#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CDH23	64072	broad.mit.edu	37	10	73567454	73567454	+	Silent	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr10:73567454G>A	ENST00000224721.6	+	58	8510	c.8505G>A	c.(8503-8505)caG>caA	p.Q2835Q	CDH23_ENST00000398788.3_Silent_p.Q590Q|CDH23_ENST00000475158.1_3'UTR	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2830	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.Q2835Q(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TCACACTGCAGGAGGTGCGCG	0.617																																					p.Q590Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1770A	10						.						35.0	37.0	37.0					10																	73567454		2170	4260	6430	73237460	SO:0001819	synonymous_variant	64072	exon12			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.8505G>A	10.37:g.73567454G>A		Somatic		Capture	Illumina HiSeq	Phase_I	73237460	NM_001171933	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	37																																																																																					0.617	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
C10orf12	26148	broad.mit.edu	37	10	98743374	98743374	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr10:98743374G>A	ENST00000286067.2	+	1	2334	c.2227G>A	c.(2227-2229)Gat>Aat	p.D743N		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	743								p.D743N(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GGGCTCCTTGGATGCTTCAAA	0.478																																					p.D743N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2227A	10						.						49.0	51.0	51.0					10																	98743374		2203	4300	6503	98733364	SO:0001583	missense	26148	exon1			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.2227G>A	10.37:g.98743374G>A	ENSP00000286067:p.Asp743Asn	Somatic		Capture	Illumina HiSeq	Phase_I	98733364	NM_015652	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528099	0.64860	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.08984	3.03	5.82	5.82	0.92795	.	0.406043	0.20338	N	0.094296	T	0.18299	0.0439	L	0.32530	0.975	0.24960	N	0.991735	D	0.63046	0.992	P	0.59357	0.856	T	0.02385	-1.1167	10	0.52906	T	0.07	-6.2849	18.273	0.90074	0.0:0.0:1.0:0.0	.	743	Q8N655	CJ012_HUMAN	N	743;577	ENSP00000286067:D743N	ENSP00000286067:D743N	D	+	1	0	C10orf12	98733364	0.658000	0.27402	0.532000	0.27989	0.107000	0.19398	3.365000	0.52335	2.765000	0.95021	0.561000	0.74099	GAT		0.478	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
MAPK8IP1	9479	broad.mit.edu	37	11	45926710	45926710	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr11:45926710G>A	ENST00000241014.2	+	11	2143	c.1973G>A	c.(1972-1974)gGg>gAg	p.G658E	MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.G648E|RP11-618K13.2_ENST00000533218.1_RNA	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	658	Interaction with VRK2.|PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)	p.G658E(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		AGGTACTTTGGGTTCATCACC	0.637																																					p.G658E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1973A	11						.						70.0	68.0	69.0					11																	45926710		2203	4299	6502	45883286	SO:0001583	missense	9479	exon11				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1973G>A	11.37:g.45926710G>A	ENSP00000241014:p.Gly658Glu	Somatic		Capture	Illumina HiSeq	Phase_I	45883286	NM_005456	D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738175	0.89573	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.17854	2.25;2.25	5.02	4.11	0.48088	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.54523	-0.8281	10	0.87932	D	0	-35.7231	13.7215	0.62730	0.0746:0.0:0.9254:0.0	.	658	Q9UQF2	JIP1_HUMAN	E	658;648	ENSP00000241014:G658E;ENSP00000378991:G648E	ENSP00000241014:G658E	G	+	2	0	MAPK8IP1	45883286	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.576000	0.98192	1.473000	0.48159	0.655000	0.94253	GGG		0.637	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456	
HNRNPUL2	221092	broad.mit.edu	37	11	62489836	62489836	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr11:62489836T>G	ENST00000301785.5	-	7	1304	c.1112A>C	c.(1111-1113)gAa>gCa	p.E371A	HNRNPUL2-BSCL2_ENST00000403734.2_Missense_Mutation_p.E371A	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	371	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E371A(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						AAGTTCTACTTCTTCAGTCTC	0.443																																					p.E371A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1112C	11						.						85.0	88.0	87.0					11																	62489836		1880	4108	5988	62246412	SO:0001583	missense	221092	exon7				CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.1112A>C	11.37:g.62489836T>G	ENSP00000301785:p.Glu371Ala	Somatic		Capture	Illumina HiSeq	Phase_I	62246412	NM_001079559	Q8N3B3	Missense_Mutation	SNP	ENST00000301785.5	37	CCDS41659.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.862323	0.51482	.	.	ENSG00000214753	ENST00000301785	T	0.50813	0.73	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.202121	0.40554	N	0.001065	T	0.54224	0.1845	L	0.53729	1.69	0.44330	D	0.997215	P	0.51449	0.945	P	0.54759	0.76	T	0.55016	-0.8206	10	0.48119	T	0.1	-16.4862	9.6504	0.39895	0.0:0.0:0.1752:0.8248	.	371	Q1KMD3	HNRL2_HUMAN	A	371	ENSP00000301785:E371A	ENSP00000301785:E371A	E	-	2	0	HNRNPUL2	62246412	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.031000	0.70911	2.308000	0.77769	0.533000	0.62120	GAA		0.443	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396208.2	XM_495877	
KAT5	10524	broad.mit.edu	37	11	65479868	65479868	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr11:65479868delT	ENST00000377046.3	+	2	303	c.31delT	c.(31-33)tgcfs	p.C11fs	KAT5_ENST00000530446.1_Frame_Shift_Del_p.C44fs|KAT5_ENST00000534650.1_5'Flank|KAT5_ENST00000352980.4_Frame_Shift_Del_p.C11fs|KAT5_ENST00000341318.4_Frame_Shift_Del_p.C44fs	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	11					androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)	p.C44fs*22(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						AATCGAGGGCTGCCGCCTACC	0.706																																					p.C44fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.130delT	11						.						17.0	23.0	21.0					11																	65479868		2196	4296	6492	65236444	SO:0001589	frameshift_variant	10524	exon1			U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.31delT	11.37:g.65479868delT	ENSP00000366245:p.Cys11fs	Somatic		Capture	Illumina HiSeq	Phase_I	65236444	NM_182710	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Frame_Shift_Del	DEL	ENST00000377046.3	37	CCDS31610.1																																																																																				0.706	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	
KCTD21	283219	broad.mit.edu	37	11	77884970	77884970	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr11:77884970C>G	ENST00000340067.3	-	2	909	c.631G>C	c.(631-633)Gtg>Ctg	p.V211L	KCTD21-AS1_ENST00000528468.1_RNA|KCTD21-AS1_ENST00000600795.1_RNA|KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000530261.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	211					protein homooligomerization (GO:0051260)			p.V211L(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			TTGGCGGGCACCACCCAGAGC	0.567																																					p.V211L												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G631C	11						.						123.0	128.0	126.0					11																	77884970		2200	4292	6492	77562618	SO:0001583	missense	283219	exon2			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.631G>C	11.37:g.77884970C>G	ENSP00000339340:p.Val211Leu	Somatic		Capture	Illumina HiSeq	Phase_I	77562618	NM_001029859	B4DTR0	Missense_Mutation	SNP	ENST00000340067.3	37	CCDS31645.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.245582	0.39697	.	.	ENSG00000188997	ENST00000340067	D	0.82803	-1.65	5.88	5.88	0.94601	.	0.123149	0.36066	N	0.002804	T	0.65974	0.2743	N	0.08118	0	0.32970	D	0.522165	B	0.02656	0.0	B	0.01281	0.0	T	0.62506	-0.6840	10	0.08179	T	0.78	.	14.8418	0.70230	0.0:0.8571:0.1429:0.0	.	211	Q4G0X4	KCD21_HUMAN	L	211	ENSP00000339340:V211L	ENSP00000339340:V211L	V	-	1	0	KCTD21	77562618	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	1.749000	0.38319	2.788000	0.95919	0.555000	0.69702	GTG		0.567	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390057.1	NM_001029859	
CADM1	23705	broad.mit.edu	37	11	115047265	115047265	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr11:115047265C>T	ENST00000452722.3	-	10	1278	c.1258G>A	c.(1258-1260)Gca>Aca	p.A420T	CADM1_ENST00000537140.1_Intron|CADM1_ENST00000331581.6_Missense_Mutation_p.A449T|CADM1_ENST00000536727.1_Missense_Mutation_p.A421T|CADM1_ENST00000537058.1_Missense_Mutation_p.A431T|CADM1_ENST00000542447.2_Missense_Mutation_p.A392T	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.A420T(2)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		GCTGTGTCTGCGTCTGCTGCG	0.458																																					p.A420T												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1258A	11						.						264.0	236.0	246.0					11																	115047265		2201	4296	6497	114552475	SO:0001583	missense	23705	exon10			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1258G>A	11.37:g.115047265C>T	ENSP00000395359:p.Ala420Thr	Somatic		Capture	Illumina HiSeq	Phase_I	114552475	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.318410|4.318410	0.81469|0.81469	.|.	.|.	ENSG00000182985|ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325|ENST00000545380	T;T;T;T;T|.	0.73897|.	-0.79;-0.27;0.06;-0.32;-0.22|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.058760|.	0.64402|.	D|.	0.000003|.	T|T	0.75079|0.75079	0.3801|0.3801	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.99;0.988|.	T|T	0.72776|0.72776	-0.4191|-0.4191	10|5	0.46703|.	T|.	0.11|.	.|.	19.277|19.277	0.94036|0.94036	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	431;393;420|.	F5H0J4;A4FVB5;Q9BY67|.	.;.;CADM1_HUMAN|.	T|H	392;420;431;421;351;449;105|390	ENSP00000439176:A392T;ENSP00000395359:A420T;ENSP00000439817:A431T;ENSP00000440322:A421T;ENSP00000329797:A449T|.	ENSP00000329797:A449T|.	A|R	-|-	1|2	0|0	CADM1|CADM1	114552475|114552475	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.651000|7.651000	0.83577|0.83577	2.782000|2.782000	0.95742|0.95742	0.655000|0.655000	0.94253|0.94253	GCA|CGC		0.458	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
TMBIM4	51643	broad.mit.edu	37	12	66541717	66541717	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr12:66541717A>G	ENST00000358230.3	-	4	437	c.317T>C	c.(316-318)cTg>cCg	p.L106P	TMBIM4_ENST00000556010.1_Missense_Mutation_p.L106P|TMBIM4_ENST00000542724.1_Missense_Mutation_p.L75P|TMBIM4_ENST00000286424.7_Missense_Mutation_p.L153P|TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000398033.4_Missense_Mutation_p.L106P|TMBIM4_ENST00000539652.1_Missense_Mutation_p.L106P	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	106					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)		p.L106P(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		AGCTTCCAACAGCGTCTAATG	0.318																																					p.L106P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T317C	12						.						43.0	42.0	42.0					12																	66541717		1814	4079	5893	64827984	SO:0001583	missense	51643	exon4			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.317T>C	12.37:g.66541717A>G	ENSP00000350965:p.Leu106Pro	Somatic		Capture	Illumina HiSeq	Phase_I	64827984	NM_016056	Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	37	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836568	0.50951	.	.	ENSG00000155957	ENST00000556010;ENST00000358230;ENST00000426857;ENST00000286424;ENST00000398033;ENST00000539043;ENST00000539427;ENST00000542724	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.19	4.01	0.46588	.	0.520096	0.19196	N	0.120314	T	0.68622	0.3021	M	0.92507	3.315	0.26831	N	0.968581	D;D;P;D;P	0.60160	0.96;0.973;0.931;0.987;0.881	P;P;P;P;P	0.62089	0.844;0.894;0.844;0.898;0.877	T	0.64198	-0.6464	9	.	.	.	0.4276	5.3816	0.16194	0.7609:0.0:0.0832:0.1559	.	106;153;106;75;106	E7EWY5;G3XAA5;E7EQ00;G3V1M2;Q9HC24	.;.;.;.;TMBI4_HUMAN	P	106;106;106;153;106;106;152;75	ENSP00000451688:L106P;ENSP00000350965:L106P;ENSP00000286424:L153P;ENSP00000381114:L106P;ENSP00000441291:L75P	.	L	-	2	0	TMBIM4	64827984	0.513000	0.26194	0.023000	0.16930	0.880000	0.50808	4.965000	0.63708	0.880000	0.35969	0.477000	0.44152	CTG		0.318	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056	
SYNE2	23224	broad.mit.edu	37	14	64514773	64514773	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr14:64514773G>A	ENST00000344113.4	+	46	7489	c.7277G>A	c.(7276-7278)aGc>aAc	p.S2426N	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.S2459N|SYNE2_ENST00000358025.3_Missense_Mutation_p.S2426N	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2426					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.S2426N(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCTCAAGAAAGCATGAAAAAC	0.328																																					p.S2426N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7277A	14						.						77.0	75.0	76.0					14																	64514773		1854	4094	5948	63584526	SO:0001583	missense	23224	exon46			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7277G>A	14.37:g.64514773G>A	ENSP00000341781:p.Ser2426Asn	Somatic		Capture	Illumina HiSeq	Phase_I	63584526	NM_015180	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.601599	0.46423	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.57273	0.74;0.75;0.41	5.7	4.8	0.61643	.	0.160223	0.44688	D	0.000423	T	0.33118	0.0852	N	0.17082	0.46	0.80722	D	1	B;B	0.24426	0.062;0.103	B;B	0.26094	0.03;0.066	T	0.13098	-1.0522	10	0.28530	T	0.3	.	6.6133	0.22763	0.084:0.0:0.5933:0.3227	.	2426;2426	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	N	2426;2426;2459;2459	ENSP00000350719:S2426N;ENSP00000341781:S2426N;ENSP00000452570:S2459N	ENSP00000261678:S2459N	S	+	2	0	SYNE2	63584526	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	2.408000	0.44574	1.404000	0.46819	0.460000	0.39030	AGC		0.328	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
GABRA5	2558	broad.mit.edu	37	15	27193307	27193307	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr15:27193307C>G	ENST00000335625.5	+	11	2204	c.1316C>G	c.(1315-1317)aCt>aGt	p.T439S	GABRA5_ENST00000400081.3_Missense_Mutation_p.T439S|GABRA5_ENST00000355395.5_Missense_Mutation_p.T439S	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	439					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.T439S(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	TTGTTCGGCACTTTCAACTTA	0.438																																					p.T439S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1316G	15						.						36.0	35.0	35.0					15																	27193307		1834	4094	5928	24776053	SO:0001583	missense	2558	exon11				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.1316C>G	15.37:g.27193307C>G	ENSP00000335592:p.Thr439Ser	Somatic		Capture	Illumina HiSeq	Phase_I	24776053	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627020	0.28978	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	D;D;D	0.85411	-1.98;-1.98;-1.98	5.06	4.14	0.48551	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.048182	0.85682	D	0.000000	T	0.78717	0.4327	L	0.41710	1.295	0.50813	D	0.999891	B	0.16603	0.018	B	0.24006	0.05	T	0.74140	-0.3761	10	0.49607	T	0.09	.	9.1564	0.36996	0.0:0.8339:0.0:0.1661	.	439	P31644	GBRA5_HUMAN	S	439	ENSP00000335592:T439S;ENSP00000347557:T439S;ENSP00000382953:T439S	ENSP00000335592:T439S	T	+	2	0	GABRA5	24776053	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	3.923000	0.56469	1.254000	0.44035	0.655000	0.94253	ACT		0.438	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
RYR3	6263	broad.mit.edu	37	15	33858936	33858936	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr15:33858936C>T	ENST00000389232.4	+	12	1274	c.1204C>T	c.(1204-1206)Cgt>Tgt	p.R402C	RYR3_ENST00000415757.3_Missense_Mutation_p.R402C	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	402					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.R402C(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAGATGCCAGCGTGAGGAGTC	0.507																																					p.R402C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1204T	15						.						176.0	180.0	178.0					15																	33858936		2124	4238	6362	31646228	SO:0001583	missense	6263	exon12				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1204C>T	15.37:g.33858936C>T	ENSP00000373884:p.Arg402Cys	Somatic		Capture	Illumina HiSeq	Phase_I	31646228	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722082	0.48728	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96745	-4.11;-4.11	4.58	2.69	0.31865	.	0.429405	0.25050	N	0.033529	D	0.90521	0.7030	L	0.34521	1.04	0.32880	D	0.510457	B;B	0.31125	0.309;0.0	B;B	0.17722	0.019;0.0	D	0.88762	0.3258	10	0.59425	D	0.04	.	5.7615	0.18203	0.1547:0.6808:0.0:0.1645	.	402;402	Q15413-2;Q15413	.;RYR3_HUMAN	C	402	ENSP00000373884:R402C;ENSP00000399610:R402C	ENSP00000354735:R402C	R	+	1	0	RYR3	31646228	0.997000	0.39634	0.548000	0.28192	0.803000	0.45373	3.701000	0.54793	0.658000	0.30925	0.650000	0.86243	CGT		0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SNX33	257364	broad.mit.edu	37	15	75942240	75942240	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr15:75942240G>A	ENST00000308527.5	+	1	1994	c.797G>A	c.(796-798)cGc>cAc	p.R266H	IMP3_ENST00000314852.2_5'Flank|IMP3_ENST00000565349.1_5'Flank	NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	266	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.R266H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						GTCTACCGGCGCTACAAACAC	0.552																																					p.R266H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G797A	15						.						147.0	136.0	140.0					15																	75942240		2197	4294	6491	73729295	SO:0001583	missense	257364	exon1			AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.797G>A	15.37:g.75942240G>A	ENSP00000311427:p.Arg266His	Somatic		Capture	Illumina HiSeq	Phase_I	73729295	NM_153271	B1NM17	Missense_Mutation	SNP	ENST00000308527.5	37	CCDS10283.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448401	0.43429	.	.	ENSG00000173548	ENST00000308527	T	0.55052	0.54	5.42	5.42	0.78866	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	D	0.83394	0.5245	H	0.97783	4.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89689	0.3896	10	0.87932	D	0	-7.8478	17.7863	0.88539	0.0:0.0:1.0:0.0	.	266	Q8WV41	SNX33_HUMAN	H	266	ENSP00000311427:R266H	ENSP00000311427:R266H	R	+	2	0	SNX33	73729295	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	9.867000	0.99620	2.543000	0.85770	0.561000	0.74099	CGC		0.552	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286471.1	NM_153271	
OR4F15	390649	broad.mit.edu	37	15	102359299	102359299	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr15:102359299C>T	ENST00000332238.4	+	1	934	c.910C>T	c.(910-912)Cgt>Tgt	p.R304C		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R304C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			ACTGTGCAGTCGTCTTGCGCA	0.368																																					p.R304C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C910T	15						.						44.0	39.0	41.0					15																	102359299		2203	4300	6503	100176822	SO:0001583	missense	390649	exon1			BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.910C>T	15.37:g.102359299C>T	ENSP00000333184:p.Arg304Cys	Somatic		Capture	Illumina HiSeq	Phase_I	100176822	NM_001001674	B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	ENST00000332238.4	37	CCDS32342.1	.	.	.	.	.	.	.	.	.	.	.	14.77	2.634701	0.47049	.	.	ENSG00000182854	ENST00000332238	T	0.35048	1.33	5.35	1.07	0.20283	.	.	.	.	.	T	0.23532	0.0569	L	0.28556	0.865	0.09310	N	1	P	0.52463	0.953	P	0.44860	0.462	T	0.09862	-1.0655	8	.	.	.	.	1.7212	0.02912	0.1587:0.4774:0.1756:0.1884	.	304	Q8NGB8	O4F15_HUMAN	C	304	ENSP00000333184:R304C	.	R	+	1	0	OR4F15	100176822	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.008000	0.12788	0.364000	0.24374	0.650000	0.86243	CGT		0.368	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674	
N4BP1	9683	broad.mit.edu	37	16	48595385	48595385	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr16:48595385C>T	ENST00000262384.3	-	2	1405	c.1169G>A	c.(1168-1170)aGa>aAa	p.R390K	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	390					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)		p.R390K(1)		breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				TTCTTGGAATCTTTTATTTTC	0.358																																					p.R390K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1169A	16						.						45.0	44.0	44.0					16																	48595385		1816	4072	5888	47152886	SO:0001583	missense	9683	exon2			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.1169G>A	16.37:g.48595385C>T	ENSP00000262384:p.Arg390Lys	Somatic		Capture	Illumina HiSeq	Phase_I	47152886	NM_153029	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	37	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	C	3.093	-0.186377	0.06340	.	.	ENSG00000102921	ENST00000262384	T	0.42513	0.97	5.78	2.78	0.32641	.	0.301827	0.36628	N	0.002494	T	0.17408	0.0418	N	0.05124	-0.11	0.09310	N	0.999995	B	0.06786	0.001	B	0.04013	0.001	T	0.20874	-1.0262	10	0.09590	T	0.72	-11.6216	8.4152	0.32668	0.0:0.6281:0.0:0.3719	.	390	O75113	N4BP1_HUMAN	K	390	ENSP00000262384:R390K	ENSP00000262384:R390K	R	-	2	0	N4BP1	47152886	0.996000	0.38824	0.954000	0.39281	0.995000	0.86356	3.066000	0.50002	1.463000	0.47967	0.655000	0.94253	AGA		0.358	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
CTCF	10664	broad.mit.edu	37	16	67660607	67660607	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr16:67660607G>T	ENST00000264010.4	+	8	1951	c.1507G>T	c.(1507-1509)Gct>Tct	p.A503S	CTCF_ENST00000401394.1_Missense_Mutation_p.A175S	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	503					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A503S(1)|p.A503T(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GTGTGATTACGCTTGTAGACA	0.448																																					p.A175S	Colon(175;1200 1966 6945 23069 27405)											.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G523T	16						.						117.0	101.0	106.0					16																	67660607		2198	4300	6498	66218108	SO:0001583	missense	10664	exon6			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1507G>T	16.37:g.67660607G>T	ENSP00000264010:p.Ala503Ser	Somatic		Capture	Illumina HiSeq	Phase_I	66218108	NM_001191022	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	37	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500405	0.85176	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	T;T	0.18338	2.22;2.22	5.38	5.38	0.77491	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.19846	0.0477	L	0.39326	1.205	0.58432	D	0.999999	B	0.31383	0.321	B	0.33568	0.166	T	0.02098	-1.1214	10	0.45353	T	0.12	-2.6316	19.4985	0.95083	0.0:0.0:1.0:0.0	.	503	P49711	CTCF_HUMAN	S	503;175	ENSP00000264010:A503S;ENSP00000384707:A175S	ENSP00000264010:A503S	A	+	1	0	CTCF	66218108	1.000000	0.71417	0.964000	0.40570	0.992000	0.81027	7.495000	0.81514	2.698000	0.92095	0.561000	0.74099	GCT		0.448	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R282W	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-2 	.	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	c.C844T	17	GRCh37	CM056413|CM920678	TP53	M	rs28934574	.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	7517819	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp	Somatic		Capture	Illumina HiSeq	Phase_I	7517819	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
GPR142	350383	broad.mit.edu	37	17	72367917	72367917	+	Silent	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr17:72367917G>A	ENST00000335666.4	+	4	615	c.567G>A	c.(565-567)agG>agA	p.R189R		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	189						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R189R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CCAGGACCAGGAGGCCCTCCT	0.637																																					p.R189R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G567A	17						.						54.0	48.0	50.0					17																	72367917		2203	4300	6503	69879512	SO:0001819	synonymous_variant	350383	exon4			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.567G>A	17.37:g.72367917G>A		Somatic		Capture	Illumina HiSeq	Phase_I	69879512	NM_181790	A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	37	CCDS11698.1																																																																																				0.637	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
CTC1	80169	broad.mit.edu	37	17	8137863	8137863	+	Silent	SNP	C	C	T	rs78320653	byFrequency	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr17:8137863C>T	ENST00000315684.8	-	10	1735	c.1728G>A	c.(1726-1728)ccG>ccA	p.P576P	CTC1_ENST00000581671.1_5'Flank	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	576					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)	p.P576P(1)		NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						AGGAGGCCTCCGGGAGGGGCA	0.642													c|||	4	0.000798722	0.0	0.0014	5008	,	,		17026	0.0		0.003	False		,,,				2504	0.0				p.P576P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1728A	17						.			2,3998		0,2,1998	26.0	31.0	29.0		1728	-2.6	0.8	17	dbSNP_132	29	14,8306		0,14,4146	no	coding-synonymous	CTC1	NM_025099.5		0,16,6144	TT,TC,CC		0.1683,0.05,0.1299		576/1218	8137863	16,12304	2000	4160	6160	8078588	SO:0001819	synonymous_variant	80169	exon10			AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.1728G>A	17.37:g.8137863C>T		Somatic		Capture	Illumina HiSeq	Phase_I	8078588	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Silent	SNP	ENST00000315684.8	37	CCDS42259.1																																																																																				0.642	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
CCDC40	55036	broad.mit.edu	37	17	78055437	78055437	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr17:78055437C>T	ENST00000397545.4	+	11	1682	c.1655C>T	c.(1654-1656)gCg>gTg	p.A552V	CCDC40_ENST00000374877.3_Missense_Mutation_p.A552V	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	552					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.A552V(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GAGAAGCTGGCGAGCATCCTG	0.542																																					p.A552V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1655T	17						.						47.0	55.0	52.0					17																	78055437		2080	4218	6298	75670032	SO:0001583	missense	55036	exon11			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1655C>T	17.37:g.78055437C>T	ENSP00000380679:p.Ala552Val	Somatic		Capture	Illumina HiSeq	Phase_I	75670032	NM_017950	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	CCDS42395.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249927	0.39797	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	T;T	0.48836	0.8;0.84	5.35	4.38	0.52667	.	.	.	.	.	T	0.32315	0.0825	L	0.47716	1.5	0.28746	N	0.901696	P;P	0.41475	0.751;0.642	B;B	0.31290	0.06;0.127	T	0.18935	-1.0321	9	0.26408	T	0.33	-23.5771	5.8245	0.18546	0.1564:0.6733:0.0:0.1704	.	552;335	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	V	552	ENSP00000364011:A552V;ENSP00000380679:A552V	ENSP00000364011:A552V	A	+	2	0	CCDC40	75670032	0.924000	0.31332	0.844000	0.33320	0.578000	0.36192	1.826000	0.39092	1.239000	0.43787	0.655000	0.94253	GCG		0.542	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
SETBP1	26040	broad.mit.edu	37	18	42531271	42531271	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr18:42531271G>C	ENST00000282030.5	+	4	2262	c.1966G>C	c.(1966-1968)Ggc>Cgc	p.G656R		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	656						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G656R(1)|p.G602R(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGGAAAGCTCGGCGTGTTGGA	0.453									Schinzel-Giedion syndrome																												p.G656R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1966C	18						.						53.0	47.0	49.0					18																	42531271		2187	4268	6455	40785269	SO:0001583	missense	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1966G>C	18.37:g.42531271G>C	ENSP00000282030:p.Gly656Arg	Somatic		Capture	Illumina HiSeq	Phase_I	40785269	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687861	0.68271	.	.	ENSG00000152217	ENST00000282030	T	0.74526	-0.85	6.07	6.07	0.98685	.	0.054962	0.64402	D	0.000001	D	0.84620	0.5512	L	0.55481	1.735	0.53005	D	0.999965	D	0.71674	0.998	D	0.71414	0.973	D	0.84438	0.0581	10	0.87932	D	0	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	656	Q9Y6X0	SETBP_HUMAN	R	656	ENSP00000282030:G656R	ENSP00000282030:G656R	G	+	1	0	SETBP1	40785269	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	6.665000	0.74442	2.890000	0.99128	0.650000	0.86243	GGC		0.453	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
CRTC1	23373	broad.mit.edu	37	19	18856738	18856738	+	Missense_Mutation	SNP	C	C	T	rs540923120		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr19:18856738C>T	ENST00000321949.8	+	3	375	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	CRTC1_ENST00000338797.6_Missense_Mutation_p.R133W|CRTC1_ENST00000594658.1_Missense_Mutation_p.R76W|CRTC1_ENST00000601916.1_Missense_Mutation_p.R42W	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1									p.R117W(1)	CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						CCCACACCGCCGGCCCCTGTC	0.672																																					p.R117W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C349T	19						.						30.0	36.0	34.0					19																	18856738		2202	4299	6501	18717738	SO:0001583	missense	23373	exon3			AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.349C>T	19.37:g.18856738C>T	ENSP00000323332:p.Arg117Trp	Somatic		Capture	Illumina HiSeq	Phase_I	18717738	NM_015321		Missense_Mutation	SNP	ENST00000321949.8	37	CCDS32963.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976137	0.92982	.	.	ENSG00000105662	ENST00000262813;ENST00000338797;ENST00000321949	T;T	0.19938	2.11;2.19	4.98	4.98	0.66077	.	0.129741	0.50627	D	0.000105	T	0.41926	0.1180	M	0.64997	1.995	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	P;P	0.61275	0.886;0.794	T	0.34675	-0.9819	10	0.72032	D	0.01	-28.5352	16.8448	0.85977	0.0:1.0:0.0:0.0	.	133;117	Q6UUV9-2;Q6UUV9	.;CRTC1_HUMAN	W	117;133;117	ENSP00000345001:R133W;ENSP00000323332:R117W	ENSP00000262813:R117W	R	+	1	2	CRTC1	18717738	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.271000	0.51608	2.332000	0.79248	0.555000	0.69702	CGG		0.672	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021	
KHSRP	8570	broad.mit.edu	37	19	6418853	6418853	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr19:6418853G>A	ENST00000398148.3	-	8	732	c.640C>T	c.(640-642)Cgg>Tgg	p.R214W	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	214	Gly-rich.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.R214W(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						CCACGACCCCGAGACACAATG	0.657																																					p.R214W	Colon(55;593 1006 2067 9135 22980)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C640T	19						.						22.0	24.0	24.0					19																	6418853		1915	4122	6037	6369853	SO:0001583	missense	8570	exon8			U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.640C>T	19.37:g.6418853G>A	ENSP00000381216:p.Arg214Trp	Somatic		Capture	Illumina HiSeq	Phase_I	6369853	NM_003685	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064530	0.55432	.	.	ENSG00000088247	ENST00000398148;ENST00000201886;ENST00000424942	T	0.54675	0.56	5.25	4.2	0.49525	.	0.122849	0.53938	D	0.000058	T	0.71022	0.3291	M	0.84082	2.675	0.53005	D	0.999966	D	0.76494	0.999	D	0.63793	0.918	T	0.75819	-0.3183	10	0.87932	D	0	.	12.3712	0.55256	0.0:0.0:0.8309:0.1691	.	214	Q92945	FUBP2_HUMAN	W	214;214;170	ENSP00000381216:R214W	ENSP00000201886:R214W	R	-	1	2	KHSRP	6369853	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.211000	0.51137	1.181000	0.42912	0.655000	0.94253	CGG		0.657	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
ZNF493	284443	broad.mit.edu	37	19	21606563	21606563	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr19:21606563A>T	ENST00000355504.4	+	2	984	c.718A>T	c.(718-720)Aaa>Taa	p.K240*	ZNF493_ENST00000392288.2_Nonsense_Mutation_p.K368*|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K240*(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						TACTACACATAAAAGAATTCA	0.353																																					p.K240X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A718T	19						.						45.0	49.0	48.0					19																	21606563		2197	4292	6489	21398403	SO:0001587	stop_gained	284443	exon2			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.718A>T	19.37:g.21606563A>T	ENSP00000347691:p.Lys240*	Somatic		Capture	Illumina HiSeq	Phase_I	21398403	NM_175910	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Nonsense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	17.87	3.494039	0.64186	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	.	.	.	0.966	-1.12	0.09808	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	5.6679	0.17704	0.5413:0.4587:0.0:0.0	.	.	.	.	X	368;240	.	ENSP00000347691:K240X	K	+	1	0	ZNF493	21398403	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-2.071000	0.01378	0.333000	0.23563	0.328000	0.21473	AAA		0.353	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
EXOSC10	5394	broad.mit.edu	37	1	11158081	11158081	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:11158081G>A	ENST00000376936.4	-	2	293	c.244C>T	c.(244-246)Cag>Tag	p.Q82*	RP4-635E18.6_ENST00000447600.1_RNA|EXOSC10_ENST00000544779.1_Nonsense_Mutation_p.Q82*|RP4-635E18.6_ENST00000435388.1_RNA|EXOSC10_ENST00000304457.7_Nonsense_Mutation_p.Q82*	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	82					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q82*(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		ACTTACCACTGAAGCAACCTG	0.373																																					p.Q82X	Colon(179;105 1987 14326 27364 29542)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C244T	1						.						73.0	68.0	69.0					1																	11158081		2203	4300	6503	11080668	SO:0001587	stop_gained	5394	exon2			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.244C>T	1.37:g.11158081G>A	ENSP00000366135:p.Gln82*	Somatic		Capture	Illumina HiSeq	Phase_I	11080668	NM_001001998	B1AKQ0|B1AKQ1|Q15158	Nonsense_Mutation	SNP	ENST00000376936.4	37	CCDS30584.1	.	.	.	.	.	.	.	.	.	.	G	33	5.236005	0.95240	.	.	ENSG00000171824	ENST00000376936;ENST00000304457;ENST00000544779	.	.	.	5.58	4.64	0.57946	.	0.272693	0.42821	D	0.000658	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	15.3351	0.74247	0.0:0.1402:0.8598:0.0	.	.	.	.	X	82	.	ENSP00000307307:Q82X	Q	-	1	0	EXOSC10	11080668	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	4.287000	0.59001	1.297000	0.44761	0.561000	0.74099	CAG		0.373	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
GPR61	83873	broad.mit.edu	37	1	110085966	110085966	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:110085966G>A	ENST00000527748.1	+	2	1005	c.322G>A	c.(322-324)Gcc>Acc	p.A108T	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.A108T(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		CTTTGACCACGCCCTCTTTGG	0.592																																					p.A108T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322A	1						.						94.0	88.0	90.0					1																	110085966		2203	4300	6503	109887489	SO:0001583	missense	83873	exon2			AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.322G>A	1.37:g.110085966G>A	ENSP00000432456:p.Ala108Thr	Somatic		Capture	Illumina HiSeq	Phase_I	109887489	NM_031936	A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Missense_Mutation	SNP	ENST00000527748.1	37	CCDS801.1	.	.	.	.	.	.	.	.	.	.	G	7.585	0.669553	0.14776	.	.	ENSG00000156097	ENST00000527748;ENST00000286603	T	0.71698	-0.59	5.46	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.380223	0.22057	N	0.065238	T	0.37892	0.1020	L	0.34521	1.04	0.29396	N	0.86225	B	0.11235	0.004	B	0.06405	0.002	T	0.27872	-1.0061	10	0.54805	T	0.06	-2.2681	6.2484	0.20832	0.1602:0.2661:0.5737:0.0	.	108	Q9BZJ8	GPR61_HUMAN	T	108;236	ENSP00000432456:A108T	ENSP00000286603:A236T	A	+	1	0	GPR61	109887489	0.007000	0.16637	0.804000	0.32291	0.976000	0.68499	1.699000	0.37804	1.294000	0.44707	0.655000	0.94253	GCC		0.592	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385575.1		
SETDB1	9869	broad.mit.edu	37	1	150923560	150923560	+	Missense_Mutation	SNP	G	G	A	rs200603147		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:150923560G>A	ENST00000271640.5	+	13	2397	c.2207G>A	c.(2206-2208)cGg>cAg	p.R736Q	SETDB1_ENST00000368969.4_Missense_Mutation_p.R736Q|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	736	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.R736Q(1)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GATGGGTGTCGGGACAAGTGA	0.527																																					p.R736Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2207A	1						.	G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	64.0	70.0	68.0		2207,2207	5.8	1.0	1		68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SETDB1	NM_001145415.1,NM_012432.3	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	736/1292,736/1291	150923560	1,13005	2203	4300	6503	149190184	SO:0001583	missense	9869	exon13			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2207G>A	1.37:g.150923560G>A	ENSP00000271640:p.Arg736Gln	Somatic		Capture	Illumina HiSeq	Phase_I	149190184	NM_001145415	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.008593	0.54361	0.0	1.16E-4	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	T;T;T	0.76186	-1.0;-1.0;-1.0	5.81	5.81	0.92471	Pre-SET zinc-binding sub-group (1);Pre-SET domain (2);	0.000000	0.85682	D	0.000000	T	0.68329	0.2989	N	0.11845	0.185	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;P;P	0.68765	0.96;0.818;0.886	T	0.68217	-0.5467	10	0.25106	T	0.35	.	19.0666	0.93114	0.0:0.0:1.0:0.0	.	736;736;736	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	Q	736	ENSP00000271640:R736Q;ENSP00000357965:R736Q;ENSP00000432348:R736Q	ENSP00000271640:R736Q	R	+	2	0	SETDB1	149190184	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	3.367000	0.52350	2.736000	0.93811	0.655000	0.94253	CGG		0.527	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
LMX1A	4009	broad.mit.edu	37	1	165175227	165175227	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:165175227T>C	ENST00000342310.3	-	8	1244	c.862A>G	c.(862-864)Aac>Gac	p.N288D	LMX1A_ENST00000367893.4_Missense_Mutation_p.N288D|LMX1A_ENST00000489443.2_5'UTR|LMX1A_ENST00000294816.2_Missense_Mutation_p.N288D	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	288					axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.N288D(1)		NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					GTGTAGGGGTTCATGATTCCT	0.567																																					p.N288D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A862G	1						.						127.0	118.0	121.0					1																	165175227		2203	4300	6503	163441851	SO:0001583	missense	4009	exon8			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.862A>G	1.37:g.165175227T>C	ENSP00000340226:p.Asn288Asp	Somatic		Capture	Illumina HiSeq	Phase_I	163441851	NM_177398	B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Missense_Mutation	SNP	ENST00000342310.3	37	CCDS1247.1	.	.	.	.	.	.	.	.	.	.	T	13.64	2.297068	0.40694	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	D;D;D	0.86432	-2.12;-2.12;-2.12	5.39	5.39	0.77823	.	0.376571	0.32081	N	0.006616	T	0.71719	0.3373	L	0.43152	1.355	0.37075	D	0.898737	P	0.41313	0.745	B	0.32928	0.155	T	0.74064	-0.3785	9	0.25751	T	0.34	.	15.0829	0.72127	0.0:0.0:0.0:1.0	.	288	Q8TE12	LMX1A_HUMAN	D	288	ENSP00000340226:N288D;ENSP00000294816:N288D;ENSP00000356868:N288D	ENSP00000294816:N288D	N	-	1	0	LMX1A	163441851	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.457000	0.80775	2.046000	0.60703	0.482000	0.46254	AAC		0.567	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083668.2	NM_177398	
MUL1	79594	broad.mit.edu	37	1	20827257	20827257	+	Missense_Mutation	SNP	C	C	T	rs139030069		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:20827257C>T	ENST00000264198.3	-	4	1121	c.985G>A	c.(985-987)Gcc>Acc	p.A329T		NM_024544.2	NP_078820.2	Q969V5	MUL1_HUMAN	mitochondrial E3 ubiquitin protein ligase 1	329					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|cellular response to exogenous dsRNA (GO:0071360)|mitochondrial fission (GO:0000266)|mitochondrion localization (GO:0051646)|negative regulation of cell growth (GO:0030308)|negative regulation of chemokine (C-C motif) ligand 5 production (GO:0071650)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of innate immune response (GO:0045824)|negative regulation of mitochondrial fusion (GO:0010637)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein sumoylation (GO:0033235)|protein stabilization (GO:0050821)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)	cytoplasm (GO:0005737)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A329T(1)		endometrium(2)|large_intestine(4)|lung(5)	11		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		TCTGGCAAGGCGCGGTAGCAC	0.567																																					p.A329T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G985A	1						.	C	THR/ALA	0,4406		0,0,2203	80.0	73.0	75.0		985	5.3	0.2	1	dbSNP_134	75	3,8597	3.0+/-9.4	0,3,4297	no	missense	MUL1	NM_024544.2	58	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	329/353	20827257	3,13003	2203	4300	6503	20699844	SO:0001583	missense	79594	exon4			BC014010	CCDS208.1	1p36.12	2013-01-11	2010-09-17	2008-03-26	ENSG00000090432	ENSG00000090432		"""RING-type (C3HC4) zinc fingers"""	25762	protein-coding gene	gene with protein product	"""ring finger protein 218"", ""mitochondria-anchored protein ligase"", ""growth inhibition and death E3 ligase"", ""mitochondrial ubiquitin ligase activator of NFKB 1"""	612037	"""chromosome 1 open reading frame 166"""	C1orf166		18591963, 12761501, 18213395, 18207745	Standard	NM_024544		Approved	FLJ12875, MULAN, RNF218, MAPL, GIDE	uc001bdi.4	Q969V5	OTTHUMG00000002838	ENST00000264198.3:c.985G>A	1.37:g.20827257C>T	ENSP00000264198:p.Ala329Thr	Somatic		Capture	Illumina HiSeq	Phase_I	20699844	NM_024544	B5M497|Q7Z431|Q9H9B5	Missense_Mutation	SNP	ENST00000264198.3	37	CCDS208.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.662159	0.67700	0.0	3.49E-4	ENSG00000090432	ENST00000264198	T	0.79033	-1.23	6.17	5.26	0.73747	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.091636	0.85682	D	0.000000	T	0.71467	0.3343	L	0.46947	1.48	0.58432	D	0.999999	P	0.41214	0.742	B	0.39258	0.295	T	0.69045	-0.5249	10	0.22706	T	0.39	-34.2296	14.8938	0.70627	0.1444:0.8556:0.0:0.0	.	329	Q969V5	MUL1_HUMAN	T	329	ENSP00000264198:A329T	ENSP00000264198:A329T	A	-	1	0	MUL1	20699844	0.992000	0.36948	0.179000	0.23059	0.507000	0.33981	3.064000	0.49986	1.623000	0.50342	-0.152000	0.13540	GCC		0.567	MUL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007951.1	NM_024544	
FMO1	2326	broad.mit.edu	37	1	171251160	171251160	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:171251160C>T	ENST00000354841.4	+	6	1002	c.871C>T	c.(871-873)Cgc>Tgc	p.R291C	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Missense_Mutation_p.R228C|FMO1_ENST00000367750.3_Missense_Mutation_p.R291C	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	291					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.R291C(2)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GCTCCCAGGACGCATCATCAC	0.418																																					p.R291C												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C871T	1						.						75.0	69.0	71.0					1																	171251160		2203	4300	6503	169517784	SO:0001583	missense	2326	exon7			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.871C>T	1.37:g.171251160C>T	ENSP00000346901:p.Arg291Cys	Somatic		Capture	Illumina HiSeq	Phase_I	169517784	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348608	0.24426	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.55413	0.52;0.52;0.52	5.81	-0.52	0.11935	.	0.108962	0.64402	N	0.000005	T	0.29126	0.0724	L	0.56769	1.78	0.19775	N	0.999951	B;B;B	0.33857	0.429;0.178;0.113	B;B;B	0.39738	0.14;0.308;0.099	T	0.35773	-0.9775	10	0.29301	T	0.29	-6.6858	10.3213	0.43767	0.0:0.4836:0.0:0.5164	.	228;291;291	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	C	291;228;291	ENSP00000356724:R291C;ENSP00000385543:R228C;ENSP00000346901:R291C	ENSP00000346901:R291C	R	+	1	0	FMO1	169517784	0.000000	0.05858	0.933000	0.37362	0.769000	0.43574	-0.086000	0.11233	-0.118000	0.11851	0.555000	0.69702	CGC		0.418	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
EBNA1BP2	10969	broad.mit.edu	37	1	43637775	43637775	+	Silent	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:43637775C>T	ENST00000236051.2	-	1	156	c.15G>A	c.(13-15)ccG>ccA	p.P5P	EBNA1BP2_ENST00000472982.1_5'UTR|WDR65_ENST00000372492.4_5'Flank|WDR65_ENST00000528956.1_5'Flank|EBNA1BP2_ENST00000431635.2_Silent_p.P60P	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	5					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P5P(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AATCCGAGAGCGGGGGAGTGT	0.647																																					p.P5P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G15A	1						.						48.0	44.0	45.0					1																	43637775		2203	4300	6503	43410362	SO:0001819	synonymous_variant	10969	exon1			U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.15G>A	1.37:g.43637775C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43410362	NM_006824	Q96A66	Silent	SNP	ENST00000236051.2	37	CCDS478.1																																																																																				0.647	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		
FPGT-TNNI3K	100526835	broad.mit.edu	37	1	74801726	74801726	+	Missense_Mutation	SNP	A	A	C	rs184881523		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:74801726A>C	ENST00000370899.3	+	9	915	c.878A>C	c.(877-879)gAt>gCt	p.D293A	TNNI3K_ENST00000326637.3_Missense_Mutation_p.D192A|TNNI3K_ENST00000370891.2_Missense_Mutation_p.D293A|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.D293A|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.D306A	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.D192A(1)									TTTGGTGCTGATGTAAATGTA	0.353																																					p.D293A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A878C	1						.						111.0	107.0	108.0					1																	74801726		2203	4300	6503	74574314	SO:0001583	missense	51086	exon9					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.878A>C	1.37:g.74801726A>C	ENSP00000359936:p.Asp293Ala	Somatic		Capture	Illumina HiSeq	Phase_I	74574314	NM_001199327		Missense_Mutation	SNP	ENST00000370899.3	37		.	.	.	.	.	.	.	.	.	.	A	23.1	4.380504	0.82792	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39	5.23	5.23	0.72850	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.76579	0.4007	M	0.70787	2.145	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;0.999;0.999;0.98	D;D;D;P	0.83275	0.996;0.964;0.964;0.554	T	0.79322	-0.1851	10	0.59425	D	0.04	.	15.2784	0.73760	1.0:0.0:0.0:0.0	.	192;293;293;293	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	A	293;293;293;293;192	ENSP00000359936:D293A;ENSP00000359932:D293A;ENSP00000450895:D293A;ENSP00000359928:D293A;ENSP00000322251:D192A	ENSP00000322251:D192A	D	+	2	0	RP11-653A5.2;AC093158.1	74574314	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.784000	0.75084	2.200000	0.70718	0.477000	0.44152	GAT		0.353	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
DRAM2	128338	broad.mit.edu	37	1	111674093	111674093	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:111674093delA	ENST00000286692.4	-	3	701	c.84delT	c.(82-84)attfs	p.I28fs	DRAM2_ENST00000484310.1_5'UTR|DRAM2_ENST00000539140.1_Frame_Shift_Del_p.I28fs			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	28					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)		p.T29fs*3(1)		endometrium(1)|large_intestine(5)|lung(3)	9						TTACTGCAGTAATGTATGAAA	0.383																																					p.I28fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.84delT	1						.						136.0	135.0	135.0					1																	111674093		2203	4300	6503	111475616	SO:0001589	frameshift_variant	128338	exon3			AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.84delT	1.37:g.111674093delA	ENSP00000286692:p.Ile28fs	Somatic		Capture	Illumina HiSeq	Phase_I	111475616	NM_178454	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Frame_Shift_Del	DEL	ENST00000286692.4	37	CCDS30801.1																																																																																				0.383	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032930.3	NM_178454	
SYT14	255928	broad.mit.edu	37	1	210194555	210194555	+	Missense_Mutation	SNP	C	C	T	rs145963511	byFrequency	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr1:210194555C>T	ENST00000472886.1	+	4	412	c.398C>T	c.(397-399)tCg>tTg	p.S133L	SYT14_ENST00000367019.1_Missense_Mutation_p.S133L|SYT14_ENST00000399639.2_Missense_Mutation_p.S133L|SYT14_ENST00000367015.1_Missense_Mutation_p.S95L|SYT14_ENST00000537238.1_Missense_Mutation_p.S95L|SYT14_ENST00000422431.1_Missense_Mutation_p.S178L|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000534859.1_Missense_Mutation_p.S133L			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	133					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)	p.S133L(1)		endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		AGTCCTCTATCGGCAGAGTAT	0.393													C|||	2	0.000399361	0.0	0.0014	5008	,	,		20209	0.0		0.001	False		,,,				2504	0.0				p.S133L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C398T	1						.	C	LEU/SER,LEU/SER,LEU/SER,LEU/SER	0,4406		0,0,2203	124.0	112.0	116.0		398,533,398,533	5.2	0.4	1	dbSNP_134	116	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense,missense	SYT14	NM_153262.2,NM_001146264.1,NM_001146262.1,NM_001146261.1	145,145,145,145	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign,benign	133/556,178/601,133/575,178/620	210194555	3,13003	2203	4300	6503	208261178	SO:0001583	missense	255928	exon4			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.398C>T	1.37:g.210194555C>T	ENSP00000418901:p.Ser133Leu	Somatic		Capture	Illumina HiSeq	Phase_I	208261178	NM_153262	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	37	CCDS31014.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	16.08	3.021321	0.54576	0.0	3.49E-4	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.19105	3.29;3.18;2.17;3.4;3.16;3.41;3.4	5.15	5.15	0.70609	.	0.178453	0.50627	D	0.000118	T	0.13329	0.0323	L	0.28274	0.84	0.54753	D	0.999986	B;B;P;B	0.41313	0.024;0.009;0.745;0.041	B;B;B;B	0.25614	0.003;0.001;0.062;0.006	T	0.09773	-1.0659	10	0.24483	T	0.36	-8.9675	18.9756	0.92735	0.0:1.0:0.0:0.0	.	161;133;133;178	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	L	178;133;133;95;133;133;95	ENSP00000389039:S178L;ENSP00000442891:S133L;ENSP00000445837:S133L;ENSP00000437423:S95L;ENSP00000355986:S133L;ENSP00000418901:S133L;ENSP00000355982:S95L	ENSP00000355982:S95L	S	+	2	0	SYT14	208261178	1.000000	0.71417	0.358000	0.25811	0.787000	0.44495	4.746000	0.62133	2.571000	0.86741	0.650000	0.86243	TCG		0.393	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
CPXM1	56265	broad.mit.edu	37	20	2777982	2777982	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr20:2777982G>T	ENST00000380605.2	-	6	752	c.688C>A	c.(688-690)Cct>Act	p.P230T		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	230	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.P230T(1)		endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GAATTGGCAGGAAATACCTGG	0.617																																					p.P230T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C688A	20						.						32.0	38.0	36.0					20																	2777982		2199	4293	6492	2725982	SO:0001583	missense	56265	exon6			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.688C>A	20.37:g.2777982G>T	ENSP00000369979:p.Pro230Thr	Somatic		Capture	Illumina HiSeq	Phase_I	2725982	NM_001184699	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	G	13.46	2.242367	0.39598	.	.	ENSG00000088882	ENST00000380605	D	0.98178	-4.77	4.84	4.84	0.62591	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.199436	0.45361	D	0.000368	D	0.95714	0.8606	N	0.20530	0.585	0.31139	N	0.70686	P;P	0.49185	0.89;0.92	P;P	0.50270	0.636;0.551	D	0.93205	0.6595	10	0.22109	T	0.4	-9.8227	10.5188	0.44907	0.0:0.0:0.807:0.193	.	230;230	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	T	230	ENSP00000369979:P230T	ENSP00000369979:P230T	P	-	1	0	CPXM1	2725982	0.059000	0.20769	1.000000	0.80357	0.970000	0.65996	0.726000	0.25984	2.530000	0.85305	0.561000	0.74099	CCT		0.617	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
ZHX3	23051	broad.mit.edu	37	20	39832365	39832365	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr20:39832365T>C	ENST00000309060.3	-	4	1607	c.1192A>G	c.(1192-1194)Agt>Ggt	p.S398G	ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000432768.2_Missense_Mutation_p.S398G|ZHX3_ENST00000540170.1_Missense_Mutation_p.S398G|ZHX3_ENST00000544979.2_Missense_Mutation_p.S398G|ZHX3_ENST00000559234.1_Missense_Mutation_p.S398G|ZHX3_ENST00000560361.1_Missense_Mutation_p.S398G|ZHX3_ENST00000557816.1_Intron			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	398	Required for homodimerization and interaction with NFYA.|Required for repressor activity.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S398G(1)		endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				TTGCCAGCACTGGCGACGAGT	0.552																																					p.S398G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1192G	20						.						99.0	89.0	92.0					20																	39832365		2203	4300	6503	39265779	SO:0001583	missense	23051	exon3			AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.1192A>G	20.37:g.39832365T>C	ENSP00000312222:p.Ser398Gly	Somatic		Capture	Illumina HiSeq	Phase_I	39265779	NM_015035	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	37	CCDS13315.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.770|3.770	-0.047868|-0.047868	0.07407|0.07407	.|.	.|.	ENSG00000174306|ENSG00000174306	ENST00000421422|ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262;ENST00000432768	.|T;T;T;T;T	.|0.31247	.|1.5;2.93;2.93;2.72;1.5	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	.|0.331247	.|0.35207	.|N	.|0.003362	T|T	0.15869|0.15869	0.0382|0.0382	N|N	0.08118|0.08118	0|0	0.30832|0.30832	N|N	0.736653|0.736653	.|B;B;B	.|0.24132	.|0.0;0.0;0.098	.|B;B;B	.|0.23716	.|0.001;0.002;0.048	T|T	0.07809|0.07809	-1.0753|-1.0753	5|10	.|0.02654	.|T	.|1	-4.8759|-4.8759	16.3009|16.3009	0.82811|0.82811	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|398;398;398	.|A8K8Q0;Q9H4I2;F5H820	.|.;ZHX3_HUMAN;.	R|G	106|398;398;398;398;176;398	.|ENSP00000312222:S398G;ENSP00000362360:S398G;ENSP00000442290:S398G;ENSP00000443783:S398G;ENSP00000415498:S398G	.|ENSP00000312222:S398G	Q|S	-|-	2|1	0|0	ZHX3|ZHX3	39265779|39265779	0.055000|0.055000	0.20627|0.20627	0.943000|0.943000	0.38184|0.38184	0.998000|0.998000	0.95712|0.95712	2.418000|2.418000	0.44662|0.44662	2.246000|2.246000	0.74042|0.74042	0.533000|0.533000	0.62120|0.62120	CAG|AGT		0.552	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	
A4GALT	53947	broad.mit.edu	37	22	43089303	43089303	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr22:43089303C>T	ENST00000401850.1	-	2	1144	c.655G>A	c.(655-657)Gcg>Acg	p.A219T	A4GALT_ENST00000249005.2_Missense_Mutation_p.A219T|A4GALT_ENST00000381278.3_Missense_Mutation_p.A219T|A4GALT_ENST00000465765.2_5'Flank			Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	219					globoside biosynthetic process (GO:0001576)|glycosphingolipid biosynthetic process (GO:0006688)|plasma membrane organization (GO:0007009)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	galactosyltransferase activity (GO:0008378)|lactosylceramide 4-alpha-galactosyltransferase activity (GO:0050512)|toxic substance binding (GO:0015643)	p.A219T(1)		NS(1)|central_nervous_system(2)|large_intestine(6)|skin(1)|urinary_tract(1)	11						GCCAGGAACGCGCCGTTGAGG	0.632																																					p.A219T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G655A	22						.						40.0	32.0	35.0					22																	43089303		2203	4299	6502	41419247	SO:0001583	missense	53947	exon3				CCDS14041.1	22q13.2	2014-07-18	2008-07-31		ENSG00000128274	ENSG00000128274	2.4.1.228		18149	protein-coding gene	gene with protein product	"""Gb3 synthase"", ""CD77 synthase"", ""globotriaosylceramide synthase"", ""lactosylceramide 4-alpha-galactosyltransferase"""	607922	"""alpha 1,4-galactosyltransferase (globotriaosylceramide synthase, P blood group)"""			10854428	Standard	XM_005261643		Approved	A14GALT, Gb3S, P(k)	uc003bdb.3	Q9NPC4	OTTHUMG00000150744	ENST00000401850.1:c.655G>A	22.37:g.43089303C>T	ENSP00000384794:p.Ala219Thr	Somatic		Capture	Illumina HiSeq	Phase_I	41419247	NM_017436	B2R7C4|Q9P1X5	Missense_Mutation	SNP	ENST00000401850.1	37	CCDS14041.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423223	0.83559	.	.	ENSG00000128274	ENST00000401850;ENST00000249005;ENST00000381278;ENST00000535654	D;D;D	0.82433	-1.61;-1.61;-1.61	5.29	5.29	0.74685	.	0.000000	0.56097	D	0.000026	D	0.92374	0.7580	M	0.88105	2.93	0.46416	D	0.999031	D	0.89917	1.0	D	0.69142	0.962	D	0.93478	0.6825	10	0.66056	D	0.02	-24.8872	18.5172	0.90939	0.0:1.0:0.0:0.0	.	219	Q9NPC4	A4GAT_HUMAN	T	219	ENSP00000384794:A219T;ENSP00000249005:A219T;ENSP00000370678:A219T	ENSP00000249005:A219T	A	-	1	0	A4GALT	41419247	0.992000	0.36948	0.982000	0.44146	0.795000	0.44927	3.107000	0.50329	2.483000	0.83821	0.561000	0.74099	GCG		0.632	A4GALT-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319917.1	NM_017436	
APOB	338	broad.mit.edu	37	2	21233296	21233297	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr2:21233296_21233297insT	ENST00000233242.1	-	26	6570_6571	c.6443_6444insA	c.(6442-6444)aagfs	p.K2148fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2148	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAATTCTATACTTTTTTGTGAG	0.337																																					p.K2148fs												.	.	0			c.6444_6445insA	2						.																																			21086802	SO:0001589	frameshift_variant	338	exon26			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6444dupA	2.37:g.21233302_21233302dupT	ENSP00000233242:p.Lys2148fs	None		Capture	Illumina HiSeq	Phase_I	21086801	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	37	CCDS1703.1																																																																																				0.337	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
RGPD2	729857	broad.mit.edu	37	2	88058535	88058536	+	Intron	INS	-	-	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr2:88058535_88058536insT	ENST00000398146.3	-	23	5459				RGPD2_ENST00000420840.2_Intron|RGPD2_ENST00000327544.6_Intron			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2						protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						AATTAACCTGAttttttttttt	0.446																																					.												.	.	0			.	2						.																																			87839651	SO:0001627	intron_variant	5342	.				CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.5237-1590->A	2.37:g.88058546_88058546dupT		Somatic		Capture	Illumina HiSeq	Phase_I	87839650	.	P0C839|Q68DN6|Q6V1X0	Splice_Site	INS	ENST00000398146.3	37	CCDS42710.2																																																																																				0.446	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330534.2	NM_001078170	
SLC35F6	54978	broad.mit.edu	37	2	26998421	26998421	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr2:26998421C>T	ENST00000344420.5	+	4	474	c.412C>T	c.(412-414)Cgg>Tgg	p.R138W	CENPA_ENST00000475662.1_Intron|SLC35F6_ENST00000416475.2_Missense_Mutation_p.R55W|SLC35F6_ENST00000482746.1_3'UTR	NM_017877.3	NP_060347.2	Q8N357	S35F6_HUMAN	solute carrier family 35, member F6	138	EamA.				negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)		p.R138W(1)									CTTCCTGGGCCGGAGGCTGGT	0.622																																					p.R138W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C412T	2						.						63.0	56.0	58.0					2																	26998421		2203	4300	6503	26851925	SO:0001583	missense	54978	exon4			AK075164	CCDS1728.1	2p24.1	2012-12-13	2012-12-07	2012-12-07	ENSG00000213699	ENSG00000213699			26055	protein-coding gene	gene with protein product	"""ANT2-binding protein"", ""transport and golgi organization 9 homolog (Drosophila)"""		"""chromosome 2 open reading frame 18"""	C2orf18		15911612, 19154410	Standard	NM_017877		Approved	FLJ20555, ANT2BP, TANGO9	uc002rhp.1	Q8N357	OTTHUMG00000128407	ENST00000344420.5:c.412C>T	2.37:g.26998421C>T	ENSP00000345528:p.Arg138Trp	Somatic		Capture	Illumina HiSeq	Phase_I	26851925	NM_017877	D6W543|Q53GK2|Q8NBX6|Q9NWX0	Missense_Mutation	SNP	ENST00000344420.5	37	CCDS1728.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351669	0.82132	.	.	ENSG00000213699	ENST00000344420;ENST00000416475	T;T	0.69926	-0.44;-0.44	5.05	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.85864	0.5796	H	0.94385	3.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.991;0.991;0.996	D	0.89063	0.3464	10	0.62326	D	0.03	.	13.7584	0.62950	0.155:0.845:0.0:0.0	.	28;55;138	E7ET27;B4DLH2;Q8N357	.;.;CB018_HUMAN	W	138;55	ENSP00000345528:R138W;ENSP00000413413:R55W	ENSP00000345528:R138W	R	+	1	2	C2orf18	26851925	1.000000	0.71417	0.998000	0.56505	0.844000	0.47949	5.315000	0.65810	1.134000	0.42165	-0.127000	0.14921	CGG		0.622	SLC35F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250187.2	NM_017877	
FBXO11	80204	broad.mit.edu	37	2	48046168	48046168	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr2:48046168G>C	ENST00000403359.3	-	15	1919	c.1847C>G	c.(1846-1848)aCt>aGt	p.T616S	FBXO11_ENST00000402508.1_Missense_Mutation_p.T532S|FBXO11_ENST00000434523.2_Missense_Mutation_p.T40S|FBXO11_ENST00000316377.4_Missense_Mutation_p.T532S	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	616					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)|p.T532S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCCAGCTAGAGTGTTACTATA	0.423			"""Mis, F, D"""		DLBCL																																p.T616S			Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	.	3	Whole gene deletion(2)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)	c.C1847G	2						.						138.0	140.0	139.0					2																	48046168		2203	4300	6503	47899672	SO:0001583	missense	80204	exon15			AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.1847C>G	2.37:g.48046168G>C	ENSP00000384823:p.Thr616Ser	Somatic		Capture	Illumina HiSeq	Phase_I	47899672	NM_001190274	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	37	CCDS54357.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.103172|5.103172	0.94245|0.94245	.|.	.|.	ENSG00000138081|ENSG00000138081	ENST00000493962|ENST00000402508;ENST00000403359;ENST00000316377;ENST00000434523	.|T;T;T;T	.|0.78246	.|-1.16;-1.16;-1.16;1.06	5.99|5.99	5.99|5.99	0.97316|0.97316	.|Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);F-box domain, Skp2-like (1);Pectin lyase fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84714|0.84714	0.5533|0.5533	L|L	0.51853|0.51853	1.615|1.615	0.80722|0.80722	D|D	1|1	.|P;P	.|0.50819	.|0.939;0.807	.|P;P	.|0.60012	.|0.867;0.635	T|T	0.82587|0.82587	-0.0383|-0.0383	5|10	.|0.44086	.|T	.|0.13	0.7406|0.7406	20.4777|20.4777	0.99188|0.99188	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|40;616	.|B3KUR1;Q86XK2	.|.;FBX11_HUMAN	Q|S	407|532;616;532;40	.|ENSP00000385398:T532S;ENSP00000384823:T616S;ENSP00000323822:T532S;ENSP00000397359:T40S	.|ENSP00000323822:T532S	H|T	-|-	3|2	2|0	FBXO11|FBXO11	47899672|47899672	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.869000|9.869000	0.99810|0.99810	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	CAC|ACT		0.423	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
PPP1R21	129285	broad.mit.edu	37	2	48713780	48713780	+	Silent	SNP	A	A	G			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr2:48713780A>G	ENST00000294952.8	+	14	1486	c.1329A>G	c.(1327-1329)aaA>aaG	p.K443K	PPP1R21_ENST00000281394.4_Silent_p.K443K|PPP1R21_ENST00000449090.2_Silent_p.K443K	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	443						membrane (GO:0016020)	phosphatase binding (GO:0019902)	p.K443K(1)		endometrium(2)|kidney(4)|lung(9)	15						ATATTTCCAAACATTATAGTC	0.328																																					p.K443K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1329G	2						.						47.0	46.0	46.0					2																	48713780		2203	4300	6503	48567284	SO:0001819	synonymous_variant	129285	exon14			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1329A>G	2.37:g.48713780A>G		Somatic		Capture	Illumina HiSeq	Phase_I	48567284	NM_001135629	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Silent	SNP	ENST00000294952.8	37	CCDS46278.1																																																																																				0.328	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994	
TTN	7273	broad.mit.edu	37	2	179640352	179640352	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr2:179640352A>T	ENST00000591111.1	-	28	6463	c.6239T>A	c.(6238-6240)aTc>aAc	p.I2080N	TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I2034N|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I2034N|TTN_ENST00000589042.1_Missense_Mutation_p.I2080N|TTN_ENST00000342175.6_Missense_Mutation_p.I2034N|TTN_ENST00000360870.5_Missense_Mutation_p.I2080N|TTN_ENST00000342992.6_Missense_Mutation_p.I2080N			Q8WZ42	TITIN_HUMAN	titin	12768	Ig-like 10.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.I2034N(3)|p.I2080N(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTTCGAAGATTTTTGGAGC	0.458																																					p.I2080N												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.T6239A	2						.						88.0	90.0	89.0					2																	179640352		2203	4300	6503	179348597	SO:0001583	missense	7273	exon28			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6239T>A	2.37:g.179640352A>T	ENSP00000465570:p.Ile2080Asn	Somatic		Capture	Illumina HiSeq	Phase_I	179348597	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	11.66	1.705268	0.30232	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.88343	0.6411	M	0.94142	3.5	0.37102	D	0.899935	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	D	0.93325	0.6696	9	0.87932	D	0	.	15.3078	0.74008	1.0:0.0:0.0:0.0	.	2034;2034;2034;2080;2080	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	2080;2034;2034;2034;2034;2080	ENSP00000343764:I2080N;ENSP00000434586:I2034N;ENSP00000340554:I2034N;ENSP00000352154:I2034N;ENSP00000354117:I2080N	ENSP00000340554:I2034N	I	-	2	0	TTN	179348597	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.307000	0.96226	2.025000	0.59659	0.533000	0.62120	ATC		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DOCK10	55619	broad.mit.edu	37	2	225738986	225738987	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	TA	TA	TA	-	TA	TA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr2:225738986_225738987delTA	ENST00000258390.7	-	10	1164_1165	c.1097_1098delTA	c.(1096-1098)atafs	p.I366fs	DOCK10_ENST00000409592.3_Frame_Shift_Del_p.I360fs	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	366					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I366fs*14(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GACTTACATCTATGTCTGGATC	0.337																																					p.366_366del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1097_1098del	2						.																																			225447231	SO:0001589	frameshift_variant	55619	exon10			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.1097_1098delTA	2.37:g.225738986_225738987delTA	ENSP00000258390:p.Ile366fs	Somatic		Capture	Illumina HiSeq	Phase_I	225447230	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Frame_Shift_Del	DEL	ENST00000258390.7	37	CCDS46528.1																																																																																				0.337	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
CMSS1	84319	broad.mit.edu	37	3	99895194	99895194	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr3:99895194A>C	ENST00000421999.2	+	9	837	c.691A>C	c.(691-693)Aaa>Caa	p.K231Q	CMSS1_ENST00000489081.1_Missense_Mutation_p.K213Q	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)	231							poly(A) RNA binding (GO:0044822)	p.K231Q(1)									GAGCCCCTTAAAATTTCTGGT	0.398																																					p.K213Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A637C	3						.						85.0	88.0	87.0					3																	99895194		2203	4300	6503	101377884	SO:0001583	missense	84319	exon9				CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.691A>C	3.37:g.99895194A>C	ENSP00000410396:p.Lys231Gln	Somatic		Capture	Illumina HiSeq	Phase_I	101377884	NM_001167924	A8K5S7|B4DUM1|E9PHS3	Missense_Mutation	SNP	ENST00000421999.2	37	CCDS2935.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.043776	0.55003	.	.	ENSG00000184220	ENST00000421999;ENST00000489081;ENST00000478909	T;T;T	0.31510	1.49;1.49;1.49	4.84	4.84	0.62591	DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.138068	0.64402	D	0.000009	T	0.47581	0.1453	L	0.50847	1.595	0.43512	D	0.995773	D	0.76494	0.999	D	0.72625	0.978	T	0.37753	-0.9692	9	.	.	.	.	13.5279	0.61605	1.0:0.0:0.0:0.0	.	231	Q9BQ75	CC026_HUMAN	Q	231;213;187	ENSP00000410396:K231Q;ENSP00000419161:K213Q;ENSP00000417293:K187Q	.	K	+	1	0	C3orf26	101377884	1.000000	0.71417	0.999000	0.59377	0.109000	0.19521	7.567000	0.82357	1.923000	0.55706	0.482000	0.46254	AAA		0.398	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353060.1	NM_032359	
ACAD11	84129	broad.mit.edu	37	3	132361597	132361597	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr3:132361597G>T	ENST00000264990.6	-	3	1270	c.299C>A	c.(298-300)cCc>cAc	p.P100H	ACAD11_ENST00000489991.1_Intron|ACAD11_ENST00000355458.3_Missense_Mutation_p.P100H|ACAD11_ENST00000545291.1_5'UTR|ACAD11_ENST00000481970.2_Missense_Mutation_p.P100H	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	100					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)	p.P100H(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						CTTGGGAACGGGGAATCCAAT	0.323																																					p.P100H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C299A	3						.						91.0	96.0	94.0					3																	132361597		2203	4300	6503	133844287	SO:0001583	missense	84129	exon3			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.299C>A	3.37:g.132361597G>T	ENSP00000264990:p.Pro100His	Somatic		Capture	Illumina HiSeq	Phase_I	133844287	NM_032169	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	ENST00000264990.6	37	CCDS3074.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.407794	0.83340	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	T;T;T	0.39997	1.05;1.05;1.05	6.06	6.06	0.98353	Aminoglycoside phosphotransferase (1);Protein kinase-like domain (1);	.	.	.	.	T	0.76630	0.4014	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.81920	-0.0712	9	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	100;100	D6RDI8;Q709F0	.;ACD11_HUMAN	H	100	ENSP00000347636:P100H;ENSP00000264990:P100H;ENSP00000420907:P100H	ENSP00000264990:P100H	P	-	2	0	ACAD11	133844287	1.000000	0.71417	0.995000	0.50966	0.588000	0.36517	8.977000	0.93446	2.882000	0.98803	0.655000	0.94253	CCC		0.323	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169	
GPD1L	23171	broad.mit.edu	37	3	32169607	32169607	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr3:32169607G>C	ENST00000282541.5	+	2	288	c.87G>C	c.(85-87)aaG>aaC	p.K29N		NM_015141.3	NP_055956.1	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	29					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophospholipid biosynthetic process (GO:0046474)|NAD metabolic process (GO:0019674)|NADH metabolic process (GO:0006734)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase C signaling (GO:0090038)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|ventricular cardiac muscle cell action potential (GO:0086005)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|plasma membrane (GO:0005886)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|ion channel binding (GO:0044325)|NAD binding (GO:0051287)|sodium channel regulator activity (GO:0017080)	p.K29N(1)		large_intestine(4)|lung(7)|ovary(1)	12						ATAATGTCAAGAAACTTCAGA	0.373																																					p.K29N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G87C	3						.						59.0	59.0	59.0					3																	32169607		2203	4300	6503	32144611	SO:0001583	missense	23171	exon2			D42047	CCDS33729.1	3p22.3	2014-09-17			ENSG00000152642	ENSG00000152642			28956	protein-coding gene	gene with protein product		611778				7788527	Standard	NM_015141		Approved	KIAA0089	uc003cew.3	Q8N335	OTTHUMG00000155846	ENST00000282541.5:c.87G>C	3.37:g.32169607G>C	ENSP00000282541:p.Lys29Asn	Somatic		Capture	Illumina HiSeq	Phase_I	32144611	NM_015141	A8K9U3|Q14702|Q9BRM5	Missense_Mutation	SNP	ENST00000282541.5	37	CCDS33729.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282730	0.40394	.	.	ENSG00000152642	ENST00000282541;ENST00000425459	T;T	0.57595	0.39;1.19	4.8	4.8	0.61643	Glycerol-3-phosphate dehydrogenase, NAD-dependent, N-terminal (1);NAD(P)-binding domain (1);	0.242007	0.47455	D	0.000229	T	0.59715	0.2214	M	0.86573	2.825	0.54753	D	0.999981	B	0.27951	0.195	B	0.34452	0.183	T	0.59526	-0.7438	10	0.31617	T	0.26	-24.4889	12.3083	0.54914	0.0889:0.0:0.9111:0.0	.	29	Q8N335	GPD1L_HUMAN	N	29	ENSP00000282541:K29N;ENSP00000408770:K29N	ENSP00000282541:K29N	K	+	3	2	GPD1L	32144611	0.007000	0.16637	0.999000	0.59377	0.988000	0.76386	0.442000	0.21628	2.665000	0.90641	0.561000	0.74099	AAG		0.373	GPD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341975.2	NM_015141	
GPD1L	23171	broad.mit.edu	37	3	32200400	32200400	+	Silent	SNP	C	C	T	rs149641866	byFrequency	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr3:32200400C>T	ENST00000282541.5	+	6	852	c.651C>T	c.(649-651)gaC>gaT	p.D217D		NM_015141.3	NP_055956.1	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	217					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophospholipid biosynthetic process (GO:0046474)|NAD metabolic process (GO:0019674)|NADH metabolic process (GO:0006734)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase C signaling (GO:0090038)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|ventricular cardiac muscle cell action potential (GO:0086005)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|plasma membrane (GO:0005886)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|ion channel binding (GO:0044325)|NAD binding (GO:0051287)|sodium channel regulator activity (GO:0017080)	p.D217D(1)		large_intestine(4)|lung(7)|ovary(1)	12						GGTTCTGCGACGGCCTCCGCT	0.562																																					p.D217D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C651T	3						.			2,4404	4.2+/-10.8	0,2,2201	52.0	53.0	53.0		651	-8.3	0.0	3	dbSNP_134	53	0,8600		0,0,4300	no	coding-synonymous	GPD1L	NM_015141.3		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		217/352	32200400	2,13004	2203	4300	6503	32175404	SO:0001819	synonymous_variant	23171	exon6			D42047	CCDS33729.1	3p22.3	2014-09-17			ENSG00000152642	ENSG00000152642			28956	protein-coding gene	gene with protein product		611778				7788527	Standard	NM_015141		Approved	KIAA0089	uc003cew.3	Q8N335	OTTHUMG00000155846	ENST00000282541.5:c.651C>T	3.37:g.32200400C>T		Somatic		Capture	Illumina HiSeq	Phase_I	32175404	NM_015141	A8K9U3|Q14702|Q9BRM5	Silent	SNP	ENST00000282541.5	37	CCDS33729.1																																																																																				0.562	GPD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341975.2	NM_015141	
AADAC	13	broad.mit.edu	37	3	151545518	151545518	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr3:151545518delA	ENST00000232892.7	+	5	884	c.758delA	c.(757-759)tatfs	p.Y253fs	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	253					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)	p.Y253fs*40(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TGGAGTGAATATTTTACCACT	0.373																																					p.Y253fs	Ovarian(30;839 841 2699 32801 46334)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.758delA	3						.						64.0	67.0	66.0					3																	151545518		2203	4299	6502	153028208	SO:0001589	frameshift_variant	13	exon5			L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.758delA	3.37:g.151545518delA	ENSP00000232892:p.Tyr253fs	Somatic		Capture	Illumina HiSeq	Phase_I	153028208	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Frame_Shift_Del	DEL	ENST00000232892.7	37	CCDS33877.1																																																																																				0.373	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
EIF4A2	1974	broad.mit.edu	37	3	186506990	186506990	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr3:186506990C>A	ENST00000323963.5	+	11	1220	c.1156C>A	c.(1156-1158)Cgt>Agt	p.R386S	SNORA4_ENST00000584302.1_RNA|SNORA81_ENST00000408493.2_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.R387S|SNORA63_ENST00000363450.1_RNA|SNORA63_ENST00000363548.1_RNA|EIF4A2_ENST00000356531.5_Missense_Mutation_p.R291S			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	386	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.R386S(1)|p.R386G(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		GAGGATTCTTCGTGACATTGA	0.428			T	BCL6	NHL																																p.R386S			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1156A	3						.						196.0	203.0	200.0					3																	186506990		2203	4300	6503	187989684	SO:0001583	missense	1974	exon11			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.1156C>A	3.37:g.186506990C>A	ENSP00000326381:p.Arg386Ser	Somatic		Capture	Illumina HiSeq	Phase_I	187989684	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	37	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502073	0.44455	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.05025	3.51;3.51;3.51	5.87	5.87	0.94306	Helicase, C-terminal (1);	0.052166	0.85682	D	0.000000	T	0.05823	0.0152	N	0.12182	0.205	0.80722	D	1	B;B;B	0.23058	0.079;0.049;0.029	B;B;B	0.23574	0.047;0.04;0.026	T	0.44997	-0.9291	10	0.59425	D	0.04	-4.0502	18.0718	0.89410	0.0:1.0:0.0:0.0	.	291;387;386	Q9NZE6;Q14240-2;Q14240	.;.;IF4A2_HUMAN	S	386;387;291	ENSP00000326381:R386S;ENSP00000398370:R387S;ENSP00000348925:R291S	ENSP00000326381:R386S	R	+	1	0	EIF4A2	187989684	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.340000	0.79292	2.941000	0.99782	0.655000	0.94253	CGT		0.428	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
JADE1	79960	broad.mit.edu	37	4	129789067	129789067	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr4:129789067C>G	ENST00000226319.6	+	10	1840	c.1560C>G	c.(1558-1560)tgC>tgG	p.C520W	PHF17_ENST00000452328.2_Missense_Mutation_p.C508W|PHF17_ENST00000512960.1_Missense_Mutation_p.C520W	NM_199320.2	NP_955352.1												p.C520W(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGTCTGTGTGCAAAGTCCAGG	0.408																																					p.C520W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1560G	4						.						92.0	88.0	89.0					4																	129789067		2203	4300	6503	130008517	SO:0001583	missense	79960	exon10																														ENST00000226319.6:c.1560C>G	4.37:g.129789067C>G	ENSP00000226319:p.Cys520Trp	Somatic		Capture	Illumina HiSeq	Phase_I	130008517	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	37	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.359062	0.41801	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.39406	1.08;1.08;1.08	5.28	5.28	0.74379	.	0.045905	0.85682	D	0.000000	T	0.41003	0.1140	L	0.55743	1.74	0.80722	D	1	B;P	0.35793	0.095;0.521	B;B	0.39068	0.135;0.289	T	0.17715	-1.0360	9	.	.	.	.	12.4284	0.55561	0.0:0.924:0.0:0.0759	.	508;520	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	W	520;508;520;520	ENSP00000226319:C520W;ENSP00000388015:C508W;ENSP00000425730:C520W	.	C	+	3	2	PHF17	130008517	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.174000	0.42482	2.736000	0.93811	0.655000	0.94253	TGC		0.408	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
RGS12	6002	broad.mit.edu	37	4	3318002	3318002	+	Silent	SNP	G	G	A	rs184207042	byFrequency	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr4:3318002G>A	ENST00000344733.5	+	2	1009	c.105G>A	c.(103-105)acG>acA	p.T35T	RGS12_ENST00000543385.1_Silent_p.T35T|RGS12_ENST00000336727.3_Silent_p.T35T|RGS12_ENST00000382788.3_Silent_p.T35T	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	35	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)	p.T35T(1)		autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACGGATTCACGCTTTCGGGAC	0.647													G|||	6	0.00119808	0.0	0.0	5008	,	,		16478	0.006		0.0	False		,,,				2504	0.0				p.T35T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G105A	4						.						58.0	61.0	60.0					4																	3318002		2203	4300	6503	3287800	SO:0001819	synonymous_variant	6002	exon2			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.105G>A	4.37:g.3318002G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3287800	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Silent	SNP	ENST00000344733.5	37	CCDS3366.1																																																																																				0.647	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
ENPP6	133121	broad.mit.edu	37	4	185038147	185038147	+	Silent	SNP	C	C	T	rs144414378		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr4:185038147C>T	ENST00000296741.2	-	5	858	c.717G>A	c.(715-717)tcG>tcA	p.S239S		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	239					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)	p.S239S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		TTCCGTGATCCGAGAAAATAA	0.532																																					p.S239S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G717A	4						.	C		0,4406		0,0,2203	101.0	86.0	91.0		717	-12.1	0.1	4	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ENPP6	NM_153343.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		239/441	185038147	1,13005	2203	4300	6503	185275141	SO:0001819	synonymous_variant	133121	exon5			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.717G>A	4.37:g.185038147C>T		Somatic		Capture	Illumina HiSeq	Phase_I	185275141	NM_153343	Q4W5Q1|Q96M57	Silent	SNP	ENST00000296741.2	37	CCDS3834.1																																																																																				0.532	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1	NM_153343	
APC	324	broad.mit.edu	37	5	112164616	112164616	+	Nonsense_Mutation	SNP	C	C	T	rs137854574		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:112164616C>T	ENST00000457016.1	+	14	2070	c.1690C>T	c.(1690-1692)Cga>Tga	p.R564*	APC_ENST00000508376.2_Nonsense_Mutation_p.R564*|CTC-554D6.1_ENST00000520401.1_Silent_p.C59C|APC_ENST00000257430.4_Nonsense_Mutation_p.R564*			P25054	APC_HUMAN	adenomatous polyposis coli	564	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R564*(14)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAAGACGTTGCGAGAAGTTGG	0.313		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R546X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	15	Substitution - Nonsense(14)|Unknown(1)	large_intestine(14)|skin(1)	c.C1636T	5	GRCh37	CM920035	APC	M	rs137854574	.						126.0	137.0	134.0					5																	112164616		2202	4300	6502	112192515	SO:0001587	stop_gained	324	exon12	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1690C>T	5.37:g.112164616C>T	ENSP00000413133:p.Arg564*	Somatic		Capture	Illumina HiSeq	Phase_I	112192515	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	7.921767	0.98563	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.62	4.73	0.59995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.3959	14.5777	0.68262	0.2726:0.7274:0.0:0.0	.	.	.	.	X	564;546;564;564;564	.	ENSP00000257430:R564X	R	+	1	2	APC	112192515	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.526000	0.45607	1.313000	0.45069	0.655000	0.94253	CGA		0.313	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CEP120	153241	broad.mit.edu	37	5	122754175	122754175	+	Silent	SNP	A	A	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:122754175A>C	ENST00000306467.5	-	2	388	c.84T>G	c.(82-84)ctT>ctG	p.L28L	CEP120_ENST00000395431.2_Silent_p.L28L|CEP120_ENST00000306481.6_Silent_p.L2L|CEP120_ENST00000515110.1_Missense_Mutation_p.C65G|CEP120_ENST00000328236.5_Silent_p.L28L			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	28					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.L28L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						CTTCCACTACAAGCATATGCT	0.408																																					p.L2L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T6G	5						.						124.0	113.0	116.0					5																	122754175		1893	4119	6012	122782074	SO:0001819	synonymous_variant	153241	exon2			AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.84T>G	5.37:g.122754175A>C		Somatic		Capture	Illumina HiSeq	Phase_I	122782074	NM_001166226	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Silent	SNP	ENST00000306467.5	37	CCDS4134.2	.	.	.	.	.	.	.	.	.	.	A	10.84	1.464363	0.26335	.	.	ENSG00000168944	ENST00000515110	.	.	.	5.18	2.6	0.31112	.	.	.	.	.	T	0.63034	0.2477	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61691	-0.7011	5	0.87932	D	0	-13.6718	7.6352	0.28261	0.6667:0.2625:0.0708:0.0	.	.	.	.	G	65	.	ENSP00000428303:C65G	C	-	1	0	CEP120	122782074	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.668000	0.37481	0.319000	0.23209	0.533000	0.62120	TGT		0.408	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250899.2	NM_153223	
PCDHB10	56126	broad.mit.edu	37	5	140569048	140569048	+	5'Flank	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:140569048G>A	ENST00000239446.4	+	0	0					NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGCAGGGCGGCCTCGGTGG	0.667																																					p.R719Q												.	.	0			c.G2156A	5						.						44.0	58.0	53.0					5																	140569048		2201	4291	6492	140549232	SO:0001631	upstream_gene_variant	56127	exon1			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626		5.37:g.140569048G>A	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	140549232	NM_019119	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																				0.667	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
RAI14	26064	broad.mit.edu	37	5	34823885	34823885	+	Silent	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:34823885C>T	ENST00000265109.3	+	15	2225	c.1938C>T	c.(1936-1938)agC>agT	p.S646S	RAI14_ENST00000506376.1_Silent_p.S638S|RAI14_ENST00000397449.1_Silent_p.S639S|RAI14_ENST00000503673.1_Silent_p.S646S|RAI14_ENST00000512629.1_Silent_p.S617S|RAI14_ENST00000428746.2_Silent_p.S646S|RAI14_ENST00000515799.1_Silent_p.S649S	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	646						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.S646S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					AACAGGTGAGCGAGCTGTCAC	0.443																																					p.S617S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1851T	5						.						76.0	80.0	79.0					5																	34823885		2203	4300	6503	34859642	SO:0001819	synonymous_variant	26064	exon14			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1938C>T	5.37:g.34823885C>T		Somatic		Capture	Illumina HiSeq	Phase_I	34859642	NM_001145522	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Silent	SNP	ENST00000265109.3	37	CCDS34142.1																																																																																				0.443	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
HCN1	348980	broad.mit.edu	37	5	45303797	45303797	+	Missense_Mutation	SNP	C	C	T	rs180790607		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:45303797C>T	ENST00000303230.4	-	6	1579	c.1522G>A	c.(1522-1524)Gtg>Atg	p.V508M		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	508					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.V508M(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TTTTTACCCACGGCTCCTTCT	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		16599	0.001		0.0	False		,,,				2504	0.0				p.V508M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1522A	5						.						114.0	112.0	112.0					5																	45303797		2203	4300	6503	45339554	SO:0001583	missense	348980	exon6			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1522G>A	5.37:g.45303797C>T	ENSP00000307342:p.Val508Met	Somatic		Capture	Illumina HiSeq	Phase_I	45339554	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.71	3.455540	0.63401	.	.	ENSG00000164588	ENST00000303230	D	0.92647	-3.08	5.62	5.62	0.85841	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000014	D	0.90563	0.7042	L	0.56280	1.765	0.80722	D	1	P	0.41366	0.747	B	0.36922	0.236	D	0.91316	0.5078	10	0.72032	D	0.01	.	20.024	0.97514	0.0:1.0:0.0:0.0	.	508	O60741	HCN1_HUMAN	M	508	ENSP00000307342:V508M	ENSP00000307342:V508M	V	-	1	0	HCN1	45339554	0.980000	0.34600	1.000000	0.80357	0.997000	0.91878	2.532000	0.45659	2.809000	0.96659	0.655000	0.94253	GTG		0.393	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
ZFYVE16	9765	broad.mit.edu	37	5	79739028	79739028	+	Nonsense_Mutation	SNP	C	C	T	rs541127111		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:79739028C>T	ENST00000338008.5	+	5	2686	c.2506C>T	c.(2506-2508)Cag>Tag	p.Q836*	ZFYVE16_ENST00000505560.1_Nonsense_Mutation_p.Q836*|ZFYVE16_ENST00000510158.1_Nonsense_Mutation_p.Q836*	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	836					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)	p.Q836*(1)		breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		CCAGCCTCCTCAGGAGAACCA	0.413																																					p.Q836X	Melanoma(150;1452 1854 16018 17851 37292)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2506T	5						.						109.0	100.0	103.0					5																	79739028		2203	4300	6503	79774784	SO:0001587	stop_gained	9765	exon6			AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.2506C>T	5.37:g.79739028C>T	ENSP00000337159:p.Gln836*	Somatic		Capture	Illumina HiSeq	Phase_I	79774784	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Nonsense_Mutation	SNP	ENST00000338008.5	37	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	C	38	7.153053	0.98099	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	.	.	.	5.49	4.59	0.56863	.	0.381500	0.22739	N	0.056232	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-0.1383	14.1075	0.65101	0.0:0.7129:0.287:0.0	.	.	.	.	X	836	.	ENSP00000337159:Q836X	Q	+	1	0	ZFYVE16	79774784	1.000000	0.71417	0.956000	0.39512	0.023000	0.10783	3.509000	0.53386	1.264000	0.44198	0.650000	0.86243	CAG		0.413	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
APC	324	broad.mit.edu	37	5	112175490	112175490	+	Frame_Shift_Del	DEL	C	C	-	rs267600319		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:112175490delC	ENST00000457016.1	+	16	4579	c.4199delC	c.(4198-4200)tcgfs	p.S1400fs	APC_ENST00000508376.2_Frame_Shift_Del_p.S1400fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.S1400fs			P25054	APC_HUMAN	adenomatous polyposis coli	1400	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1400*(6)|p.S1400fs*1(6)|p.Y1376fs*41(1)|p.?(1)|p.S1400L(1)|p.K1192fs*3(1)|p.S1400fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAGAGTCGTTCGATTGCCAGC	0.478		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1382X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	17	Deletion - Frameshift(9)|Substitution - Nonsense(6)|Unknown(1)|Substitution - Missense(1)	large_intestine(15)|soft_tissue(1)|skin(1)	c.4145delC	5	GRCh37	CM995167	APC	M		.						109.0	102.0	104.0					5																	112175490		2202	4300	6502	112203389	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4199delC	5.37:g.112175490delC	ENSP00000413133:p.Ser1400fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203389	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHGA5	56110	broad.mit.edu	37	5	140744589	140744589	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr5:140744589C>T	ENST00000518069.1	+	1	692	c.692C>T	c.(691-693)aCg>aTg	p.T231M	PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	231	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T231M(2)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCGTGTTACGGTCCTCGAC	0.587																																					p.T231M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C692T	5						.						81.0	81.0	81.0					5																	140744589		2080	4216	6296	140724773	SO:0001583	missense	56110	exon1			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.692C>T	5.37:g.140744589C>T	ENSP00000429834:p.Thr231Met	Somatic		Capture	Illumina HiSeq	Phase_I	140724773	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	3.761	-0.049672	0.07407	.	.	ENSG00000253485	ENST00000518069	T	0.01838	4.61	5.4	-0.525	0.11917	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.03651	0.0104	M	0.71871	2.18	0.09310	N	1	B;B	0.29646	0.029;0.253	B;B	0.33254	0.032;0.16	T	0.35076	-0.9803	9	0.54805	T	0.06	.	5.3987	0.16283	0.1505:0.5109:0.0:0.3385	.	231;231	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	M	231	ENSP00000429834:T231M	ENSP00000429834:T231M	T	+	2	0	PCDHGA5	140724773	0.000000	0.05858	0.357000	0.25798	0.058000	0.15608	-1.250000	0.02885	0.106000	0.17784	-0.670000	0.03821	ACG		0.587	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
HSPA1B	3304	broad.mit.edu	37	6	31795839	31795840	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr6:31795839_31795840insC	ENST00000375650.3	+	1	328_329	c.112_113insC	c.(112-114)accfs	p.T38fs	HSPA1B_ENST00000545241.1_Intron	NM_005346.4	NP_005337.2	P08107	HSP71_HUMAN	heat shock 70kDa protein 1B	38					ATP catabolic process (GO:0006200)|cellular heat acclimation (GO:0070370)|cellular response to heat (GO:0034605)|gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of erythrocyte differentiation (GO:0045648)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)	aggresome (GO:0016235)|blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|protein N-terminus binding (GO:0047485)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|virus receptor activity (GO:0001618)	p.S40fs*30(1)		breast(1)|large_intestine(1)|prostate(1)	3						CAACCGCACCACCCCCAGCTAC	0.653																																					p.T38fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.112_113insC	6						.																																			31903819	SO:0001589	frameshift_variant	3304	exon1				CCDS34415.1	6p21.3	2011-09-02	2002-08-29		ENSG00000204388	ENSG00000204388		"""Heat shock proteins / HSP70"""	5233	protein-coding gene	gene with protein product		603012	"""heat shock 70kD protein 1B"""			1700760	Standard	NM_005346		Approved	HSP70-2	uc003nxk.2	P08107	OTTHUMG00000031202	ENST00000375650.3:c.117dupC	6.37:g.31795844_31795844dupC	ENSP00000364801:p.Thr38fs	Somatic		Capture	Illumina HiSeq	Phase_I	31903818	NM_005346	B4E3B6|P19790|Q5JQI4|Q5SP17|Q9UQL9|Q9UQM0	Frame_Shift_Ins	INS	ENST00000375650.3	37	CCDS34415.1																																																																																				0.653	HSPA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076402.2		
DST	667	broad.mit.edu	37	6	56481027	56481027	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr6:56481027T>C	ENST00000370765.6	-	24	7345	c.7238A>G	c.(7237-7239)gAc>gGc	p.D2413G	DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370788.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1728	Asp-rich.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.D2413G(2)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CAAGGCTTTGTCAATTGTTCC	0.398																																					p.D2413G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A7238G	6						.						94.0	84.0	87.0					6																	56481027		2203	4300	6503	56588986	SO:0001583	missense	667	exon24			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7238A>G	6.37:g.56481027T>C	ENSP00000359801:p.Asp2413Gly	Somatic		Capture	Illumina HiSeq	Phase_I	56588986	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	37	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.150014	0.57151	.	.	ENSG00000151914	ENST00000370765	T	0.74106	-0.81	5.92	5.92	0.95590	.	.	.	.	.	T	0.77525	0.4143	.	.	.	0.09310	N	0.999992	D	0.59767	0.986	P	0.58721	0.844	T	0.75792	-0.3193	7	0.30078	T	0.28	.	16.3636	0.83296	0.0:0.0:0.0:1.0	.	2413	Q03001-3	.	G	2413	ENSP00000359801:D2413G	ENSP00000359801:D2413G	D	-	2	0	DST	56588986	1.000000	0.71417	0.996000	0.52242	0.848000	0.48234	3.357000	0.52277	2.267000	0.75376	0.528000	0.53228	GAC		0.398	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
C7orf50	84310	broad.mit.edu	37	7	1037310	1037311	+	Frame_Shift_Ins	INS	-	-	G	rs375372981		TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr7:1037310_1037311insG	ENST00000397098.3	-	5	1461_1462	c.535_536insC	c.(535-537)ctgfs	p.L179fs	C7orf50_ENST00000397100.2_Frame_Shift_Ins_p.L179fs|C7orf50_ENST00000357429.6_Frame_Shift_Ins_p.L179fs|C7orf50_ENST00000488073.1_5'UTR			Q9BRJ6	CG050_HUMAN	chromosome 7 open reading frame 50	179							poly(A) RNA binding (GO:0044822)	p.L179fs*>17(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		CCTCCCCGGCAGGGGGGGATCA	0.723																																					p.L179fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.536_537insC	7						.																																			1003837	SO:0001589	frameshift_variant	84310	exon5			BC006224	CCDS5320.1	7p22.3	2011-11-25			ENSG00000146540	ENSG00000146540			22421	protein-coding gene	gene with protein product							Standard	NM_032350		Approved	MGC11257, YCR016W	uc011jvu.1	Q9BRJ6	OTTHUMG00000151477	ENST00000397098.3:c.536dupC	7.37:g.1037317_1037317dupG	ENSP00000380286:p.Leu179fs	Somatic		Capture	Illumina HiSeq	Phase_I	1003836	NM_032350		Frame_Shift_Ins	INS	ENST00000397098.3	37	CCDS5320.1																																																																																				0.723	C7orf50-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322817.3	NM_032350	
ABCA13	154664	broad.mit.edu	37	7	48450142	48450142	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr7:48450142C>A	ENST00000435803.1	+	40	12120	c.12096C>A	c.(12094-12096)caC>caA	p.H4032Q		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4032	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.H3977Q(1)|p.H4032Q(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCACAACCCACCACCTGGATG	0.607																																					p.T3978N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C11933A	7						.						111.0	107.0	108.0					7																	48450142		2066	4219	6285	48420688	SO:0001583	missense	154664	exon38			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12096C>A	7.37:g.48450142C>A	ENSP00000411096:p.His4032Gln	Somatic		Capture	Illumina HiSeq	Phase_I	48420688	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041493	0.55003	.	.	ENSG00000179869	ENST00000435803	D	0.99607	-6.27	5.33	1.52	0.23074	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.52532	D	0.000080	D	0.99527	0.9831	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.99774	1.1025	10	0.87932	D	0	.	9.1481	0.36946	0.0:0.7018:0.0:0.2982	.	1734;4032	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	Q	4032	ENSP00000411096:H4032Q	ENSP00000411096:H4032Q	H	+	3	2	ABCA13	48420688	1.000000	0.71417	0.995000	0.50966	0.428000	0.31595	1.490000	0.35573	0.337000	0.23665	-0.126000	0.14955	CAC		0.607	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
CDK14	5218	broad.mit.edu	37	7	90355881	90355881	+	Splice_Site	SNP	A	A	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr7:90355881A>T	ENST00000380050.3	+	3	255	c.124A>T	c.(124-126)Ata>Tta	p.I42L	CDK14_ENST00000436577.2_5'UTR|CDK14_ENST00000265741.3_Splice_Site_p.I24L|CDK14_ENST00000406263.1_5'UTR|CDK14_ENST00000496279.1_3'UTR			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	42					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.I24L(1)		breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						CTTTTCTCAGATATGTGTCAC	0.378																																					p.I24L	GBM(83;1228 1256 8311 16577 31299)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A70T	7						.						64.0	60.0	61.0					7																	90355881		2203	4299	6502	90193817	SO:0001630	splice_region_variant	5218	exon2				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.124-1A>T	7.37:g.90355881A>T		Somatic		Capture	Illumina HiSeq	Phase_I	90193817	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	A	11.76	1.733944	0.30684	.	.	ENSG00000058091	ENST00000380050;ENST00000265741	T;T	0.69561	-0.41;-0.4	5.72	5.72	0.89469	.	0.053114	0.64402	D	0.000001	T	0.52901	0.1763	N	0.24115	0.695	0.80722	D	1	B;B	0.18166	0.026;0.015	B;B	0.17098	0.017;0.011	T	0.48725	-0.9010	10	0.17369	T	0.5	-11.0846	16.0018	0.80297	1.0:0.0:0.0:0.0	.	24;42	O94921-2;O94921	.;CDK14_HUMAN	L	42;24	ENSP00000369390:I42L;ENSP00000265741:I24L	ENSP00000265741:I24L	I	+	1	0	CDK14	90193817	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	8.513000	0.90542	2.184000	0.69523	0.460000	0.39030	ATA		0.378	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	Missense_Mutation
NUP205	23165	broad.mit.edu	37	7	135263576	135263576	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr7:135263576C>G	ENST00000285968.6	+	7	981	c.955C>G	c.(955-957)Ctt>Gtt	p.L319V	NUP205_ENST00000440390.2_Missense_Mutation_p.L113V	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	319					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.L319V(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GGACTCACAGCTTTGGAAACT	0.453																																					p.L319V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C955G	7						.						114.0	109.0	110.0					7																	135263576		2203	4300	6503	134914116	SO:0001583	missense	23165	exon7			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.955C>G	7.37:g.135263576C>G	ENSP00000285968:p.Leu319Val	Somatic		Capture	Illumina HiSeq	Phase_I	134914116	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591507	0.28357	.	.	ENSG00000155561	ENST00000285968;ENST00000440390	T;T	0.29142	1.58;1.58	5.47	4.58	0.56647	.	0.492899	0.23614	N	0.046305	T	0.18257	0.0438	N	0.08118	0	0.20307	N	0.999915	B	0.02656	0.0	B	0.04013	0.001	T	0.11717	-1.0576	10	0.30078	T	0.28	-8.9217	16.1628	0.81731	0.0:0.8664:0.1336:0.0	.	319	Q92621	NU205_HUMAN	V	319;113	ENSP00000285968:L319V;ENSP00000401983:L113V	ENSP00000285968:L319V	L	+	1	0	NUP205	134914116	0.938000	0.31826	0.762000	0.31397	0.752000	0.42762	1.468000	0.35332	1.250000	0.43966	0.563000	0.77884	CTT		0.453	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
BLK	640	broad.mit.edu	37	8	11400835	11400835	+	Silent	SNP	C	C	T	rs75383960	byFrequency	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr8:11400835C>T	ENST00000259089.4	+	2	694	c.102C>T	c.(100-102)gaC>gaT	p.D34D	BLK_ENST00000529894.1_Intron	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	34					B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.D34D(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		AAGACAAGGACGCCCCGCCAC	0.542													c|||	50	0.00998403	0.0378	0.0	5008	,	,		14147	0.0		0.0	False		,,,				2504	0.0				p.D34D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C102T	8						.	T		100,4304	77.8+/-116.1	0,100,2102	46.0	50.0	49.0		102	-11.1	0.0	8	dbSNP_132	49	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BLK	NM_001715.2		0,101,6401	TT,TC,CC		0.0116,2.2707,0.7767		34/506	11400835	101,12903	2202	4300	6502	11438244	SO:0001819	synonymous_variant	640	exon2			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.102C>T	8.37:g.11400835C>T		Somatic		Capture	Illumina HiSeq	Phase_I	11438244	NM_001715	Q16291|Q96IN1	Silent	SNP	ENST00000259089.4	37	CCDS5982.1																																																																																				0.542	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1		
VPS13B	157680	broad.mit.edu	37	8	100115255	100115255	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr8:100115255G>T	ENST00000358544.2	+	5	598	c.487G>T	c.(487-489)Gtt>Ttt	p.V163F	VPS13B_ENST00000395996.1_Missense_Mutation_p.V163F|VPS13B_ENST00000441350.2_Missense_Mutation_p.V163F|VPS13B_ENST00000355155.1_Missense_Mutation_p.V163F|VPS13B_ENST00000357162.2_Missense_Mutation_p.V163F	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	163					protein transport (GO:0015031)			p.V163F(2)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACTAAAATATGTTGAAGATGA	0.308																																					p.V163F	Colon(161;2205 2542 7338 31318)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G487T	8						.						118.0	114.0	115.0					8																	100115255		2203	4300	6503	100184431	SO:0001583	missense	157680	exon5			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.487G>T	8.37:g.100115255G>T	ENSP00000351346:p.Val163Phe	Somatic		Capture	Illumina HiSeq	Phase_I	100184431	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910145	0.52439	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	T;T;T;T;D	0.83992	-1.26;-0.58;-0.57;-0.29;-1.79	5.94	5.07	0.68467	.	0.000000	0.64402	D	0.000002	D	0.90539	0.7035	M	0.76574	2.34	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;0.981;1.0;1.0;0.999	D;P;D;D;D	0.91635	0.997;0.694;0.999;0.999;0.986	D	0.91686	0.5362	10	0.87932	D	0	.	15.1108	0.72355	0.0676:0.0:0.9324:0.0	.	163;163;163;163;163	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4;Q7Z7G8-5	.;VP13B_HUMAN;.;.;.	F	163	ENSP00000347281:V163F;ENSP00000349685:V163F;ENSP00000351346:V163F;ENSP00000379318:V163F;ENSP00000398472:V163F	ENSP00000347281:V163F	V	+	1	0	VPS13B	100184431	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	9.086000	0.94088	1.524000	0.49035	-0.259000	0.10710	GTT		0.308	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
TAF1L	138474	broad.mit.edu	37	9	32632736	32632736	+	Missense_Mutation	SNP	C	C	T	rs142873850	byFrequency	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chr9:32632736C>T	ENST00000242310.4	-	1	2931	c.2842G>A	c.(2842-2844)Gct>Act	p.A948T	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	948					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.A948T(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CAAGGAGCAGCGTGAACTTCA	0.502													C|||	14	0.00279553	0.0083	0.0029	5008	,	,		20007	0.0		0.001	False		,,,				2504	0.0				p.A948T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2842A	9						.	C	THR/ALA	18,4388	25.3+/-52.1	0,18,2185	165.0	150.0	155.0		2842	-2.1	1.0	9	dbSNP_134	155	1,8599	1.2+/-3.3	0,1,4299	no	missense	TAF1L	NM_153809.2	58	0,19,6484	TT,TC,CC		0.0116,0.4085,0.1461	benign	948/1827	32632736	19,12987	2203	4300	6503	32622736	SO:0001583	missense	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2842G>A	9.37:g.32632736C>T	ENSP00000418379:p.Ala948Thr	Somatic		Capture	Illumina HiSeq	Phase_I	32622736	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	3	0.0013736263736263737	0	0.0	2	0.0055248618784530384	0	0.0	1	0.0013192612137203166	C	5.308	0.242281	0.10077	0.004085	1.16E-4	ENSG00000122728	ENST00000242310	T	0.13538	2.58	1.04	-2.07	0.07276	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.055833	0.64402	N	0.000001	T	0.03053	0.0090	N	0.11201	0.11	0.20926	N	0.99983	B	0.02656	0.0	B	0.04013	0.001	T	0.38735	-0.9647	10	0.12430	T	0.62	.	5.2596	0.15565	0.0:0.4378:0.0:0.5622	.	948	Q8IZX4	TAF1L_HUMAN	T	948	ENSP00000418379:A948T	ENSP00000418379:A948T	A	-	1	0	TAF1L	32622736	1.000000	0.71417	0.973000	0.42090	0.792000	0.44763	2.631000	0.46502	-0.866000	0.04068	-1.373000	0.01185	GCT		0.502	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
NXF5	55998	broad.mit.edu	37	X	101092588	101092588	+	Nonsense_Mutation	SNP	G	G	A	rs140252282	byFrequency	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chrX:101092588G>A	ENST00000361708.2	-	15	1317	c.958C>T	c.(958-960)Cga>Tga	p.R320*	NXF5_ENST00000537026.1_Nonsense_Mutation_p.R320*|NXF5_ENST00000473265.2_Nonsense_Mutation_p.R320*			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	320	NTF2; truncated.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R320*(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						TCCACGTTTCGTGGACATTTT	0.537													G|||	8	0.00211921	0.0053	0.0014	3775	,	,		14021	0.0		0.0	False		,,,				2504	0.0				p.R320X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C958T	X						.	G	stop/ARG	32,3803		0,25,7,1607,564	172.0	137.0	149.0		958		0.0	X	dbSNP_134	149	1,6727		0,1,0,2427,1872	yes	stop-gained	NXF5	NM_032946.2		0,26,7,4034,2436	AA,AG,A,GG,G		0.0149,0.8344,0.3124		320/366	101092588	33,10530	2203	4300	6503	100979244	SO:0001587	stop_gained	55998	exon15			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.958C>T	X.37:g.101092588G>A	ENSP00000355286:p.Arg320*	Somatic		Capture	Illumina HiSeq	Phase_I	100979244	NM_032946	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Nonsense_Mutation	SNP	ENST00000361708.2	37		5	0.0030138637733574444	4	0.00816326530612245	0	0.0	0	0.0	0	0.0	.	17.99	3.523252	0.64747	0.008344	1.49E-4	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	.	.	.	.	.	.	.	0.419726	0.23752	U	0.044916	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	.	.	.	.	.	.	.	X	320	.	ENSP00000263032:R320X	R	-	1	2	NXF5	100979244	0.004000	0.15560	0.002000	0.10522	0.003000	0.03518	0.204000	0.17335	0.099000	0.17552	0.100000	0.15512	CGA		0.537	NXF5-201	KNOWN	basic	protein_coding	protein_coding			
MUM1L1	139221	broad.mit.edu	37	X	105450575	105450575	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chrX:105450575C>T	ENST00000357175.2	+	4	1799	c.1150C>T	c.(1150-1152)Cat>Tat	p.H384Y	MUM1L1_ENST00000372552.1_Missense_Mutation_p.H384Y|MUM1L1_ENST00000337685.2_Missense_Mutation_p.H384Y	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	384						extracellular vesicular exosome (GO:0070062)		p.H384Y(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTTCATTTTACATTATGAGAC	0.373																																					p.H384Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1150T	X						.						46.0	39.0	41.0					X																	105450575		1862	4094	5956	105337231	SO:0001583	missense	139221	exon5			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1150C>T	X.37:g.105450575C>T	ENSP00000349699:p.His384Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	105337231	NM_152423	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	ENST00000357175.2	37	CCDS55469.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.220287	0.00024	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.21932	1.98;1.98;1.98	4.31	0.296	0.15757	.	0.557239	0.16100	N	0.229615	T	0.12092	0.0294	L	0.38531	1.155	0.09310	N	1	P	0.42296	0.775	B	0.40825	0.341	T	0.19257	-1.0311	10	0.02654	T	1	-4.6496	6.8347	0.23929	0.5081:0.3288:0.163:0.0	.	384	Q5H9M0	MUML1_HUMAN	Y	384	ENSP00000349699:H384Y;ENSP00000338641:H384Y;ENSP00000361632:H384Y	ENSP00000338641:H384Y	H	+	1	0	MUM1L1	105337231	0.000000	0.05858	0.008000	0.14137	0.095000	0.18619	-0.299000	0.08254	-0.074000	0.12820	-0.353000	0.07706	CAT		0.373	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057795.1	NM_152423	
CSF2RA	1438	broad.mit.edu	37	X	1407701	1407701	+	Silent	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chrX:1407701G>A	ENST00000381524.3	+	6	579	c.393G>A	c.(391-393)gcG>gcA	p.A131A	CSF2RA_ENST00000355432.3_Silent_p.A131A|CSF2RA_ENST00000381500.1_Silent_p.A131A|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000417535.2_Silent_p.A131A|CSF2RA_ENST00000432318.2_Silent_p.A131A|CSF2RA_ENST00000361536.3_Silent_p.A131A|CSF2RA_ENST00000381529.3_Silent_p.A131A|CSF2RA_ENST00000355805.2_Silent_p.A131A|CSF2RA_ENST00000381509.3_Silent_p.A131A|CSF2RA_ENST00000501036.2_5'UTR|CSF2RA_ENST00000494969.2_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	131					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A131A(4)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TCTACAATGCGGATTTAATGA	0.473													g|||	6	0.00119808	0.0045	0.0	5008	,	,		17032	0.0		0.0	False		,,,				2504	0.0				p.A131A	Esophageal Squamous(131;723 1707 25334 40494 41806)											.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.G393A	X						.	G	,,,,,,,,	13,4393		0,13,2190	174.0	183.0	180.0		393,393,393,,393,393,393,393,393	-4.0	0.0	X	dbSNP_134	180	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,utr-5,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CSF2RA	NM_001161529.1,NM_001161530.1,NM_001161531.1,NM_001161532.1,NM_006140.4,NM_172245.2,NM_172246.2,NM_172247.2,NM_172249.2	,,,,,,,,	0,13,6486	AA,AG,GG		0.0,0.2951,0.1	,,,,,,,,	131/401,131/435,131/411,,131/401,131/401,131/378,131/334,131/234	1407701	13,12985	2203	4296	6499	1367701	SO:0001819	synonymous_variant	1438	exon6			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.393G>A	X.37:g.1407701G>A		Somatic		Capture	Illumina HiSeq	Phase_I	1367701	NM_172245	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Silent	SNP	ENST00000381524.3	37	CCDS35191.1																																																																																				0.473	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2		
ZFX	7543	broad.mit.edu	37	X	24228602	24228602	+	Silent	SNP	G	G	A			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chrX:24228602G>A	ENST00000379177.1	+	11	1954	c.1527G>A	c.(1525-1527)gtG>gtA	p.V509V	ZFX_ENST00000304543.5_Silent_p.V509V|ZFX_ENST00000539115.1_Silent_p.V280V|ZFX_ENST00000540034.1_Silent_p.V548V|ZFX_ENST00000338565.3_Silent_p.V459V|ZFX_ENST00000379188.3_Silent_p.V509V	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	509					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.V509V(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						ACAAAATGGTGCATAAGGAAA	0.463																																					p.V280V	Esophageal Squamous(20;306 562 7346 32868 37983)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G840A	X						.						113.0	101.0	105.0					X																	24228602		2203	4300	6503	24138523	SO:0001819	synonymous_variant	7543	exon6				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1527G>A	X.37:g.24228602G>A		Somatic		Capture	Illumina HiSeq	Phase_I	24138523	NM_001178086	B9EG97|O43668|Q8WYJ8	Silent	SNP	ENST00000379177.1	37	CCDS14211.1																																																																																				0.463	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
WNK3	65267	broad.mit.edu	37	X	54282313	54282313	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chrX:54282313G>C	ENST00000375159.2	-	11	2109	c.2110C>G	c.(2110-2112)Caa>Gaa	p.Q704E	WNK3_ENST00000375169.3_Missense_Mutation_p.Q704E|WNK3_ENST00000354646.2_Missense_Mutation_p.Q704E			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	704			Q -> H (in dbSNP:rs56077971). {ECO:0000269|PubMed:17344846}.		intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q704E(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GCCACATCTTGATTCAAGCTA	0.358																																					p.Q704E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2110G	X						.						142.0	119.0	127.0					X																	54282313		2203	4300	6503	54299038	SO:0001583	missense	65267	exon12			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.2110C>G	X.37:g.54282313G>C	ENSP00000364301:p.Gln704Glu	Somatic		Capture	Illumina HiSeq	Phase_I	54299038	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	G	8.564	0.878501	0.17395	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.41065	1.01;1.01;1.01	4.93	1.83	0.25207	.	0.603414	0.14573	N	0.311337	T	0.26774	0.0655	N	0.24115	0.695	0.22317	N	0.999208	B;B	0.24483	0.043;0.104	B;B	0.21360	0.034;0.024	T	0.18808	-1.0325	10	0.56958	D	0.05	1.5947	7.6914	0.28569	0.0:0.3237:0.5086:0.1677	.	704;704	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	E	704	ENSP00000364312:Q704E;ENSP00000346667:Q704E;ENSP00000364301:Q704E	ENSP00000346667:Q704E	Q	-	1	0	WNK3	54299038	1.000000	0.71417	0.899000	0.35326	0.844000	0.47949	1.841000	0.39240	0.373000	0.24621	0.583000	0.79449	CAA		0.358	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
ZCCHC12	170261	broad.mit.edu	37	X	117959515	117959515	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3667-01A-01W-0900-09	TCGA-AA-3667-10A-01W-0900-09	g.chrX:117959515C>T	ENST00000310164.2	+	4	815	c.308C>T	c.(307-309)gCg>gTg	p.A103V		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	103					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.A103V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						gtgcttcaggcgaccaaccct	0.512																																					p.A103V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C308T	X						.						164.0	156.0	159.0					X																	117959515		2203	4300	6503	117843543	SO:0001583	missense	170261	exon4			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.308C>T	X.37:g.117959515C>T	ENSP00000308921:p.Ala103Val	Somatic		Capture	Illumina HiSeq	Phase_I	117843543	NM_173798	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	ENST00000310164.2	37	CCDS14574.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101348	0.56183	.	.	ENSG00000174460	ENST00000310164	T	0.10382	2.88	3.09	3.09	0.35607	.	0.000000	0.32753	N	0.005687	T	0.32912	0.0845	M	0.86343	2.81	0.30572	N	0.763371	D	0.89917	1.0	D	0.83275	0.996	T	0.22347	-1.0219	10	0.51188	T	0.08	-15.2242	8.7855	0.34818	0.0:1.0:0.0:0.0	.	103	Q6PEW1	ZCH12_HUMAN	V	103	ENSP00000308921:A103V	ENSP00000308921:A103V	A	+	2	0	ZCCHC12	117843543	0.983000	0.35010	0.969000	0.41365	0.891000	0.51852	2.978000	0.49305	1.801000	0.52704	0.594000	0.82650	GCG		0.512	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798	
