#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SDK1	221935	hgsc.bcm.edu	37	7	4008969	4008969	+	Missense_Mutation	SNP	G	G	A	rs140446821	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr7:4008969G>A	ENST00000404826.2	+	11	1766	c.1627G>A	c.(1627-1629)Gtc>Atc	p.V543I	SDK1_ENST00000389531.3_Missense_Mutation_p.V543I	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	543	Ig-like C2-type 5.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V543I(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GATCGCGCCCGTCTTCATCCA	0.552													G|||	4	0.000798722	0.0023	0.0014	5008	,	,		15758	0.0		0.0	False		,,,				2504	0.0				p.V543I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1627A	7						.	G	ILE/VAL	8,4398	14.3+/-33.2	0,8,2195	166.0	175.0	172.0		1627	5.6	0.1	7	dbSNP_134	172	1,8599		0,1,4299	yes	missense	SDK1	NM_152744.3	29	0,9,6494	AA,AG,GG		0.0116,0.1816,0.0692	benign	543/2214	4008969	9,12997	2203	4300	6503	3975495	SO:0001583	missense	221935	exon11			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1627G>A	7.37:g.4008969G>A	ENSP00000385899:p.Val543Ile	Somatic		Capture	SOLID	Phase_I	3975495	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	10.46	1.356249	0.24598	0.001816	1.16E-4	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.69306	-0.39;-0.39	5.63	5.63	0.86233	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.086231	0.47093	D	0.000252	T	0.53238	0.1784	L	0.35793	1.09	0.09310	N	1	P	0.47910	0.902	B	0.36567	0.228	T	0.55903	-0.8067	10	0.07030	T	0.85	.	20.0572	0.97657	0.0:0.0:1.0:0.0	.	543	Q7Z5N4	SDK1_HUMAN	I	543	ENSP00000385899:V543I;ENSP00000374182:V543I	ENSP00000374182:V543I	V	+	1	0	SDK1	3975495	1.000000	0.71417	0.059000	0.19551	0.464000	0.32679	4.890000	0.63178	2.826000	0.97356	0.655000	0.94253	GTC		0.552	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
TBRG4	9238	hgsc.bcm.edu	37	7	45143809	45143809	+	Silent	SNP	G	G	T	rs144224340	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr7:45143809G>T	ENST00000258770.3	-	5	1075	c.954C>A	c.(952-954)acC>acA	p.T318T	TBRG4_ENST00000361278.3_Intron|SNORA5B_ENST00000363786.1_RNA|SNORA5C_ENST00000364902.1_RNA|TBRG4_ENST00000395655.4_Intron|SNORA5A_ENST00000384111.1_RNA|TBRG4_ENST00000494076.1_Silent_p.T318T	NM_004749.3	NP_004740.2	Q969Z0	TBRG4_HUMAN	transforming growth factor beta regulator 4	318					cell cycle arrest (GO:0007050)|cellular respiration (GO:0045333)|positive regulation of cell proliferation (GO:0008284)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.T318T(1)		cervix(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(2)	17						ATAGCAGGTCGGTGGCCAGGC	0.587																																					p.T318T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C954A	7						.						74.0	67.0	69.0					7																	45143809		2203	4300	6503	45110334	SO:0001819	synonymous_variant	9238	exon5			AB023165	CCDS5501.1, CCDS5502.1	7p13	2006-07-07			ENSG00000136270	ENSG00000136270			17443	protein-coding gene	gene with protein product	"""FAST kinase domains 4"", ""cell cycle progression 2 protein"""	611325				9383053	Standard	NM_004749		Approved	Cpr2, KIAA0948, H_TD2522F11.8, FASTKD4	uc011kcd.3	Q969Z0	OTTHUMG00000129247	ENST00000258770.3:c.954C>A	7.37:g.45143809G>T		Somatic		Capture	SOLID	Phase_I	45110334	NM_004749	A4D2L2|A4D2L3|D3DVL5|D3DVL6|O14710|Q53GI8|Q8NDM4|Q9BUC6|Q9Y2F6	Silent	SNP	ENST00000258770.3	37	CCDS5501.1																																																																																				0.587	TBRG4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251351.1	NM_030900	
STYXL1	51657	hgsc.bcm.edu	37	7	75643160	75643160	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr7:75643160C>T	ENST00000248600.1	-	5	695	c.353G>A	c.(352-354)cGc>cAc	p.R118H	STYXL1_ENST00000431581.1_Missense_Mutation_p.R118H|STYXL1_ENST00000451157.1_Missense_Mutation_p.R118H|STYXL1_ENST00000460184.2_5'UTR|STYXL1_ENST00000359697.3_Missense_Mutation_p.R118H|STYXL1_ENST00000340062.5_Intron|STYXL1_ENST00000360591.3_Intron	NM_016086.2	NP_057170.1	Q9Y6J8	STYL1_HUMAN	serine/threonine/tyrosine interacting-like 1	118	Rhodanese.				intracellular signal transduction (GO:0035556)|protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R118H(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	10						GTGGGTGAGGCGGGTCAGGAT	0.542																																					p.R118H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G353A	7						.						145.0	136.0	139.0					7																	75643160		2203	4300	6503	75481096	SO:0001583	missense	51657	exon5			AF069762	CCDS5580.1	7q11.23	2011-06-09	2005-09-22	2005-09-22	ENSG00000127952	ENSG00000127952		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	18165	protein-coding gene	gene with protein product			"""dual specificity phosphatase 24 (putative)"""	DUSP24		9757831	Standard	NM_016086		Approved	MK-STYX	uc003uel.3	Q9Y6J8	OTTHUMG00000130459	ENST00000248600.1:c.353G>A	7.37:g.75643160C>T	ENSP00000248600:p.Arg118His	Somatic		Capture	SOLID	Phase_I	75481096	NM_016086	Q9UBP1|Q9UK06|Q9UK07|Q9UKG2|Q9UKG3	Missense_Mutation	SNP	ENST00000248600.1	37	CCDS5580.1	.	.	.	.	.	.	.	.	.	.	C	5.423	0.263123	0.10294	.	.	ENSG00000127952	ENST00000248600;ENST00000359697;ENST00000404050;ENST00000431581;ENST00000454618;ENST00000451157	T;T;T;T;T	0.43688	1.78;1.78;1.78;0.94;1.78	5.58	0.541	0.17168	Rhodanese-like (4);	1.354230	0.04155	N	0.322046	T	0.21103	0.0508	N	0.02736	-0.51	0.09310	N	1	B;B;B	0.12630	0.004;0.006;0.004	B;B;B	0.09377	0.004;0.003;0.004	T	0.19128	-1.0315	10	0.27785	T	0.31	-2.2955	8.644	0.33994	0.0:0.3231:0.0:0.6769	.	118;118;118	C9J4H0;Q9Y6J8-2;Q9Y6J8	.;.;STYL1_HUMAN	H	118;118;118;118;73;118	ENSP00000248600:R118H;ENSP00000352726:R118H;ENSP00000392221:R118H;ENSP00000406073:R73H;ENSP00000411812:R118H	ENSP00000248600:R118H	R	-	2	0	STYXL1	75481096	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.001000	0.13038	-0.128000	0.11641	-0.378000	0.06908	CGC		0.542	STYXL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344825.1	NM_016086	
SVOPL	136306	hgsc.bcm.edu	37	7	138313016	138313016	+	Missense_Mutation	SNP	G	G	A	rs201768743	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr7:138313016G>A	ENST00000419765.3	-	10	989	c.956C>T	c.(955-957)gCg>gTg	p.A319V	SVOPL_ENST00000288513.5_Missense_Mutation_p.A167V|SVOPL_ENST00000463557.1_5'Flank|SVOPL_ENST00000436657.1_Missense_Mutation_p.A167V|SVOPL_ENST00000421622.1_Missense_Mutation_p.A199V	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	319						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.A167V(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						CACCACCACCGCAGAGTCTGA	0.567																																					p.A167V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C500T	7						.	T	VAL/ALA,VAL/ALA	0,4406		0,0,2203	96.0	94.0	95.0		956,500	4.2	0.0	7		95	2,8598		0,2,4298	yes	missense,missense	SVOPL	NM_001139456.1,NM_174959.2	64,64	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	319/493,167/341	138313016	2,13004	2203	4300	6503	137963556	SO:0001583	missense	136306	exon7			BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.956C>T	7.37:g.138313016G>A	ENSP00000405482:p.Ala319Val	Somatic		Capture	SOLID	Phase_I	137963556	NM_174959		Missense_Mutation	SNP	ENST00000419765.3	37	CCDS47721.1	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390938	0.25118	0.0	2.33E-4	ENSG00000157703	ENST00000288513;ENST00000421622;ENST00000436657;ENST00000419765	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	4.23	4.23	0.50019	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.784298	0.12102	N	0.499372	T	0.33147	0.0853	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21827	-1.0234	10	0.22109	T	0.4	-8.708	5.7584	0.18186	0.155:0.0:0.365:0.48	.	319;167	Q8N434;Q8N434-2	SVOPL_HUMAN;.	V	167;199;167;319	ENSP00000288513:A167V;ENSP00000412830:A199V;ENSP00000417018:A167V;ENSP00000405482:A319V	ENSP00000288513:A167V	A	-	2	0	SVOPL	137963556	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.331000	0.07914	0.665000	0.31066	-0.362000	0.07510	GCG		0.567	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342092.4	NM_174959	
NRXN3	9369	hgsc.bcm.edu	37	14	79175640	79175640	+	Silent	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr14:79175640C>T	ENST00000554719.1	+	4	674	c.183C>T	c.(181-183)ggC>ggT	p.G61G	NRXN3_ENST00000335750.5_Silent_p.G61G|RP11-232C2.2_ENST00000555680.1_RNA	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.G61G(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AAATCTATGGCGAAGTTGTGT	0.468																																					p.G61G												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C183T	14						.						102.0	99.0	100.0					14																	79175640		2203	4300	6503	78245393	SO:0001819	synonymous_variant	9369	exon4			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.183C>T	14.37:g.79175640C>T		Somatic		Capture	SOLID	Phase_I	78245393	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000554719.1	37	CCDS9870.1																																																																																				0.468	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
FLRT2	23768	hgsc.bcm.edu	37	14	86087992	86087992	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr14:86087992A>G	ENST00000330753.4	+	2	901	c.134A>G	c.(133-135)aAc>aGc	p.N45S	FLRT2_ENST00000554746.1_Missense_Mutation_p.N45S	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	45	LRRNT.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.N45S(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TGCGACAGGAACTTTGTCTAC	0.512																																					p.N45S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A134G	14						.						129.0	120.0	123.0					14																	86087992		2203	4300	6503	85157745	SO:0001583	missense	23768	exon2			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.134A>G	14.37:g.86087992A>G	ENSP00000332879:p.Asn45Ser	Somatic		Capture	SOLID	Phase_I	85157745	NM_013231	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.352552	0.41700	.	.	ENSG00000185070	ENST00000330753;ENST00000554746	D;D	0.95690	-3.78;-3.78	5.73	4.57	0.56435	Leucine-rich repeat-containing N-terminal (2);	0.101143	0.64402	D	0.000003	D	0.88851	0.6549	N	0.17345	0.48	0.30188	N	0.79977	B	0.30727	0.292	B	0.26517	0.07	T	0.82000	-0.0674	10	0.17832	T	0.49	-14.229	12.2339	0.54503	0.8724:0.0:0.0:0.1276	.	45	O43155	FLRT2_HUMAN	S	45	ENSP00000332879:N45S;ENSP00000451050:N45S	ENSP00000332879:N45S	N	+	2	0	FLRT2	85157745	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.465000	0.35299	0.972000	0.38314	0.533000	0.62120	AAC		0.512	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
FLRT2	23768	hgsc.bcm.edu	37	14	86088446	86088446	+	Silent	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr14:86088446C>T	ENST00000330753.4	+	2	1355	c.588C>T	c.(586-588)tcC>tcT	p.S196S	FLRT2_ENST00000554746.1_Silent_p.S196S	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	196					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.S196S(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CTGTCATATCCGACATGGCCT	0.507																																					p.S196S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C588T	14						.						110.0	111.0	111.0					14																	86088446		2203	4300	6503	85158199	SO:0001819	synonymous_variant	23768	exon2			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.588C>T	14.37:g.86088446C>T		Somatic		Capture	SOLID	Phase_I	85158199	NM_013231	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	CCDS9877.1																																																																																				0.507	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
FAM181A	90050	hgsc.bcm.edu	37	14	94394680	94394680	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr14:94394680G>A	ENST00000267594.5	+	3	542	c.235G>A	c.(235-237)Gcg>Acg	p.A79T	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000557000.2_Missense_Mutation_p.A17T|FAM181A_ENST00000556222.1_Missense_Mutation_p.A17T|FAM181A_ENST00000557719.1_Missense_Mutation_p.A17T	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	79								p.A79T(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						CGTGAACCTGGCGTCCAGCGA	0.602																																					p.A79T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235A	14						.						82.0	72.0	75.0					14																	94394680		2203	4300	6503	93464433	SO:0001583	missense	90050	exon3			BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.235G>A	14.37:g.94394680G>A	ENSP00000267594:p.Ala79Thr	Somatic		Capture	SOLID	Phase_I	93464433	NM_138344	B2RD39|Q96GY1	Missense_Mutation	SNP	ENST00000267594.5	37	CCDS9914.1	.	.	.	.	.	.	.	.	.	.	G	32	5.190483	0.94923	.	.	ENSG00000140067	ENST00000557719;ENST00000267594;ENST00000556222;ENST00000554404;ENST00000557000	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.79	4.79	0.61399	.	0.000000	0.56097	D	0.000028	D	0.82688	0.5091	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85062	0.0935	10	0.87932	D	0	-8.7789	17.8599	0.88778	0.0:0.0:1.0:0.0	.	79	Q8N9Y4	F181A_HUMAN	T	17;79;17;17;68	ENSP00000451802:A17T;ENSP00000267594:A79T;ENSP00000451678:A17T;ENSP00000452393:A17T	ENSP00000267594:A79T	A	+	1	0	FAM181A	93464433	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	9.841000	0.99482	2.220000	0.72140	0.491000	0.48974	GCG		0.602	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412840.1	NM_138344	
TSHZ3	57616	hgsc.bcm.edu	37	19	31768228	31768228	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr19:31768228G>A	ENST00000240587.4	-	2	2798	c.2471C>T	c.(2470-2472)aCg>aTg	p.T824M		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	824					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T641M(1)|p.T824M(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TGTCTTTGCCGTTGTCACCGT	0.522																																					p.T824M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2471T	19						.						132.0	117.0	122.0					19																	31768228		2203	4300	6503	36460068	SO:0001583	missense	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2471C>T	19.37:g.31768228G>A	ENSP00000240587:p.Thr824Met	Somatic		Capture	SOLID	Phase_I	36460068	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362886	0.24684	.	.	ENSG00000121297	ENST00000240587	T	0.11604	2.76	5.37	5.37	0.77165	.	0.150419	0.64402	D	0.000015	T	0.07458	0.0188	N	0.08118	0	0.42171	D	0.991641	B	0.16802	0.019	B	0.06405	0.002	T	0.38090	-0.9677	10	0.29301	T	0.29	-10.3937	19.1085	0.93307	0.0:0.0:1.0:0.0	.	824	Q63HK5	TSH3_HUMAN	M	824	ENSP00000240587:T824M	ENSP00000240587:T824M	T	-	2	0	TSHZ3	36460068	1.000000	0.71417	0.892000	0.35008	0.143000	0.21401	7.163000	0.77524	2.501000	0.84356	0.655000	0.94253	ACG		0.522	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
TSHZ3	57616	hgsc.bcm.edu	37	19	31770097	31770097	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr19:31770097C>A	ENST00000240587.4	-	2	929	c.602G>T	c.(601-603)aGc>aTc	p.S201I		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	201					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S201N(1)|p.S18N(1)|p.S18I(1)|p.S201I(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ATAGAGCTTGCTGCTCTGCCG	0.622																																					p.S201I												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.G602T	19						.						65.0	61.0	62.0					19																	31770097		2203	4300	6503	36461937	SO:0001583	missense	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.602G>T	19.37:g.31770097C>A	ENSP00000240587:p.Ser201Ile	Somatic		Capture	SOLID	Phase_I	36461937	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	18.18	3.567458	0.65651	.	.	ENSG00000121297	ENST00000240587	T	0.13657	2.57	5.42	5.42	0.78866	.	0.162845	0.56097	D	0.000039	T	0.21841	0.0526	L	0.47716	1.5	0.52501	D	0.999956	P	0.49307	0.922	P	0.47299	0.543	T	0.00482	-1.1713	10	0.72032	D	0.01	-24.2671	19.2151	0.93774	0.0:1.0:0.0:0.0	.	201	Q63HK5	TSH3_HUMAN	I	201	ENSP00000240587:S201I	ENSP00000240587:S201I	S	-	2	0	TSHZ3	36461937	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.885000	0.63142	2.509000	0.84616	0.655000	0.94253	AGC		0.622	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
FBN3	84467	hgsc.bcm.edu	37	19	8161801	8161801	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr19:8161801G>A	ENST00000600128.1	-	43	5791	c.5377C>T	c.(5377-5379)Cga>Tga	p.R1793*	FBN3_ENST00000270509.2_Nonsense_Mutation_p.R1793*|FBN3_ENST00000601739.1_Nonsense_Mutation_p.R1793*			Q75N90	FBN3_HUMAN	fibrillin 3	1793	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R1793*(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TTGTACCCTCGGGTGCACTTG	0.602																																					p.R1793X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C5377T	19						.						78.0	73.0	74.0					19																	8161801		2203	4300	6503	8067801	SO:0001587	stop_gained	84467	exon42				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5377C>T	19.37:g.8161801G>A	ENSP00000470498:p.Arg1793*	Somatic		Capture	SOLID	Phase_I	8067801	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Nonsense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	G	44	11.204972	0.99531	.	.	ENSG00000142449	ENST00000270509	.	.	.	3.39	2.21	0.28008	.	0.949703	0.08781	U	0.894613	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	5.6434	0.17577	0.0:0.1681:0.4756:0.3563	.	.	.	.	X	1793	.	ENSP00000270509:R1793X	R	-	1	2	FBN3	8067801	0.000000	0.05858	0.068000	0.19968	0.209000	0.24338	0.476000	0.22180	1.574000	0.49760	0.561000	0.74099	CGA		0.602	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
NLRP7	199713	hgsc.bcm.edu	37	19	55450318	55450318	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr19:55450318C>G	ENST00000590030.1	-	3	1909	c.1869G>C	c.(1867-1869)caG>caC	p.Q623H	NLRP7_ENST00000592784.1_Missense_Mutation_p.Q623H|NLRP7_ENST00000588756.1_Missense_Mutation_p.Q623H|NLRP7_ENST00000448121.2_Missense_Mutation_p.Q623H|NLRP7_ENST00000328092.5_Missense_Mutation_p.Q623H|NLRP7_ENST00000340844.2_Missense_Mutation_p.Q623H|NLRP7_ENST00000446217.1_Missense_Mutation_p.Q651H			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	623							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CCTTTGCTACCTGCAGTGAGA	0.428																																					p.Q623H												.	.	0			c.G1869C	19						.						69.0	66.0	67.0					19																	55450318		2203	4300	6503	60142130	SO:0001583	missense	199713	exon4			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1869G>C	19.37:g.55450318C>G	ENSP00000465520:p.Gln623His	None		Capture	SOLID	Phase_I	60142130	NM_139176	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.031104	0.35797	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	1.92	1.92	0.25849	.	.	.	.	.	T	0.57961	0.2089	L	0.58810	1.83	0.09310	N	1	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	P;P;P;D	0.66716	0.885;0.885;0.885;0.946	T	0.39143	-0.9628	9	0.44086	T	0.13	.	7.3493	0.26680	0.0:1.0:0.0:0.0	.	651;623;623;623	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	H	623;623;623;651;390	ENSP00000329568:Q623H;ENSP00000409137:Q623H;ENSP00000339491:Q623H;ENSP00000414273:Q651H	ENSP00000329568:Q623H	Q	-	3	2	NLRP7	60142130	0.066000	0.20996	0.041000	0.18516	0.239000	0.25481	0.485000	0.22324	1.384000	0.46424	0.462000	0.41574	CAG		0.428	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
DLC1	10395	hgsc.bcm.edu	37	8	12943848	12943848	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr8:12943848A>T	ENST00000276297.4	-	17	4826	c.4417T>A	c.(4417-4419)Tgt>Agt	p.C1473S	DLC1_ENST00000358919.2_Missense_Mutation_p.C1036S|DLC1_ENST00000520226.1_Missense_Mutation_p.C962S|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Missense_Mutation_p.C1070S	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1473	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.C1473S(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CCTGGCCCACAGGGTTCAATC	0.458																																					p.C1473S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4417A	8						.						131.0	123.0	125.0					8																	12943848		2203	4300	6503	12988219	SO:0001583	missense	10395	exon17			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4417T>A	8.37:g.12943848A>T	ENSP00000276297:p.Cys1473Ser	Somatic		Capture	SOLID	Phase_I	12988219	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046577	0.55110	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	4.99	4.99	0.66335	Lipid-binding START (3);START-like domain (1);	0.048187	0.85682	D	0.000000	T	0.81763	0.4891	M	0.66939	2.045	0.80722	D	1	B;D;P	0.61080	0.005;0.989;0.543	B;P;B	0.54270	0.007;0.747;0.059	T	0.82989	-0.0183	10	0.54805	T	0.06	.	11.1983	0.48726	0.8466:0.1534:0.0:0.0	.	1473;1070;1036	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	S	1473;1036;412;1070;962	ENSP00000276297:C1473S;ENSP00000351797:C1036S;ENSP00000422595:C1070S;ENSP00000428028:C962S	ENSP00000276297:C1473S	C	-	1	0	DLC1	12988219	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.794000	0.69067	2.234000	0.73211	0.459000	0.35465	TGT		0.458	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
KCNQ3	3786	hgsc.bcm.edu	37	8	133196523	133196523	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr8:133196523C>T	ENST00000388996.4	-	3	989	c.569G>A	c.(568-570)cGa>cAa	p.R190Q	KCNQ3_ENST00000519445.1_Missense_Mutation_p.R190Q|KCNQ3_ENST00000521134.1_Missense_Mutation_p.R70Q	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	190					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.R190Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	AAACTTCAGTCGGCCCCGCCA	0.537																																					p.R190Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	8						.						84.0	86.0	85.0					8																	133196523		2203	4300	6503	133265705	SO:0001583	missense	3786	exon3			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.569G>A	8.37:g.133196523C>T	ENSP00000373648:p.Arg190Gln	Somatic		Capture	SOLID	Phase_I	133265705	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	36	5.781410	0.96929	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.97831	-4.56;-4.56;-4.56	5.87	5.87	0.94306	Ion transport (1);	0.100176	0.64402	D	0.000006	D	0.98858	0.9614	M	0.86268	2.805	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.99723	1.1010	10	0.87932	D	0	-14.5127	19.1915	0.93669	0.0:1.0:0.0:0.0	.	190;190	E7ET42;O43525	.;KCNQ3_HUMAN	Q	190;70;190;179;69	ENSP00000373648:R190Q;ENSP00000429799:R70Q;ENSP00000428790:R190Q	ENSP00000373648:R190Q	R	-	2	0	KCNQ3	133265705	0.998000	0.40836	0.732000	0.30844	0.924000	0.55760	7.773000	0.85462	2.779000	0.95612	0.655000	0.94253	CGA		0.537	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
DIEXF	27042	hgsc.bcm.edu	37	1	210010182	210010182	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr1:210010182T>C	ENST00000491415.2	+	6	745	c.688T>C	c.(688-690)Ttt>Ctt	p.F230L		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	230					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.F230L(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						TTCCTCTAAGTTTCAGAAGTT	0.403																																					p.F230L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T688C	1						.						83.0	94.0	90.0					1																	210010182		2201	4299	6500	208076805	SO:0001583	missense	27042	exon6			BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.688T>C	1.37:g.210010182T>C	ENSP00000419005:p.Phe230Leu	Somatic		Capture	SOLID	Phase_I	208076805	NM_014388	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	37	CCDS1493.1	.	.	.	.	.	.	.	.	.	.	T	9.520	1.107991	0.20714	.	.	ENSG00000117597	ENST00000491415	T	0.39056	1.1	5.91	5.91	0.95273	.	0.114932	0.64402	D	0.000008	T	0.19485	0.0468	N	0.04090	-0.28	0.38914	D	0.957587	B	0.02656	0.0	B	0.04013	0.001	T	0.19910	-1.0291	10	0.10377	T	0.69	-11.7047	10.6452	0.45615	0.0:0.0708:0.0:0.9292	.	230	Q68CQ4	DIEXF_HUMAN	L	230	ENSP00000419005:F230L	ENSP00000419005:F230L	F	+	1	0	DIEXF	208076805	0.979000	0.34478	1.000000	0.80357	0.989000	0.77384	2.011000	0.40922	2.254000	0.74563	0.533000	0.62120	TTT		0.403	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
USP48	84196	hgsc.bcm.edu	37	1	22079499	22079499	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr1:22079499T>C	ENST00000308271.9	-	4	1174	c.526A>G	c.(526-528)Act>Gct	p.T176A	USP48_ENST00000421625.2_Missense_Mutation_p.T176A|USP48_ENST00000529637.1_Missense_Mutation_p.T176A|USP48_ENST00000400301.1_Missense_Mutation_p.T176A	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	176	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.T176A(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TGTTGTCCAGTGTCCAGGCCC	0.368																																					p.T176A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A526G	1						.						71.0	69.0	69.0					1																	22079499		2203	4300	6503	21952086	SO:0001583	missense	84196	exon4			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.526A>G	1.37:g.22079499T>C	ENSP00000309262:p.Thr176Ala	Somatic		Capture	SOLID	Phase_I	21952086	NM_001032730	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517600	0.85495	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.91	5.91	0.95273	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.48223	0.1488	L	0.56396	1.775	0.80722	D	1	P;P;B;P;D;P	0.52996	0.905;0.599;0.34;0.946;0.957;0.926	P;P;B;P;P;P	0.58077	0.642;0.47;0.108;0.781;0.832;0.729	T	0.47947	-0.9077	10	0.87932	D	0	.	15.1676	0.72840	0.0:0.0:0.0:1.0	.	176;176;176;176;176;176	B7ZKS7;B7ZKS3;Q86UV5-7;Q86UV5-3;Q86UV5-2;Q86UV5	.;.;.;.;.;UBP48_HUMAN	A	176	ENSP00000383157:T176A;ENSP00000309262:T176A;ENSP00000431949:T176A;ENSP00000406256:T176A	ENSP00000309262:T176A	T	-	1	0	USP48	21952086	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.624000	0.83124	2.269000	0.75478	0.533000	0.62120	ACT		0.368	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
TINAGL1	64129	hgsc.bcm.edu	37	1	32050532	32050532	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr1:32050532C>T	ENST00000271064.7	+	7	828	c.752C>T	c.(751-753)aCg>aTg	p.T251M	TINAGL1_ENST00000481165.1_3'UTR|TINAGL1_ENST00000537531.1_3'UTR|TINAGL1_ENST00000457433.2_Missense_Mutation_p.T220M	NM_001204415.1|NM_022164.2	NP_001191344.1|NP_071447.1	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1	251					endosomal transport (GO:0016197)|immune response (GO:0006955)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type peptidase activity (GO:0008234)|extracellular matrix structural constituent (GO:0005201)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T251M(1)		breast(2)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		GGACACATGACGCCTGTCCTG	0.637																																					p.T251M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C752T	1						.						79.0	72.0	75.0					1																	32050532		2203	4300	6503	31823119	SO:0001583	missense	64129	exon7			AB050716	CCDS343.1, CCDS55586.1, CCDS72745.1	1p34.3	2014-04-22	2005-08-18	2005-08-18	ENSG00000142910	ENSG00000142910			19168	protein-coding gene	gene with protein product			"""lipocalin 7"", ""TINAG-like 1"""	LCN7		11170462	Standard	NM_022164		Approved	P3ECSL, LIECG3, ARG1, TINAGRP	uc001bta.3	Q9GZM7	OTTHUMG00000003884	ENST00000271064.7:c.752C>T	1.37:g.32050532C>T	ENSP00000271064:p.Thr251Met	Somatic		Capture	SOLID	Phase_I	31823119	NM_022164	A8K9Q5|B4DPK6|D3DPN8|Q8TEJ9|Q8WZ23|Q96GZ4|Q96JW3	Missense_Mutation	SNP	ENST00000271064.7	37	CCDS343.1	.	.	.	.	.	.	.	.	.	.	c	14.97	2.693532	0.48202	.	.	ENSG00000142910	ENST00000457433;ENST00000271064;ENST00000403321	D;D	0.84370	-1.84;-1.84	5.05	4.12	0.48240	Peptidase C1A, papain C-terminal (2);	0.142073	0.64402	D	0.000006	D	0.89670	0.6782	L	0.49256	1.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.949;0.977	D	0.90380	0.4387	10	0.62326	D	0.03	.	15.3318	0.74219	0.0:0.8592:0.1408:0.0	.	220;251	B4DPK6;Q9GZM7	.;TINAL_HUMAN	M	220;251;239	ENSP00000395137:T220M;ENSP00000271064:T251M	ENSP00000271064:T251M	T	+	2	0	TINAGL1	31823119	0.994000	0.37717	0.821000	0.32701	0.769000	0.43574	3.131000	0.50515	1.234000	0.43709	0.491000	0.48974	ACG		0.637	TINAGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011072.1	NM_022164	
ROR1	4919	hgsc.bcm.edu	37	1	64643425	64643425	+	Silent	SNP	A	A	G	rs139252286		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr1:64643425A>G	ENST00000371079.1	+	9	2076	c.1701A>G	c.(1699-1701)agA>agG	p.R567R	ROR1_ENST00000545203.1_Silent_p.R18R	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	567	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> I (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.R567R(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						TCATCATGAGATCCCCACACT	0.473																																					p.R567R												ROR1,large_intestine,NS,Substitution - Missense,+1	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1701G	1						.						72.0	73.0	73.0					1																	64643425		2203	4300	6503	64416013	SO:0001819	synonymous_variant	4919	exon9			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1701A>G	1.37:g.64643425A>G		Somatic		Capture	SOLID	Phase_I	64416013	NM_005012	Q5VVX6|Q66K77|Q92776	Silent	SNP	ENST00000371079.1	37	CCDS626.1																																																																																				0.473	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
LRRC7	57554	hgsc.bcm.edu	37	1	70303931	70303931	+	Silent	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr1:70303931G>A	ENST00000035383.5	+	5	528	c.498G>A	c.(496-498)ttG>ttA	p.L166L	LRRC7_ENST00000370958.1_Silent_p.L204L|LRRC7_ENST00000310961.5_Silent_p.L171L|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	166						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.L166L(1)|p.L204L(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TGCGGATCTTGGAGTTAAGAG	0.289																																					p.L166L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G498A	1						.						73.0	77.0	76.0					1																	70303931		2203	4297	6500	70076519	SO:0001819	synonymous_variant	57554	exon5				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.498G>A	1.37:g.70303931G>A		Somatic		Capture	SOLID	Phase_I	70076519	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	ENST00000035383.5	37	CCDS645.1																																																																																				0.289	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
USH2A	7399	hgsc.bcm.edu	37	1	215848856	215848856	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr1:215848856C>A	ENST00000307340.3	-	63	12783	c.12397G>T	c.(12397-12399)Gag>Tag	p.E4133*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.E4133*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4133	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.E4133*(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTGCAGGCCTCCAGGGTCAGT	0.557										HNSCC(13;0.011)																											p.E4133X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G12397T	1						.						49.0	50.0	50.0					1																	215848856		2203	4300	6503	213915479	SO:0001587	stop_gained	7399	exon63			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12397G>T	1.37:g.215848856C>A	ENSP00000305941:p.Glu4133*	Somatic		Capture	SOLID	Phase_I	213915479	NM_206933	Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	55	24.572049	0.99961	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	.	.	.	5.25	3.36	0.38483	.	0.000000	0.45606	D	0.000358	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	15.723	0.77728	0.0:0.7411:0.2589:0.0	.	.	.	.	X	4133	.	ENSP00000305941:E4133X	E	-	1	0	USH2A	213915479	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.563000	0.60823	0.595000	0.29777	-0.127000	0.14921	GAG		0.557	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
PSMD13	5719	hgsc.bcm.edu	37	11	244167	244167	+	Silent	SNP	C	C	T	rs1128320	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr11:244167C>T	ENST00000532097.1	+	4	720	c.216C>T	c.(214-216)aaC>aaT	p.N72N	PSMD13_ENST00000431206.2_Silent_p.N74N|PSMD13_ENST00000352303.5_Silent_p.N72N	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	72					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.N72N(1)|p.N74N(1)		NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TCAGGGTGAACCCTTTGTCCC	0.418													T|||	4083	0.815296	0.8918	0.83	5008	,	,		16356	0.8036		0.7306	False		,,,				2504	0.8006				p.N72N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C216T	11						.	T	,	3855,551	224.3+/-240.5	1713,429,61	57.0	62.0	60.0		216,222	-2.1	1.0	11	dbSNP_86	60	6312,2288	364.1+/-333.4	2371,1570,359	no	coding-synonymous,coding-synonymous	PSMD13	NM_002817.3,NM_175932.2	,	4084,1999,420	TT,TC,CC		26.6047,12.5057,21.8284	,	72/377,74/379	244167	10167,2839	2203	4300	6503	234167	SO:0001819	synonymous_variant	5719	exon4			AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.216C>T	11.37:g.244167C>T		Somatic		Capture	SOLID	Phase_I	234167	NM_002817	B3KT15|O75831|Q53XU2|Q9UNV3	Silent	SNP	ENST00000532097.1	37	CCDS7692.1																																																																																				0.418	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817	
TUB	7275	hgsc.bcm.edu	37	11	8060486	8060486	+	Silent	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr11:8060486C>T	ENST00000305253.4	+	1	307	c.66C>T	c.(64-66)ttC>ttT	p.F22F	RP11-236J17.6_ENST00000526646.1_RNA|TUB_ENST00000534099.1_Intron|RP11-236J17.6_ENST00000528151.1_RNA	NM_003320.4	NP_003311.2	P50607	TUB_HUMAN	tubby bipartite transcription factor	0					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)	p.F22F(1)		breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		GGATTTTGTTCCCAGGAGGCA	0.557																																					p.F22F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C66T	11						.						118.0	113.0	115.0					11																	8060486		2201	4296	6497	8017062	SO:0001819	synonymous_variant	7275	exon1			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000305253.4:c.66C>T	11.37:g.8060486C>T		Somatic		Capture	SOLID	Phase_I	8017062	NM_003320	D3DQU4|O00293|Q6B007	Silent	SNP	ENST00000305253.4	37	CCDS7786.1																																																																																				0.557	TUB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385822.1	NM_003320	
HIST1H4B	8366	hgsc.bcm.edu	37	6	26027385	26027385	+	Silent	SNP	T	T	C	rs372902403		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr6:26027385T>C	ENST00000377364.3	-	1	95	c.96A>G	c.(94-96)aaA>aaG	p.K32K		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	32					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.K32K(1)		large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						GAATGGCCGGTTTGGTGATGC	0.542																																					p.K32K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A96G	6						.	C		0,4406		0,0,2203	66.0	60.0	62.0		96	1.9	1.0	6		62	1,8599		0,1,4299	no	coding-synonymous	HIST1H4B	NM_003544.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		32/104	26027385	1,13005	2203	4300	6503	26135364	SO:0001819	synonymous_variant	8366	exon1			X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.96A>G	6.37:g.26027385T>C		Somatic		Capture	SOLID	Phase_I	26135364	NM_003544	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000377364.3	37	CCDS4572.1																																																																																				0.542	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544	
PGK2	5232	hgsc.bcm.edu	37	6	49753791	49753791	+	Silent	SNP	A	A	G			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr6:49753791A>G	ENST00000304801.3	-	1	1262	c.1110T>C	c.(1108-1110)gtT>gtC	p.V370V		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	370					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.V370V(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CACCCCCTATAACAGTGATGC	0.502																																					p.V370V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1110C	6						.						154.0	151.0	152.0					6																	49753791		2203	4300	6503	49861750	SO:0001819	synonymous_variant	5232	exon1			K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.1110T>C	6.37:g.49753791A>G		Somatic		Capture	SOLID	Phase_I	49861750	NM_138733	B2R6Y8|Q9H107	Silent	SNP	ENST00000304801.3	37	CCDS4930.1																																																																																				0.502	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
IL17A	3605	hgsc.bcm.edu	37	6	52053906	52053906	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr6:52053906G>A	ENST00000340057.1	+	3	329	c.284G>A	c.(283-285)cGc>cAc	p.R95H		NM_002190.2	NP_002181.1	Q16552	IL17_HUMAN	interleukin 17A	95					apoptotic process (GO:0006915)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|cellular response to interleukin-1 (GO:0071347)|fibroblast activation (GO:0072537)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein glycosylation (GO:0006486)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.R95H(1)		endometrium(3)|large_intestine(2)|lung(8)|prostate(3)|skin(1)	17	Lung NSC(77;0.116)					GCAAAGTGCCGCCACTTGGGC	0.552																																					p.R95H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G284A	6						.						74.0	62.0	66.0					6																	52053906		2203	4300	6503	52161865	SO:0001583	missense	3605	exon3			U32659	CCDS4937.1	6p12	2011-07-14	2006-04-26	2006-04-26	ENSG00000112115	ENSG00000112115		"""Interleukins and interleukin receptors"""	5981	protein-coding gene	gene with protein product	"""cytotoxic T-lymphocyte-associated protein 8"""	603149	"""interleukin 17 (cytotoxic T-lymphocyte-associated serine esterase 8)"""	CTLA8, IL17		8390535	Standard	NM_002190		Approved	IL-17A, IL-17	uc003pak.1	Q16552	OTTHUMG00000014840	ENST00000340057.1:c.284G>A	6.37:g.52053906G>A	ENSP00000344192:p.Arg95His	Somatic		Capture	SOLID	Phase_I	52161865	NM_002190	Q5T2P0	Missense_Mutation	SNP	ENST00000340057.1	37	CCDS4937.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376688	0.61735	.	.	ENSG00000112115	ENST00000340057	T	0.56444	0.46	5.64	3.85	0.44370	.	0.390354	0.29616	N	0.011642	T	0.53932	0.1827	L	0.60845	1.875	0.37345	D	0.91055	D	0.89917	1.0	P	0.60682	0.878	T	0.56842	-0.7912	10	0.40728	T	0.16	-21.5642	15.1076	0.72332	0.0:0.0:0.7419:0.2581	.	95	Q16552	IL17_HUMAN	H	95	ENSP00000344192:R95H	ENSP00000344192:R95H	R	+	2	0	IL17A	52161865	0.999000	0.42202	0.993000	0.49108	0.567000	0.35839	3.135000	0.50546	0.731000	0.32448	0.609000	0.83330	CGC		0.552	IL17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040892.1	NM_002190	
SLFN13	146857	hgsc.bcm.edu	37	17	33769244	33769244	+	Silent	SNP	A	A	G			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr17:33769244A>G	ENST00000285013.6	-	5	1535	c.1260T>C	c.(1258-1260)caT>caC	p.H420H	SLFN13_ENST00000542635.1_Silent_p.H420H|SLFN13_ENST00000526861.1_Silent_p.H420H|SLFN13_ENST00000533791.1_Silent_p.H420H|SLFN13_ENST00000534689.1_Silent_p.H102H|SLFN13_ENST00000360502.2_Silent_p.H102H	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	420						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.H420H(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TTAGTCCTTCATGCTGTAAAG	0.453																																					p.H420H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1260C	17						.						71.0	67.0	68.0					17																	33769244		2203	4300	6503	30793357	SO:0001819	synonymous_variant	146857	exon5			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1260T>C	17.37:g.33769244A>G		Somatic		Capture	SOLID	Phase_I	30793357	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Silent	SNP	ENST00000285013.6	37	CCDS32620.1																																																																																				0.453	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
TP53	7157	hgsc.bcm.edu	37	17	7578213	7578214	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	AA	AA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr17:7578213_7578214delAA	ENST00000269305.4	-	6	824_825	c.635_636delTT	c.(634-636)tttfs	p.F212fs	TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.F212fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	212	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in a sporadic cancer; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F212fs*3(12)|p.0?(8)|p.?(5)|p.R213fs*35(3)|p.F212S(2)|p.F212L(2)|p.D208fs*1(1)|p.R209_R213delRNTFR(1)|p.F119fs*3(1)|p.T211fs*28(1)|p.D207_R213delDDRNTFR(1)|p.D207_V216del10(1)|p.T211_S215delTFRHS(1)|p.F80fs*3(1)|p.F212Y(1)|p.R120fs*35(1)|p.R209fs*6(1)|p.R81fs*>11(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTATGTCGAAAAGTGTTTCT	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.212_212del	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	45	Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Substitution - Missense(5)	large_intestine(8)|oesophagus(8)|upper_aerodigestive_tract(5)|biliary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|breast(4)|central_nervous_system(2)|lung(2)|stomach(1)|soft_tissue(1)|liver(1)	c.635_636del	17	GRCh37	CD011205	TP53	D		.																																			7518939	SO:0001589	frameshift_variant	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.635_636delTT	17.37:g.7578215_7578216delAA	ENSP00000269305:p.Phe212fs	Somatic		Capture	SOLID	Phase_I	7518938	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ARSG	22901	hgsc.bcm.edu	37	17	66339909	66339909	+	Missense_Mutation	SNP	C	C	T	rs201030584		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr17:66339909C>T	ENST00000448504.2	+	3	1179	c.383C>T	c.(382-384)gCg>gTg	p.A128V	ARSG_ENST00000452479.2_5'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	128					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.A128V(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTGCAGCAGGCGGGTTACGTC	0.562																																					p.A128V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C383T	17						.						67.0	48.0	55.0					17																	66339909		2203	4300	6503	63851504	SO:0001583	missense	22901	exon3			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.383C>T	17.37:g.66339909C>T	ENSP00000407193:p.Ala128Val	Somatic		Capture	SOLID	Phase_I	63851504	NM_014960	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061080	0.55432	.	.	ENSG00000141337	ENST00000452479	.	.	.	4.56	3.57	0.40892	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.282399	0.33364	N	0.004981	T	0.66005	0.2746	M	0.67517	2.055	0.58432	D	0.999992	D	0.61697	0.99	P	0.55087	0.768	T	0.65438	-0.6168	9	0.28530	T	0.3	.	14.195	0.65664	0.1503:0.8497:0.0:0.0	.	128	Q96EG1	ARSG_HUMAN	V	128	.	ENSP00000413953:A128V	A	+	2	0	ARSG	63851504	0.991000	0.36638	0.132000	0.22025	0.834000	0.47266	4.815000	0.62634	1.237000	0.43756	0.650000	0.86243	GCG		0.562	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960	
ESCO1	114799	hgsc.bcm.edu	37	18	19154233	19154233	+	Missense_Mutation	SNP	T	T	C	rs35087820	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr18:19154233T>C	ENST00000269214.5	-	4	1509	c.572A>G	c.(571-573)aAt>aGt	p.N191S		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	191			N -> S (in dbSNP:rs35087820).		mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)	p.N191S(1)		breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						AATTACTAGATTTTCATCTTC	0.358													T|||	49	0.00978435	0.0008	0.0144	5008	,	,		20572	0.002		0.0278	False		,,,				2504	0.0082				p.N191S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A572G	18						.	T	SER/ASN	31,4375	36.8+/-68.6	0,31,2172	88.0	88.0	88.0		572	0.4	0.0	18	dbSNP_126	88	246,8354	97.2+/-158.9	3,240,4057	yes	missense	ESCO1	NM_052911.2	46	3,271,6229	CC,CT,TT		2.8605,0.7036,2.1298	benign	191/841	19154233	277,12729	2203	4300	6503	17408231	SO:0001583	missense	114799	exon4			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.572A>G	18.37:g.19154233T>C	ENSP00000269214:p.Asn191Ser	Somatic		Capture	SOLID	Phase_I	17408231	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	37	CCDS32800.1	23	0.010531135531135532	1	0.0020325203252032522	6	0.016574585635359115	2	0.0034965034965034965	14	0.018469656992084433	T	1.911	-0.450726	0.04572	0.007036	0.028605	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.58060	0.36;1.91	5.72	0.44	0.16572	.	0.911205	0.09440	N	0.801839	T	0.13713	0.0332	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15723	-1.0427	10	0.10902	T	0.67	-32.3976	4.9507	0.14013	0.1316:0.2368:0.0:0.6316	rs35087820	191	Q5FWF5	ESCO1_HUMAN	S	191	ENSP00000269214:N191S;ENSP00000372763:N191S	ENSP00000269214:N191S	N	-	2	0	ESCO1	17408231	0.031000	0.19500	0.021000	0.16686	0.368000	0.29767	0.956000	0.29202	0.451000	0.26802	0.533000	0.62120	AAT		0.358	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
RUVBL1	8607	hgsc.bcm.edu	37	3	127800215	127800215	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:127800215C>G	ENST00000322623.5	-	11	1348	c.1249G>C	c.(1249-1251)Gct>Cct	p.A417P	RUVBL1_ENST00000417360.1_Missense_Mutation_p.C386S|RUVBL1-AS1_ENST00000485218.1_RNA|RUVBL1_ENST00000480616.1_5'Flank|RUVBL1_ENST00000464873.1_Intron	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	417					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)	p.A417P(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		TTGATTTTAGCAAGCAAGTTG	0.542																																					p.A417P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1249C	3						.						113.0	103.0	106.0					3																	127800215		2203	4300	6503	129282905	SO:0001583	missense	8607	exon11			AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.1249G>C	3.37:g.127800215C>G	ENSP00000318297:p.Ala417Pro	Somatic		Capture	SOLID	Phase_I	129282905	NM_003707	B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Missense_Mutation	SNP	ENST00000322623.5	37	CCDS3047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.454708|4.454708	0.84209|0.84209	.|.	.|.	ENSG00000175792|ENSG00000175792	ENST00000322623;ENST00000478892|ENST00000417360	T|T	0.70986|0.56275	-0.53|0.47	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.049978|.	0.85682|.	D|.	0.000000|.	T|T	0.66177|0.66177	0.2763|0.2763	M|M	0.92219|0.92219	3.285|3.285	0.36461|0.36461	D|D	0.866706|0.866706	P|B	0.44281|0.06786	0.831|0.001	P|B	0.44990|0.08055	0.466|0.003	T|T	0.73241|0.73241	-0.4045|-0.4045	10|9	0.87932|0.87932	D|D	0|0	-13.5143|-13.5143	18.8651|18.8651	0.92289|0.92289	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	417|386	Q9Y265|Q9Y265-2	RUVB1_HUMAN|.	P|S	417;228|386	ENSP00000318297:A417P|ENSP00000393755:C386S	ENSP00000318297:A417P|ENSP00000393755:C386S	A|C	-|-	1|2	0|0	RUVBL1|RUVBL1	129282905|129282905	1.000000|1.000000	0.71417|0.71417	0.903000|0.903000	0.35520|0.35520	0.963000|0.963000	0.63663|0.63663	7.616000|7.616000	0.83018|0.83018	2.445000|2.445000	0.82738|0.82738	0.591000|0.591000	0.81541|0.81541	GCT|TGC		0.542	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356728.2		
CCDC174	51244	hgsc.bcm.edu	37	3	14709018	14709018	+	Missense_Mutation	SNP	G	G	A	rs576532078		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:14709018G>A	ENST00000383794.3	+	8	885	c.812G>A	c.(811-813)cGt>cAt	p.R271H	CCDC174_ENST00000303688.7_Intron	NM_016474.4	NP_057558.3	Q6PII3	CC174_HUMAN	coiled-coil domain containing 174	271						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R271H(1)									GAGATGCTGCGTGAACAGGTA	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		18665	0.0		0.001	False		,,,				2504	0.0				p.R271H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G812A	3						.						85.0	84.0	84.0					3																	14709018		2203	4300	6503	14684022	SO:0001583	missense	51244	exon8			AF151046	CCDS2620.2	3p25.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000154781	ENSG00000154781			28033	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 19"""	C3orf19		11042152	Standard	NM_016474		Approved	FLJ33839	uc003byw.3	Q6PII3	OTTHUMG00000129837	ENST00000383794.3:c.812G>A	3.37:g.14709018G>A	ENSP00000373304:p.Arg271His	Somatic		Capture	SOLID	Phase_I	14684022	NM_016474	Q96CS5	Missense_Mutation	SNP	ENST00000383794.3	37	CCDS2620.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415965	0.83449	.	.	ENSG00000154781	ENST00000383794	T	0.72051	-0.62	5.29	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	M	0.77406	2.37	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85057	0.0932	10	0.87932	D	0	-25.1898	12.6983	0.57016	0.0807:0.0:0.9192:0.0	.	271	Q6PII3	CC019_HUMAN	H	271	ENSP00000373304:R271H	ENSP00000373304:R271H	R	+	2	0	C3orf19	14684022	1.000000	0.71417	0.979000	0.43373	0.992000	0.81027	6.949000	0.75971	1.242000	0.43836	0.491000	0.48974	CGT		0.433	CCDC174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252077.2	NM_016474	
GALNT15	117248	hgsc.bcm.edu	37	3	16264182	16264182	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:16264182G>T	ENST00000339732.5	+	9	2193	c.1690G>T	c.(1690-1692)Gct>Tct	p.A564S	GALNT15_ENST00000437509.1_Missense_Mutation_p.A564S	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	564	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A564S(1)									CCTGTGCTTTGCTGTCAGGCA	0.542																																					p.A564S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1690T	3						.						118.0	117.0	117.0					3																	16264182		2203	4300	6503	16239186	SO:0001583	missense	117248	exon9			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1690G>T	3.37:g.16264182G>T	ENSP00000344260:p.Ala564Ser	Somatic		Capture	SOLID	Phase_I	16239186	NM_054110	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	ENST00000339732.5	37	CCDS33711.1	.	.	.	.	.	.	.	.	.	.	G	3.795	-0.042976	0.07452	.	.	ENSG00000131386	ENST00000339732;ENST00000437509;ENST00000543679	T;T	0.28069	1.63;1.63	5.4	4.53	0.55603	Ricin B-related lectin (1);Ricin B lectin (3);	0.414350	0.25288	N	0.031748	T	0.26195	0.0639	L	0.36672	1.1	0.22873	N	0.998624	B	0.10296	0.003	B	0.14023	0.01	T	0.20075	-1.0286	10	0.56958	D	0.05	.	12.66	0.56809	0.0768:0.0:0.9232:0.0	.	564	Q8N3T1	GLTL2_HUMAN	S	564;564;94	ENSP00000344260:A564S;ENSP00000395873:A564S	ENSP00000344260:A564S	A	+	1	0	GALNTL2	16239186	0.999000	0.42202	0.118000	0.21660	0.034000	0.12701	4.002000	0.57053	1.279000	0.44446	-0.254000	0.11334	GCT		0.542	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	
TMEM42	131616	hgsc.bcm.edu	37	3	44906648	44906648	+	Missense_Mutation	SNP	G	G	T	rs568433157	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:44906648G>T	ENST00000302392.4	+	3	512	c.456G>T	c.(454-456)aaG>aaT	p.K152N		NM_144638.1	NP_653239.1	Q69YG0	TMM42_HUMAN	transmembrane protein 42	152						integral component of membrane (GO:0016021)		p.K152N(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00839)|KIRC - Kidney renal clear cell carcinoma(197;0.0461)|Kidney(197;0.0576)		CCACCTGGAAGCCCCTTCCAC	0.562																																					p.K152N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G456T	3						.						138.0	98.0	112.0					3																	44906648		2203	4300	6503	44881652	SO:0001583	missense	131616	exon3			AL834253	CCDS2722.1	3p21.31	2005-01-19			ENSG00000169964	ENSG00000169964			28444	protein-coding gene	gene with protein product						12477932	Standard	NM_144638		Approved	MGC29956	uc003cnz.3	Q69YG0	OTTHUMG00000133092	ENST00000302392.4:c.456G>T	3.37:g.44906648G>T	ENSP00000306564:p.Lys152Asn	Somatic		Capture	SOLID	Phase_I	44881652	NM_144638	Q8WUQ6	Missense_Mutation	SNP	ENST00000302392.4	37	CCDS2722.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283296	0.80803	.	.	ENSG00000169964	ENST00000302392	T	0.09911	2.93	3.68	3.68	0.42216	.	0.275088	0.28760	N	0.014233	T	0.16811	0.0404	L	0.44542	1.39	0.21697	N	0.99959	D	0.61697	0.99	P	0.54174	0.744	T	0.02184	-1.1199	10	0.66056	D	0.02	-13.3285	11.1959	0.48713	0.0:0.0:1.0:0.0	.	152	Q69YG0	TMM42_HUMAN	N	152	ENSP00000306564:K152N	ENSP00000306564:K152N	K	+	3	2	TMEM42	44881652	0.258000	0.24033	0.232000	0.24009	0.614000	0.37383	1.810000	0.38932	2.338000	0.79540	0.561000	0.74099	AAG		0.562	TMEM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256750.2	NM_144638	
CCR3	1232	hgsc.bcm.edu	37	3	46307332	46307332	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:46307332G>C	ENST00000357422.2	+	4	1226	c.683G>C	c.(682-684)aGg>aCg	p.R228T	CCR3_ENST00000395940.2_Missense_Mutation_p.R228T|CCR3_ENST00000395942.2_Missense_Mutation_p.R228T|CCR3_ENST00000541018.1_Missense_Mutation_p.R228T|CCR3_ENST00000545097.1_Missense_Mutation_p.R249T			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	228					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.R228T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		ACGCTGCTGAGGTGCCCCAGT	0.473																																					p.R249T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G746C	3						.						77.0	75.0	76.0					3																	46307332		2203	4300	6503	46282336	SO:0001583	missense	1232	exon3			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.683G>C	3.37:g.46307332G>C	ENSP00000350003:p.Arg228Thr	Somatic		Capture	SOLID	Phase_I	46282336	NM_178328	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839809	0.32513	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.96	2.09	0.27110	GPCR, rhodopsin-like superfamily (1);	0.411149	0.21287	N	0.077053	T	0.43166	0.1235	M	0.81112	2.525	0.09310	N	1	B;B	0.22480	0.07;0.036	B;B	0.25140	0.056;0.058	T	0.46456	-0.9190	10	0.87932	D	0	.	7.2256	0.26014	0.5549:0.0:0.4451:0.0	.	249;228	F5GWL6;P51677	.;CCR3_HUMAN	T	228;249;228;228;228	ENSP00000350003:R228T;ENSP00000441600:R249T;ENSP00000440097:R228T;ENSP00000379271:R228T;ENSP00000379273:R228T	ENSP00000350003:R228T	R	+	2	0	CCR3	46282336	0.001000	0.12720	0.991000	0.47740	0.626000	0.37791	0.224000	0.17738	0.375000	0.24679	0.655000	0.94253	AGG		0.473	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
NME6	10201	hgsc.bcm.edu	37	3	48336643	48336643	+	Nonsense_Mutation	SNP	G	G	A	rs142896746		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:48336643G>A	ENST00000452211.1	-	6	553	c.316C>T	c.(316-318)Cga>Tga	p.R106*	NME6_ENST00000435684.1_Silent_p.S92S|NME6_ENST00000451657.1_Silent_p.S92S|NME6_ENST00000442597.1_Nonsense_Mutation_p.R106*|NME6_ENST00000447314.1_Nonsense_Mutation_p.R61*|NME6_ENST00000426689.2_Nonsense_Mutation_p.R106*|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000450160.1_Silent_p.S92S|NME6_ENST00000444069.1_5'UTR|NME6_ENST00000426723.1_Intron|NME6_ENST00000415053.1_Nonsense_Mutation_p.R106*|NME6_ENST00000421967.1_Nonsense_Mutation_p.R114*|NME6_ENST00000415644.1_Intron			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	106					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)	p.R114*(1)		breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TGGCGTGCTCGGAACACTCTG	0.592																																					p.R114X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C340T	3						.	G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	84.0	74.0	77.0		340	4.9	1.0	3	dbSNP_134	77	0,8600		0,0,4300	yes	stop-gained	NME6	NM_005793.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		114/195	48336643	1,13005	2203	4300	6503	48311647	SO:0001587	stop_gained	10201	exon5			AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.316C>T	3.37:g.48336643G>A	ENSP00000392352:p.Arg106*	Somatic		Capture	SOLID	Phase_I	48311647	NM_005793	B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Nonsense_Mutation	SNP	ENST00000452211.1	37		.	.	.	.	.	.	.	.	.	.	G	16.81	3.225832	0.58668	2.27E-4	0.0	ENSG00000172113	ENST00000421967;ENST00000426689;ENST00000452211;ENST00000415053;ENST00000442597;ENST00000447314;ENST00000425930;ENST00000456495	.	.	.	4.91	4.91	0.64330	.	0.263259	0.36740	N	0.002424	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0682	10.974	0.47454	0.0:0.0:0.8138:0.1861	.	.	.	.	X	114;106;106;106;106;61;106;106	.	ENSP00000399582:R106X	R	-	1	2	NME6	48311647	1.000000	0.71417	0.984000	0.44739	0.979000	0.70002	2.449000	0.44935	2.727000	0.93392	0.655000	0.94253	CGA		0.592	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000346107.1	NM_005793	
MAGI1	9223	hgsc.bcm.edu	37	3	65456157	65456157	+	Missense_Mutation	SNP	C	C	T	rs149211419		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:65456157C>T	ENST00000497477.2	-	5	759	c.760G>A	c.(760-762)Gat>Aat	p.D254N	MAGI1_ENST00000402939.2_Missense_Mutation_p.D254N|MAGI1_ENST00000330909.8_Missense_Mutation_p.D254N|MAGI1_ENST00000483466.1_Missense_Mutation_p.D254N|MAGI1_ENST00000470990.1_5'UTR			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	254	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.D254N(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TCACCAGAATCGGCTGCTTAA	0.448																																					p.D254N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G760A	3						.	C	ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	134.0	131.0	132.0		760,760,760	5.5	1.0	3	dbSNP_134	132	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	MAGI1	NM_001033057.1,NM_004742.2,NM_015520.1	23,23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	254/1463,254/1257,254/1288	65456157	1,13005	2203	4300	6503	65431197	SO:0001583	missense	9223	exon5			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.760G>A	3.37:g.65456157C>T	ENSP00000424369:p.Asp254Asn	Somatic		Capture	SOLID	Phase_I	65431197	NM_015520	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000497477.2	37		.	.	.	.	.	.	.	.	.	.	C	17.85	3.491116	0.64074	0.0	1.16E-4	ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257;ENST00000479287	T;T;T;T;T;T	0.47177	0.85;0.85;2.33;0.85;0.85;2.34	5.5	5.5	0.81552	Guanylate kinase/L-type calcium channel (1);	0.143866	0.64402	D	0.000011	T	0.39600	0.1084	L	0.46157	1.445	0.50813	D	0.999896	B;B;P;B;B;B	0.35433	0.136;0.039;0.501;0.021;0.038;0.137	B;B;B;B;B;B	0.24541	0.016;0.007;0.054;0.009;0.016;0.016	T	0.24048	-1.0171	10	0.18710	T	0.47	-27.0071	19.3889	0.94570	0.0:1.0:0.0:0.0	.	254;254;254;254;254;254	Q96QZ7-6;Q96QZ7;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5	.;MAGI1_HUMAN;.;.;.;.	N	254;254;150;129;254;254;40;16	ENSP00000385450:D254N;ENSP00000331157:D254N;ENSP00000418177:D129N;ENSP00000420323:D254N;ENSP00000424369:D254N;ENSP00000420796:D40N	ENSP00000331157:D254N	D	-	1	0	MAGI1	65431197	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.309000	0.51903	2.593000	0.87608	0.508000	0.49915	GAT		0.448	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
PCCB	5096	hgsc.bcm.edu	37	3	136048789	136048789	+	Missense_Mutation	SNP	G	G	A	rs577625696	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr3:136048789G>A	ENST00000251654.4	+	15	1611	c.1541G>A	c.(1540-1542)cGa>cAa	p.R514Q	PCCB_ENST00000468777.1_Missense_Mutation_p.R545Q|PCCB_ENST00000483687.1_Missense_Mutation_p.R495Q|PCCB_ENST00000482086.1_Missense_Mutation_p.R398Q|PCCB_ENST00000490504.1_Missense_Mutation_p.R457Q|PCCB_ENST00000466072.1_Missense_Mutation_p.R534Q|PCCB_ENST00000471595.1_Missense_Mutation_p.R514Q|PCCB_ENST00000462637.1_Missense_Mutation_p.R491Q|PCCB_ENST00000478469.1_Intron|PCCB_ENST00000469217.1_Missense_Mutation_p.R534Q	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	514	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)	p.R514Q(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	ACACGTGCCCGAATCTGCTGT	0.473													G|||	6	0.00119808	0.0	0.0	5008	,	,		19906	0.0		0.0	False		,,,				2504	0.0061				p.R534Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1601A	3						.						175.0	129.0	145.0					3																	136048789		2203	4300	6503	137531479	SO:0001583	missense	5096	exon16				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.1541G>A	3.37:g.136048789G>A	ENSP00000251654:p.Arg514Gln	Somatic		Capture	SOLID	Phase_I	137531479	NM_001178014	B7Z2Z4|Q16813|Q96CX0	Missense_Mutation	SNP	ENST00000251654.4	37	CCDS3089.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536242	0.64972	.	.	ENSG00000114054	ENST00000251654;ENST00000490504;ENST00000483687;ENST00000468777;ENST00000462637;ENST00000466072;ENST00000482086;ENST00000471595;ENST00000469217	D;D;D;D;D;D;D;D;D	0.97553	-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43	5.26	4.39	0.52855	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.178763	0.47093	N	0.000244	D	0.95513	0.8542	M	0.69523	2.12	0.80722	D	1	B;P;P	0.40553	0.426;0.721;0.721	B;B;B	0.36378	0.223;0.187;0.111	D	0.94581	0.7779	10	0.56958	D	0.05	.	13.3938	0.60838	0.0754:0.0:0.9246:0.0	.	534;514;514	B7Z2Z4;E9PDR0;P05166	.;.;PCCB_HUMAN	Q	514;457;495;545;491;534;398;514;534	ENSP00000251654:R514Q;ENSP00000418307:R457Q;ENSP00000420639:R495Q;ENSP00000419129:R545Q;ENSP00000420391:R491Q;ENSP00000420158:R534Q;ENSP00000417253:R398Q;ENSP00000417549:R514Q;ENSP00000419027:R534Q	ENSP00000251654:R514Q	R	+	2	0	PCCB	137531479	1.000000	0.71417	0.971000	0.41717	0.938000	0.57974	4.733000	0.62036	1.220000	0.43490	0.555000	0.69702	CGA		0.473	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357335.1		
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ELMOD2	255520	hgsc.bcm.edu	37	4	141461344	141461344	+	Missense_Mutation	SNP	C	C	T	rs373389261		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr4:141461344C>T	ENST00000323570.3	+	6	554	c.422C>T	c.(421-423)aCg>aTg	p.T141M		NM_153702.3	NP_714913.1	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	141	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				defense response to virus (GO:0051607)|phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)|regulation of defense response to virus (GO:0050688)	cytoskeleton (GO:0005856)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.T141M(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7	all_hematologic(180;0.162)					CTAATGCCCACGAAGAAGTTA	0.373																																					p.T141M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C422T	4						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	87.0	85.0	86.0		422	4.0	0.6	4		86	0,8600		0,0,4300	no	missense	ELMOD2	NM_153702.3	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	141/294	141461344	1,13005	2203	4300	6503	141680794	SO:0001583	missense	255520	exon6			BX648349	CCDS3752.1	4q31.1	2006-10-24	2006-01-20		ENSG00000179387	ENSG00000179387			28111	protein-coding gene	gene with protein product		610196	"""ELMO domain containing 2"""			16773575	Standard	NM_153702		Approved	MGC10084	uc003iik.3	Q8IZ81	OTTHUMG00000133417	ENST00000323570.3:c.422C>T	4.37:g.141461344C>T	ENSP00000326342:p.Thr141Met	Somatic		Capture	SOLID	Phase_I	141680794	NM_153702	B2R712|D3DNZ0	Missense_Mutation	SNP	ENST00000323570.3	37	CCDS3752.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700402	0.48307	2.27E-4	0.0	ENSG00000179387	ENST00000323570;ENST00000502397;ENST00000513606	T;T;T	0.30448	1.53;1.53;1.53	5.9	3.99	0.46301	Engulfment/cell motility, ELMO (2);	0.623994	0.17848	N	0.159949	T	0.31606	0.0802	L	0.48642	1.525	0.09310	N	1	D	0.53885	0.963	P	0.48795	0.59	T	0.10019	-1.0648	10	0.42905	T	0.14	-0.2803	7.134	0.25517	0.5144:0.3917:0.0:0.0939	.	141	Q8IZ81	ELMD2_HUMAN	M	141;141;64	ENSP00000326342:T141M;ENSP00000422582:T141M;ENSP00000427592:T64M	ENSP00000326342:T141M	T	+	2	0	ELMOD2	141680794	0.984000	0.35163	0.628000	0.29241	0.660000	0.38997	3.356000	0.52269	0.777000	0.33496	0.650000	0.86243	ACG		0.373	ELMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257277.2	NM_153702	
SLIT2	9353	hgsc.bcm.edu	37	4	20258327	20258327	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr4:20258327C>T	ENST00000504154.1	+	2	464	c.212C>T	c.(211-213)aCg>aTg	p.T71M	SLIT2_ENST00000503823.1_Missense_Mutation_p.T71M|SLIT2_ENST00000273739.5_Missense_Mutation_p.T71M|SLIT2_ENST00000503837.1_Missense_Mutation_p.T71M	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	71					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.T71M(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACAAGAATTACGAAGACAGAT	0.294																																					p.T71M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C212T	4						.						86.0	93.0	91.0					4																	20258327		2203	4297	6500	19867425	SO:0001583	missense	9353	exon2			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.212C>T	4.37:g.20258327C>T	ENSP00000422591:p.Thr71Met	Somatic		Capture	SOLID	Phase_I	19867425	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.802018	0.70682	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837;ENST00000508824	T;T;T;T;D	0.83755	1.79;1.79;1.79;1.79;-1.76	5.65	5.65	0.86999	.	0.053525	0.85682	D	0.000000	D	0.87708	0.6245	L	0.53617	1.68	0.58432	D	0.999997	D;D	0.76494	0.999;0.99	P;P	0.57846	0.828;0.806	D	0.85268	0.1054	10	0.34782	T	0.22	.	20.1057	0.97893	0.0:1.0:0.0:0.0	.	71;71	O94813-3;O94813	.;SLIT2_HUMAN	M	71;71;71;71;71;32	ENSP00000427548:T71M;ENSP00000422591:T71M;ENSP00000273739:T71M;ENSP00000422261:T71M;ENSP00000426356:T32M	ENSP00000273739:T71M	T	+	2	0	SLIT2	19867425	1.000000	0.71417	0.998000	0.56505	0.889000	0.51656	7.445000	0.80570	2.827000	0.97445	0.650000	0.86243	ACG		0.294	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SPATA18	132671	hgsc.bcm.edu	37	4	52926953	52926953	+	Missense_Mutation	SNP	C	C	T	rs200997138	byFrequency	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr4:52926953C>T	ENST00000295213.4	+	3	573	c.199C>T	c.(199-201)Cgt>Tgt	p.R67C	SPATA18_ENST00000419395.2_Missense_Mutation_p.R67C|SPATA18_ENST00000506829.1_Intron	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	67					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.R67C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			tTTAGGAGGACGTAATGATGG	0.458													C|||	3	0.000599042	0.0023	0.0	5008	,	,		21697	0.0		0.0	False		,,,				2504	0.0				p.R67C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C199T	4						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	132.0	114.0	120.0		199	0.8	0.1	4		120	1,8599	1.2+/-3.3	0,1,4299	no	missense	SPATA18	NM_145263.2	180	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging	67/539	52926953	2,13004	2203	4300	6503	52621710	SO:0001583	missense	132671	exon3			BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.199C>T	4.37:g.52926953C>T	ENSP00000295213:p.Arg67Cys	Somatic		Capture	SOLID	Phase_I	52621710	NM_145263	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	CCDS3489.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	3.965	-0.009543	0.07727	2.27E-4	1.16E-4	ENSG00000163071	ENST00000295213;ENST00000419395	T;T	0.31510	1.49;1.49	4.81	0.837	0.18896	.	0.585389	0.19501	N	0.112723	T	0.13415	0.0325	N	0.08118	0	0.09310	N	0.999991	B;B;B	0.12013	0.005;0.005;0.003	B;B;B	0.06405	0.001;0.001;0.002	T	0.16482	-1.0401	10	0.51188	T	0.08	-0.9916	5.9199	0.19076	0.4907:0.4177:0.0:0.0916	.	67;67;67	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	C	67	ENSP00000295213:R67C;ENSP00000415309:R67C	ENSP00000295213:R67C	R	+	1	0	SPATA18	52621710	0.183000	0.23186	0.067000	0.19924	0.111000	0.19643	0.733000	0.26087	0.007000	0.14760	0.462000	0.41574	CGT		0.458	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263	
FBXW7	55294	hgsc.bcm.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	G	A	rs149680468		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr4:153247289G>A	ENST00000281708.4	-	10	2742	c.1513C>T	c.(1513-1515)Cgc>Tgc	p.R505C	FBXW7_ENST00000263981.5_Missense_Mutation_p.R425C|FBXW7_ENST00000296555.5_Missense_Mutation_p.R387C|FBXW7_ENST00000603548.1_Missense_Mutation_p.R505C|FBXW7_ENST00000603841.1_Missense_Mutation_p.R505C|FBXW7_ENST00000393956.3_Missense_Mutation_p.R329C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	505			R -> L (in an ovarian cancer cell line). {ECO:0000269|PubMed:11565033, ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R505C(60)|p.R505G(18)|p.R425C(14)|p.R266C(13)|p.R425G(9)|p.R266G(9)|p.R387G(6)|p.R387C(3)|p.R505S(3)|p.R387S(1)|p.?(1)|p.R425S(1)|p.R266S(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R425C			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	139	Substitution - Missense(138)|Unknown(1)	haematopoietic_and_lymphoid_tissue(44)|large_intestine(26)|endometrium(20)|urinary_tract(15)|lung(15)|upper_aerodigestive_tract(8)|skin(8)|ovary(2)|biliary_tract(1)	c.C1273T	4						.						167.0	156.0	160.0					4																	153247289		2203	4300	6503	153466739	SO:0001583	missense	55294	exon9			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1513C>T	4.37:g.153247289G>A	ENSP00000281708:p.Arg505Cys	Somatic		Capture	SOLID	Phase_I	153466739	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722220	0.68959	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.72	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101576	0.64402	D	0.000001	T	0.78679	0.4321	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81858	-0.0739	10	0.87932	D	0	-12.0024	15.0746	0.72066	0.0681:0.0:0.9319:0.0	.	329;505;387;425	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	505;387;425;329	ENSP00000281708:R505C;ENSP00000296555:R387C;ENSP00000263981:R425C;ENSP00000377528:R329C	ENSP00000263981:R425C	R	-	1	0	FBXW7	153466739	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	9.772000	0.98984	1.559000	0.49555	-0.145000	0.13849	CGC		0.468	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
TENM1	10178	hgsc.bcm.edu	37	X	123515058	123515058	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:123515058A>C	ENST00000371130.3	-	31	7569	c.7506T>G	c.(7504-7506)aaT>aaG	p.N2502K	TENM1_ENST00000422452.2_Missense_Mutation_p.N2509K|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2502					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.N2504K(1)									ACCGTCCATCATTGTATCGGG	0.458																																					p.N2502K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T7506G	X						.						136.0	130.0	132.0					X																	123515058		2202	4298	6500	123342739	SO:0001583	missense	10178	exon31			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7506T>G	X.37:g.123515058A>C	ENSP00000360171:p.Asn2502Lys	Somatic		Capture	SOLID	Phase_I	123342739	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	A	1.134	-0.651561	0.03506	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.84589	-1.87;-1.84	5.83	4.68	0.58851	.	0.429903	0.28921	N	0.013708	T	0.65091	0.2658	N	0.04880	-0.145	0.30863	N	0.733338	B;B;B	0.20368	0.044;0.02;0.007	B;B;B	0.15870	0.014;0.006;0.006	T	0.57271	-0.7840	10	0.05721	T	0.95	.	10.4112	0.44294	0.9235:0.0:0.0765:0.0	.	2508;2509;2502	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	2502;2509	ENSP00000360171:N2502K;ENSP00000403954:N2509K	ENSP00000360171:N2502K	N	-	3	2	ODZ1	123342739	0.995000	0.38212	0.940000	0.37924	0.997000	0.91878	1.749000	0.38319	1.965000	0.57142	0.486000	0.48141	AAT		0.458	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
TENM1	10178	hgsc.bcm.edu	37	X	123697602	123697602	+	Nonsense_Mutation	SNP	G	G	A	rs200123894		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:123697602G>A	ENST00000371130.3	-	13	2347	c.2284C>T	c.(2284-2286)Cga>Tga	p.R762*	TENM1_ENST00000422452.2_Nonsense_Mutation_p.R762*	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	762	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R764*(1)									ATCTTACCTCGGACAGCATCT	0.323																																					p.R762X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2284T	X						.						43.0	40.0	41.0					X																	123697602		2203	4299	6502	123525283	SO:0001587	stop_gained	10178	exon13			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2284C>T	X.37:g.123697602G>A	ENSP00000360171:p.Arg762*	Somatic		Capture	SOLID	Phase_I	123525283	NM_014253	B2RTR5|Q5JZ17	Nonsense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	39	7.736335	0.98462	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	.	.	.	5.7	4.83	0.62350	.	0.393227	0.23498	N	0.047528	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	12.1121	0.53846	0.0:0.0:0.6888:0.3112	.	.	.	.	X	762	.	ENSP00000360171:R762X	R	-	1	2	ODZ1	123525283	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.510000	0.35790	1.151000	0.42436	-0.245000	0.11935	CGA		0.323	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
PHEX	5251	hgsc.bcm.edu	37	X	22239858	22239858	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:22239858A>C	ENST00000379374.4	+	18	2462	c.1897A>C	c.(1897-1899)Aat>Cat	p.N633H	PHEX_ENST00000535894.1_Missense_Mutation_p.N536H|PHEX_ENST00000418858.3_Missense_Mutation_p.N336H|PHEX_ENST00000537599.1_Missense_Mutation_p.N633H	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	633					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N633H(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						AGCTGGCTTAAATGTGAGTAC	0.388																																					p.N633H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1897C	X						.						101.0	97.0	98.0					X																	22239858		2203	4300	6503	22149779	SO:0001583	missense	5251	exon18			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1897A>C	X.37:g.22239858A>C	ENSP00000368682:p.Asn633His	Somatic		Capture	SOLID	Phase_I	22149779	NM_000444	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	A	9.186	1.024785	0.19433	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	D;D;D;D	0.90676	-2.71;-2.71;-2.71;-2.71	5.96	4.79	0.61399	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.130403	0.64402	D	0.000002	T	0.80226	0.4584	N	0.11789	0.175	0.45330	D	0.998323	B;B	0.12630	0.005;0.006	B;B	0.16289	0.009;0.015	T	0.70666	-0.4809	10	0.11182	T	0.66	.	12.2673	0.54684	0.5913:0.4087:0.0:0.0	.	633;633	F5GXU4;P78562	.;PHEX_HUMAN	H	633;633;536;336	ENSP00000368682:N633H;ENSP00000440362:N633H;ENSP00000439418:N536H;ENSP00000443531:N336H	ENSP00000368682:N633H	N	+	1	0	PHEX	22149779	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.208000	0.58486	0.843000	0.35070	0.486000	0.48141	AAT		0.388	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
DMD	1756	hgsc.bcm.edu	37	X	32235179	32235179	+	Splice_Site	SNP	G	G	A	rs128626250		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:32235179G>A	ENST00000357033.4	-	44	6498	c.6292C>T	c.(6292-6294)Cga>Tga	p.R2098*	DMD_ENST00000378677.2_Splice_Site_p.R2094*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2098					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R2093*(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTGTCAAATCGCCTGCAGGTA	0.328																																					p.R757X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2269T	X	GRCh37	CM940356	DMD	M	rs128626250	.						39.0	36.0	37.0					X																	32235179		2201	4297	6498	32145100	SO:0001630	splice_region_variant	1756	exon16			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6291-1C>T	X.37:g.32235179G>A		Somatic		Capture	SOLID	Phase_I	32145100	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	46	12.579278	0.99680	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	.	.	.	5.75	-2.74	0.05932	.	0.675955	0.10809	U	0.631807	.	.	.	.	.	.	0.09310	A	1.15215e-07	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.969	0.89107	0.0:0.0:0.3024:0.6976	.	.	.	.	X	2090;757;754;2094;2098;2098;1975	.	ENSP00000354923:R2098X	R	-	1	2	DMD	32145100	0.186000	0.23225	0.024000	0.17045	0.591000	0.36615	0.307000	0.19296	-0.506000	0.06558	0.513000	0.50165	CGA		0.328	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	Nonsense_Mutation
FAM47B	170062	hgsc.bcm.edu	37	X	34962764	34962764	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:34962764G>A	ENST00000329357.5	+	1	1852	c.1816G>A	c.(1816-1818)Gtc>Atc	p.V606I		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	606								p.V606I(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AATGCCTGGCGTCATTGAAAA	0.438													G|||	1	0.000264901	0.0	0.0	3775	,	,		14814	0.0		0.0	False		,,,				2504	0.001				p.V606I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1816A	X						.						154.0	143.0	147.0					X																	34962764		2202	4300	6502	34872685	SO:0001583	missense	170062	exon1			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1816G>A	X.37:g.34962764G>A	ENSP00000328307:p.Val606Ile	Somatic		Capture	SOLID	Phase_I	34872685	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.508113	0.00010	.	.	ENSG00000189132	ENST00000329357	T	0.14516	2.5	0.843	-1.69	0.08186	.	.	.	.	.	T	0.01870	0.0059	N	0.00289	-1.7	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.18429	-1.0337	8	0.02654	T	1	.	.	.	.	.	606	Q8NA70	FA47B_HUMAN	I	606	ENSP00000328307:V606I	ENSP00000328307:V606I	V	+	1	0	FAM47B	34872685	0.278000	0.24230	0.000000	0.03702	0.028000	0.11728	-0.546000	0.06062	-2.672000	0.00413	-1.891000	0.00535	GTC		0.438	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
CLCN5	1184	hgsc.bcm.edu	37	X	49855382	49855382	+	Silent	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:49855382G>A	ENST00000307367.2	+	11	2280	c.1989G>A	c.(1987-1989)acG>acA	p.T663T	CLCN5_ENST00000376108.3_Silent_p.T663T|CLCN5_ENST00000376088.3_Silent_p.T733T|CLCN5_ENST00000376091.3_Silent_p.T733T			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	663					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.T663T(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TTTATTTCACGGAGCATTCTC	0.453																																					p.T733T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2199A	X						.						129.0	104.0	112.0					X																	49855382		2203	4300	6503	49742122	SO:0001819	synonymous_variant	1184	exon14			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1989G>A	X.37:g.49855382G>A		Somatic		Capture	SOLID	Phase_I	49742122	NM_001127899	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Silent	SNP	ENST00000307367.2	37	CCDS14328.1																																																																																				0.453	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
IQSEC2	23096	hgsc.bcm.edu	37	X	53283948	53283948	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:53283948G>A	ENST00000375368.5	-	3	1335	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	IQSEC2_ENST00000396435.3_Missense_Mutation_p.R389W|IQSEC2_ENST00000375365.2_Missense_Mutation_p.R184W			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	379					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R386W(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						AACTGCATCCGCATGTTGGAA	0.602																																					p.R389W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1165T	X						.						50.0	31.0	37.0					X																	53283948		2201	4299	6500	53300673	SO:0001583	missense	23096	exon4			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1135C>T	X.37:g.53283948G>A	ENSP00000364517:p.Arg379Trp	Somatic		Capture	SOLID	Phase_I	53300673	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		.	.	.	.	.	.	.	.	.	.	G	20.3	3.966935	0.74131	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.76709	-1.04;-1.04;-1.04	5.09	3.26	0.37387	.	0.000000	0.85682	D	0.000000	D	0.85102	0.5620	L	0.61036	1.89	0.51767	D	0.999936	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84662	0.0707	10	0.87932	D	0	.	12.3586	0.55190	0.0:0.0:0.6944:0.3056	.	389;184	Q5JU85-2;Q5JU85-3	.;.	W	389;379;184	ENSP00000379712:R389W;ENSP00000364517:R379W;ENSP00000364514:R184W	ENSP00000364514:R184W	R	-	1	2	IQSEC2	53300673	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.224000	0.32539	0.343000	0.23821	0.513000	0.50165	CGG		0.602	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
ALAS2	212	hgsc.bcm.edu	37	X	55039970	55039970	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:55039970G>A	ENST00000330807.5	-	10	1686	c.1549C>T	c.(1549-1551)Cgc>Tgc	p.R517C	ALAS2_ENST00000335854.4_Missense_Mutation_p.R480C|ALAS2_ENST00000396198.3_Missense_Mutation_p.R504C|ALAS2_ENST00000498636.1_Intron	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	517					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)	p.R517C(1)		central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	GGTGCCAAGCGCAGGAGCTCT	0.577																																					p.R480C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1438T	X						.						69.0	56.0	61.0					X																	55039970		2203	4300	6503	55056695	SO:0001583	missense	212	exon9				CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.1549C>T	X.37:g.55039970G>A	ENSP00000332369:p.Arg517Cys	Somatic		Capture	SOLID	Phase_I	55056695	NM_001037967	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809104	0.70797	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.98280	-4.84;-4.84;-4.84	5.39	4.48	0.54585	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99486	0.9817	H	0.99887	4.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97496	1.0057	10	0.87932	D	0	-22.8558	12.2799	0.54757	0.0:0.0:0.7302:0.2698	.	480;504;517	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	C	517;504;480	ENSP00000332369:R517C;ENSP00000379501:R504C;ENSP00000337131:R480C	ENSP00000332369:R517C	R	-	1	0	ALAS2	55056695	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	4.597000	0.61062	2.411000	0.81874	0.538000	0.68166	CGC		0.577	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032	
ZCCHC13	389874	hgsc.bcm.edu	37	X	73524329	73524329	+	Silent	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:73524329C>T	ENST00000339534.2	+	1	305	c.228C>T	c.(226-228)atC>atT	p.I76I		NM_203303.2	NP_976048.1	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	76							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.I76I(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	8						GCGGCCACATCGCCAAAGACT	0.502																																					p.I76I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C228T	X						.						135.0	104.0	115.0					X																	73524329		2203	4300	6503	73441054	SO:0001819	synonymous_variant	389874	exon1			BC021176	CCDS14425.1	Xq13.2	2008-02-05			ENSG00000187969	ENSG00000187969		"""Zinc fingers, CCHC domain containing"""	31749	protein-coding gene	gene with protein product							Standard	NM_203303		Approved	4930513O09RIK, Cnbp2, ZNF9L	uc004ebs.4	Q8WW36	OTTHUMG00000021851	ENST00000339534.2:c.228C>T	X.37:g.73524329C>T		Somatic		Capture	SOLID	Phase_I	73441054	NM_203303		Silent	SNP	ENST00000339534.2	37	CCDS14425.1																																																																																				0.502	ZCCHC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057260.1	NM_203303	
ATP2B3	492	hgsc.bcm.edu	37	X	152845601	152845601	+	Missense_Mutation	SNP	C	C	T	rs368530977		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chrX:152845601C>T	ENST00000349466.2	+	21	3834	c.3508C>T	c.(3508-3510)Cgc>Tgc	p.R1170C	ATP2B3_ENST00000370181.2_3'UTR|ATP2B3_ENST00000359149.3_3'UTR|ATP2B3_ENST00000263519.4_Missense_Mutation_p.R1170C|ATP2B3_ENST00000370186.1_3'UTR			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	1170					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.R1170C(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAACGAGGAGCGCCTCCGGGC	0.592																																					p.R1170C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3508T	X						.		CYS/ARG,	0,3835		0,0,1632,571	105.0	100.0	102.0		3508,	5.3	1.0	X		102	1,6727		0,1,2427,1872	no	missense,utr-3	ATP2B3	NM_001001344.2,NM_021949.3	180,	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	possibly-damaging,	1170/1221,	152845601	1,10562	2203	4300	6503	152498795	SO:0001583	missense	492	exon20			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3508C>T	X.37:g.152845601C>T	ENSP00000343886:p.Arg1170Cys	Somatic		Capture	SOLID	Phase_I	152498795	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	37	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	c	13.72	2.320695	0.41096	0.0	1.49E-4	ENSG00000067842	ENST00000349466;ENST00000263519	D;D	0.94687	-3.49;-3.49	5.34	5.34	0.76211	.	0.625613	0.14809	N	0.297153	D	0.91415	0.7291	N	0.14661	0.345	0.80722	D	1	P;P	0.51240	0.943;0.905	P;B	0.47162	0.54;0.209	D	0.92293	0.5843	10	0.66056	D	0.02	-16.568	16.741	0.85459	0.0:1.0:0.0:0.0	.	1156;1170	Q16720-4;Q16720	.;AT2B3_HUMAN	C	1170	ENSP00000343886:R1170C;ENSP00000263519:R1170C	ENSP00000263519:R1170C	R	+	1	0	ATP2B3	152498795	0.115000	0.22152	0.998000	0.56505	0.334000	0.28698	1.623000	0.37008	2.212000	0.71576	0.525000	0.51046	CGC		0.592	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
EHD3	30845	hgsc.bcm.edu	37	2	31457628	31457628	+	Silent	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr2:31457628G>A	ENST00000322054.5	+	1	426	c.141G>A	c.(139-141)tcG>tcA	p.S47S	EHD3_ENST00000541626.1_Silent_p.S47S	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	47					blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)	p.S47S(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					AGTTCCACTCGCCCGCCCTGG	0.592																																					p.S47S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G141A	2						.						105.0	99.0	101.0					2																	31457628		2203	4300	6503	31311132	SO:0001819	synonymous_variant	30845	exon1			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.141G>A	2.37:g.31457628G>A		Somatic		Capture	SOLID	Phase_I	31311132	NM_014600	B4DFR5|D6W574|Q8N514|Q9NZB3	Silent	SNP	ENST00000322054.5	37	CCDS1774.1																																																																																				0.592	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600	
C2orf42	54980	hgsc.bcm.edu	37	2	70406756	70406756	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr2:70406756A>G	ENST00000264434.2	-	4	1221	c.842T>C	c.(841-843)gTa>gCa	p.V281A	C2orf42_ENST00000470096.1_5'Flank|C2orf42_ENST00000420306.1_Missense_Mutation_p.V281A	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	281								p.V281A(1)		endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						TAACTGGGGTACAATAATCTC	0.358																																					p.V281A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T842C	2						.						95.0	94.0	94.0					2																	70406756		2203	4300	6503	70260260	SO:0001583	missense	54980	exon4			AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.842T>C	2.37:g.70406756A>G	ENSP00000264434:p.Val281Ala	Somatic		Capture	SOLID	Phase_I	70260260	NM_017880	D6W5G3|Q9H629	Missense_Mutation	SNP	ENST00000264434.2	37	CCDS1899.1	.	.	.	.	.	.	.	.	.	.	A	5.523	0.281460	0.10458	.	.	ENSG00000115998	ENST00000264434;ENST00000420306	T;T	0.38401	1.14;1.14	4.98	4.98	0.66077	.	0.614434	0.16618	N	0.206607	T	0.34164	0.0888	L	0.47716	1.5	0.40184	D	0.977324	B	0.25007	0.116	B	0.25759	0.063	T	0.14868	-1.0457	10	0.42905	T	0.14	-14.8553	13.6822	0.62493	1.0:0.0:0.0:0.0	.	281	Q9NWW7	CB042_HUMAN	A	281	ENSP00000264434:V281A;ENSP00000404515:V281A	ENSP00000264434:V281A	V	-	2	0	C2orf42	70260260	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.663000	0.54518	2.096000	0.63516	0.529000	0.55759	GTA		0.358	C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251840.1	NM_017880	
REG3A	5068	hgsc.bcm.edu	37	2	79385552	79385552	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr2:79385552G>A	ENST00000409839.3	-	4	269	c.233C>T	c.(232-234)tCt>tTt	p.S78F	REG3A_ENST00000393878.1_Missense_Mutation_p.S78F|AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000305165.2_Missense_Mutation_p.S78F	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	78	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)	p.S78F(1)		breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						ACTGAGCACAGACACCAGGTT	0.582																																					p.S78F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C233T	2						.						119.0	102.0	107.0					2																	79385552		2203	4300	6503	79239060	SO:0001583	missense	5068	exon4			S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.233C>T	2.37:g.79385552G>A	ENSP00000386630:p.Ser78Phe	Somatic		Capture	SOLID	Phase_I	79239060	NM_002580		Missense_Mutation	SNP	ENST00000409839.3	37	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652266	0.47362	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.21361	2.01;2.01;2.01	4.02	4.02	0.46733	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.51477	D	0.000096	T	0.49847	0.1581	M	0.88241	2.94	0.40988	D	0.984838	D	0.89917	1.0	D	0.97110	1.0	T	0.56432	-0.7980	10	0.51188	T	0.08	.	11.9367	0.52878	0.0:0.0:1.0:0.0	.	78	Q06141	REG3A_HUMAN	F	78	ENSP00000386630:S78F;ENSP00000377456:S78F;ENSP00000304311:S78F	ENSP00000304311:S78F	S	-	2	0	REG3A	79239060	0.995000	0.38212	0.996000	0.52242	0.456000	0.32438	3.918000	0.56432	2.529000	0.85273	0.603000	0.83216	TCT		0.582	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580	
SPATA31E1	286234	hgsc.bcm.edu	37	9	90500991	90500991	+	Missense_Mutation	SNP	C	C	A	rs566061215		TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr9:90500991C>A	ENST00000325643.5	+	4	1655	c.1589C>A	c.(1588-1590)cCt>cAt	p.P530H		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	530					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P530H(1)									ctctcaccccctgtcccaAGC	0.632																																					p.P530H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1589A	9						.						51.0	54.0	53.0					9																	90500991		2203	4299	6502	89690811	SO:0001583	missense	286234	exon4			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.1589C>A	9.37:g.90500991C>A	ENSP00000322640:p.Pro530His	Somatic		Capture	SOLID	Phase_I	89690811	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	c	12.00	1.806744	0.31961	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.08193	3.12	2.35	1.38	0.22167	.	0.795460	0.10988	N	0.611967	T	0.16514	0.0397	L	0.49778	1.585	0.09310	N	1	D;D	0.64830	0.994;0.994	P;P	0.59643	0.861;0.85	T	0.13388	-1.0511	10	0.62326	D	0.03	.	6.7012	0.23227	0.0:0.7018:0.2982:0.0	.	530;182	Q6ZUB1;Q8NA33	CI079_HUMAN;.	H	530;182	ENSP00000322640:P530H	ENSP00000322640:P530H	P	+	2	0	C9orf79	89690811	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.195000	0.09546	0.512000	0.28257	0.603000	0.83216	CCT		0.632	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
MCM10	55388	hgsc.bcm.edu	37	10	13212996	13212996	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr10:13212996G>A	ENST00000484800.2	+	3	185	c.82G>A	c.(82-84)Gaa>Aaa	p.E28K	MCM10_ENST00000378714.3_Missense_Mutation_p.E28K|MCM10_ENST00000378694.1_Missense_Mutation_p.E28K			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	28	N-terminal domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.E28K(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TAATTCAGAAGAAAATAACTT	0.478																																					p.E28K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G82A	10						.						108.0	112.0	110.0					10																	13212996		2203	4300	6503	13253002	SO:0001583	missense	55388	exon3			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.82G>A	10.37:g.13212996G>A	ENSP00000418268:p.Glu28Lys	Somatic		Capture	SOLID	Phase_I	13253002	NM_018518	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.284102	0.23392	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.17691	2.27;2.27;2.26	5.7	3.77	0.43336	.	0.417057	0.28933	N	0.013661	T	0.11879	0.0289	L	0.29908	0.895	0.09310	N	1	B;B;B	0.18166	0.015;0.026;0.001	B;B;B	0.16289	0.006;0.015;0.002	T	0.23048	-1.0199	10	0.20519	T	0.43	-7.5632	11.159	0.48505	0.141:0.1335:0.7255:0.0	.	28;28;28	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	K	28	ENSP00000367986:E28K;ENSP00000418268:E28K;ENSP00000367966:E28K	ENSP00000354945:E28K	E	+	1	0	MCM10	13253002	0.260000	0.24053	0.258000	0.24420	0.155000	0.21991	1.198000	0.32223	1.371000	0.46172	0.655000	0.94253	GAA		0.478	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24909911	24909911	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr10:24909911C>T	ENST00000396432.2	-	9	1399	c.913G>A	c.(913-915)Gtg>Atg	p.V305M	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.V92M	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	304				S -> N (in Ref. 1; AAM22955). {ECO:0000305}.	establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.V304M(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TGCTCACTCACGCCATACCTC	0.433																																					p.V305M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G913A	10						.						161.0	153.0	156.0					10																	24909911		2203	4300	6503	24949917	SO:0001583	missense	57584	exon9			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.913G>A	10.37:g.24909911C>T	ENSP00000379709:p.Val305Met	Somatic		Capture	SOLID	Phase_I	24949917	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	C	6.588	0.476842	0.12521	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.45276	2.86;2.96;0.9;0.9	5.35	-10.7	0.00240	.	1.801200	0.02660	N	0.107446	T	0.20740	0.0499	L	0.36672	1.1	0.09310	N	1	P;B	0.40909	0.732;0.038	B;B	0.29267	0.1;0.009	T	0.16988	-1.0384	10	0.23302	T	0.38	.	5.3233	0.15893	0.0993:0.4258:0.2904:0.1845	.	295;304	F8W9U9;Q5T5U3	.;RHG21_HUMAN	M	305;294;92;295;305;140	ENSP00000379709:V305M;ENSP00000365604:V92M;ENSP00000365592:V295M;ENSP00000405018:V305M	ENSP00000365604:V92M	V	-	1	0	ARHGAP21	24949917	0.000000	0.05858	0.000000	0.03702	0.952000	0.60782	-3.499000	0.00450	-3.070000	0.00254	-0.300000	0.09419	GTG		0.433	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
ASAH2B	653308	hgsc.bcm.edu	37	10	52512229	52512229	+	Splice_Site	SNP	C	C	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr10:52512229C>A	ENST00000374006.1	+	5	286	c.221C>A	c.(220-222)aCc>aAc	p.T74N	ASAH2B_ENST00000374007.1_Splice_Site_p.T69N|ASAH2B_ENST00000483649.1_3'UTR|ASAH2B_ENST00000185907.9_Splice_Site_p.T69N	NM_001079516.1	NP_001072984.1	P0C7U1	ASA2B_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B	74								p.T74N(1)		large_intestine(2)|lung(2)	4						GCATTTCAGACCCATCAGACC	0.438																																					p.T74N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C221A	10						.						1.0	1.0	1.0					10																	52512229		2	10	12	52182235	SO:0001630	splice_region_variant	653308	exon5			BI553338	CCDS31203.1	10q11.23	2010-05-04			ENSG00000204147	ENSG00000204147			23456	protein-coding gene	gene with protein product		610987				17334805	Standard	NM_001079516		Approved	bA449O16.3, ASAH2L	uc001jjg.4	P0C7U1	OTTHUMG00000018239	ENST00000374006.1:c.220-1C>A	10.37:g.52512229C>A		Somatic		Capture	SOLID	Phase_I	52182235	NM_001079516	B7Z261	Missense_Mutation	SNP	ENST00000374006.1	37	CCDS31203.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.073564	0.36566	.	.	ENSG00000204147	ENST00000374007;ENST00000185907;ENST00000374006	T;T;T	0.46063	0.88;0.88;0.88	2.68	2.68	0.31781	.	0.134260	0.49916	U	0.000133	T	0.64068	0.2565	M	0.88640	2.97	0.49130	D	0.999755	D;D	0.76494	0.999;0.998	D;D	0.70935	0.971;0.96	T	0.66380	-0.5938	10	0.27785	T	0.31	-9.1838	11.1385	0.48390	0.0:1.0:0.0:0.0	.	69;74	B7Z261;P0C7U1	.;ASA2B_HUMAN	N	69;69;74	ENSP00000363119:T69N;ENSP00000185907:T69N;ENSP00000363118:T74N	ENSP00000185907:T69N	T	+	2	0	ASAH2B	52182235	0.991000	0.36638	0.992000	0.48379	0.698000	0.40448	3.138000	0.50570	1.505000	0.48720	0.306000	0.20318	ACC		0.438	ASAH2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048084.1		Missense_Mutation
PIK3AP1	118788	hgsc.bcm.edu	37	10	98412536	98412536	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr10:98412536C>A	ENST00000339364.5	-	4	750	c.631G>T	c.(631-633)Gag>Tag	p.E211*	PIK3AP1_ENST00000371110.2_Nonsense_Mutation_p.E33*|PIK3AP1_ENST00000468783.1_5'UTR	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	211	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)	p.E211*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		GGAGAAAACTCTGCTTCTGTC	0.502																																					p.E211X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G631T	10						.						169.0	160.0	163.0					10																	98412536		2203	4300	6503	98402526	SO:0001587	stop_gained	118788	exon4			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.631G>T	10.37:g.98412536C>A	ENSP00000339826:p.Glu211*	Somatic		Capture	SOLID	Phase_I	98402526	NM_152309	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Nonsense_Mutation	SNP	ENST00000339364.5	37	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	C	36	5.746453	0.96882	.	.	ENSG00000155629	ENST00000339364;ENST00000371110	.	.	.	6.03	6.03	0.97812	.	0.100758	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-22.0191	17.7156	0.88336	0.0:1.0:0.0:0.0	.	.	.	.	X	211;33	.	ENSP00000339826:E211X	E	-	1	0	PIK3AP1	98402526	1.000000	0.71417	0.928000	0.36995	0.345000	0.29048	6.404000	0.73268	2.868000	0.98415	0.555000	0.69702	GAG		0.502	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309	
PLEKHS1	79949	hgsc.bcm.edu	37	10	115534019	115534019	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr10:115534019G>T	ENST00000369310.3	+	8	1250	c.688G>T	c.(688-690)Gaa>Taa	p.E230*	PLEKHS1_ENST00000369312.4_Nonsense_Mutation_p.E148*|PLEKHS1_ENST00000369309.1_Nonsense_Mutation_p.E50*|PLEKHS1_ENST00000354462.3_5'UTR|PLEKHS1_ENST00000361048.1_Nonsense_Mutation_p.E236*	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	230								p.E236*(1)									TGATTCTGGTGAATCCATTGA	0.378																																					p.E148X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G442T	10						.						126.0	115.0	119.0					10																	115534019		2203	4300	6503	115524009	SO:0001587	stop_gained	79949	exon7			AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.688G>T	10.37:g.115534019G>T	ENSP00000358316:p.Glu230*	Somatic		Capture	SOLID	Phase_I	115524009	NM_001193435	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Nonsense_Mutation	SNP	ENST00000369310.3	37	CCDS53580.1	.	.	.	.	.	.	.	.	.	.	G	39	7.750318	0.98468	.	.	ENSG00000148735	ENST00000361048;ENST00000369312;ENST00000369310;ENST00000369309	.	.	.	5.74	1.83	0.25207	.	0.600781	0.18322	N	0.144762	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-8.5005	4.4793	0.11759	0.2619:0.1643:0.5739:0.0	.	.	.	.	X	236;148;230;50	.	ENSP00000354332:E236X	E	+	1	0	C10orf81	115524009	0.097000	0.21791	0.004000	0.12327	0.075000	0.17131	1.021000	0.30040	0.356000	0.24157	0.563000	0.77884	GAA		0.378	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
C5orf51	285636	hgsc.bcm.edu	37	5	41917282	41917282	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3560-01A-01W-0831-10	TCGA-AA-3560-10A-01W-0831-10	g.chr5:41917282G>A	ENST00000381647.2	+	6	785	c.766G>A	c.(766-768)Gta>Ata	p.V256I		NM_175921.4	NP_787117.3	A6NDU8	CE051_HUMAN	chromosome 5 open reading frame 51	256								p.V256I(1)		endometrium(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						TTTCCGAGAAGTAGGAGAAAA	0.393																																					p.V256I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G766A	5						.						103.0	101.0	101.0					5																	41917282		2203	4300	6503	41953039	SO:0001583	missense	285636	exon6			AL833916, AK094002	CCDS34151.1	5p13.1	2008-07-18			ENSG00000205765	ENSG00000205765			27750	protein-coding gene	gene with protein product						14702039	Standard	NM_175921		Approved	LOC285636	uc003jmo.3	A6NDU8	OTTHUMG00000162084	ENST00000381647.2:c.766G>A	5.37:g.41917282G>A	ENSP00000371061:p.Val256Ile	Somatic		Capture	SOLID	Phase_I	41953039	NM_175921	A2RRM9	Missense_Mutation	SNP	ENST00000381647.2	37	CCDS34151.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.515464	0.27123	.	.	ENSG00000205765	ENST00000381647	D	0.81996	-1.56	5.66	4.68	0.58851	.	0.121291	0.53938	D	0.000055	T	0.58495	0.2126	N	0.04880	-0.145	0.28890	N	0.893893	B	0.20887	0.049	B	0.10450	0.005	T	0.45991	-0.9223	10	0.14656	T	0.56	-29.5845	3.399	0.07316	0.1871:0.2745:0.5384:0.0	.	256	A6NDU8	CE051_HUMAN	I	256	ENSP00000371061:V256I	ENSP00000371061:V256I	V	+	1	0	C5orf51	41953039	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	2.426000	0.44731	2.649000	0.89929	0.563000	0.77884	GTA		0.393	C5orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367144.1	NM_175921	
