1orf131_ENST00000471936.1_5'UTR|C1orf131_ENST00000366649.2_Missense_Mutation_p.P117L|C1orf131_ENST00000318906.2_Missense_Mutation_p.P117L	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase						cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.P117L(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				GGAAGAGGGAGGAACTGCAGC	0.458																																					p.P117L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C350T	1						.						76.0	78.0	77.0					1																	231374703		2203	4300	6503	229441326	SO:0001631	upstream_gene_variant	128061	exon2			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024		1.37:g.231374703G>A	Exception_encountered	Somatic		Capture	SOLID	Phase_I	229441326	NM_152379	B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	ENST00000366647.4	37	CCDS1592.1	.	.	.	.	.	.	.	.	.	.	G	7.285	0.609862	0.14066	.	.	ENSG00000143633	ENST00000366649;ENST00000318906;ENST00000366651;ENST00000366648;ENST00000451322	T;T;T;T	0.13307	2.6;2.6;2.6;2.6	5.54	1.63	0.23807	.	1.323450	0.04556	N	0.390799	T	0.09905	0.0243	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.26708	0.157;0.001;0.018;0.011;0.011	B;B;B;B;B	0.24155	0.051;0.002;0.006;0.014;0.014	T	0.38178	-0.9673	10	0.23891	T	0.37	-12.8261	6.5836	0.22609	0.1466:0.0:0.5981:0.2553	.	117;117;117;117;117	B4E0F7;Q8NDD1-4;Q8NDD1;Q8NDD1-3;Q8NDD1-2	.;.;CA131_HUMAN;.;.	L	117;117;117;107;100	ENSP00000355609:P117L;ENSP00000321341:P117L;ENSP00000355611:P117L;ENSP00000401677:P100L	ENSP00000321341:P117L	P	-	2	0	C1orf131	229441326	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	1.214000	0.32419	-0.041000	0.13558	-2.726000	0.00130	CCT		0.458	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1		
CARS	833	hgsc.bcm.edu	37	11	3038502	3038504	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	ATT	ATT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr11:3038502_3038504delATT	ENST00000397111.5	-	15	1745_1747	c.1500_1502delAAT	c.(1498-1503)gcaatt>gct	p.I501del	CARS_ENST00000397114.3_In_Frame_Del_p.I491del|CARS_ENST00000278224.9_In_Frame_Del_p.I501del|CARS_ENST00000401769.3_In_Frame_Del_p.I514del|CARS_ENST00000380525.4_In_Frame_Del_p.I584del			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	501					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.A500A(1)|p.I501delI(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	GGCTTTGTGAATTGCTGTCTTCT	0.507			T	ALK	ALCL																																p.583_584del	Ovarian(61;932 1157 5961 20446 52152)		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	.	.	2	Substitution - coding silent(1)|Deletion - In frame(1)	large_intestine(1)|ovary(1)	c.1749_1751del	11						.																																			2995080	SO:0001651	inframe_deletion	833	exon16			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1500_1502delAAT	11.37:g.3038502_3038504delATT	ENSP00000380300:p.Ile501del	Somatic		Capture	SOLID	Phase_I	2995078	NM_001014437	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	In_Frame_Del	DEL	ENST00000397111.5	37	CCDS7742.1																																																																																				0.507	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751	
SNX19	399979	hgsc.bcm.edu	37	11	130749591	130749591	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr11:130749591A>T	ENST00000265909.4	-	10	3343	c.2774T>A	c.(2773-2775)aTt>aAt	p.I925N	SNX19_ENST00000539184.1_Missense_Mutation_p.I368N|SNX19_ENST00000534726.1_Missense_Mutation_p.I165N|SNX19_ENST00000426933.2_Missense_Mutation_p.I93N|SNX19_ENST00000533318.1_5'UTR|SNX19_ENST00000530356.1_Missense_Mutation_p.I305N|SNX19_ENST00000528555.1_Missense_Mutation_p.I305N|SNX19_ENST00000545537.1_Missense_Mutation_p.I165N	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	925					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.I925N(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		CACCCCAAGAATTTCTACTAC	0.458																																					p.I925N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2774A	11						.						84.0	80.0	81.0					11																	130749591		2201	4297	6498	130254801	SO:0001583	missense	399979	exon10			D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.2774T>A	11.37:g.130749591A>T	ENSP00000265909:p.Ile925Asn	Somatic		Capture	SOLID	Phase_I	130254801	NM_014758	E9PKB9|Q8IV55	Missense_Mutation	SNP	ENST00000265909.4	37	CCDS31721.1	.	.	.	.	.	.	.	.	.	.	A	17.11	3.306451	0.60305	.	.	ENSG00000120451	ENST00000265909;ENST00000534726;ENST00000545537;ENST00000426933;ENST00000528555;ENST00000530356;ENST00000539184	T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4	6.06	6.06	0.98353	Sorting nexin, C-terminal (1);	0.453272	0.24930	N	0.034479	T	0.60196	0.2250	M	0.69823	2.125	0.51012	D	0.999908	D;D	0.71674	0.975;0.998	P;D	0.68353	0.814;0.957	T	0.62676	-0.6804	10	0.72032	D	0.01	-11.3321	16.6127	0.84892	1.0:0.0:0.0:0.0	.	368;925	F5H5D1;Q92543	.;SNX19_HUMAN	N	925;165;165;93;305;305;368	ENSP00000265909:I925N;ENSP00000433699:I165N;ENSP00000437982:I165N;ENSP00000413345:I93N;ENSP00000435122:I305N;ENSP00000432307:I305N;ENSP00000443480:I368N	ENSP00000265909:I925N	I	-	2	0	SNX19	130254801	1.000000	0.71417	0.974000	0.42286	0.189000	0.23516	7.439000	0.80444	2.322000	0.78497	0.528000	0.53228	ATT		0.458	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758	
TCP11	6954	hgsc.bcm.edu	37	6	35090080	35090080	+	Missense_Mutation	SNP	C	C	T	rs150752841		TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr6:35090080C>T	ENST00000512012.1	-	4	548	c.392G>A	c.(391-393)cGc>cAc	p.R131H	TCP11_ENST00000373974.4_Missense_Mutation_p.R98H|TCP11_ENST00000311875.5_Missense_Mutation_p.R144H|TCP11_ENST00000444780.2_Missense_Mutation_p.R139H|TCP11_ENST00000244645.3_Missense_Mutation_p.R69H|TCP11_ENST00000412155.2_Missense_Mutation_p.R93H|TCP11_ENST00000418521.2_Missense_Mutation_p.R68H|TCP11_ENST00000373979.2_Missense_Mutation_p.R69H			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	131					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R69H(1)		breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						AATTCTCAGGCGGTTCTGGCG	0.468																																					p.R144H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G431A	6						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	92.0	88.0	89.0		431,206	4.3	1.0	6	dbSNP_134	89	0,8600		0,0,4300	no	missense,missense	TCP11	NM_001093728.1,NM_018679.4	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	144/517,69/442	35090080	1,13005	2203	4300	6503	35198058	SO:0001583	missense	6954	exon5				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.392G>A	6.37:g.35090080C>T	ENSP00000425995:p.Arg131His	Somatic		Capture	SOLID	Phase_I	35198058	NM_001093728	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	ENST00000512012.1	37		.	.	.	.	.	.	.	.	.	.	C	24.3	4.514523	0.85389	2.27E-4	0.0	ENSG00000124678	ENST00000373979;ENST00000412155;ENST00000244645;ENST00000373977;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012;ENST00000492680;ENST00000507706;ENST00000505400	T;T;T;T;T;T;T;T;T;T;T	0.60548	2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;0.18	4.33	4.33	0.51752	.	0.064498	0.64402	D	0.000014	T	0.73497	0.3594	M	0.90483	3.12	0.52099	D	0.999949	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.73380	0.965;0.965;0.965;0.98;0.965;0.954	T	0.77539	-0.2550	10	0.54805	T	0.06	.	11.9408	0.52899	0.0:0.9128:0.0:0.0872	.	98;93;139;204;131;69	B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.;.;.;.;TCP11_HUMAN;.	H	69;93;69;93;144;139;98;68;131;69;68;68	ENSP00000363091:R69H;ENSP00000402816:R93H;ENSP00000244645:R69H;ENSP00000308708:R144H;ENSP00000404479:R139H;ENSP00000363085:R98H;ENSP00000415320:R68H;ENSP00000425995:R131H;ENSP00000422774:R69H;ENSP00000423183:R68H;ENSP00000421333:R68H	ENSP00000244645:R69H	R	-	2	0	TCP11	35198058	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.423000	0.59861	2.409000	0.81822	0.563000	0.77884	CGC		0.468	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728	
AOC2	314	hgsc.bcm.edu	37	17	40997489	40997489	+	Silent	SNP	G	G	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr17:40997489G>C	ENST00000253799.3	+	1	873	c.846G>C	c.(844-846)gtG>gtC	p.V282V	AOC2_ENST00000452774.2_Silent_p.V282V	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	282					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.V282V(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GGTTGGAAGTGGTTAGAGTCC	0.572																																					p.V282V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G846C	17						.						86.0	86.0	86.0					17																	40997489		2203	4300	6503	38251015	SO:0001819	synonymous_variant	314	exon1			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.846G>C	17.37:g.40997489G>C		Somatic		Capture	SOLID	Phase_I	38251015	NM_001158	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Silent	SNP	ENST00000253799.3	37	CCDS11443.1																																																																																				0.572	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
DNAH3	55567	hgsc.bcm.edu	37	16	21136679	21136679	+	Silent	SNP	G	G	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr16:21136679G>C	ENST00000261383.3	-	9	1220	c.1221C>G	c.(1219-1221)acC>acG	p.T407T	CTC-508F8.1_ENST00000575612.1_RNA|DNAH3_ENST00000415178.1_Silent_p.T407T	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	407	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.T407T(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCTGGGCGCAGGTGGGGATCC	0.522																																					p.T407T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1221G	16						.						63.0	66.0	65.0					16																	21136679		2201	4300	6501	21044180	SO:0001819	synonymous_variant	55567	exon9			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1221C>G	16.37:g.21136679G>C		Somatic		Capture	SOLID	Phase_I	21044180	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	CCDS10594.1																																																																																				0.522	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
MORC1	27136	hgsc.bcm.edu	37	3	108677818	108677818	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr3:108677818T>G	ENST00000483760.1	-	27	2929	c.2886A>C	c.(2884-2886)gaA>gaC	p.E962D	MORC1_ENST00000232603.5_Missense_Mutation_p.E983D					MORC family CW-type zinc finger 1									p.E983D(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TGACTTAATTTTCCGaagtct	0.264																																					p.E983D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2949C	3						.						30.0	30.0	30.0					3																	108677818		2198	4293	6491	110160508	SO:0001583	missense	27136	exon28			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2886A>C	3.37:g.108677818T>G	ENSP00000417282:p.Glu962Asp	Somatic		Capture	SOLID	Phase_I	110160508	NM_014429		Missense_Mutation	SNP	ENST00000483760.1	37		.	.	.	.	.	.	.	.	.	.	T	10.58	1.389176	0.25118	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.05996	3.37;3.36	4.57	0.491	0.16867	.	.	.	.	.	T	0.03305	0.0096	N	0.08118	0	0.09310	N	1	B;B	0.22276	0.067;0.067	B;B	0.19391	0.025;0.025	T	0.41928	-0.9481	9	0.87932	D	0	3.8034	5.3587	0.16075	0.1733:0.0:0.3596:0.4671	.	962;983	E7ERX1;Q86VD1	.;MORC1_HUMAN	D	983;962	ENSP00000232603:E983D;ENSP00000417282:E962D	ENSP00000232603:E983D	E	-	3	2	MORC1	110160508	0.002000	0.14202	0.002000	0.10522	0.007000	0.05969	-0.257000	0.08745	0.349000	0.23975	0.528000	0.53228	GAA		0.264	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
WWTR1	25937	hgsc.bcm.edu	37	3	149290773	149290773	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr3:149290773A>T	ENST00000465804.1	-	4	702	c.446T>A	c.(445-447)aTc>aAc	p.I149N	WWTR1_ENST00000467467.1_Missense_Mutation_p.I149N|WWTR1_ENST00000360632.3_Missense_Mutation_p.I149N	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	149	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.I149N(1)		breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CCATGTGGTGATTTTTTCTAT	0.408			T	CAMTA1	epitheliod hemangioendothelioma																																p.I149N			Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T446A	3						.						132.0	124.0	126.0					3																	149290773		2203	4300	6503	150773463	SO:0001583	missense	25937	exon3			AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.446T>A	3.37:g.149290773A>T	ENSP00000419465:p.Ile149Asn	Somatic		Capture	SOLID	Phase_I	150773463	NM_015472	D3DNH7|Q8N3P2|Q9Y3W6	Missense_Mutation	SNP	ENST00000465804.1	37	CCDS3144.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.054040	0.75960	.	.	ENSG00000018408	ENST00000465804;ENST00000360632;ENST00000467467;ENST00000472417;ENST00000479238	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	5.55	5.55	0.83447	WW/Rsp5/WWP (6);	0.053250	0.85682	D	0.000000	D	0.88969	0.6582	L	0.54323	1.7	0.58432	D	0.999998	D	0.62365	0.991	D	0.75484	0.986	D	0.89920	0.4058	10	0.72032	D	0.01	-24.9644	15.3689	0.74548	1.0:0.0:0.0:0.0	.	149	Q9GZV5	WWTR1_HUMAN	N	149;149;149;7;149	ENSP00000419465:I149N;ENSP00000353847:I149N;ENSP00000419234:I149N;ENSP00000418580:I149N	ENSP00000353847:I149N	I	-	2	0	WWTR1	150773463	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.546000	0.73887	2.117000	0.64856	0.533000	0.62120	ATC		0.408	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356498.1	NM_015472	
FBXL2	25827	hgsc.bcm.edu	37	3	33400460	33400460	+	Splice_Site	SNP	A	A	G			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr3:33400460A>G	ENST00000484457.1	+	3	158	c.67A>G	c.(67-69)Ata>Gta	p.I23V	FBXL2_ENST00000538892.1_Splice_Site_p.I23V|FBXL2_ENST00000538181.1_Intron|FBXL2_ENST00000507198.1_Splice_Site_p.I23V|FBXL2_ENST00000542085.1_5'UTR|FBXL2_ENST00000283627.6_Intron|FBXL2_ENST00000446237.3_5'UTR	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2									p.I23V(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						TCTCTGTAGAATATTTTCCTT	0.318																																					p.I23V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A67G	3						.						37.0	38.0	38.0					3																	33400460		2199	4295	6494	33375464	SO:0001630	splice_region_variant	25827	exon3			AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.66-1A>G	3.37:g.33400460A>G		Somatic		Capture	SOLID	Phase_I	33375464	NM_001171713		Missense_Mutation	SNP	ENST00000484457.1	37	CCDS2658.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.082067	0.36758	.	.	ENSG00000153558	ENST00000484457;ENST00000538892;ENST00000507198	T;T;T	0.74632	-0.86;-0.86;-0.86	5.36	4.18	0.49190	F-box domain, cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.68723	0.3032	L	0.35487	1.065	0.80722	D	1	P	0.35807	0.522	P	0.44359	0.447	T	0.65134	-0.6242	10	0.33940	T	0.23	.	10.6324	0.45545	0.8565:0.0:0.0:0.1435	.	23	Q9UKC9	FBXL2_HUMAN	V	23	ENSP00000417601:I23V;ENSP00000441228:I23V;ENSP00000426163:I23V	ENSP00000408895:I23V	I	+	1	0	FBXL2	33375464	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.978000	0.70501	1.095000	0.41419	0.482000	0.46254	ATA		0.318	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253245.2	NM_012157	Missense_Mutation
TCTA	6988	hgsc.bcm.edu	37	3	49452268	49452268	+	Silent	SNP	C	C	T	rs146887788	byFrequency	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr3:49452268C>T	ENST00000273590.3	+	3	506	c.285C>T	c.(283-285)aaC>aaT	p.N95N	RHOA_ENST00000454011.2_5'Flank|RHOA_ENST00000422781.1_5'Flank|RHOA_ENST00000418115.1_5'Flank|RHOA_ENST00000265538.3_5'Flank|AMT_ENST00000476226.1_5'Flank|TCTA_ENST00000493381.1_3'UTR	NM_022171.2	NP_071503.1	P57738	TCTA_HUMAN	T-cell leukemia translocation altered	95						integral component of membrane (GO:0016021)		p.N95N(1)		large_intestine(4)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGGCAGCAAACGAACCTCTCA	0.512																																					p.N95N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C285T	3						.						109.0	95.0	99.0					3																	49452268		2203	4300	6503	49427272	SO:0001819	synonymous_variant	6988	exon3				CCDS2796.1	3p21	2012-02-27	2012-02-27		ENSG00000145022	ENSG00000145022			11692	protein-coding gene	gene with protein product		600690	"""T-cell leukemia translocation altered gene"""			7728759	Standard	NM_022171		Approved		uc003cwv.4	P57738	OTTHUMG00000156846	ENST00000273590.3:c.285C>T	3.37:g.49452268C>T		Somatic		Capture	SOLID	Phase_I	49427272	NM_022171	B2R4I4|Q6I9U4|Q9BSB0	Silent	SNP	ENST00000273590.3	37	CCDS2796.1																																																																																				0.512	TCTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346210.1	NM_022171	
TRIM59	286827	hgsc.bcm.edu	37	3	160156827	160156827	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr3:160156827G>A	ENST00000309784.4	-	3	330	c.145C>T	c.(145-147)Cct>Tct	p.P49S	RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.P49S|TRIM59_ENST00000543469.1_Missense_Mutation_p.P49S	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	49					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P49S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATTCGTAAAGGTCTCCATATA	0.363																																					p.P49S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C145T	3						.						85.0	87.0	86.0					3																	160156827		2203	4300	6503	161639521	SO:0001583	missense	286827	exon3			AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.145C>T	3.37:g.160156827G>A	ENSP00000311219:p.Pro49Ser	Somatic		Capture	SOLID	Phase_I	161639521	NM_173084	A8K5G9|D3DNL9	Missense_Mutation	SNP	ENST00000309784.4	37	CCDS3190.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062218	0.76187	.	.	ENSG00000213186	ENST00000543469;ENST00000309784;ENST00000479460;ENST00000471396;ENST00000496222;ENST00000471155;ENST00000494486;ENST00000468542	T;T;T;T;T;T;T;T	0.33216	1.98;1.77;2.1;2.12;2.08;1.42;1.42;1.95	6.17	4.31	0.51392	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.053259	0.85682	D	0.000000	T	0.26011	0.0634	N	0.02985	-0.445	0.45806	D	0.99868	D	0.65815	0.995	P	0.62491	0.903	T	0.14727	-1.0462	9	.	.	.	-3.6326	14.3087	0.66400	0.0:0.1134:0.7695:0.1171	.	49	Q8IWR1	TRI59_HUMAN	S	49;49;49;49;77;49;49;56	ENSP00000444313:P49S;ENSP00000311219:P49S;ENSP00000417081:P49S;ENSP00000420520:P49S;ENSP00000418856:P77S;ENSP00000418699:P49S;ENSP00000417605:P49S;ENSP00000420451:P56S	.	P	-	1	0	TRIM59	161639521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.682000	0.61671	2.941000	0.99782	0.655000	0.94253	CCT		0.363	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352963.1	NM_173084	
KLRB1	3820	hgsc.bcm.edu	37	12	9750665	9750665	+	Silent	SNP	G	G	A	rs34291189	byFrequency	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr12:9750665G>A	ENST00000229402.3	-	5	553	c.507C>T	c.(505-507)aaC>aaT	p.N169N		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	169	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.N169N(1)		endometrium(2)|large_intestine(6)|lung(4)	12						AAAAAGAGCCGTTTATCCACT	0.308													G|||	2	0.000399361	0.0	0.0	5008	,	,		-128	0.0		0.002	False		,,,				2504	0.0				p.N169N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C507T	12						.	G		4,4400	6.2+/-15.9	0,4,2198	48.0	46.0	47.0		507	0.7	0.8	12	dbSNP_126	47	5,8581	4.3+/-15.6	0,5,4288	no	coding-synonymous	KLRB1	NM_002258.2		0,9,6486	AA,AG,GG		0.0582,0.0908,0.0693		169/226	9750665	9,12981	2202	4293	6495	9641932	SO:0001819	synonymous_variant	3820	exon5			U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.507C>T	12.37:g.9750665G>A		Somatic		Capture	SOLID	Phase_I	9641932	NM_002258	Q24K24	Silent	SNP	ENST00000229402.3	37	CCDS8601.1																																																																																				0.308	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400280.1	NM_002258	
IQCD	115811	hgsc.bcm.edu	37	12	113633516	113633516	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr12:113633516G>A	ENST00000416617.2	-	5	1404	c.1214C>T	c.(1213-1215)aCg>aTg	p.T405M	IQCD_ENST00000299732.2_Missense_Mutation_p.T303M			Q96DY2	IQCD_HUMAN	IQ motif containing D	405	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.							p.T303M(1)		endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CTGGATGAGCGTGGCCGCCCG	0.592																																					p.T303M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C908T	12						.						163.0	143.0	150.0					12																	113633516		2203	4300	6503	112117899	SO:0001583	missense	115811	exon3			BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.1214C>T	12.37:g.113633516G>A	ENSP00000400669:p.Thr405Met	Somatic		Capture	SOLID	Phase_I	112117899	NM_138451	Q6ZSU0	Missense_Mutation	SNP	ENST00000416617.2	37		.	.	.	.	.	.	.	.	.	.	G	11.98	1.800676	0.31869	.	.	ENSG00000166578	ENST00000299732;ENST00000416617	T;T	0.28255	1.62;1.62	4.28	4.28	0.50868	.	.	.	.	.	T	0.56731	0.2005	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.62886	-0.6759	8	0.62326	D	0.03	-12.2469	15.6415	0.77006	0.0:0.0:1.0:0.0	.	303	Q96DY2-2	.	M	303;405	ENSP00000299732:T303M;ENSP00000400669:T405M	ENSP00000299732:T303M	T	-	2	0	IQCD	112117899	0.997000	0.39634	0.898000	0.35279	0.007000	0.05969	2.638000	0.46562	2.216000	0.71823	0.561000	0.74099	ACG		0.592	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405327.1	NM_138451	
UBR1	197131	hgsc.bcm.edu	37	15	43270128	43270128	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr15:43270128T>C	ENST00000290650.4	-	38	4246	c.4168A>G	c.(4168-4170)Aaa>Gaa	p.K1390E	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1390					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K1390E(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TCTTCTGATTTTATGTTAGGA	0.303																																					p.K1390E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4168G	15						.						116.0	108.0	110.0					15																	43270128		2203	4296	6499	41057420	SO:0001583	missense	197131	exon38				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.4168A>G	15.37:g.43270128T>C	ENSP00000290650:p.Lys1390Glu	Somatic		Capture	SOLID	Phase_I	41057420	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	t	8.150	0.787197	0.16189	.	.	ENSG00000159459	ENST00000290650	T	0.57273	0.41	5.55	0.56	0.17279	.	0.529195	0.22701	N	0.056692	T	0.35278	0.0926	L	0.50333	1.59	0.80722	D	1	B	0.12630	0.006	B	0.11329	0.006	T	0.26121	-1.0112	10	0.05351	T	0.99	-33.6606	6.0281	0.19665	0.0:0.1414:0.2684:0.5903	.	1390	Q8IWV7	UBR1_HUMAN	E	1390	ENSP00000290650:K1390E	ENSP00000290650:K1390E	K	-	1	0	UBR1	41057420	0.999000	0.42202	0.994000	0.49952	0.969000	0.65631	1.790000	0.38734	0.057000	0.16193	0.398000	0.26397	AAA		0.303	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
LDB2	9079	hgsc.bcm.edu	37	4	16513609	16513609	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr4:16513609G>A	ENST00000304523.5	-	6	1057	c.734C>T	c.(733-735)cCg>cTg	p.P245L	LDB2_ENST00000503178.2_Missense_Mutation_p.P121L|LDB2_ENST00000515064.1_Missense_Mutation_p.P245L|LDB2_ENST00000502640.1_Missense_Mutation_p.P245L|LDB2_ENST00000441778.2_Missense_Mutation_p.P245L|RP11-446J8.1_ENST00000512370.1_RNA	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	245					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)	p.P245L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						TGTACCTGGCGGAGCCACCAT	0.463																																					p.P245L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C734T	4						.						104.0	99.0	100.0					4																	16513609		2203	4300	6503	16122707	SO:0001583	missense	9079	exon6			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.734C>T	4.37:g.16513609G>A	ENSP00000306772:p.Pro245Leu	Somatic		Capture	SOLID	Phase_I	16122707	NM_001130834	O60619|O75480	Missense_Mutation	SNP	ENST00000304523.5	37	CCDS3420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.275670|4.275670	0.80580|0.80580	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000503178|ENST00000507464	T;T;T;T;T|.	0.19938|.	2.11;2.11;2.11;2.11;2.11|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.000000|.	0.64402|.	D|.	0.000003|.	T|T	0.79317|0.79317	0.4425|0.4425	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	0.999;0.982;0.999;1.0;1.0;0.999;1.0|.	T|T	0.78986|0.78986	-0.1987|-0.1987	10|5	0.59425|.	D|.	0.04|.	-14.2613|-14.2613	19.1065|19.1065	0.93299|0.93299	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	121;211;245;245;245;245;221|.	B7Z2D3;B7Z6D0;E9PFI4;G5E9Y7;O43679-2;O43679;O43679-3|.	.;.;.;.;.;LDB2_HUMAN;.|.	L|C	245;245;245;245;121|167	ENSP00000422552:P245L;ENSP00000392089:P245L;ENSP00000306772:P245L;ENSP00000423963:P245L;ENSP00000440940:P121L|.	ENSP00000306772:P245L|.	P|R	-|-	2|1	0|0	LDB2|LDB2	16122707|16122707	1.000000|1.000000	0.71417|0.71417	0.822000|0.822000	0.32727|0.32727	0.247000|0.247000	0.25773|0.25773	9.869000|9.869000	0.99810|0.99810	2.775000|2.775000	0.95449|0.95449	0.650000|0.650000	0.86243|0.86243	CCG|CGC		0.463	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2		
TBC1D8B	54885	hgsc.bcm.edu	37	X	106064148	106064148	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chrX:106064148G>A	ENST00000357242.5	+	3	457	c.283G>A	c.(283-285)Gaa>Aaa	p.E95K	TBC1D8B_ENST00000481617.2_Missense_Mutation_p.E95K|TBC1D8B_ENST00000310452.2_Missense_Mutation_p.E95K|TBC1D8B_ENST00000276175.3_Missense_Mutation_p.E95K	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	95							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.E95K(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GGATTGGTTGGAACAAAATAT	0.313																																					p.E95K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G283A	X						.						66.0	62.0	63.0					X																	106064148		2202	4299	6501	105950804	SO:0001583	missense	54885	exon3			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.283G>A	X.37:g.106064148G>A	ENSP00000349781:p.Glu95Lys	Somatic		Capture	SOLID	Phase_I	105950804	NM_198881	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	ENST00000357242.5	37	CCDS14522.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.335255	0.60853	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000481617;ENST00000276175	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.14	5.14	0.70334	.	0.063273	0.64402	D	0.000005	T	0.32734	0.0839	M	0.69463	2.115	0.50039	D	0.999843	P;B;P	0.42456	0.78;0.444;0.78	B;B;B	0.41332	0.192;0.354;0.192	T	0.15263	-1.0443	10	0.49607	T	0.09	-18.9052	16.4042	0.83652	0.0:0.0:1.0:0.0	.	95;95;95	Q0IIM8;B9A6K6;D6RFZ2	TBC8B_HUMAN;.;.	K	95	ENSP00000349781:E95K;ENSP00000310675:E95K;ENSP00000421375:E95K;ENSP00000276175:E95K	ENSP00000276175:E95K	E	+	1	0	TBC1D8B	105950804	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.331000	0.79192	2.266000	0.75297	0.415000	0.27848	GAA		0.313	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	NM_017752	
PHKA2	5256	hgsc.bcm.edu	37	X	18924896	18924896	+	Silent	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chrX:18924896G>A	ENST00000379942.4	-	24	3299	c.2634C>T	c.(2632-2634)taC>taT	p.Y878Y		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	878					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.Y878Y(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					CACTGGCCTCGTAGATGAGTT	0.612																																					p.Y878Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2634T	X						.						156.0	138.0	145.0					X																	18924896		2203	4300	6503	18834817	SO:0001819	synonymous_variant	5256	exon24				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2634C>T	X.37:g.18924896G>A		Somatic		Capture	SOLID	Phase_I	18834817	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	ENST00000379942.4	37	CCDS14190.1																																																																																				0.612	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
CXorf58	254158	hgsc.bcm.edu	37	X	23934411	23934411	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chrX:23934411T>C	ENST00000379211.3	+	5	938	c.389T>C	c.(388-390)tTt>tCt	p.F130S		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	130								p.F130S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						TACAAGTATTTTAGTGGAAAA	0.299																																					p.F130S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T389C	X						.						110.0	97.0	101.0					X																	23934411		2202	4297	6499	23844332	SO:0001583	missense	254158	exon5			AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.389T>C	X.37:g.23934411T>C	ENSP00000368511:p.Phe130Ser	Somatic		Capture	SOLID	Phase_I	23844332	NM_152761		Missense_Mutation	SNP	ENST00000379211.3	37	CCDS14209.1	.	.	.	.	.	.	.	.	.	.	t	13.28	2.189846	0.38707	.	.	ENSG00000165182	ENST00000379211	T	0.28666	1.6	5.0	5.0	0.66597	.	0.281393	0.25091	N	0.033215	T	0.48732	0.1516	M	0.70275	2.135	0.24946	N	0.991825	D;D	0.71674	0.998;0.998	P;P	0.59703	0.862;0.862	T	0.46317	-0.9200	10	0.66056	D	0.02	-8.6861	11.3307	0.49475	0.0:0.0:0.0:1.0	.	130;130	B7ZLS7;Q96LI9	.;CX058_HUMAN	S	130	ENSP00000368511:F130S	ENSP00000368511:F130S	F	+	2	0	CXorf58	23844332	1.000000	0.71417	0.220000	0.23810	0.030000	0.12068	4.207000	0.58480	1.656000	0.50722	0.336000	0.21669	TTT		0.299	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	
MCF2	4168	hgsc.bcm.edu	37	X	138713585	138713585	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chrX:138713585T>A	ENST00000370576.4	-	3	466	c.257A>T	c.(256-258)tAc>tTc	p.Y86F	MCF2_ENST00000520602.1_Missense_Mutation_p.Y146F|MCF2_ENST00000414978.1_Missense_Mutation_p.Y146F|MCF2_ENST00000519895.1_Missense_Mutation_p.Y146F|MCF2_ENST00000370573.4_Missense_Mutation_p.Y86F|MCF2_ENST00000370578.4_Missense_Mutation_p.Y231F|MCF2_ENST00000338585.6_Missense_Mutation_p.Y86F|MCF2_ENST00000536274.1_Intron	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	86	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y146F(1)|p.Y86F(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					ACTGTGGCAGTACTGCAAGGT	0.393																																					p.Y146F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A437T	X						.						195.0	162.0	173.0					X																	138713585		2203	4300	6503	138541251	SO:0001583	missense	4168	exon6				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.257A>T	X.37:g.138713585T>A	ENSP00000359608:p.Tyr86Phe	Somatic		Capture	SOLID	Phase_I	138541251	NM_001099855	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.799796	0.90538	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	5.91	5.91	0.95273	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.81682	2.555	0.42278	D	0.992082	D;P;D;D;P;D	0.64830	0.994;0.922;0.968;0.985;0.839;0.994	D;P;P;D;P;D	0.71870	0.975;0.677;0.903;0.914;0.548;0.975	D	0.84292	0.0500	10	0.62326	D	0.03	.	13.9959	0.64402	0.0:0.0:0.0:1.0	.	146;231;86;231;86;86	E9PH77;B7Z3Z2;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;MCF2_HUMAN	F	146;86;231;146;146;86;86	ENSP00000427745:Y146F;ENSP00000359608:Y86F;ENSP00000359610:Y231F;ENSP00000397055:Y146F;ENSP00000430276:Y146F;ENSP00000359605:Y86F;ENSP00000342204:Y86F	ENSP00000342204:Y86F	Y	-	2	0	MCF2	138541251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.391000	0.79828	1.986000	0.57962	0.481000	0.45027	TAC		0.393	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369	
TMEM163	81615	hgsc.bcm.edu	37	2	135308174	135308174	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr2:135308174G>A	ENST00000281924.6	-	4	489	c.425C>T	c.(424-426)gCg>gTg	p.A142V		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	142						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)	p.A142V(1)		endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		CACAGCGGCCGCGTTGCTGTA	0.532																																					p.A142V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C425T	2						.						115.0	111.0	112.0					2																	135308174		2203	4300	6503	135024644	SO:0001583	missense	81615	exon4				CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.425C>T	2.37:g.135308174G>A	ENSP00000281924:p.Ala142Val	Somatic		Capture	SOLID	Phase_I	135024644	NM_030923	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Missense_Mutation	SNP	ENST00000281924.6	37	CCDS2172.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919414	0.73098	.	.	ENSG00000152128	ENST00000281924;ENST00000537539	T	0.67345	-0.26	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.79936	0.4532	L	0.56769	1.78	0.58432	D	0.999996	D	0.89917	1.0	D	0.80764	0.994	T	0.80079	-0.1532	10	0.56958	D	0.05	.	18.3542	0.90351	0.0:0.0:1.0:0.0	.	142	Q8TC26	TM163_HUMAN	V	142;81	ENSP00000281924:A142V	ENSP00000281924:A142V	A	-	2	0	TMEM163	135024644	1.000000	0.71417	0.200000	0.23457	0.186000	0.23388	8.983000	0.93477	2.640000	0.89533	0.563000	0.77884	GCG		0.532	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923	
ARMC9	80210	hgsc.bcm.edu	37	2	232100064	232100064	+	Silent	SNP	T	T	C			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr2:232100064T>C	ENST00000349938.4	+	8	944	c.750T>C	c.(748-750)gaT>gaC	p.D250D	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	250						extracellular vesicular exosome (GO:0070062)		p.D250D(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		AGCTGGTGGATTCTCTAGAGG	0.468																																					p.D250D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T750C	2						.						98.0	96.0	96.0					2																	232100064		2203	4300	6503	231808308	SO:0001819	synonymous_variant	80210	exon8			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.750T>C	2.37:g.232100064T>C		Somatic		Capture	SOLID	Phase_I	231808308	NM_025139	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Silent	SNP	ENST00000349938.4	37	CCDS2484.1																																																																																				0.468	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	
CCDC70	83446	hgsc.bcm.edu	37	13	52439682	52439682	+	Missense_Mutation	SNP	A	A	C	rs199744746		TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr13:52439682A>C	ENST00000242819.4	+	2	464	c.168A>C	c.(166-168)aaA>aaC	p.K56N		NM_031290.2	NP_112580.2	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70	56						extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.K56N(1)		breast(1)|large_intestine(4)|lung(7)|skin(2)|urinary_tract(1)	15		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		AAGAGATGAAAATTTTTCGTG	0.502													A|||	1	0.000199681	0.0	0.0	5008	,	,		18488	0.001		0.0	False		,,,				2504	0.0				p.K56N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A168C	13						.						64.0	68.0	67.0					13																	52439682		2203	4300	6503	51337683	SO:0001583	missense	83446	exon2				CCDS9431.1	13q14.3	2006-02-07			ENSG00000123171	ENSG00000123171			25303	protein-coding gene	gene with protein product						11230166	Standard	NM_031290		Approved	DKFZP434K1172, FLJ25853	uc001vfu.4	Q6NSX1	OTTHUMG00000016950	ENST00000242819.4:c.168A>C	13.37:g.52439682A>C	ENSP00000242819:p.Lys56Asn	Somatic		Capture	SOLID	Phase_I	51337683	NM_031290	Q8N7A8|Q9H097	Missense_Mutation	SNP	ENST00000242819.4	37	CCDS9431.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	9.518	1.107594	0.20714	.	.	ENSG00000123171	ENST00000242819	T	0.19806	2.12	5.55	0.646	0.17789	.	0.378181	0.25352	N	0.031291	T	0.24774	0.0601	M	0.63428	1.95	0.09310	N	1	P	0.42203	0.773	P	0.45829	0.494	T	0.08432	-1.0722	10	0.56958	D	0.05	-18.9866	8.4093	0.32634	0.6869:0.0:0.3131:0.0	.	56	Q6NSX1	CCD70_HUMAN	N	56	ENSP00000242819:K56N	ENSP00000242819:K56N	K	+	3	2	CCDC70	51337683	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.118000	0.15605	0.410000	0.25675	0.460000	0.39030	AAA		0.502	CCDC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045033.2	NM_031290	
ITIH2	3698	hgsc.bcm.edu	37	10	7773926	7773926	+	Silent	SNP	G	G	A			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr10:7773926G>A	ENST00000358415.4	+	13	1780	c.1614G>A	c.(1612-1614)ttG>ttA	p.L538L	ITIH2_ENST00000379587.4_Silent_p.L527L	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	538					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L538L(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						CTGCTAAATTGGATCAAATAG	0.433																																					p.L538L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1614A	10						.						144.0	136.0	139.0					10																	7773926		2203	4300	6503	7813932	SO:0001819	synonymous_variant	3698	exon13			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.1614G>A	10.37:g.7773926G>A		Somatic		Capture	SOLID	Phase_I	7813932	NM_002216	Q14659|Q15484|Q5T986	Silent	SNP	ENST00000358415.4	37	CCDS31141.1																																																																																				0.433	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
AMACR	23600	hgsc.bcm.edu	37	5	33998823	33998823	+	Missense_Mutation	SNP	G	G	A	rs573730345		TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr5:33998823G>A	ENST00000335606.6	-	4	750	c.662C>T	c.(661-663)aCg>aTg	p.T221M	AMACR_ENST00000382072.2_Silent_p.Y167Y|AMACR_ENST00000382085.3_Missense_Mutation_p.T221M|AMACR_ENST00000426255.2_Missense_Mutation_p.T221M|AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000512079.1_Missense_Mutation_p.T221M|AMACR_ENST00000382068.3_Silent_p.Y167Y|AMACR_ENST00000441713.2_Silent_p.Y167Y|RP11-1084J3.4_ENST00000382079.3_3'UTR|AMACR_ENST00000502637.1_Missense_Mutation_p.T206M	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	221					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)	p.T221M(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						CCTGTAAGTCGTATAGAAAGG	0.463													g|||	1	0.000199681	0.0	0.0	5008	,	,		17480	0.0		0.0	False		,,,				2504	0.001				p.T221M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C662T	5						.						147.0	131.0	136.0					5																	33998823		2203	4300	6503	34034580	SO:0001583	missense	23600	exon4			AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.662C>T	5.37:g.33998823G>A	ENSP00000334424:p.Thr221Met	Somatic		Capture	SOLID	Phase_I	34034580	NM_001167596	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	37	CCDS3902.1	.	.	.	.	.	.	.	.	.	.	g	15.29	2.788491	0.49997	.	.	ENSG00000242110	ENST00000335606;ENST00000382085;ENST00000502637	T;T;T	0.52295	0.67;0.67;0.67	5.34	3.37	0.38596	CoA-transferase family III domain (2);	0.316136	0.37437	N	0.002086	T	0.54111	0.1838	L	0.48642	1.525	0.80722	D	1	P;D;D;D	0.65815	0.848;0.994;0.995;0.995	B;P;P;P	0.59595	0.34;0.781;0.86;0.86	T	0.54016	-0.8356	10	0.72032	D	0.01	-7.929	9.4752	0.38867	0.0901:0.0:0.7259:0.1839	.	221;221;206;221	B3KMU8;F8W9N1;D6RB81;Q9UHK6	.;.;.;AMACR_HUMAN	M	221;221;206	ENSP00000334424:T221M;ENSP00000371517:T221M;ENSP00000424351:T206M	ENSP00000334424:T221M	T	-	2	0	AMACR	34034580	1.000000	0.71417	0.994000	0.49952	0.315000	0.28087	3.807000	0.55591	0.658000	0.30925	-0.925000	0.02716	ACG		0.463	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
APC	324	hgsc.bcm.edu	37	5	112174106	112174106	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3538-01A-01W-0831-10	TCGA-AA-3538-10A-01W-0831-10	g.chr5:112174106A>T	ENST00000457016.1	+	16	3195	c.2815A>T	c.(2815-2817)Aag>Tag	p.K939*	APC_ENST00000508376.2_Nonsense_Mutation_p.K939*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.K939*			P25054	APC_HUMAN	adenomatous polyposis coli	939	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)|p.K939*(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAATTTCACTAAGTCGGAAAA	0.363		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.K921X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.A2761T	5	GRCh37	CD086037	APC	D		.						68.0	69.0	69.0					5																	112174106		2202	4300	6502	112202005	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2815A>T	5.37:g.112174106A>T	ENSP00000413133:p.Lys939*	Somatic		Capture	SOLID	Phase_I	112202005	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	37	6.000042	0.97189	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.0183	16.0954	0.81117	1.0:0.0:0.0:0.0	.	.	.	.	X	939;921;939;939;939	.	ENSP00000257430:K939X	K	+	1	0	APC	112202005	1.000000	0.71417	0.996000	0.52242	0.662000	0.39071	5.467000	0.66737	2.203000	0.70933	0.455000	0.32223	AAG		0.363	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
