#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF804B	219578	hgsc.bcm.edu	37	7	88963600	88963600	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr7:88963600A>G	ENST00000333190.4	+	4	1913	c.1304A>G	c.(1303-1305)aAt>aGt	p.N435S		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	435							metal ion binding (GO:0046872)	p.N435S(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TGTACCCATAATGTGGCATCT	0.373										HNSCC(36;0.09)																											p.N435S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1304G	7						.						66.0	66.0	66.0					7																	88963600		2201	4297	6498	88801536	SO:0001583	missense	219578	exon4			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1304A>G	7.37:g.88963600A>G	ENSP00000329638:p.Asn435Ser	Somatic		Capture	SOLID	Phase_I	88801536	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	A	0.215	-1.033379	0.02029	.	.	ENSG00000182348	ENST00000333190	T	0.04706	3.57	5.24	4.08	0.47627	.	0.732058	0.12981	N	0.423240	T	0.02418	0.0074	N	0.03608	-0.345	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.42666	-0.9438	10	0.29301	T	0.29	-5.7988	8.5056	0.33186	0.8449:0.0:0.1551:0.0	.	435	A4D1E1	Z804B_HUMAN	S	435	ENSP00000329638:N435S	ENSP00000329638:N435S	N	+	2	0	ZNF804B	88801536	0.650000	0.27331	0.396000	0.26296	0.125000	0.20455	2.526000	0.45607	2.206000	0.71126	0.383000	0.25322	AAT		0.373	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
TRRAP	8295	hgsc.bcm.edu	37	7	98591220	98591220	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr7:98591220G>A	ENST00000359863.4	+	65	10074	c.9865G>A	c.(9865-9867)Ggg>Agg	p.G3289R	TRRAP_ENST00000446306.3_Missense_Mutation_p.G3278R|TRRAP_ENST00000355540.3_Missense_Mutation_p.G3260R	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3289					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.G3260R(1)|p.G3289R(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ATCAGATCCAGGGCCCATAAG	0.567																																					p.G3260R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9778A	7						.						131.0	104.0	113.0					7																	98591220		2203	4300	6503	98429156	SO:0001583	missense	8295	exon64			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.9865G>A	7.37:g.98591220G>A	ENSP00000352925:p.Gly3289Arg	Somatic		Capture	SOLID	Phase_I	98429156	NM_003496	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010916	0.75046	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.03065	4.06;4.06	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.12603	0.0306	M	0.61703	1.905	0.80722	D	1	D;D;D	0.63880	0.993;0.985;0.987	P;P;P	0.56865	0.808;0.782;0.648	T	0.15983	-1.0418	10	0.20046	T	0.44	.	19.5623	0.95376	0.0:0.0:1.0:0.0	.	3260;3017;3289	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	R	3289;3260;3277	ENSP00000352925:G3289R;ENSP00000347733:G3260R	ENSP00000347733:G3260R	G	+	1	0	TRRAP	98429156	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.762000	0.98944	2.689000	0.91719	0.650000	0.86243	GGG		0.567	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
NOM1	64434	hgsc.bcm.edu	37	7	156755710	156755710	+	Silent	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr7:156755710C>T	ENST00000275820.3	+	6	1767	c.1752C>T	c.(1750-1752)aaC>aaT	p.N584N		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	584						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.N584N(1)		endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AGGTCCGCAACGCCGGCTCAG	0.532																																					p.N584N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1752T	7						.						44.0	43.0	43.0					7																	156755710		2203	4300	6503	156448471	SO:0001819	synonymous_variant	64434	exon6			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.1752C>T	7.37:g.156755710C>T		Somatic		Capture	SOLID	Phase_I	156448471	NM_138400	Q96I08	Silent	SNP	ENST00000275820.3	37	CCDS34787.1																																																																																				0.532	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
ARID4A	5926	hgsc.bcm.edu	37	14	58772805	58772805	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr14:58772805G>T	ENST00000355431.3	+	5	622	c.249G>T	c.(247-249)ttG>ttT	p.L83F	ARID4A_ENST00000348476.3_Missense_Mutation_p.L83F|ARID4A_ENST00000395168.3_Missense_Mutation_p.L83F|ARID4A_ENST00000431317.2_Missense_Mutation_p.L83F	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	83					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L83F(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TCAGCAAGTTGACAGATGCTA	0.358																																					p.L83F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G249T	14						.						160.0	156.0	157.0					14																	58772805		2203	4300	6503	57842558	SO:0001583	missense	5926	exon5			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.249G>T	14.37:g.58772805G>T	ENSP00000347602:p.Leu83Phe	Somatic		Capture	SOLID	Phase_I	57842558	NM_023000	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	37	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277434	0.80580	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000445108;ENST00000431317	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.82	5.82	0.92795	Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.988;0.994	T	0.66077	-0.6013	10	0.87932	D	0	-7.4717	15.2562	0.73588	0.069:0.0:0.931:0.0	.	83;83;83	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	F	83;83;83;46;83	ENSP00000347602:L83F;ENSP00000344556:L83F;ENSP00000378597:L83F;ENSP00000392567:L46F;ENSP00000397368:L83F	ENSP00000344556:L83F	L	+	3	2	ARID4A	57842558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.540000	0.60664	2.765000	0.95021	0.591000	0.81541	TTG		0.358	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
PPM1F	9647	hgsc.bcm.edu	37	22	22294003	22294003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr22:22294003G>A	ENST00000263212.5	-	3	361	c.256C>T	c.(256-258)Cag>Tag	p.Q86*	LL22NC03-86G7.1_ENST00000458178.1_RNA|PPM1F_ENST00000486259.1_5'Flank|PPM1F_ENST00000538191.1_5'Flank|PPM1F_ENST00000407142.1_5'Flank|PPM1F_ENST00000397495.4_Nonsense_Mutation_p.Q86*|LL22NC03-86G7.1_ENST00000538634.1_RNA	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	86					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)	p.Q86*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		TGTAGCAGCTGTGAAACTGCT	0.602																																					p.Q86X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C256T	22						.						68.0	55.0	59.0					22																	22294003		2193	4285	6478	20624003	SO:0001587	stop_gained	9647	exon3			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.256C>T	22.37:g.22294003G>A	ENSP00000263212:p.Gln86*	Somatic		Capture	SOLID	Phase_I	20624003	NM_014634	A8K6G3|B7Z2C3|Q96PM2	Nonsense_Mutation	SNP	ENST00000263212.5	37	CCDS13796.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517515	0.44763	.	.	ENSG00000100034	ENST00000263212;ENST00000397495	.	.	.	4.1	3.07	0.35406	.	1.362740	0.04792	N	0.431885	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-16.7975	7.2229	0.25999	0.0:0.1891:0.6157:0.1953	.	.	.	.	X	86	.	ENSP00000263212:Q86X	Q	-	1	0	PPM1F	20624003	0.999000	0.42202	0.996000	0.52242	0.019000	0.09904	1.288000	0.33296	1.090000	0.41315	0.305000	0.20034	CAG		0.602	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320267.2	NM_014634	
LYPD4	147719	hgsc.bcm.edu	37	19	42342290	42342290	+	Missense_Mutation	SNP	G	G	A	rs34770649		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr19:42342290G>A	ENST00000330743.3	-	4	1468	c.257C>T	c.(256-258)tCg>tTg	p.S86L	AC020956.3_ENST00000593354.1_lincRNA|LYPD4_ENST00000343055.4_Missense_Mutation_p.S51L|LYPD4_ENST00000601246.1_Missense_Mutation_p.S51L	NM_173506.4	NP_775777.3	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4	86	Poly-Ser.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.S86L(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)	12						AGGGTAAGACGAAGACGAGCT	0.562																																					p.S86L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C257T	19						.						95.0	87.0	90.0					19																	42342290		2203	4300	6503	47034130	SO:0001583	missense	147719	exon4			AY358726	CCDS12587.1	19q13.2	2008-02-05				ENSG00000273111			28659	protein-coding gene	gene with protein product						12975309	Standard	XM_005278383		Approved	MGC42718	uc002orp.1	Q6UWN0		ENST00000330743.3:c.257C>T	19.37:g.42342290G>A	ENSP00000328737:p.Ser86Leu	Somatic		Capture	SOLID	Phase_I	47034130	NM_173506	Q8IYW0	Missense_Mutation	SNP	ENST00000330743.3	37	CCDS12587.1	.	.	.	.	.	.	.	.	.	.	g	1.715	-0.498118	0.04291	.	.	ENSG00000183103	ENST00000330743;ENST00000343055	T;T	0.11821	3.38;2.74	3.97	-1.04	0.10068	.	1.440710	0.04497	N	0.380589	T	0.12518	0.0304	L	0.44542	1.39	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36359	-0.9751	10	0.30078	T	0.28	4.3043	7.4468	0.27215	0.4092:0.0:0.5908:0.0	rs34770649	51;86	Q6UWN0-2;Q6UWN0	.;LYPD4_HUMAN	L	86;51	ENSP00000328737:S86L;ENSP00000339568:S51L	ENSP00000328737:S86L	S	-	2	0	LYPD4	47034130	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	0.790000	0.26900	-0.175000	0.10725	-0.427000	0.05922	TCG		0.562	LYPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463039.1	NM_173506	
CCDC114	93233	hgsc.bcm.edu	37	19	48806095	48806095	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr19:48806095G>A	ENST00000315396.7	-	10	1667	c.985C>T	c.(985-987)Cgt>Tgt	p.R329C		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	329			R -> H (in dbSNP:rs35361179).		outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)		p.R122C(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		TTGCTGGCACGTGCGCTCACC	0.617																																					p.R329C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C985T	19						.						86.0	79.0	81.0					19																	48806095		2203	4300	6503	53497907	SO:0001583	missense	93233	exon10			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.985C>T	19.37:g.48806095G>A	ENSP00000318429:p.Arg329Cys	Somatic		Capture	SOLID	Phase_I	53497907	NM_144577	Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	ENST00000315396.7	37	CCDS12714.2	.	.	.	.	.	.	.	.	.	.	G	14.41	2.525681	0.44969	.	.	ENSG00000105479	ENST00000315396	T	0.29917	1.55	3.6	2.45	0.29901	.	.	.	.	.	T	0.34424	0.0897	L	0.29908	0.895	0.09310	N	1	D;D;D	0.76494	0.998;0.999;0.999	P;P;P	0.58077	0.649;0.832;0.55	T	0.08106	-1.0738	9	0.72032	D	0.01	-7.3408	8.3863	0.32501	0.0:0.2426:0.7573:0.0	.	122;329;329	Q96M63-4;Q96M63;Q96M63-5	.;CC114_HUMAN;.	C	329	ENSP00000318429:R329C	ENSP00000318429:R329C	R	-	1	0	CCDC114	53497907	0.118000	0.22208	0.003000	0.11579	0.003000	0.03518	4.230000	0.58632	2.058000	0.61347	0.543000	0.68304	CGT		0.617	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343207.1	NM_144577	
DERL1	79139	hgsc.bcm.edu	37	8	124054246	124054246	+	Silent	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr8:124054246G>A	ENST00000259512.4	-	1	417	c.117C>T	c.(115-117)ctC>ctT	p.L39L	DERL1_ENST00000419562.2_Silent_p.L39L|RNY4P5_ENST00000362808.1_RNA|DERL1_ENST00000405944.3_Silent_p.L39L	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	39					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)	p.L39L(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GCCAGAGGAAGAGGTAGGCCG	0.652																																					p.L39L												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C117T	8						.						60.0	54.0	56.0					8																	124054246		2203	4300	6503	124123427	SO:0001819	synonymous_variant	79139	exon1			BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.117C>T	8.37:g.124054246G>A		Somatic		Capture	SOLID	Phase_I	124123427	NM_024295	B3KW41|E9PH19	Silent	SNP	ENST00000259512.4	37	CCDS6337.1																																																																																				0.652	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381714.2	NM_024295	
COL11A1	1301	hgsc.bcm.edu	37	1	103540276	103540276	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr1:103540276C>A	ENST00000370096.3	-	4	861	c.549G>T	c.(547-549)aaG>aaT	p.K183N	COL11A1_ENST00000358392.2_Missense_Mutation_p.K183N|COL11A1_ENST00000353414.4_Missense_Mutation_p.K183N|COL11A1_ENST00000512756.1_Missense_Mutation_p.K183N	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	183	Laminin G-like.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.K183N(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGGTTTTCTTCTTACAATCAA	0.368																																					p.K183N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G549T	1						.						161.0	141.0	148.0					1																	103540276		2203	4300	6503	103312864	SO:0001583	missense	1301	exon4			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.549G>T	1.37:g.103540276C>A	ENSP00000359114:p.Lys183Asn	Somatic		Capture	SOLID	Phase_I	103312864	NM_001854	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303488	0.40795	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239;ENST00000447608	T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.73	4.82	0.62117	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.101787	0.64402	D	0.000003	T	0.62282	0.2415	L	0.61036	1.89	0.49299	D	0.99977	B;B;B;B	0.15719	0.014;0.011;0.011;0.014	B;B;B;B	0.20184	0.028;0.016;0.016;0.028	T	0.63422	-0.6641	10	0.38643	T	0.18	.	11.1032	0.48188	0.0:0.7903:0.1377:0.0719	.	183;183;183;183	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	N	183;183;183;183;183;110	ENSP00000359114:K183N;ENSP00000351163:K183N;ENSP00000302551:K183N;ENSP00000426533:K183N;ENSP00000408640:K183N;ENSP00000410177:K110N	ENSP00000302551:K183N	K	-	3	2	COL11A1	103312864	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.989000	0.29629	1.417000	0.47077	0.650000	0.86243	AAG		0.368	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
CSF3R	1441	hgsc.bcm.edu	37	1	36935319	36935319	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr1:36935319C>T	ENST00000373106.1	-	11	1955	c.1408G>A	c.(1408-1410)Gcg>Acg	p.A470T	CSF3R_ENST00000440588.2_Missense_Mutation_p.A470T|CSF3R_ENST00000361632.4_Missense_Mutation_p.A470T|CSF3R_ENST00000418048.2_Missense_Mutation_p.A470T|CSF3R_ENST00000373104.1_Missense_Mutation_p.A470T|CSF3R_ENST00000373103.1_Missense_Mutation_p.A470T|CSF3R_ENST00000331941.5_Missense_Mutation_p.A470T|CSF3R_ENST00000487540.2_5'UTR|CSF3R_ENST00000338937.5_Missense_Mutation_p.A470T	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	470	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A470T(2)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CTATTGCTCGCGCTGGGGGGG	0.637																																					p.A470T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1408A	1						.						80.0	83.0	82.0					1																	36935319		2203	4300	6503	36707906	SO:0001583	missense	1441	exon11			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.1408G>A	1.37:g.36935319C>T	ENSP00000362198:p.Ala470Thr	Somatic		Capture	SOLID	Phase_I	36707906	NM_172313		Missense_Mutation	SNP	ENST00000373106.1	37	CCDS413.1	.	.	.	.	.	.	.	.	.	.	C	8.308	0.821558	0.16678	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.32	-1.16	0.09678	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.899643	0.09610	N	0.779093	T	0.13798	0.0334	N	0.00926	-1.1	0.09310	N	1	B;B;B;B;B;B	0.15930	0.0;0.015;0.0;0.0;0.0;0.011	B;B;B;B;B;B	0.09377	0.0;0.002;0.001;0.0;0.001;0.004	T	0.19484	-1.0304	10	0.21540	T	0.41	-2.4335	1.3842	0.02236	0.3162:0.1336:0.4091:0.141	.	470;470;470;470;470;470	Q1ZYL6;E1B6W6;Q99062-3;Q99062;Q99062-4;Q99062-2	.;.;.;CSF3R_HUMAN;.;.	T	470	ENSP00000362198:A470T;ENSP00000362196:A470T;ENSP00000362195:A470T;ENSP00000355406:A470T;ENSP00000332180:A470T;ENSP00000401588:A470T;ENSP00000345013:A470T;ENSP00000397568:A470T	ENSP00000332180:A470T	A	-	1	0	CSF3R	36707906	0.008000	0.16893	0.005000	0.12908	0.001000	0.01503	0.159000	0.16442	-0.183000	0.10585	-0.911000	0.02809	GCG		0.637	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039	
LRRIQ3	127255	hgsc.bcm.edu	37	1	74648338	74648338	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr1:74648338C>T	ENST00000395089.1	-	2	456	c.457G>A	c.(457-459)Gcg>Acg	p.A153T	LRRIQ3_ENST00000370909.2_Intron|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.A153T|LRRIQ3_ENST00000354431.4_Missense_Mutation_p.A153T			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	153	LRRCT.							p.A153T(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TGATCCAGCGCTTTGAGAGGC	0.383																																					p.A153T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G457A	1						.						110.0	107.0	108.0					1																	74648338		2203	4300	6503	74420926	SO:0001583	missense	127255	exon3			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.457G>A	1.37:g.74648338C>T	ENSP00000378524:p.Ala153Thr	Somatic		Capture	SOLID	Phase_I	74420926	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490434	0.64074	.	.	ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000388972;ENST00000370911	T;T;T	0.23147	1.92;1.92;1.92	5.65	3.68	0.42216	.	0.300757	0.27311	N	0.019949	T	0.27524	0.0676	L	0.50333	1.59	0.27993	N	0.935598	D	0.69078	0.997	D	0.63793	0.918	T	0.00939	-1.1507	10	0.51188	T	0.08	.	11.2743	0.49157	0.0:0.7945:0.1306:0.0749	.	153	A6PVS8	LRIQ3_HUMAN	T	153	ENSP00000378524:A153T;ENSP00000346414:A153T;ENSP00000359948:A153T	ENSP00000346414:A153T	A	-	1	0	LRRIQ3	74420926	1.000000	0.71417	0.998000	0.56505	0.508000	0.34012	2.204000	0.42761	2.653000	0.90120	0.650000	0.86243	GCG		0.383	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
ARNT	405	hgsc.bcm.edu	37	1	150808901	150808901	+	Silent	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr1:150808901C>T	ENST00000358595.5	-	7	755	c.555G>A	c.(553-555)agG>agA	p.R185R	ARNT_ENST00000515192.1_Silent_p.R176R|ARNT_ENST00000505755.1_Silent_p.R170R|ARNT_ENST00000354396.2_Silent_p.R185R|ARNT_ENST00000468970.1_5'UTR	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	185	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R185R(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CATACACCACCCTGCCTGTCT	0.453			T	ETV6	AML																																p.R170R			Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G510A	1						.						97.0	83.0	88.0					1																	150808901		2203	4300	6503	149075525	SO:0001819	synonymous_variant	405	exon6			AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.555G>A	1.37:g.150808901C>T		Somatic		Capture	SOLID	Phase_I	149075525	NM_001197325	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Silent	SNP	ENST00000358595.5	37	CCDS970.1																																																																																				0.453	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2		
P2RX3	5024	hgsc.bcm.edu	37	11	57118271	57118271	+	Silent	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr11:57118271C>T	ENST00000263314.2	+	8	775	c.741C>T	c.(739-741)tgC>tgT	p.C247C		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	247					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)	p.C247C(2)		endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						GCTGGGTGTGCGACTTGGACA	0.597																																					p.C247C												.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.C741T	11						.						89.0	74.0	79.0					11																	57118271		2201	4296	6497	56874847	SO:0001819	synonymous_variant	5024	exon8			Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.741C>T	11.37:g.57118271C>T		Somatic		Capture	SOLID	Phase_I	56874847	NM_002559	Q6DK37|Q9UQB6	Silent	SNP	ENST00000263314.2	37	CCDS7953.1																																																																																				0.597	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392465.1	NM_002559	
GDPD5	81544	hgsc.bcm.edu	37	11	75168750	75168750	+	Silent	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr11:75168750G>A	ENST00000336898.3	-	5	1140	c.303C>T	c.(301-303)atC>atT	p.I101I	GDPD5_ENST00000443276.2_Silent_p.I101I|GDPD5_ENST00000529721.1_Silent_p.I101I|GDPD5_ENST00000376282.3_Intron|GDPD5_ENST00000533784.1_Intron	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	101					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)	p.I101I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						GGAGGCCAGCGATGTATGCGA	0.642																																					p.I101I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C303T	11						.						100.0	90.0	93.0					11																	75168750		2200	4293	6493	74846398	SO:0001819	synonymous_variant	81544	exon5			AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.303C>T	11.37:g.75168750G>A		Somatic		Capture	SOLID	Phase_I	74846398	NM_030792	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Silent	SNP	ENST00000336898.3	37	CCDS8238.1																																																																																				0.642	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792	
VNN1	8876	hgsc.bcm.edu	37	6	133013397	133013397	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr6:133013397C>T	ENST00000367928.4	-	5	1166	c.1153G>A	c.(1153-1155)Gga>Aga	p.G385R		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	385					acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)	p.G385R(2)		NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		GTGTGCAGTCCGTCAAATGCC	0.368																																					p.G385R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1153A	6						.						106.0	101.0	103.0					6																	133013397		2203	4300	6503	133055090	SO:0001583	missense	8876	exon5			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.1153G>A	6.37:g.133013397C>T	ENSP00000356905:p.Gly385Arg	Somatic		Capture	SOLID	Phase_I	133055090	NM_004666	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Missense_Mutation	SNP	ENST00000367928.4	37	CCDS5159.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523335	0.85600	.	.	ENSG00000112299	ENST00000367928	D	0.91180	-2.8	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.96386	0.8821	M	0.93594	3.435	0.58432	D	0.999999	D	0.76494	0.999	D	0.65010	0.931	D	0.96810	0.9596	10	0.87932	D	0	-19.2659	19.8316	0.96638	0.0:1.0:0.0:0.0	.	385	O95497	VNN1_HUMAN	R	385	ENSP00000356905:G385R	ENSP00000356905:G385R	G	-	1	0	VNN1	133055090	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.096000	0.71446	2.687000	0.91594	0.563000	0.77884	GGA		0.368	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042263.1		
SERAC1	84947	hgsc.bcm.edu	37	6	158567893	158567893	+	Silent	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr6:158567893G>A	ENST00000367104.3	-	6	539	c.408C>T	c.(406-408)ctC>ctT	p.L136L	SERAC1_ENST00000367102.2_Silent_p.L136L|SERAC1_ENST00000367101.1_Silent_p.L136L|SERAC1_ENST00000607000.1_Silent_p.L136L	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	136					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)	p.L136L(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		TCTTCCGTAGGAGCAGCCACA	0.443																																					p.L136L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C408T	6						.						177.0	157.0	164.0					6																	158567893		2203	4300	6503	158487881	SO:0001819	synonymous_variant	84947	exon6			BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.408C>T	6.37:g.158567893G>A		Somatic		Capture	SOLID	Phase_I	158487881	NM_032861	Q49AT1|Q5VTX3|Q6PKF3	Silent	SNP	ENST00000367104.3	37	CCDS5255.1																																																																																				0.443	SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
HIST1H2BA	255626	hgsc.bcm.edu	37	6	25727240	25727240	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr6:25727240G>A	ENST00000274764.2	+	1	104	c.104G>A	c.(103-105)cGt>cAt	p.R35H	HIST1H2AA_ENST00000297012.3_5'Flank	NM_170610.2	NP_733759.1	Q96A08	H2B1A_HUMAN	histone cluster 1, H2ba	35					cellular response to acid chemical (GO:0071229)|chromatin organization (GO:0006325)|inflammatory response (GO:0006954)|mononuclear cell migration (GO:0071674)|nucleosome assembly (GO:0006334)|nucleosome disassembly (GO:0006337)|plasminogen activation (GO:0031639)|positive regulation of binding (GO:0051099)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	extrinsic component of plasma membrane (GO:0019897)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R35H(1)		breast(1)|kidney(1)	2						AAGAGGACCCGTAAGGAGAGT	0.448																																					p.R35H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G104A	6						.						333.0	280.0	298.0					6																	25727240		2203	4300	6503	25835219	SO:0001583	missense	255626	exon1			AF397301	CCDS4563.1	6p22.2	2011-01-27	2006-10-11		ENSG00000146047	ENSG00000146047		"""Histones / Replication-dependent"""	18730	protein-coding gene	gene with protein product		609904	"""H2B histone family, member U, (testis-specific)"", ""histone 1, H2ba"""			12408966, 12213818	Standard	NM_170610		Approved	bA317E16.3, STBP, TSH2B, H2BFU	uc003nfd.3	Q96A08	OTTHUMG00000014408	ENST00000274764.2:c.104G>A	6.37:g.25727240G>A	ENSP00000274764:p.Arg35His	Somatic		Capture	SOLID	Phase_I	25835219	NM_170610	B2R544|Q6NZ98|Q6NZA0|Q6NZA1	Missense_Mutation	SNP	ENST00000274764.2	37	CCDS4563.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858767	0.51376	.	.	ENSG00000146047	ENST00000274764	T	0.24723	1.84	3.07	2.16	0.27623	Histone-fold (2);Histone core (1);	0.000000	0.53938	D	0.000041	T	0.43523	0.1251	M	0.92923	3.36	0.43890	D	0.996519	D	0.76494	0.999	D	0.64410	0.925	T	0.52823	-0.8524	10	0.46703	T	0.11	.	10.6977	0.45909	0.0:0.0:0.8065:0.1935	.	35	Q96A08	H2B1A_HUMAN	H	35	ENSP00000274764:R35H	ENSP00000274764:R35H	R	+	2	0	HIST1H2BA	25835219	0.907000	0.30839	0.001000	0.08648	0.002000	0.02628	4.640000	0.61368	0.822000	0.34565	0.585000	0.79938	CGT		0.448	HIST1H2BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040066.1	NM_170610	
PRSS16	10279	hgsc.bcm.edu	37	6	27216931	27216931	+	Silent	SNP	A	A	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr6:27216931A>G	ENST00000230582.3	+	4	405	c.390A>G	c.(388-390)gaA>gaG	p.E130E	PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	130					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)	p.E130E(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						TAAGCCTGGAACACAGATTTT	0.597																																					p.E130E	NSCLC(178;1118 2105 17078 23587 44429)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A390G	6						.						81.0	84.0	83.0					6																	27216931		2203	4300	6503	27324910	SO:0001819	synonymous_variant	10279	exon4			AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.390A>G	6.37:g.27216931A>G		Somatic		Capture	SOLID	Phase_I	27324910	NM_005865	O75416	Silent	SNP	ENST00000230582.3	37	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	A	4.647	0.120276	0.08881	.	.	ENSG00000112812	ENST00000485993;ENST00000475106	.	.	.	4.04	-3.01	0.05463	.	.	.	.	.	T	0.40546	0.1121	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48736	-0.9009	4	.	.	.	-36.7007	10.8166	0.46580	0.4236:0.0:0.5764:0.0	.	.	.	.	A	22	.	.	T	+	1	0	PRSS16	27324910	0.039000	0.19947	0.984000	0.44739	0.485000	0.33311	-2.099000	0.01346	-0.684000	0.05183	-0.410000	0.06199	ACA		0.597	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
FAM120B	84498	hgsc.bcm.edu	37	6	170627941	170627941	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr6:170627941G>A	ENST00000476287.1	+	2	1571	c.1463G>A	c.(1462-1464)cGg>cAg	p.R488Q	FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000537664.1_Missense_Mutation_p.R511Q|FAM120B_ENST00000540480.1_Missense_Mutation_p.R500Q	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	488					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R488Q(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GTTTTAATACGGACAGACCCT	0.453																																					p.R488Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1463A	6						.						101.0	106.0	104.0					6																	170627941		2203	4300	6503	170469866	SO:0001583	missense	84498	exon2			AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1463G>A	6.37:g.170627941G>A	ENSP00000417970:p.Arg488Gln	Somatic		Capture	SOLID	Phase_I	170469866	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	-	5.073	0.199173	0.09652	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.08008	3.15;3.14;3.15	0.668	-0.429	0.12303	.	9.403430	0.00610	U	0.000403	T	0.01061	0.0035	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.01281	0.0;0.0	T	0.42155	-0.9468	10	0.13853	T	0.58	.	4.916	0.13846	0.2699:0.0:0.7301:0.0	.	488;488	Q96EK7;F2Z2E1	F120B_HUMAN;.	Q	500;511;488	ENSP00000444125:R500Q;ENSP00000440125:R511Q;ENSP00000417970:R488Q	ENSP00000436640:R488Q	R	+	2	0	FAM120B	170469866	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.362000	0.20284	-0.225000	0.09913	0.205000	0.17691	CGG		0.453	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
MYH8	4626	hgsc.bcm.edu	37	17	10298502	10298502	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr17:10298502C>T	ENST00000403437.2	-	34	5004	c.4910G>A	c.(4909-4911)cGc>cAc	p.R1637H	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1637					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.R1637H(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TGCAGCTAAGCGATTGGCATG	0.463									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.R1637H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4910A	17						.						285.0	268.0	273.0					17																	10298502		2203	4300	6503	10239227	SO:0001583	missense	4626	exon34	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4910G>A	17.37:g.10298502C>T	ENSP00000384330:p.Arg1637His	Somatic		Capture	SOLID	Phase_I	10239227	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459951	0.84317	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.81908	-1.55	4.85	4.85	0.62838	Myosin tail (1);	0.000000	0.42682	U	0.000680	D	0.84808	0.5554	M	0.81112	2.525	0.54753	D	0.99998	B	0.33266	0.404	B	0.33196	0.159	D	0.86687	0.1920	10	0.87932	D	0	.	18.168	0.89734	0.0:1.0:0.0:0.0	.	1637	P13535	MYH8_HUMAN	H	1637	ENSP00000384330:R1637H	ENSP00000252173:R1637H	R	-	2	0	MYH8	10239227	1.000000	0.71417	0.997000	0.53966	0.714000	0.41099	7.600000	0.82769	2.521000	0.84997	0.650000	0.86243	CGC		0.463	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
TP53	7157	hgsc.bcm.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	SOLID	Phase_I	7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYH10	4628	hgsc.bcm.edu	37	17	8452060	8452060	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr17:8452060T>C	ENST00000269243.4	-	9	1073	c.935A>G	c.(934-936)aAt>aGt	p.N312S	MYH10_ENST00000360416.3_Missense_Mutation_p.N322S|MYH10_ENST00000379980.4_Missense_Mutation_p.N328S|RN7SL129P_ENST00000479993.2_RNA|MYH10_ENST00000396239.1_Missense_Mutation_p.N312S	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	312	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.N312S(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						AATATAGCCATTGGAGAGAAA	0.368																																					p.N312S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A935G	17						.						139.0	141.0	140.0					17																	8452060		2203	4300	6503	8392785	SO:0001583	missense	4628	exon9			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.935A>G	17.37:g.8452060T>C	ENSP00000269243:p.Asn312Ser	Somatic		Capture	SOLID	Phase_I	8392785	NM_005964	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610800	0.66558	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.25	5.25	0.73442	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.82440	0.5037	L	0.35793	1.09	0.80722	D	1	B;B;B	0.25850	0.034;0.136;0.034	B;B;B	0.23852	0.017;0.049;0.017	T	0.80890	-0.1180	10	0.62326	D	0.03	.	15.3318	0.74219	0.0:0.0:0.0:1.0	.	321;322;312	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	S	312;322;312;328	ENSP00000269243:N312S;ENSP00000353590:N322S;ENSP00000379539:N312S;ENSP00000369315:N328S	ENSP00000269243:N312S	N	-	2	0	MYH10	8392785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.214000	0.71695	0.528000	0.53228	AAT		0.368	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
GLP2R	9340	hgsc.bcm.edu	37	17	9764490	9764490	+	Silent	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr17:9764490C>T	ENST00000262441.5	+	8	1473	c.960C>T	c.(958-960)ttC>ttT	p.F320F	GLP2R_ENST00000574745.1_Silent_p.F140F	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	320					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.F320F(1)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	CCTGGGGTTTCGCCCGTGCAC	0.502																																					p.F320F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C960T	17						.						208.0	188.0	195.0					17																	9764490		2203	4300	6503	9705215	SO:0001819	synonymous_variant	9340	exon8			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.960C>T	17.37:g.9764490C>T		Somatic		Capture	SOLID	Phase_I	9705215	NM_004246	Q4VAT3	Silent	SNP	ENST00000262441.5	37	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	C	0.233	-1.019612	0.02078	.	.	ENSG00000065325	ENST00000458005	.	.	.	5.24	-10.5	0.00291	.	.	.	.	.	T	0.24275	0.0588	.	.	.	0.19300	N	0.999971	.	.	.	.	.	.	T	0.18304	-1.0341	4	.	.	.	.	7.8231	0.29298	0.1137:0.6089:0.1426:0.1348	.	.	.	.	L	173	.	.	S	+	2	0	GLP2R	9705215	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-3.935000	0.00331	-4.256000	0.00061	-1.851000	0.00568	TCG		0.502	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
SPAG5	10615	hgsc.bcm.edu	37	17	26906166	26906166	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr17:26906166C>T	ENST00000321765.5	-	19	3442	c.3110G>A	c.(3109-3111)cGc>cAc	p.R1037H	ALDOC_ENST00000395319.3_5'Flank|ALDOC_ENST00000395321.2_5'Flank|ALDOC_ENST00000226253.4_5'Flank	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	1037					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)		p.R1037H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CACCTTGTAGCGCAAGCACAA	0.557																																					p.R1037H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3110A	17						.						110.0	87.0	95.0					17																	26906166		2203	4300	6503	23930293	SO:0001583	missense	10615	exon19			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.3110G>A	17.37:g.26906166C>T	ENSP00000323300:p.Arg1037His	Somatic		Capture	SOLID	Phase_I	23930293	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	c	18.14	3.558306	0.65538	.	.	ENSG00000076382	ENST00000321765	T	0.32515	1.45	5.81	4.83	0.62350	.	0.102198	0.44285	D	0.000470	T	0.41696	0.1170	L	0.34521	1.04	0.29445	N	0.858852	D	0.89917	1.0	D	0.63597	0.916	T	0.36890	-0.9729	10	0.54805	T	0.06	-2.1285	13.7503	0.62904	0.1536:0.8464:0.0:0.0	.	1037	Q96R06	SPAG5_HUMAN	H	1037	ENSP00000323300:R1037H	ENSP00000323300:R1037H	R	-	2	0	SPAG5	23930293	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.993000	0.40747	1.442000	0.47568	0.651000	0.88453	CGC		0.557	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
SETD4	54093	hgsc.bcm.edu	37	21	37431157	37431157	+	Silent	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr21:37431157C>T	ENST00000399215.1	-	1	1402	c.30G>A	c.(28-30)cgG>cgA	p.R10R	SETD4_ENST00000399205.1_5'UTR|SETD4_ENST00000399212.1_5'UTR|SETD4_ENST00000399208.2_Silent_p.R10R|SETD4_ENST00000399201.1_5'UTR|AP000688.11_ENST00000436303.1_RNA|SETD4_ENST00000399207.1_Silent_p.R10R|SETD4_ENST00000481477.1_5'UTR|SETD4_ENST00000332131.4_Silent_p.R10R			Q9NVD3	SETD4_HUMAN	SET domain containing 4	10							methyltransferase activity (GO:0008168)	p.R10R(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						GTCTTCTGATCCGGCTTGTTC	0.348																																					p.R10R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G30A	21						.						213.0	217.0	215.0					21																	37431157		2203	4300	6503	36353027	SO:0001819	synonymous_variant	54093	exon2			AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.30G>A	21.37:g.37431157C>T		Somatic		Capture	SOLID	Phase_I	36353027	NM_017438	B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Silent	SNP	ENST00000399215.1	37	CCDS13640.1																																																																																				0.348	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1	NM_017438	
THRB	7068	hgsc.bcm.edu	37	3	24193892	24193892	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr3:24193892C>T	ENST00000356447.4	-	5	657	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	THRB_ENST00000396671.2_Missense_Mutation_p.E125K|THRB_ENST00000416420.1_Missense_Mutation_p.E125K|THRB_ENST00000280696.5_Missense_Mutation_p.E140K	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	125					female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.E125K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TTGCAGCCTTCACACGTGATA	0.507																																					p.E125K	Melanoma(21;896 1043 15021 37958)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G373A	3						.						135.0	109.0	118.0					3																	24193892		2203	4300	6503	24168896	SO:0001583	missense	7068	exon5				CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.373G>A	3.37:g.24193892C>T	ENSP00000348827:p.Glu125Lys	Somatic		Capture	SOLID	Phase_I	24168896	NM_000461	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	ENST00000356447.4	37	CCDS2641.1	.	.	.	.	.	.	.	.	.	.	C	37	5.978736	0.97168	.	.	ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000280696;ENST00000413780	D;D;D;D;D	0.98060	-4.69;-4.69;-4.69;-4.69;-4.69	5.65	5.65	0.86999	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.64402	D	0.000001	D	0.98817	0.9601	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.99698	1.1003	10	0.72032	D	0.01	.	19.7276	0.96170	0.0:1.0:0.0:0.0	.	140;125	P10828-2;P10828	.;THB_HUMAN	K	125;125;125;140;94	ENSP00000379904:E125K;ENSP00000348827:E125K;ENSP00000414444:E125K;ENSP00000280696:E140K;ENSP00000414100:E94K	ENSP00000280696:E140K	E	-	1	0	THRB	24168896	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.798000	0.85924	2.663000	0.90544	0.561000	0.74099	GAA		0.507	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252877.3	NM_000461	
ITIH1	3697	hgsc.bcm.edu	37	3	52820403	52820403	+	Silent	SNP	C	C	T	rs142797927		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr3:52820403C>T	ENST00000273283.2	+	13	1710	c.1686C>T	c.(1684-1686)gtC>gtT	p.V562V	ITIH1_ENST00000542827.1_Silent_p.V562V|ITIH1_ENST00000540715.1_Silent_p.V420V|ITIH1_ENST00000405128.3_5'Flank|ITIH1_ENST00000537050.1_Silent_p.V274V	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	562	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V562V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		AGAACCACGTCGAGCGCCTCT	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		17597	0.0		0.001	False		,,,				2504	0.0				p.V420V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1260T	3						.	C	,,,	1,4405		0,1,2202	42.0	34.0	37.0		1260,822,822,1686	-9.6	0.0	3	dbSNP_134	37	7,8583		0,7,4288	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ITIH1	NM_001166434.1,NM_001166435.1,NM_001166436.1,NM_002215.2	,,,	0,8,6490	TT,TC,CC		0.0815,0.0227,0.0616	,,,	420/770,274/624,274/624,562/912	52820403	8,12988	2203	4295	6498	52795443	SO:0001819	synonymous_variant	3697	exon11				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1686C>T	3.37:g.52820403C>T		Somatic		Capture	SOLID	Phase_I	52795443	NM_001166434	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	ENST00000273283.2	37	CCDS2864.1																																																																																				0.617	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
ITIH4	3700	hgsc.bcm.edu	37	3	52850958	52850958	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr3:52850958G>A	ENST00000266041.4	-	21	2509	c.2413C>T	c.(2413-2415)Cgg>Tgg	p.R805W	ITIH4_ENST00000406595.1_Missense_Mutation_p.R775W|ITIH4_ENST00000346281.5_Missense_Mutation_p.R789W|ITIH4_ENST00000485816.1_Missense_Mutation_p.R810W|RP5-966M1.6_ENST00000468472.1_3'UTR	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	805					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R805W(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTTCGGTTCCGAGTCACCACC	0.577																																					p.R805W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2413T	3						.						168.0	167.0	167.0					3																	52850958		2203	4300	6503	52825998	SO:0001583	missense	3700	exon21			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.2413C>T	3.37:g.52850958G>A	ENSP00000266041:p.Arg805Trp	Somatic		Capture	SOLID	Phase_I	52825998	NM_002218	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	ENST00000266041.4	37	CCDS2865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.12|12.12	1.843097|1.843097	0.32606|0.32606	.|.	.|.	ENSG00000055955|ENSG00000055955	ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421|ENST00000441637	T;T;T;T|.	0.12774|.	2.65;2.65;2.65;2.65|.	5.47|5.47	2.59|2.59	0.31030|0.31030	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);|.	0.492999|.	0.19547|.	N|.	0.111675|.	T|T	0.55114|0.55114	0.1900|0.1900	M|M	0.70275|0.70275	2.135|2.135	0.09310|0.09310	N|N	1|1	D;D;D;P|.	0.89917|.	1.0;1.0;1.0;0.515|.	D;D;D;B|.	0.85130|.	0.994;0.996;0.997;0.199|.	T|T	0.45702|0.45702	-0.9243|-0.9243	10|5	0.66056|.	D|.	0.02|.	-11.9751|-11.9751	11.5711|11.5711	0.50834|0.50834	0.0:0.0:0.5329:0.4671|0.0:0.0:0.5329:0.4671	.|.	775;810;805;789|.	E9PGN5;B7ZKJ8;Q14624;Q14624-2|.	.;.;ITIH4_HUMAN;.|.	W|L	805;789;810;775;763|593	ENSP00000266041:R805W;ENSP00000340520:R789W;ENSP00000417824:R810W;ENSP00000384425:R775W|.	ENSP00000266041:R805W|.	R|S	-|-	1|2	2|0	ITIH4|ITIH4	52825998|52825998	0.014000|0.014000	0.17966|0.17966	0.000000|0.000000	0.03702|0.03702	0.068000|0.068000	0.16541|0.16541	1.369000|1.369000	0.34227|0.34227	0.219000|0.219000	0.20840|0.20840	0.561000|0.561000	0.74099|0.74099	CGG|TCG		0.577	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218	
CEP70	80321	hgsc.bcm.edu	37	3	138227352	138227352	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr3:138227352C>A	ENST00000264982.3	-	12	1245	c.979G>T	c.(979-981)Gac>Tac	p.D327Y	CEP70_ENST00000542237.1_Missense_Mutation_p.D307Y|CEP70_ENST00000489254.1_Missense_Mutation_p.D175Y|CEP70_ENST00000481834.1_Missense_Mutation_p.D327Y|CEP70_ENST00000484888.1_Missense_Mutation_p.D327Y	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	327					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.D327Y(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						TTCTCTGTGTCCTCAGCCTTC	0.353																																					p.D327Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G979T	3						.						211.0	216.0	214.0					3																	138227352		2203	4300	6503	139710042	SO:0001583	missense	80321	exon12			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.979G>T	3.37:g.138227352C>A	ENSP00000264982:p.Asp327Tyr	Somatic		Capture	SOLID	Phase_I	139710042	NM_024491	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	ENST00000264982.3	37	CCDS3102.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886920	0.52014	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000481834	T;T;T;T;T;T	0.53206	1.21;1.21;0.63;1.21;1.21;1.2	5.24	3.31	0.37934	.	0.229273	0.44483	D	0.000448	T	0.57475	0.2056	L	0.57536	1.79	0.25953	N	0.982729	D;B;B;B	0.76494	0.999;0.005;0.006;0.005	D;B;B;B	0.66979	0.948;0.007;0.007;0.007	T	0.47471	-0.9115	10	0.72032	D	0.01	-11.294	6.4716	0.22011	0.0:0.7817:0.0:0.2183	.	175;307;327;327	B7Z2D2;F5GZX8;Q8NHQ1-2;Q8NHQ1	.;.;.;CEP70_HUMAN	Y	327;307;175;327;309;327	ENSP00000264982:D327Y;ENSP00000444128:D307Y;ENSP00000417821:D175Y;ENSP00000419231:D327Y;ENSP00000419833:D309Y;ENSP00000417465:D327Y	ENSP00000264982:D327Y	D	-	1	0	CEP70	139710042	0.336000	0.24757	0.866000	0.34008	0.756000	0.42949	0.405000	0.21015	1.432000	0.47375	0.655000	0.94253	GAC		0.353	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491	
SLCO1B1	10599	hgsc.bcm.edu	37	12	21325668	21325668	+	Missense_Mutation	SNP	C	C	T	rs139257324		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr12:21325668C>T	ENST00000256958.2	+	3	265	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	57					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.R57W(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	TCATATAGAACGGAGATTTGA	0.323																																					p.R57W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C169T	12						.	A	TRP/ARG	1,4405		0,1,2202	151.0	139.0	143.0		169	2.1	1.0	12	dbSNP_134	143	0,8596		0,0,4298	no	missense	SLCO1B1	NM_006446.4	101	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	57/692	21325668	1,13001	2203	4298	6501	21216935	SO:0001583	missense	10599	exon3				CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.169C>T	12.37:g.21325668C>T	ENSP00000256958:p.Arg57Trp	Somatic		Capture	SOLID	Phase_I	21216935	NM_006446	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	A	16.43	3.121349	0.56613	2.27E-4	0.0	ENSG00000134538	ENST00000256958	T	0.54279	0.58	3.36	2.14	0.27477	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.76702	0.4024	M	0.93375	3.41	0.43360	D	0.995438	D	0.89917	1.0	D	0.97110	1.0	T	0.78565	-0.2155	10	0.87932	D	0	.	11.1615	0.48518	0.5502:0.4498:0.0:0.0	.	57	Q9Y6L6	SO1B1_HUMAN	W	57	ENSP00000256958:R57W	ENSP00000256958:R57W	R	+	1	2	SLCO1B1	21216935	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	2.358000	0.44134	0.038000	0.15604	-0.824000	0.03097	CGG		0.323	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446	
KIF5A	3798	hgsc.bcm.edu	37	12	57963874	57963874	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr12:57963874C>T	ENST00000455537.2	+	12	1496	c.1222C>T	c.(1222-1224)Cgc>Tgc	p.R408C	KIF5A_ENST00000286452.5_Missense_Mutation_p.R319C	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	408					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.R408C(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						CATCGTGGTGCGCATCGCGCC	0.632																																					p.R408C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1222T	12						.						57.0	45.0	49.0					12																	57963874		2203	4300	6503	56250141	SO:0001583	missense	3798	exon12			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1222C>T	12.37:g.57963874C>T	ENSP00000408979:p.Arg408Cys	Somatic		Capture	SOLID	Phase_I	56250141	NM_004984	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137194	0.56936	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.77877	-1.13;-1.13	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.79633	0.4479	L	0.53249	1.67	0.80722	D	1	D;D	0.61697	0.978;0.99	P;P	0.49361	0.608;0.608	T	0.81387	-0.0956	10	0.52906	T	0.07	.	17.1515	0.86779	0.0:1.0:0.0:0.0	.	319;408	B7Z2M7;Q12840	.;KIF5A_HUMAN	C	408;319	ENSP00000408979:R408C;ENSP00000286452:R319C	ENSP00000286452:R319C	R	+	1	0	KIF5A	56250141	0.646000	0.27295	1.000000	0.80357	0.071000	0.16799	0.669000	0.25142	2.667000	0.90743	0.655000	0.94253	CGC		0.632	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
RMDN3	55177	hgsc.bcm.edu	37	15	41044218	41044218	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr15:41044218G>A	ENST00000260385.6	-	2	1413	c.346C>T	c.(346-348)Cga>Tga	p.R116*	RMDN3_ENST00000558560.1_5'UTR|RMDN3_ENST00000338376.3_Nonsense_Mutation_p.R116*			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3	116					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.R116*(1)									GCAAGCCCTCGCAGGCTGCTT	0.617																																					p.R116X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C346T	15						.						82.0	72.0	76.0					15																	41044218		2203	4300	6503	38831510	SO:0001587	stop_gained	55177	exon3			AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.346C>T	15.37:g.41044218G>A	ENSP00000260385:p.Arg116*	Somatic		Capture	SOLID	Phase_I	38831510	NM_018145	A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Nonsense_Mutation	SNP	ENST00000260385.6	37	CCDS10063.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311694	0.81358	.	.	ENSG00000137824	ENST00000260385;ENST00000338376;ENST00000426872	.	.	.	5.34	4.42	0.53409	.	0.286916	0.39909	N	0.001235	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-6.5107	15.1352	0.72558	0.0:0.0:0.8573:0.1427	.	.	.	.	X	116;116;53	.	ENSP00000260385:R116X	R	-	1	2	FAM82A2	38831510	0.999000	0.42202	0.913000	0.36048	0.087000	0.18053	5.316000	0.65815	1.239000	0.43787	-0.268000	0.10319	CGA		0.617	RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252357.1	NM_018145	
NUTM1	256646	hgsc.bcm.edu	37	15	34646714	34646714	+	Silent	SNP	A	A	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr15:34646714A>G	ENST00000333756.4	+	5	1214	c.1059A>G	c.(1057-1059)agA>agG	p.R353R	NUTM1_ENST00000438749.3_Silent_p.R371R|NUTM1_ENST00000537011.1_Silent_p.R381R	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	353						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R353R(1)									AAGCCCAGAGACCTCCTGCTC	0.582																																					p.R353R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1059G	15						.						97.0	101.0	99.0					15																	34646714		2201	4298	6499	32434006	SO:0001819	synonymous_variant	256646	exon5			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.1059A>G	15.37:g.34646714A>G		Somatic		Capture	SOLID	Phase_I	32434006	NM_175741	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	ENST00000333756.4	37	CCDS32190.1																																																																																				0.582	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	
VPS13C	54832	hgsc.bcm.edu	37	15	62221787	62221787	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr15:62221787C>T	ENST00000261517.5	-	51	6272	c.6199G>A	c.(6199-6201)Gct>Act	p.A2067T	VPS13C_ENST00000395896.4_Missense_Mutation_p.A2067T|VPS13C_ENST00000249837.3_Missense_Mutation_p.A2024T|VPS13C_ENST00000395898.3_Missense_Mutation_p.A2024T	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.A2067T(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TGAGGCACAGCTTTGATAAAG	0.403																																					p.A2024T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6070A	15						.						142.0	124.0	130.0					15																	62221787		2203	4300	6503	60009079	SO:0001583	missense	54832	exon49			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6199G>A	15.37:g.62221787C>T	ENSP00000261517:p.Ala2067Thr	Somatic		Capture	SOLID	Phase_I	60009079	NM_017684		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	31	5.093571	0.94149	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.50001	0.76;0.76;0.94	5.26	5.26	0.73747	.	0.056233	0.64402	D	0.000001	T	0.64886	0.2639	M	0.78637	2.42	0.58432	D	0.999999	P;D;P;D	0.61697	0.753;0.99;0.798;0.982	B;P;P;P	0.58721	0.281;0.844;0.454;0.703	T	0.68089	-0.5501	10	0.52906	T	0.07	.	14.6706	0.68942	0.1545:0.8455:0.0:0.0	.	2024;2067;2024;2067	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	T	2024;2067;2067;2067	ENSP00000249837:A2024T;ENSP00000261517:A2067T;ENSP00000379233:A2067T	ENSP00000249837:A2024T	A	-	1	0	VPS13C	60009079	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	5.504000	0.66968	2.442000	0.82660	0.655000	0.94253	GCT		0.403	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
CPE	1363	hgsc.bcm.edu	37	4	166405608	166405608	+	Silent	SNP	C	C	T	rs184912639	byFrequency	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr4:166405608C>T	ENST00000402744.4	+	5	1105	c.825C>T	c.(823-825)gaC>gaT	p.D275D		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	275					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)	p.D275D(1)		endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCCCAGATGACGCCATTTTCC	0.483													C|||	3	0.000599042	0.0008	0.0	5008	,	,		17659	0.001		0.001	False		,,,				2504	0.0				p.D275D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C825T	4						.						259.0	252.0	254.0					4																	166405608		2203	4300	6503	166625058	SO:0001819	synonymous_variant	1363	exon5			X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.825C>T	4.37:g.166405608C>T		Somatic		Capture	SOLID	Phase_I	166625058	NM_001873	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Silent	SNP	ENST00000402744.4	37	CCDS3810.1																																																																																				0.483	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	NM_001873	
CRMP1	1400	hgsc.bcm.edu	37	4	5862768	5862768	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr4:5862768C>T	ENST00000397890.2	-	3	512	c.298G>A	c.(298-300)Ggg>Agg	p.G100R	CRMP1_ENST00000512574.1_Missense_Mutation_p.G98R|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Missense_Mutation_p.G214R	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	100					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.G214R(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		ATCGTGGTCCCGCCCACCAGT	0.582																																					p.G100R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G298A	4						.						90.0	82.0	85.0					4																	5862768		2203	4300	6503	5913669	SO:0001583	missense	1400	exon3			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.298G>A	4.37:g.5862768C>T	ENSP00000380987:p.Gly100Arg	Somatic		Capture	SOLID	Phase_I	5913669	NM_001313	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	ENST00000397890.2	37	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686440	0.88639	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.99671	-6.35;-6.35;-6.35	4.37	4.37	0.52481	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	H	0.98048	4.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96680	0.9503	10	0.87932	D	0	-20.5733	16.0708	0.80928	0.0:1.0:0.0:0.0	.	214;98;100	A0EJG6;E9PD68;Q14194	.;.;DPYL1_HUMAN	R	214;100;100;98	ENSP00000321606:G214R;ENSP00000380987:G100R;ENSP00000425742:G98R	ENSP00000321606:G214R	G	-	1	0	CRMP1	5913669	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	7.132000	0.77251	2.251000	0.74343	0.561000	0.74099	GGG		0.582	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
IBSP	3381	hgsc.bcm.edu	37	4	88732603	88732603	+	Silent	SNP	C	C	T	rs200405481		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr4:88732603C>T	ENST00000226284.5	+	7	562	c.495C>T	c.(493-495)agC>agT	p.S165S		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	165	Asp/Glu-rich (acidic).				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)		p.S165S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		acgaagaaagcgaagcagaag	0.458																																					p.S165S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C495T	4						.						137.0	127.0	131.0					4																	88732603		2203	4300	6503	88951627	SO:0001819	synonymous_variant	3381	exon7				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.495C>T	4.37:g.88732603C>T		Somatic		Capture	SOLID	Phase_I	88951627	NM_004967		Silent	SNP	ENST00000226284.5	37	CCDS3624.1																																																																																				0.458	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
F11	2160	hgsc.bcm.edu	37	4	187201170	187201170	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr4:187201170C>G	ENST00000403665.2	+	8	1112	c.760C>G	c.(760-762)Ctt>Gtt	p.L254V	F11_ENST00000264692.4_Missense_Mutation_p.L202V	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	254	Apple 3. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)	p.L254V(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	TGTTAGAAATCTTTGTCTCCT	0.368																																					p.L254V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C760G	4						.						60.0	60.0	60.0					4																	187201170		2203	4300	6503	187438164	SO:0001583	missense	2160	exon8			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.760C>G	4.37:g.187201170C>G	ENSP00000384957:p.Leu254Val	Somatic		Capture	SOLID	Phase_I	187438164	NM_000128	D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	37	CCDS3847.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.47|10.47	1.360577|1.360577	0.24598|0.24598	.|.	.|.	ENSG00000088926|ENSG00000088926	ENST00000452239|ENST00000403665;ENST00000264692	.|D;D	.|0.88896	.|-2.44;-2.44	5.63|5.63	5.63|5.63	0.86233|0.86233	.|Apple domain (3);PAN-1 domain (1);Apple-like (1);	.|0.264721	.|0.33180	.|N	.|0.005198	D|D	0.84915|0.84915	0.5578|0.5578	L|L	0.28556|0.28556	0.865|0.865	0.30903|0.30903	N|N	0.729103|0.729103	.|P	.|0.46656	.|0.882	.|P	.|0.50659	.|0.647	T|T	0.78440|0.78440	-0.2203|-0.2203	5|10	.|0.08179	.|T	.|0.78	.|.	11.393|11.393	0.49825|0.49825	0.1405:0.724:0.1355:0.0|0.1405:0.724:0.1355:0.0	.|.	.|254	.|P03951	.|FA11_HUMAN	M|V	69|254;202	.|ENSP00000384957:L254V;ENSP00000264692:L202V	.|ENSP00000264692:L202V	I|L	+|+	3|1	3|0	F11|F11	187438164|187438164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	2.411000|2.411000	0.44600|0.44600	2.829000|2.829000	0.97493|0.97493	0.644000|0.644000	0.83932|0.83932	ATC|CTT		0.368	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4		
ARMCX1	51309	hgsc.bcm.edu	37	X	100808880	100808880	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chrX:100808880C>A	ENST00000372829.3	+	4	1338	c.967C>A	c.(967-969)Cat>Aat	p.H323N		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	323						integral component of membrane (GO:0016021)		p.H323N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						TCATTACCAACATTTGCTTTC	0.388																																					p.H323N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C967A	X						.						148.0	102.0	118.0					X																	100808880		2203	4300	6503	100695536	SO:0001583	missense	51309	exon4			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.967C>A	X.37:g.100808880C>A	ENSP00000361917:p.His323Asn	Somatic		Capture	SOLID	Phase_I	100695536	NM_016608	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	ENST00000372829.3	37	CCDS14487.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.638410	0.47153	.	.	ENSG00000126947	ENST00000372829;ENST00000538894	T	0.35789	1.29	3.21	3.21	0.36854	Armadillo-like helical (1);Armadillo-type fold (1);	0.111857	0.64402	D	0.000014	T	0.44095	0.1277	L	0.45352	1.415	0.33824	D	0.629348	D	0.60160	0.987	D	0.67725	0.953	T	0.50939	-0.8768	10	0.24483	T	0.36	-10.4286	9.0243	0.36220	0.0:1.0:0.0:0.0	.	323	Q9P291	ARMX1_HUMAN	N	323;28	ENSP00000361917:H323N	ENSP00000361917:H323N	H	+	1	0	ARMCX1	100695536	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.943000	0.40253	1.864000	0.54056	0.544000	0.68410	CAT		0.388	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
DIAPH2	1730	hgsc.bcm.edu	37	X	96136642	96136642	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chrX:96136642G>A	ENST00000324765.8	+	5	859	c.512G>A	c.(511-513)cGa>cAa	p.R171Q	DIAPH2_ENST00000373054.4_Missense_Mutation_p.R167Q|DIAPH2_ENST00000355827.4_Missense_Mutation_p.R171Q|DIAPH2_ENST00000373061.3_Missense_Mutation_p.R171Q|DIAPH2_ENST00000373049.4_Missense_Mutation_p.R171Q|RPA4_ENST00000373040.3_5'Flank			O60879	DIAP2_HUMAN	diaphanous-related formin 2	171	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.R171Q(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CATGAATTACGATCGGGTATA	0.383																																					p.R171Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G512A	X						.						80.0	72.0	75.0					X																	96136642		2203	4300	6503	96023298	SO:0001583	missense	1730	exon5			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.512G>A	X.37:g.96136642G>A	ENSP00000321348:p.Arg171Gln	Somatic		Capture	SOLID	Phase_I	96023298	NM_006729	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920308	0.73098	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46	5.44	5.44	0.79542	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.64402	D	0.000005	D	0.89255	0.6663	N	0.16903	0.455	0.53688	D	0.99997	D;D;D	0.76494	0.998;0.998;0.999	P;D;D	0.75020	0.762;0.94;0.985	D	0.87004	0.2118	10	0.18276	T	0.48	.	18.3408	0.90304	0.0:0.0:1.0:0.0	.	171;171;178	O60879;O60879-2;B7ZLJ0	DIAP2_HUMAN;.;.	Q	171;167;171;171;171;178	ENSP00000362152:R171Q;ENSP00000362145:R167Q;ENSP00000348082:R171Q;ENSP00000362140:R171Q;ENSP00000321348:R171Q	ENSP00000321348:R171Q	R	+	2	0	DIAPH2	96023298	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.544000	0.82117	2.270000	0.75569	0.594000	0.82650	CGA		0.383	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
ZBTB33	10009	hgsc.bcm.edu	37	X	119388318	119388318	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chrX:119388318G>A	ENST00000326624.2	+	2	1276	c.1048G>A	c.(1048-1050)Gtc>Atc	p.V350I	ZBTB33_ENST00000557385.1_Missense_Mutation_p.V350I	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	350					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)	p.V350I(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGACTCGGCCGTCAGTAATAC	0.413																																					p.V350I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1048A	X						.						154.0	135.0	141.0					X																	119388318		2203	4300	6503	119272346	SO:0001583	missense	10009	exon2			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.1048G>A	X.37:g.119388318G>A	ENSP00000314153:p.Val350Ile	Somatic		Capture	SOLID	Phase_I	119272346	NM_006777	B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	ENST00000326624.2	37	CCDS14596.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445155	0.43429	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.10960	2.82;2.82	5.55	4.68	0.58851	.	0.070286	0.56097	D	0.000035	T	0.17916	0.0430	L	0.27053	0.805	0.39158	D	0.96234	D	0.69078	0.997	D	0.70487	0.969	T	0.06954	-1.0798	10	0.30854	T	0.27	-4.5799	11.1759	0.48598	0.0871:0.0:0.9129:0.0	.	350	Q86T24	KAISO_HUMAN	I	350	ENSP00000314153:V350I;ENSP00000450969:V350I	ENSP00000314153:V350I	V	+	1	0	ZBTB33;AC002086.1	119272346	0.999000	0.42202	0.841000	0.33234	0.947000	0.59692	2.849000	0.48286	1.227000	0.43598	0.513000	0.50165	GTC		0.413	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058085.2	NM_006777	
NMS	129521	hgsc.bcm.edu	37	2	101089304	101089304	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr2:101089304C>A	ENST00000376865.1	+	2	131	c.124C>A	c.(124-126)Cag>Aag	p.Q42K		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	42					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.Q42K(1)		breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						GGATATTGTGCAGCTTGAGGT	0.328																																					p.Q42K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C124A	2						.						160.0	148.0	152.0					2																	101089304		2203	4300	6503	100455736	SO:0001583	missense	129521	exon2			AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.124C>A	2.37:g.101089304C>A	ENSP00000366061:p.Gln42Lys	Somatic		Capture	SOLID	Phase_I	100455736	NM_001011717		Missense_Mutation	SNP	ENST00000376865.1	37	CCDS33259.1	.	.	.	.	.	.	.	.	.	.	C	8.745	0.919934	0.17982	.	.	ENSG00000204640	ENST00000376865	T	0.46063	0.88	4.49	1.57	0.23409	.	1.276180	0.05491	N	0.556665	T	0.25531	0.0621	N	0.19112	0.55	0.21861	N	0.999505	B	0.12013	0.005	B	0.09377	0.004	T	0.19095	-1.0316	10	0.27082	T	0.32	-0.128	2.7013	0.05149	0.1949:0.5214:0.1806:0.1032	.	42	Q5H8A3	NMS_HUMAN	K	42	ENSP00000366061:Q42K	ENSP00000366061:Q42K	Q	+	1	0	NMS	100455736	0.007000	0.16637	0.426000	0.26672	0.984000	0.73092	-0.298000	0.08265	0.112000	0.17975	0.455000	0.32223	CAG		0.328	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329737.1	NM_001011717	
CREG2	200407	hgsc.bcm.edu	37	2	101967444	101967444	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr2:101967444C>T	ENST00000324768.5	-	4	951	c.814G>A	c.(814-816)Gga>Aga	p.G272R		NM_153836.3	NP_722578.1	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2	272						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)	p.G272R(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						GATGCGCCTCCATACCATTTC	0.438																																					p.G272R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G814A	2						.						119.0	114.0	116.0					2																	101967444		2203	4300	6503	101333876	SO:0001583	missense	200407	exon4			AB046109	CCDS2052.1	2q12.1	2007-08-01			ENSG00000175874	ENSG00000175874			14272	protein-coding gene	gene with protein product						12408961	Standard	NM_153836		Approved		uc002tba.2	Q8IUH2	OTTHUMG00000130692	ENST00000324768.5:c.814G>A	2.37:g.101967444C>T	ENSP00000315203:p.Gly272Arg	Somatic		Capture	SOLID	Phase_I	101333876	NM_153836	Q86X03|Q8N540|Q8N9E3	Missense_Mutation	SNP	ENST00000324768.5	37	CCDS2052.1	.	.	.	.	.	.	.	.	.	.	C	30	5.053134	0.93793	.	.	ENSG00000175874	ENST00000324768	T	0.68025	-0.3	5.88	5.88	0.94601	FMN-binding split barrel-related (1);FMN-binding split barrel (1);	0.000000	0.85682	D	0.000000	D	0.86611	0.5974	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89052	0.3456	10	0.87932	D	0	.	18.4085	0.90542	0.0:1.0:0.0:0.0	.	272	Q8IUH2	CREG2_HUMAN	R	272	ENSP00000315203:G272R	ENSP00000315203:G272R	G	-	1	0	CREG2	101333876	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.702000	0.74628	2.778000	0.95560	0.655000	0.94253	GGA		0.438	CREG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253188.2	NM_153836	
DARS	1615	hgsc.bcm.edu	37	2	136670078	136670078	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr2:136670078G>A	ENST00000264161.4	-	13	1423	c.1208C>T	c.(1207-1209)aCc>aTc	p.T403I	DARS_ENST00000537273.1_Missense_Mutation_p.T303I	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	403					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.T403I(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	GTCAGGCATGGTATAGAAAGG	0.294																																					p.T403I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1208T	2						.						66.0	75.0	72.0					2																	136670078		2203	4297	6500	136386548	SO:0001583	missense	1615	exon13			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.1208C>T	2.37:g.136670078G>A	ENSP00000264161:p.Thr403Ile	Somatic		Capture	SOLID	Phase_I	136386548	NM_001349	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	ENST00000264161.4	37	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851415	0.91355	.	.	ENSG00000115866	ENST00000264161;ENST00000537273	T;T	0.79653	-1.29;-1.29	5.98	5.98	0.97165	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.87908	0.6296	M	0.86343	2.81	0.80722	D	1	P	0.46621	0.881	P	0.47744	0.556	D	0.89250	0.3590	10	0.87932	D	0	-10.431	20.4366	0.99092	0.0:0.0:1.0:0.0	.	403	P14868	SYDC_HUMAN	I	403;303	ENSP00000264161:T403I;ENSP00000444192:T303I	ENSP00000264161:T403I	T	-	2	0	DARS	136386548	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.707000	0.84623	2.843000	0.97960	0.585000	0.79938	ACC		0.294	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349	
GAD1	2571	hgsc.bcm.edu	37	2	171716383	171716383	+	Silent	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr2:171716383G>A	ENST00000358196.3	+	17	2326	c.1776G>A	c.(1774-1776)caG>caA	p.Q592Q		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	592					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.Q592Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						GACTGGGCCAGGATCTGTAAT	0.493																																					p.Q592Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1776A	2						.						64.0	60.0	61.0					2																	171716383		2203	4300	6503	171424629	SO:0001819	synonymous_variant	2571	exon17				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1776G>A	2.37:g.171716383G>A		Somatic		Capture	SOLID	Phase_I	171424629	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Silent	SNP	ENST00000358196.3	37	CCDS2239.1																																																																																				0.493	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
GALNT14	79623	hgsc.bcm.edu	37	2	31215718	31215718	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr2:31215718G>T	ENST00000349752.5	-	2	924	c.285C>A	c.(283-285)gaC>gaA	p.D95E	GALNT14_ENST00000324589.5_Intron|GALNT14_ENST00000356174.3_Missense_Mutation_p.D95E|GALNT14_ENST00000420311.2_Missense_Mutation_p.D60E|AC009305.1_ENST00000449780.1_RNA|GALNT14_ENST00000406653.1_Missense_Mutation_p.D75E	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	95					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.D95E(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					GATGGCGAGTGTCCGGGATGG	0.557																																					p.D95E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C285A	2						.						106.0	102.0	103.0					2																	31215718		2203	4300	6503	31069222	SO:0001583	missense	79623	exon2			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.285C>A	2.37:g.31215718G>T	ENSP00000288988:p.Asp95Glu	Somatic		Capture	SOLID	Phase_I	31069222	NM_024572	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504282	0.26949	.	.	ENSG00000158089	ENST00000349752;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T	0.73152	0.14;0.14;-0.39;0.14;-0.72	4.96	1.23	0.21249	.	.	.	.	.	D	0.82875	0.5132	M	0.85945	2.785	0.54753	D	0.999987	P;P;D;B;D	0.89917	0.602;0.467;1.0;0.168;0.997	B;B;D;B;D	0.83275	0.397;0.144;0.996;0.067;0.953	T	0.81747	-0.0791	9	0.87932	D	0	.	9.8161	0.40853	0.2739:0.0:0.7261:0.0	.	60;60;95;95;75	F5H263;B7Z5C5;Q96FL9-2;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	E	95;75;95;60;95	ENSP00000288988:D95E;ENSP00000385435:D75E;ENSP00000348497:D95E;ENSP00000415514:D60E;ENSP00000406399:D95E	ENSP00000288988:D95E	D	-	3	2	GALNT14	31069222	1.000000	0.71417	0.994000	0.49952	0.128000	0.20619	2.328000	0.43867	0.041000	0.15688	-0.254000	0.11334	GAC		0.557	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
SH3BP4	23677	hgsc.bcm.edu	37	2	235961294	235961294	+	Missense_Mutation	SNP	G	G	A	rs139519179		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr2:235961294G>A	ENST00000409212.1	+	5	3074	c.2567G>A	c.(2566-2568)cGc>cAc	p.R856H	SH3BP4_ENST00000392011.2_Missense_Mutation_p.R856H|SH3BP4_ENST00000344528.4_Missense_Mutation_p.R856H			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	856					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.R856H(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GTGGCCCAGCGCTGGCGGGAG	0.632																																					p.R856H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2567A	2						.	G	HIS/ARG	1,4389		0,1,2194	34.0	30.0	31.0		2567	4.8	1.0	2	dbSNP_134	31	0,8588		0,0,4294	no	missense	SH3BP4	NM_014521.2	29	0,1,6488	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging	856/964	235961294	1,12977	2195	4294	6489	235626033	SO:0001583	missense	23677	exon5			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.2567G>A	2.37:g.235961294G>A	ENSP00000386862:p.Arg856His	Somatic		Capture	SOLID	Phase_I	235626033	NM_014521	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221083	0.79464	2.28E-4	0.0	ENSG00000130147	ENST00000392011;ENST00000409212;ENST00000344528;ENST00000538289	T;T;T	0.34667	1.35;1.35;1.35	5.72	4.85	0.62838	.	0.048468	0.85682	D	0.000000	T	0.59074	0.2167	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.60667	-0.7218	10	0.44086	T	0.13	-33.1419	13.5689	0.61834	0.0751:0.0:0.9249:0.0	.	856;856	A8K594;Q9P0V3	.;SH3B4_HUMAN	H	856;856;856;94	ENSP00000375867:R856H;ENSP00000386862:R856H;ENSP00000340237:R856H	ENSP00000340237:R856H	R	+	2	0	SH3BP4	235626033	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	9.549000	0.98106	1.417000	0.47077	0.655000	0.94253	CGC		0.632	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
C5	727	hgsc.bcm.edu	37	9	123751382	123751382	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr9:123751382A>G	ENST00000223642.1	-	25	3201	c.3172T>C	c.(3172-3174)Tcc>Ccc	p.S1058P		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1058					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.S1058P(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TTTCTGTAGGACATAATGCTC	0.413																																					p.S1058P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3172C	9						.						137.0	122.0	127.0					9																	123751382		2203	4300	6503	122791203	SO:0001583	missense	727	exon25			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3172T>C	9.37:g.123751382A>G	ENSP00000223642:p.Ser1058Pro	Somatic		Capture	SOLID	Phase_I	122791203	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981256	0.74474	.	.	ENSG00000106804	ENST00000223642	T	0.35421	1.31	5.45	5.45	0.79879	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.000000	0.85682	D	0.000000	T	0.62877	0.2464	M	0.86028	2.79	0.45108	D	0.998123	D	0.89917	1.0	D	0.91635	0.999	T	0.68405	-0.5417	10	0.66056	D	0.02	.	12.1897	0.54264	1.0:0.0:0.0:0.0	.	1058	P01031	CO5_HUMAN	P	1058	ENSP00000223642:S1058P	ENSP00000223642:S1058P	S	-	1	0	C5	122791203	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.117000	0.57877	2.195000	0.70347	0.533000	0.62120	TCC		0.413	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
SOHLH2	54937	hgsc.bcm.edu	37	13	36776121	36776121	+	Missense_Mutation	SNP	G	G	A	rs142901524		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr13:36776121G>A	ENST00000379881.3	-	2	246	c.158C>T	c.(157-159)aCg>aTg	p.T53M	CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.T130M|SOHLH2_ENST00000554962.1_Missense_Mutation_p.T130M|SOHLH2_ENST00000317764.6_Missense_Mutation_p.T53M	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	53					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T53M(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		TGCCTCCTTCGTGTCACTGAT	0.458																																					p.T53M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C158T	13						.	A	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	154.0	118.0	130.0		389,158	2.0	0.0	13	dbSNP_134	130	0,8600		0,0,4300	no	missense,missense	SOHLH2,CCDC169-SOHLH2	NM_001198910.1,NM_017826.2	81,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	130/503,53/426	36776121	1,13005	2203	4300	6503	35674121	SO:0001583	missense	54937	exon2			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.158C>T	13.37:g.36776121G>A	ENSP00000369210:p.Thr53Met	Somatic		Capture	SOLID	Phase_I	35674121	NM_017826	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	g	1.541	-0.541865	0.04053	2.27E-4	0.0	ENSG00000120669;ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000317764;ENST00000511166	T;T;T;T	0.45276	1.5;1.5;0.9;1.5	5.69	1.95	0.26073	.	0.440276	0.19264	N	0.118593	T	0.20941	0.0504	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.16748	-1.0392	10	0.31617	T	0.26	-0.2253	9.2812	0.37729	0.8398:0.0:0.1602:0.0	.	130;53	B4DX90;Q9NX45	.;SOLH2_HUMAN	M	53;130;53;130	ENSP00000369210:T53M;ENSP00000451542:T130M;ENSP00000326838:T53M;ENSP00000421868:T130M	ENSP00000421868:T130M	T	-	2	0	CCDC169-SOHLH2;SOHLH2	35674121	0.005000	0.15991	0.003000	0.11579	0.000000	0.00434	0.914000	0.28624	0.123000	0.18342	-0.959000	0.02639	ACG		0.458	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
MYO16	23026	hgsc.bcm.edu	37	13	109753200	109753200	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr13:109753200C>G	ENST00000357550.2	+	27	3378	c.3337C>G	c.(3337-3339)Ctt>Gtt	p.L1113V	MYO16_ENST00000457511.2_Missense_Mutation_p.L625V|MYO16-AS2_ENST00000412809.1_RNA|MYO16_ENST00000356711.2_Missense_Mutation_p.L1113V	NM_001198950.1	NP_001185879.1			myosin XVI									p.L1113V(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GCGATGTCGACTTGTTCTCCA	0.438																																					p.L1135V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3403G	13						.						82.0	73.0	76.0					13																	109753200		2203	4300	6503	108551201	SO:0001583	missense	23026	exon28				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3337C>G	13.37:g.109753200C>G	ENSP00000350160:p.Leu1113Val	Somatic		Capture	SOLID	Phase_I	108551201	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	0.494	-0.874185	0.02550	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	D;D;D	0.87179	-2.22;-2.22;-2.22	5.45	2.7	0.31948	Myosin head, motor domain (2);	0.719490	0.11236	U	0.585103	T	0.81365	0.4807	L	0.41415	1.275	0.09310	N	1	B;B	0.24132	0.098;0.036	B;B	0.29785	0.107;0.06	T	0.65857	-0.6066	9	.	.	.	.	7.8296	0.29334	0.0:0.7262:0.0:0.2738	.	625;1113	F8W883;Q9Y6X6	.;MYO16_HUMAN	V	1113;1113;625	ENSP00000349145:L1113V;ENSP00000350160:L1113V;ENSP00000401633:L625V	.	L	+	1	0	MYO16	108551201	0.581000	0.26741	0.007000	0.13788	0.117000	0.20001	1.011000	0.29911	0.234000	0.21139	-0.137000	0.14449	CTT		0.438	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
MAT1A	4143	hgsc.bcm.edu	37	10	82036290	82036290	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr10:82036290C>T	ENST00000372213.3	-	6	870	c.610G>A	c.(610-612)Gtc>Atc	p.V204I	MAT1A_ENST00000485270.1_5'Flank	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	204					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)	p.V204I(1)		endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	ACAGAGATGACGATGGTGTGG	0.582																																					p.V204I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G610A	10						.						202.0	161.0	175.0					10																	82036290		2203	4300	6503	82026270	SO:0001583	missense	4143	exon6				CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.610G>A	10.37:g.82036290C>T	ENSP00000361287:p.Val204Ile	Somatic		Capture	SOLID	Phase_I	82026270	NM_000429	D3DWD5|Q5QP09	Missense_Mutation	SNP	ENST00000372213.3	37	CCDS7365.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.719904	0.89205	.	.	ENSG00000151224	ENST00000372213;ENST00000372206;ENST00000455001	D;D	0.85556	-2.0;-2.0	4.84	4.84	0.62591	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.115579	0.64402	D	0.000016	D	0.91734	0.7386	M	0.91768	3.24	0.80722	D	1	D	0.55605	0.972	P	0.53224	0.721	D	0.93510	0.6852	10	0.87932	D	0	-58.1133	15.8349	0.78791	0.0:1.0:0.0:0.0	.	204	Q00266	METK1_HUMAN	I	204;204;141	ENSP00000361287:V204I;ENSP00000414961:V141I	ENSP00000361280:V204I	V	-	1	0	MAT1A	82026270	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.320000	0.79064	2.677000	0.91161	0.655000	0.94253	GTC		0.582	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
CRTAC1	55118	hgsc.bcm.edu	37	10	99677378	99677378	+	Silent	SNP	G	G	A	rs145011978		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr10:99677378G>A	ENST00000370597.3	-	5	949	c.594C>T	c.(592-594)taC>taT	p.Y198Y	CRTAC1_ENST00000370591.2_Silent_p.Y198Y|CRTAC1_ENST00000298819.4_Silent_p.Y198Y	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	198						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.Y198Y(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TACCGTAGGCGTAATTGGCAA	0.592																																					p.Y198Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C594T	10						.	A	,	1,4405	2.1+/-5.4	0,1,2202	72.0	57.0	62.0		594,594	-5.1	1.0	10	dbSNP_134	62	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CRTAC1	NM_001206528.2,NM_018058.6	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	198/646,198/662	99677378	1,13005	2203	4300	6503	99667368	SO:0001819	synonymous_variant	55118	exon5			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.594C>T	10.37:g.99677378G>A		Somatic		Capture	SOLID	Phase_I	99667368	NM_018058	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Silent	SNP	ENST00000370597.3	37	CCDS31266.1																																																																																				0.592	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058	
PKD2L1	9033	hgsc.bcm.edu	37	10	102058401	102058401	+	Missense_Mutation	SNP	G	G	A	rs186268157	byFrequency	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr10:102058401G>A	ENST00000318222.3	-	4	1031	c.649C>T	c.(649-651)Cgg>Tgg	p.R217W	PKD2L1_ENST00000338519.3_Missense_Mutation_p.R217W|PKD2L1_ENST00000353274.3_Missense_Mutation_p.R217W	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	217					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)	p.R217W(1)		NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		ATGTCCTCCCGGAAGTCTTCA	0.537													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17423	0.0		0.001	False		,,,				2504	0.0				p.R217W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C649T	10						.						112.0	102.0	106.0					10																	102058401		2203	4300	6503	102048391	SO:0001583	missense	9033	exon4			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.649C>T	10.37:g.102058401G>A	ENSP00000325296:p.Arg217Trp	Somatic		Capture	SOLID	Phase_I	102048391	NM_016112	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	CCDS7492.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	22.6	4.314629	0.81358	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.70869	-0.52;-0.52;-0.52	5.32	4.36	0.52297	Polycystin cation channel, PKD1/PKD2 (1);	0.165870	0.51477	D	0.000093	T	0.75576	0.3868	L	0.43923	1.385	0.42695	D	0.993599	D;D	0.89917	1.0;0.998	P;D	0.67725	0.862;0.953	T	0.75522	-0.3288	10	0.48119	T	0.1	-5.9656	11.0636	0.47961	0.0:0.0:0.6637:0.3363	.	170;217	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	W	217	ENSP00000345068:R217W;ENSP00000266049:R217W;ENSP00000325296:R217W	ENSP00000325296:R217W	R	-	1	2	PKD2L1	102048391	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	1.594000	0.36697	2.490000	0.84030	0.561000	0.74099	CGG		0.537	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112	
STARD4	134429	hgsc.bcm.edu	37	5	110836795	110836795	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:110836795T>C	ENST00000296632.3	-	5	436	c.302A>G	c.(301-303)tAc>tGc	p.Y101C	STARD4_ENST00000512160.1_3'UTR|STARD4_ENST00000511569.1_5'UTR|STARD4_ENST00000502322.1_Missense_Mutation_p.Y101C|STARD4_ENST00000509887.1_3'UTR	NM_139164.1	NP_631903.1	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain containing 4	101	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)	p.Y101C(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	12		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)		AGCAGTAGTGTAACGCATCAC	0.348																																					p.Y101C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A302G	5						.						96.0	102.0	100.0					5																	110836795		2202	4300	6502	110864694	SO:0001583	missense	134429	exon5			AF480299	CCDS4104.1	5q22	2011-09-12	2007-08-16		ENSG00000164211	ENSG00000164211		"""StAR-related lipid transfer (START) domain containing"""	18058	protein-coding gene	gene with protein product		607049	"""START domain containing 4, sterol regulated"""			12011452	Standard	NM_139164		Approved		uc003kph.1	Q96DR4	OTTHUMG00000128793	ENST00000296632.3:c.302A>G	5.37:g.110836795T>C	ENSP00000296632:p.Tyr101Cys	Somatic		Capture	SOLID	Phase_I	110864694	NM_139164	Q86TN9	Missense_Mutation	SNP	ENST00000296632.3	37	CCDS4104.1	.	.	.	.	.	.	.	.	.	.	T	19.93	3.917321	0.73098	.	.	ENSG00000164211	ENST00000296632;ENST00000505803;ENST00000502322	T;T;T	0.80033	-1.33;-1.33;-1.33	5.71	5.71	0.89125	Lipid-binding START (2);START-like domain (1);	0.000000	0.64402	D	0.000003	D	0.88731	0.6516	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.88172	0.2865	10	0.40728	T	0.16	-16.4912	15.9905	0.80202	0.0:0.0:0.0:1.0	.	101;101	Q86TN9;Q96DR4	.;STAR4_HUMAN	C	101	ENSP00000296632:Y101C;ENSP00000427478:Y101C;ENSP00000427639:Y101C	ENSP00000296632:Y101C	Y	-	2	0	STARD4	110864694	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.274000	0.72587	2.187000	0.69744	0.533000	0.62120	TAC		0.348	STARD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250720.1	NM_139164	
APC	324	hgsc.bcm.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	SOLID	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FBN2	2201	hgsc.bcm.edu	37	5	127671703	127671703	+	Missense_Mutation	SNP	G	G	A	rs368105987		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:127671703G>A	ENST00000508053.1	-	34	4675	c.3701C>T	c.(3700-3702)aCg>aTg	p.T1234M	FBN2_ENST00000262464.4_Missense_Mutation_p.T1234M|FBN2_ENST00000507835.1_Missense_Mutation_p.T84M|FBN2_ENST00000508989.1_Missense_Mutation_p.T1201M			P35556	FBN2_HUMAN	fibrillin 2	1234	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T1234M(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCGGTCTGGCGTAGCCTGATA	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		20907	0.0		0.0	False		,,,				2504	0.001				p.T1234M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3701T	5						.	G	MET/THR	0,4406		0,0,2203	85.0	76.0	79.0		3701	3.8	0.9	5		79	1,8599	1.2+/-3.3	0,1,4299	no	missense	FBN2	NM_001999.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1234/2913	127671703	1,13005	2203	4300	6503	127699602	SO:0001583	missense	2201	exon28			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3701C>T	5.37:g.127671703G>A	ENSP00000424571:p.Thr1234Met	Somatic		Capture	SOLID	Phase_I	127699602	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350092	0.61183	0.0	1.16E-4	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98	4.7	3.84	0.44239	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.072319	0.53938	N	0.000054	D	0.93756	0.8004	L	0.42008	1.315	0.51233	D	0.999919	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.94222	0.7468	10	0.87932	D	0	.	13.5342	0.61639	0.0755:0.0:0.9245:0.0	.	1201;1234	D6RJI3;P35556	.;FBN2_HUMAN	M	1234;1234;84;1201	ENSP00000262464:T1234M;ENSP00000424571:T1234M;ENSP00000426839:T84M;ENSP00000425596:T1201M	ENSP00000262464:T1234M	T	-	2	0	FBN2	127699602	1.000000	0.71417	0.871000	0.34182	0.516000	0.34256	6.566000	0.73978	1.361000	0.45981	-0.363000	0.07495	ACG		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FBN2	2201	hgsc.bcm.edu	37	5	127700375	127700375	+	Silent	SNP	C	C	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:127700375C>G	ENST00000508053.1	-	24	3320	c.2346G>C	c.(2344-2346)ggG>ggC	p.G782G	FBN2_ENST00000262464.4_Silent_p.G782G|FBN2_ENST00000511489.1_5'Flank|FBN2_ENST00000508989.1_Silent_p.G749G			P35556	FBN2_HUMAN	fibrillin 2	782	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.G782G(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTTCACAAATCCCATTGGCAC	0.338																																					p.G782G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2346C	5						.						94.0	89.0	91.0					5																	127700375		2203	4300	6503	127728274	SO:0001819	synonymous_variant	2201	exon18			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2346G>C	5.37:g.127700375C>G		Somatic		Capture	SOLID	Phase_I	127728274	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																				0.338	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
GALNT10	55568	hgsc.bcm.edu	37	5	153789139	153789139	+	Silent	SNP	C	C	T	rs557019914		TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:153789139C>T	ENST00000297107.6	+	9	1340	c.1203C>T	c.(1201-1203)taC>taT	p.Y401Y	GALNT10_ENST00000377657.3_Silent_p.Y74Y|GALNT10_ENST00000377661.2_Silent_p.Y339Y|SAP30L-AS1_ENST00000524264.1_RNA|SAP30L-AS1_ENST00000519727.1_RNA	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	401					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.Y401Y(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TGGATGAGTACGCAGAGTACA	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17027	0.0		0.0	False		,,,				2504	0.0				p.Y401Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1203T	5						.						124.0	133.0	130.0					5																	153789139		2203	4300	6503	153769332	SO:0001819	synonymous_variant	55568	exon9			AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.1203C>T	5.37:g.153789139C>T		Somatic		Capture	SOLID	Phase_I	153769332	NM_198321	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Silent	SNP	ENST00000297107.6	37	CCDS4325.1																																																																																				0.562	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321	
RICTOR	253260	hgsc.bcm.edu	37	5	38991081	38991081	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:38991081G>A	ENST00000357387.3	-	7	583	c.553C>T	c.(553-555)Cga>Tga	p.R185*	RICTOR_ENST00000296782.5_Nonsense_Mutation_p.R185*	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.R185*(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					ATGCATGCTCGGACCATTCTG	0.333																																					p.R185X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C553T	5						.						101.0	90.0	94.0					5																	38991081		2203	4299	6502	39026838	SO:0001587	stop_gained	253260	exon7				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.553C>T	5.37:g.38991081G>A	ENSP00000349959:p.Arg185*	Somatic		Capture	SOLID	Phase_I	39026838	NM_152756		Nonsense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013314	0.93346	.	.	ENSG00000164327	ENST00000357387;ENST00000296782;ENST00000514735	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3536	18.6031	0.91256	0.0:0.0:1.0:0.0	.	.	.	.	X	185;185;169	.	ENSP00000296782:R185X	R	-	1	2	RICTOR	39026838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.479000	0.81095	2.371000	0.80710	0.591000	0.81541	CGA		0.333	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
PIK3R1	5295	hgsc.bcm.edu	37	5	67591097	67591097	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:67591097A>G	ENST00000521381.1	+	13	2306	c.1690A>G	c.(1690-1692)Aac>Gac	p.N564D	PIK3R1_ENST00000336483.5_Missense_Mutation_p.N294D|PIK3R1_ENST00000396611.1_Missense_Mutation_p.N564D|PIK3R1_ENST00000523872.1_Missense_Mutation_p.N201D|PIK3R1_ENST00000521657.1_Missense_Mutation_p.N564D|PIK3R1_ENST00000274335.5_Missense_Mutation_p.N564D|PIK3R1_ENST00000320694.8_Missense_Mutation_p.N264D	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	564					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.N564D(4)|p.D560_S565del(1)|p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	CAAACGTATGAACAGCATTAA	0.373			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.N564D			Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	PIK3R1,central_nervous_system,brain,Substitution - Missense,-2	.	7	Substitution - Missense(4)|Whole gene deletion(1)|Deletion - In frame(1)|Unknown(1)	large_intestine(3)|central_nervous_system(2)|lung(1)|endometrium(1)	c.A1690G	5						.						146.0	145.0	146.0					5																	67591097		2203	4300	6503	67626853	SO:0001583	missense	5295	exon12			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1690A>G	5.37:g.67591097A>G	ENSP00000428056:p.Asn564Asp	Somatic		Capture	SOLID	Phase_I	67626853	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	ENST00000521381.1	37	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694508	0.88830	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000336483;ENST00000523872	T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.51822	0.1697	M	0.84846	2.72	0.80722	D	1	B;B;B;P	0.50272	0.162;0.107;0.082;0.933	B;B;B;P	0.53450	0.202;0.352;0.236;0.726	T	0.61535	-0.7043	10	0.66056	D	0.02	-28.8288	14.3587	0.66754	1.0:0.0:0.0:0.0	.	234;294;264;564	B7Z2N8;P27986-2;P27986-3;P27986	.;.;.;P85A_HUMAN	D	564;564;564;564;264;294;201	ENSP00000428056:N564D;ENSP00000429277:N564D;ENSP00000379855:N564D;ENSP00000274335:N564D;ENSP00000323512:N264D;ENSP00000338554:N294D;ENSP00000430098:N201D	ENSP00000274335:N564D	N	+	1	0	PIK3R1	67626853	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.087000	0.94110	2.036000	0.60181	0.377000	0.23210	AAC		0.373	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
DOCK2	1794	hgsc.bcm.edu	37	5	169435601	169435601	+	Splice_Site	SNP	A	A	C			TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3552-01A-01W-0831-10	TCGA-AA-3552-10A-01W-0831-10	g.chr5:169435601A>C	ENST00000256935.8	+	31	3253	c.3173A>C	c.(3172-3174)aAg>aCg	p.K1058T	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Splice_Site_p.K119T|DOCK2_ENST00000520908.1_Splice_Site_p.K550T	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1058	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.K1058T(2)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCCTGAATAAGTAGGTTGCA	0.468																																					p.K1058T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3173C	5						.						135.0	132.0	133.0					5																	169435601		2203	4300	6503	169368179	SO:0001630	splice_region_variant	1794	exon31			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3173+1A>C	5.37:g.169435601A>C		Somatic		Capture	SOLID	Phase_I	169368179	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.793522	0.70452	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.55052	0.54;0.54;0.54	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.70806	0.3266	M	0.76938	2.355	0.58432	D	0.999996	P;D	0.76494	0.915;0.999	P;D	0.78314	0.549;0.991	T	0.68176	-0.5478	10	0.14252	T	0.57	.	15.9958	0.80243	1.0:0.0:0.0:0.0	.	550;1058	E7ERW7;Q92608	.;DOCK2_HUMAN	T	1058;550;119	ENSP00000256935:K1058T;ENSP00000429283:K550T;ENSP00000438827:K119T	ENSP00000256935:K1058T	K	+	2	0	DOCK2	169368179	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.188000	0.69820	0.533000	0.62120	AAG		0.468	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	Missense_Mutation
