#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CNNM1	26507	broad.mit.edu	37	10	101120634	101120634	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:101120634A>C	ENST00000356713.4	+	3	2049	c.1760A>C	c.(1759-1761)aAg>aCg	p.K587T	CNNM1_ENST00000370534.4_Missense_Mutation_p.K222T|CNNM1_ENST00000370528.3_Missense_Mutation_p.K516T|CNNM1_ENST00000446890.1_Missense_Mutation_p.K516T	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	587					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.K222T(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CGGGAGCGGAAGCGGCATGAC	0.537																																					p.K587T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1760C	10						.						145.0	147.0	146.0					10																	101120634		2203	4300	6503	101110624	SO:0001583	missense	26507	exon3			AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1760A>C	10.37:g.101120634A>C	ENSP00000349147:p.Lys587Thr	Somatic		Capture	Illumina HiSeq	Phase_I	101110624	NM_020348	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	A	17.64	3.439420	0.63067	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534;ENST00000545665	D;D;D;T	0.85088	-1.94;-1.88;-1.86;-0.86	5.74	4.61	0.57282	.	0.099477	0.64402	D	0.000002	D	0.86239	0.5885	M	0.75447	2.3	0.58432	D	0.999997	B;B;B;B	0.33073	0.056;0.396;0.255;0.004	B;B;B;B	0.40285	0.054;0.325;0.184;0.024	D	0.84772	0.0768	10	0.56958	D	0.05	-13.619	10.9155	0.47133	0.9256:0.0:0.0744:0.0	.	222;587;222;587	F5H5J0;Q9NRU3-2;B7Z5S3;Q9NRU3	.;.;.;CNNM1_HUMAN	T	587;516;516;222;40	ENSP00000349147:K587T;ENSP00000406492:K516T;ENSP00000359559:K516T;ENSP00000359565:K222T	ENSP00000349147:K587T	K	+	2	0	CNNM1	101110624	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.447000	0.80620	1.015000	0.39444	0.533000	0.62120	AAG		0.537	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
MGEA5	10724	broad.mit.edu	37	10	103547198	103547198	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:103547198T>C	ENST00000361464.3	-	15	2932	c.2537A>G	c.(2536-2538)gAc>gGc	p.D846G	MGEA5_ENST00000482611.1_5'UTR|MGEA5_ENST00000439817.1_Missense_Mutation_p.D793G|MGEA5_ENST00000357797.5_Missense_Mutation_p.D779G	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	846					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)	p.D846G(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TTTGTGAATGTCCATCTTTAT	0.393																																					p.D846G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2537G	10						.						151.0	150.0	151.0					10																	103547198		2203	4300	6503	103537188	SO:0001583	missense	10724	exon15			AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.2537A>G	10.37:g.103547198T>C	ENSP00000354850:p.Asp846Gly	Somatic		Capture	Illumina HiSeq	Phase_I	103537188	NM_012215	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	ENST00000361464.3	37	CCDS7520.1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909329	0.72868	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797	T;T;T	0.52057	0.68;0.68;0.68	5.74	5.74	0.90152	Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.53158	0.1779	L	0.34521	1.04	0.80722	D	1	P;D;B	0.56035	0.956;0.974;0.226	P;P;B	0.56343	0.63;0.796;0.147	T	0.50825	-0.8782	10	0.41790	T	0.15	-21.5221	16.3817	0.83467	0.0:0.0:0.0:1.0	.	793;779;846	E9PGF9;O60502-2;O60502	.;.;NCOAT_HUMAN	G	793;846;779	ENSP00000409973:D793G;ENSP00000354850:D846G;ENSP00000350445:D779G	ENSP00000350445:D779G	D	-	2	0	MGEA5	103537188	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.655000	0.83696	2.330000	0.79161	0.529000	0.55759	GAC		0.393	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
GPAM	57678	broad.mit.edu	37	10	113921449	113921449	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:113921449G>A	ENST00000348367.4	-	15	1667	c.1470C>T	c.(1468-1470)tgC>tgT	p.C490C	GPAM_ENST00000423155.1_Silent_p.C490C|GPAM_ENST00000369425.1_Silent_p.C490C			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	490					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.C490C(2)		breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		AGAGGAGCAGGCAAGCCACAA	0.453																																					p.C490C	Ovarian(161;1017 2606 18293 52943)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1470T	10						.						97.0	82.0	87.0					10																	113921449		2203	4300	6503	113911439	SO:0001819	synonymous_variant	57678	exon15			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1470C>T	10.37:g.113921449G>A		Somatic		Capture	Illumina HiSeq	Phase_I	113911439	NM_020918	Q5VW51|Q86TA3	Silent	SNP	ENST00000348367.4	37	CCDS7570.1																																																																																				0.453	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
NRAP	4892	broad.mit.edu	37	10	115364534	115364534	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:115364534T>C	ENST00000359988.3	-	35	4305	c.4061A>G	c.(4060-4062)cAa>cGa	p.Q1354R	NRAP_ENST00000360478.3_Missense_Mutation_p.Q1319R|NRAP_ENST00000369358.4_Missense_Mutation_p.Q1362R|NRAP_ENST00000369360.3_Missense_Mutation_p.Q1327R	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.Q1354R(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GAACTGGGCTTGGCTGCTGGT	0.632																																					p.Q1354R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4061G	10						.						102.0	101.0	101.0					10																	115364534		2203	4300	6503	115354524	SO:0001583	missense	4892	exon35				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.4061A>G	10.37:g.115364534T>C	ENSP00000353078:p.Gln1354Arg	Somatic		Capture	Illumina HiSeq	Phase_I	115354524	NM_198060		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	T	10.85	1.466871	0.26335	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.68	0.879	0.19155	.	0.472153	0.24370	N	0.039113	T	0.15652	0.0377	N	0.16368	0.405	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.24368	-1.0162	10	0.21014	T	0.42	.	9.0043	0.36102	0.0:0.5941:0.0:0.4059	.	512;1354;1319;1354	B1ANW7;A0AVL2;Q86VF7-4;Q86VF7	.;.;.;NRAP_HUMAN	R	1362;1327;1354;1319;512	ENSP00000358365:Q1362R;ENSP00000358367:Q1327R;ENSP00000353078:Q1354R;ENSP00000353666:Q1319R	ENSP00000353078:Q1354R	Q	-	2	0	NRAP	115354524	0.662000	0.27439	0.797000	0.32132	0.882000	0.50991	1.200000	0.32247	0.124000	0.18369	0.528000	0.53228	CAA		0.632	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
NET1	10276	broad.mit.edu	37	10	5498831	5498831	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:5498831A>T	ENST00000355029.4	+	12	1807	c.1665A>T	c.(1663-1665)agA>agT	p.R555S	NET1_ENST00000542715.1_Missense_Mutation_p.R374S|NET1_ENST00000380359.3_Missense_Mutation_p.R501S	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	555					apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R501S(1)|p.R555S(1)		breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						ACGCTTACAGATGTGGCTCTG	0.547																																					p.R501S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1503T	10						.						74.0	70.0	71.0					10																	5498831		2203	4300	6503	5488831	SO:0001583	missense	10276	exon10			AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.1665A>T	10.37:g.5498831A>T	ENSP00000347134:p.Arg555Ser	Somatic		Capture	Illumina HiSeq	Phase_I	5488831	NM_005863	Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	ENST00000355029.4	37	CCDS41483.1	.	.	.	.	.	.	.	.	.	.	A	3.408	-0.120872	0.06838	.	.	ENSG00000173848	ENST00000355029;ENST00000542715;ENST00000380359	T;T;T	0.12879	2.84;2.64;2.85	5.38	-10.8	0.00216	.	0.356243	0.19460	N	0.113717	T	0.07999	0.0200	N	0.22421	0.69	0.09310	N	1	B;B	0.21309	0.001;0.054	B;B	0.21360	0.002;0.034	T	0.11616	-1.0580	10	0.52906	T	0.07	-3.8399	17.9764	0.89129	0.1572:0.0:0.7419:0.1009	.	501;555	Q5SQI7;Q7Z628	.;ARHG8_HUMAN	S	555;374;501	ENSP00000347134:R555S;ENSP00000446452:R374S;ENSP00000369717:R501S	ENSP00000347134:R555S	R	+	3	2	NET1	5488831	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.026000	0.03596	-2.846000	0.00333	-0.925000	0.02716	AGA		0.547	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	
ITIH2	3698	broad.mit.edu	37	10	7763667	7763667	+	Missense_Mutation	SNP	G	G	A	rs201601009	byFrequency	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:7763667G>A	ENST00000358415.4	+	8	960	c.794G>A	c.(793-795)cGg>cAg	p.R265Q	ITIH2_ENST00000379587.4_Missense_Mutation_p.R254Q	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	265					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R265Q(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						CCTAACTGCCGGGAGACTGCG	0.562													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18659	0.001		0.0	False		,,,				2504	0.0				p.R265Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	10						.						175.0	156.0	162.0					10																	7763667		2203	4300	6503	7803673	SO:0001583	missense	3698	exon8			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.794G>A	10.37:g.7763667G>A	ENSP00000351190:p.Arg265Gln	Somatic		Capture	Illumina HiSeq	Phase_I	7803673	NM_002216	Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	CCDS31141.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.45	1.942887	0.34283	.	.	ENSG00000151655	ENST00000358415;ENST00000379587	T;T	0.77229	-1.08;-1.08	5.29	2.46	0.29980	.	0.325875	0.37304	N	0.002153	T	0.44456	0.1294	N	0.01168	-0.975	0.21915	N	0.999477	B	0.31949	0.348	B	0.23018	0.043	T	0.40478	-0.9561	10	0.33940	T	0.23	-2.0538	8.4247	0.32723	0.0:0.7244:0.133:0.1426	.	265	P19823	ITIH2_HUMAN	Q	265;254	ENSP00000351190:R265Q;ENSP00000368906:R254Q	ENSP00000351190:R265Q	R	+	2	0	ITIH2	7803673	0.996000	0.38824	0.145000	0.22337	0.053000	0.15095	3.496000	0.53288	0.244000	0.21351	-0.521000	0.04368	CGG		0.562	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
CUBN	8029	broad.mit.edu	37	10	16893251	16893251	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:16893251G>A	ENST00000377833.4	-	60	9711	c.9646C>T	c.(9646-9648)Ctt>Ttt	p.L3216F		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3216	CUB 24. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.L3216F(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TAATCATAAAGGCATCTTTGC	0.348																																					p.L3216F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9646T	10						.						87.0	91.0	90.0					10																	16893251		2203	4300	6503	16933257	SO:0001583	missense	8029	exon60			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9646C>T	10.37:g.16893251G>A	ENSP00000367064:p.Leu3216Phe	Somatic		Capture	Illumina HiSeq	Phase_I	16933257	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.751703	0.49362	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.52295	0.67	5.26	-10.5	0.00291	CUB (5);	2.297390	0.02906	N	0.136014	T	0.29588	0.0738	L	0.31476	0.935	0.35360	D	0.788163	P	0.37914	0.611	B	0.39419	0.299	T	0.31613	-0.9937	10	0.33141	T	0.24	.	3.9384	0.09316	0.1158:0.3218:0.1309:0.4315	.	3216	O60494	CUBN_HUMAN	F	3216;57	ENSP00000367064:L3216F	ENSP00000367064:L3216F	L	-	1	0	CUBN	16933257	0.000000	0.05858	0.001000	0.08648	0.831000	0.47069	-4.901000	0.00172	-2.863000	0.00326	0.313000	0.20887	CTT		0.348	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
C10orf71	118461	broad.mit.edu	37	10	50532105	50532105	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:50532105C>T	ENST00000374144.3	+	3	1803	c.1515C>T	c.(1513-1515)gaC>gaT	p.D505D	C10orf71_ENST00000323868.4_Silent_p.D505D			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	505								p.D505D(2)		endometrium(1)	1						ACCTCAAGGACGTGCGGAAGC	0.488																																					p.D505D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1515T	10						.						48.0	52.0	51.0					10																	50532105		2064	4198	6262	50202111	SO:0001819	synonymous_variant	118461	exon3			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1515C>T	10.37:g.50532105C>T		Somatic		Capture	Illumina HiSeq	Phase_I	50202111	NM_001135196	A0AVL8	Silent	SNP	ENST00000374144.3	37	CCDS44387.1																																																																																				0.488	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
TNKS2	80351	broad.mit.edu	37	10	93593683	93593683	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:93593683G>A	ENST00000371627.4	+	12	1728	c.1349G>A	c.(1348-1350)cGc>cAc	p.R450H		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	450					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.R450H(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				CAAACCTGCCGCCTACTCCTG	0.413																																					p.R450H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1349A	10						.						148.0	130.0	136.0					10																	93593683		2203	4300	6503	93583663	SO:0001583	missense	80351	exon12			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.1349G>A	10.37:g.93593683G>A	ENSP00000360689:p.Arg450His	Somatic		Capture	Illumina HiSeq	Phase_I	93583663	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	37	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544810	0.65198	.	.	ENSG00000107854	ENST00000371627	T	0.67171	-0.25	5.83	5.83	0.93111	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000020	T	0.63558	0.2521	L	0.41027	1.25	0.51012	D	0.999904	B	0.24483	0.104	B	0.26693	0.072	T	0.59343	-0.7472	10	0.54805	T	0.06	.	20.1162	0.97934	0.0:0.0:1.0:0.0	.	450	Q9H2K2	TNKS2_HUMAN	H	450	ENSP00000360689:R450H	ENSP00000360689:R450H	R	+	2	0	TNKS2	93583663	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.735000	0.62051	2.756000	0.94617	0.655000	0.94253	CGC		0.413	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
BAG3	9531	broad.mit.edu	37	10	121436596	121436596	+	Silent	SNP	C	C	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr10:121436596C>G	ENST00000369085.3	+	4	1836	c.1530C>G	c.(1528-1530)ctC>ctG	p.L510L		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	510					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)		p.L510L(1)		endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		TCTATGAACTCCAGCCCAGCA	0.517																																					p.L510L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1530G	10						.						102.0	99.0	100.0					10																	121436596		2203	4300	6503	121426586	SO:0001819	synonymous_variant	9531	exon4			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.1530C>G	10.37:g.121436596C>G		Somatic		Capture	Illumina HiSeq	Phase_I	121426586	NM_004281	A8K5L8|Q3B763|Q9NT20|Q9P120	Silent	SNP	ENST00000369085.3	37	CCDS7615.1																																																																																				0.517	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050662.1	NM_004281	
OR52K1	390036	broad.mit.edu	37	11	4510780	4510780	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr11:4510780T>C	ENST00000307632.3	+	1	672	c.650T>C	c.(649-651)aTc>aCc	p.I217T		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I217T(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTCTTTGTTATCCTGTCTTAT	0.502																																					p.I217T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T650C	11						.						525.0	411.0	450.0					11																	4510780		2201	4298	6499	4467356	SO:0001583	missense	390036	exon1			AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.650T>C	11.37:g.4510780T>C	ENSP00000302422:p.Ile217Thr	Somatic		Capture	Illumina HiSeq	Phase_I	4467356	NM_001005171	B9EH54|Q6IFK5	Missense_Mutation	SNP	ENST00000307632.3	37	CCDS31352.1	.	.	.	.	.	.	.	.	.	.	T	3.510	-0.099978	0.07010	.	.	ENSG00000196778	ENST00000307632	T	0.00164	8.64	4.5	2.18	0.27775	GPCR, rhodopsin-like superfamily (1);	0.501265	0.16856	N	0.196756	T	0.00109	0.0003	N	0.13235	0.315	0.09310	N	1	P	0.42161	0.772	B	0.44315	0.446	T	0.33828	-0.9853	10	0.29301	T	0.29	.	6.7907	0.23697	0.0:0.0862:0.1555:0.7583	.	217	Q8NGK4	O52K1_HUMAN	T	217	ENSP00000302422:I217T	ENSP00000302422:I217T	I	+	2	0	OR52K1	4467356	0.000000	0.05858	0.213000	0.23690	0.867000	0.49689	-0.617000	0.05584	0.840000	0.34995	0.338000	0.21704	ATC		0.502	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385846.1	NM_001005171	
OR52L1	338751	broad.mit.edu	37	11	6008035	6008035	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr11:6008035C>T	ENST00000332249.4	-	1	180	c.126G>A	c.(124-126)caG>caA	p.Q42Q		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q27Q(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAATCCAGTGCTGGCTTTCCT	0.493																																					p.Q42Q	Melanoma(121;653 1666 10547 22796 51255)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G126A	11						.						57.0	57.0	57.0					11																	6008035		1921	4140	6061	5964611	SO:0001819	synonymous_variant	338751	exon1			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.126G>A	11.37:g.6008035C>T		Somatic		Capture	Illumina HiSeq	Phase_I	5964611	NM_001005173	B2RPA6|Q6IFK9	Silent	SNP	ENST00000332249.4	37	CCDS44529.1																																																																																				0.493	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173	
TAF6L	10629	broad.mit.edu	37	11	62549651	62549651	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr11:62549651C>T	ENST00000294168.3	+	8	874	c.673C>T	c.(673-675)Cgt>Tgt	p.R225C	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	225					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.R225C(1)		endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						GAGCCTATTTCGTAATCCGCA	0.582																																					p.R225C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C673T	11						.						90.0	85.0	87.0					11																	62549651		2201	4299	6500	62306227	SO:0001583	missense	10629	exon8			BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.673C>T	11.37:g.62549651C>T	ENSP00000294168:p.Arg225Cys	Somatic		Capture	Illumina HiSeq	Phase_I	62306227	NM_006473	B2RAT0|Q96HA6	Missense_Mutation	SNP	ENST00000294168.3	37	CCDS8035.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.811266	0.70797	.	.	ENSG00000162227	ENST00000294168	T	0.67523	-0.27	5.4	4.47	0.54385	.	0.184993	0.41938	D	0.000797	T	0.51991	0.1707	L	0.29908	0.895	0.80722	D	1	D	0.67145	0.996	B	0.43575	0.424	T	0.54636	-0.8264	10	0.52906	T	0.07	-11.5133	6.7508	0.23485	0.1774:0.736:0.0:0.0866	.	225	Q9Y6J9	TAF6L_HUMAN	C	225	ENSP00000294168:R225C	ENSP00000294168:R225C	R	+	1	0	TAF6L	62306227	1.000000	0.71417	0.998000	0.56505	0.887000	0.51463	5.650000	0.67944	1.492000	0.48499	0.561000	0.74099	CGT		0.582	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395352.1	NM_006473	
OR6T1	219874	broad.mit.edu	37	11	123814011	123814011	+	Missense_Mutation	SNP	G	G	A	rs140103246		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr11:123814011G>A	ENST00000321252.2	-	1	569	c.535C>T	c.(535-537)Cgt>Tgt	p.R179C		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R179C(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CAACTGTCACGAAAGAAGTGG	0.572																																					p.R179C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C535T	11						.	A	CYS/ARG	1,4403	825.9+/-416.6	0,1,2201	79.0	66.0	70.0		535	2.5	0.4	11	dbSNP_134	70	0,8598		0,0,4299	no	missense	OR6T1	NM_001005187.1	180	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	benign	179/324	123814011	1,13001	2202	4299	6501	123319221	SO:0001583	missense	219874	exon1			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.535C>T	11.37:g.123814011G>A	ENSP00000325203:p.Arg179Cys	Somatic		Capture	Illumina HiSeq	Phase_I	123319221	NM_001005187	Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	37	CCDS31700.1	.	.	.	.	.	.	.	.	.	.	A	0.996	-0.692594	0.03303	2.27E-4	0.0	ENSG00000181499	ENST00000321252	T	0.15256	2.44	3.7	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01222	0.0040	N	0.00001	-3.815	0.34346	D	0.689322	B	0.02656	0.0	B	0.01281	0.0	T	0.31308	-0.9948	9	0.02654	T	1	-26.7136	4.8222	0.13396	0.7032:0.1892:0.1076:0.0	.	179	Q8NGN1	OR6T1_HUMAN	C	179	ENSP00000325203:R179C	ENSP00000325203:R179C	R	-	1	0	OR6T1	123319221	0.969000	0.33509	0.362000	0.25862	0.944000	0.59088	2.532000	0.45659	0.041000	0.15688	-0.360000	0.07572	CGT		0.572	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187	
GPN3	51184	broad.mit.edu	37	12	110895384	110895384	+	Silent	SNP	G	G	A	rs199869926		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:110895384G>A	ENST00000228827.3	-	4	443	c.381C>T	c.(379-381)ctC>ctT	p.L127L	GPN3_ENST00000537466.2_Silent_p.L137L|GPN3_ENST00000552180.1_5'Flank|GPN3_ENST00000543199.1_Silent_p.L166L	NM_016301.3	NP_057385.3			GPN-loop GTPase 3									p.L127L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						CCCACTGCTCGAGCTGCTGGA	0.413																																					p.L127L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C381T	12						.						55.0	50.0	52.0					12																	110895384		2203	4300	6503	109379767	SO:0001819	synonymous_variant	51184	exon4			BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.381C>T	12.37:g.110895384G>A		Somatic		Capture	Illumina HiSeq	Phase_I	109379767	NM_016301		Silent	SNP	ENST00000228827.3	37	CCDS9147.1	.	.	.	.	.	.	.	.	.	.	G	7.830	0.719592	0.15372	.	.	ENSG00000111231	ENST00000550228	.	.	.	5.78	-11.6	0.00059	.	.	.	.	.	T	0.32763	0.0840	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42849	-0.9427	4	.	.	.	-6.3239	2.5237	0.04686	0.144:0.1488:0.3027:0.4044	.	.	.	.	L	75	.	.	S	-	2	0	GPN3	109379767	0.000000	0.05858	0.058000	0.19502	0.874000	0.50279	-2.085000	0.01362	-2.902000	0.00311	-0.293000	0.09583	TCG		0.413	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1	NM_016301	
BCL7A	605	broad.mit.edu	37	12	122468669	122468669	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:122468669G>A	ENST00000261822.4	+	2	362	c.156G>A	c.(154-156)acG>acA	p.T52T	BCL7A_ENST00000538010.1_Silent_p.T52T	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	52					negative regulation of transcription, DNA-templated (GO:0045892)			p.T52T(2)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		TCCCTGTGACGGAGCCCAAGG	0.582			T	MYC	BNHL																																p.T52T	GBM(17;197 467 16477 23242 44349)		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G156A	12						.						157.0	124.0	135.0					12																	122468669		2203	4300	6503	120953052	SO:0001819	synonymous_variant	605	exon2			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.156G>A	12.37:g.122468669G>A		Somatic		Capture	Illumina HiSeq	Phase_I	120953052	NM_020993	B4DJN6|B7ZB21|Q13843|Q14CT7	Silent	SNP	ENST00000261822.4	37	CCDS53841.1																																																																																				0.582	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
PDZRN4	29951	broad.mit.edu	37	12	41967397	41967397	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:41967397G>A	ENST00000402685.2	+	10	2824	c.2816G>A	c.(2815-2817)cGc>cAc	p.R939H	PDZRN4_ENST00000539469.2_Missense_Mutation_p.R681H|PDZRN4_ENST00000298919.7_Missense_Mutation_p.R679H	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	939							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R681H(1)|p.R939H(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AAAATGGGGCGCTACTGGAGC	0.542																																					p.R939H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2816A	12						.						92.0	87.0	89.0					12																	41967397		2203	4300	6503	40253664	SO:0001583	missense	29951	exon10			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2816G>A	12.37:g.41967397G>A	ENSP00000384197:p.Arg939His	Somatic		Capture	Illumina HiSeq	Phase_I	40253664	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848696	0.91277	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.46819	0.86;0.86;0.86	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.73885	0.3644	M	0.86178	2.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.77574	-0.2537	10	0.87932	D	0	-33.3157	19.7189	0.96135	0.0:0.0:1.0:0.0	.	939;679;681	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	H	939;681;679	ENSP00000384197:R939H;ENSP00000439990:R681H;ENSP00000298919:R679H	ENSP00000298919:R679H	R	+	2	0	PDZRN4	40253664	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.939000	0.87685	2.834000	0.97654	0.650000	0.86243	CGC		0.542	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
DIP2B	57609	broad.mit.edu	37	12	51133277	51133277	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:51133277G>A	ENST00000301180.5	+	36	4296	c.4262G>A	c.(4261-4263)cGc>cAc	p.R1421H		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1421						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.R1421H(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TTCAACACTCGCCTCAGCTTT	0.527																																					p.R1421H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4262A	12						.						127.0	103.0	111.0					12																	51133277		2203	4300	6503	49419544	SO:0001583	missense	57609	exon36			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.4262G>A	12.37:g.51133277G>A	ENSP00000301180:p.Arg1421His	Somatic		Capture	Illumina HiSeq	Phase_I	49419544	NM_173602	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670398	0.67814	.	.	ENSG00000066084	ENST00000301180	T	0.28255	1.62	5.21	5.21	0.72293	AMP-dependent synthetase/ligase (1);	0.049660	0.85682	D	0.000000	T	0.55401	0.1918	M	0.70275	2.135	0.54753	D	0.999989	D	0.76494	0.999	D	0.68943	0.961	T	0.53837	-0.8382	10	0.48119	T	0.1	-12.3815	18.5419	0.91031	0.0:0.0:1.0:0.0	.	1421	Q9P265	DIP2B_HUMAN	H	1421	ENSP00000301180:R1421H	ENSP00000301180:R1421H	R	+	2	0	DIP2B	49419544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.652000	0.54439	2.716000	0.92895	0.491000	0.48974	CGC		0.527	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
CNPY2	10330	broad.mit.edu	37	12	56708726	56708726	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:56708726A>G	ENST00000273308.4	-	3	653	c.113T>C	c.(112-114)cTa>cCa	p.L38P	PAN2_ENST00000549090.1_5'Flank|RP11-977G19.10_ENST00000549318.1_Missense_Mutation_p.L38P|CNPY2_ENST00000551720.1_5'UTR|RP11-977G19.11_ENST00000549860.1_RNA|RP11-977G19.11_ENST00000549565.1_RNA	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2	38	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)		p.L38P(1)		large_intestine(2)|lung(2)	4						TTCCCATTCTAGTTCATCCAC	0.542																																					p.L38P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T113C	12						.						103.0	93.0	97.0					12																	56708726		2203	4300	6503	54994993	SO:0001583	missense	10330	exon3			AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.113T>C	12.37:g.56708726A>G	ENSP00000273308:p.Leu38Pro	Somatic		Capture	Illumina HiSeq	Phase_I	54994993	NM_014255	B2R7B9|Q9UHE9	Missense_Mutation	SNP	ENST00000273308.4	37	CCDS8914.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.765135	0.90020	.	.	ENSG00000144785;ENSG00000144785;ENSG00000144785;ENSG00000257727;ENSG00000257727	ENST00000549318;ENST00000547423;ENST00000548360;ENST00000273308;ENST00000551475	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.69	5.69	0.88448	Saposin B (1);	0.120780	0.56097	D	0.000036	T	0.70360	0.3215	L	0.58810	1.83	0.80722	D	1	D;D	0.65815	0.969;0.995	P;P	0.61658	0.839;0.892	T	0.73436	-0.3983	10	0.87932	D	0	-22.5316	15.2513	0.73549	1.0:0.0:0.0:0.0	.	38;38	Q9Y2B0-2;Q9Y2B0	.;CNPY2_HUMAN	P	38	ENSP00000446743:L38P;ENSP00000446506:L38P;ENSP00000447042:L38P;ENSP00000273308:L38P;ENSP00000448809:L38P	ENSP00000273308:L38P	L	-	2	0	RP11-977G19.10;CNPY2	54994993	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.108000	0.94275	2.311000	0.77944	0.533000	0.62120	CTA		0.542	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255	
NAV3	89795	broad.mit.edu	37	12	78512067	78512067	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:78512067C>T	ENST00000397909.2	+	14	3203	c.3030C>T	c.(3028-3030)ctC>ctT	p.L1010L	NAV3_ENST00000536525.2_Silent_p.L1010L|NAV3_ENST00000228327.6_Silent_p.L1010L|NAV3_ENST00000266692.7_Silent_p.L1010L			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1010						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.L1010L(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAAGTGCACTCAAAACACCCG	0.453										HNSCC(70;0.22)																											p.L1010L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3030T	12						.						47.0	48.0	47.0					12																	78512067		1897	4128	6025	77036198	SO:0001819	synonymous_variant	89795	exon14			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3030C>T	12.37:g.78512067C>T		Somatic		Capture	Illumina HiSeq	Phase_I	77036198	NM_014903	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	1.153	-0.646222	0.03531	.	.	ENSG00000067798	ENST00000552895	.	.	.	5.85	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.6575	10.5708	0.45198	0.0:0.8572:0.0:0.1428	.	.	.	.	X	82	.	.	Q	+	1	0	NAV3	77036198	0.988000	0.35896	1.000000	0.80357	0.166000	0.22503	0.263000	0.18478	2.767000	0.95098	0.563000	0.77884	CAA		0.453	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
CEP290	80184	broad.mit.edu	37	12	88482945	88482945	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:88482945A>T	ENST00000552810.1	-	31	4236	c.3893T>A	c.(3892-3894)cTt>cAt	p.L1298H	CEP290_ENST00000547691.2_Missense_Mutation_p.L358H|CEP290_ENST00000397838.3_Missense_Mutation_p.L358H|CEP290_ENST00000309041.7_Missense_Mutation_p.L1300H	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1298					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.L1300H(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CATTATCTTAAGTTTGTCATT	0.343																																					p.L1298H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3893A	12						.						112.0	98.0	103.0					12																	88482945		1814	4081	5895	87007076	SO:0001583	missense	80184	exon31			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.3893T>A	12.37:g.88482945A>T	ENSP00000448012:p.Leu1298His	Somatic		Capture	Illumina HiSeq	Phase_I	87007076	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.389550	0.61956	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.64803	0.45;-0.12;-0.12;0.45	5.57	5.57	0.84162	.	0.344282	0.30920	N	0.008602	T	0.74921	0.3780	L	0.56769	1.78	0.30600	N	0.760637	D	0.89917	1.0	D	0.68353	0.957	T	0.75224	-0.3393	10	0.44086	T	0.13	.	15.7269	0.77766	1.0:0.0:0.0:0.0	.	1298	O15078	CE290_HUMAN	H	358;1298;1300;358	ENSP00000446905:L358H;ENSP00000448012:L1298H;ENSP00000308021:L1300H;ENSP00000380938:L358H	ENSP00000308021:L1300H	L	-	2	0	CEP290	87007076	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	4.912000	0.63335	2.123000	0.65237	0.482000	0.46254	CTT		0.343	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
TMED2	10959	broad.mit.edu	37	12	124071432	124071432	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr12:124071432A>T	ENST00000262225.3	+	2	425	c.319A>T	c.(319-321)Atg>Ttg	p.M107L	TMED2_ENST00000509052.2_Missense_Mutation_p.M22L|RP11-486O12.2_ENST00000498967.2_lincRNA	NM_006815.3	NP_006806.1	Q15363	TMED2_HUMAN	transmembrane emp24 domain trafficking protein 2	107	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.|Interaction with F2RL1.				cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPII vesicle coating (GO:0048208)|embryonic morphogenesis (GO:0048598)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|maternal placenta development (GO:0001893)|negative regulation of GTPase activity (GO:0034260)|protein targeting to plasma membrane (GO:0072661)	COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|zymogen granule membrane (GO:0042589)		p.M107L(1)		kidney(1)|large_intestine(4)|lung(1)|prostate(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000138)|Epithelial(86;0.000613)|all cancers(50;0.00745)		AAAAATAGTGATGTTCACCAT	0.393																																					p.M107L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A319T	12						.						81.0	75.0	77.0					12																	124071432		2203	4300	6503	122637385	SO:0001583	missense	10959	exon2			X92098	CCDS9250.1	12q24.31	2006-03-27			ENSG00000086598	ENSG00000086598			16996	protein-coding gene	gene with protein product						8663407	Standard	NM_006815		Approved	RNP24, P24A	uc001ufg.3	Q15363	OTTHUMG00000168694	ENST00000262225.3:c.319A>T	12.37:g.124071432A>T	ENSP00000262225:p.Met107Leu	Somatic		Capture	Illumina HiSeq	Phase_I	122637385	NM_006815		Missense_Mutation	SNP	ENST00000262225.3	37	CCDS9250.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.036941	0.54896	.	.	ENSG00000086598	ENST00000262225;ENST00000438031;ENST00000432022;ENST00000509052	T;T;T	0.16196	2.36;2.36;2.36	4.82	3.68	0.42216	GOLD (3);	0.000000	0.85682	D	0.000000	T	0.16727	0.0402	L	0.54863	1.705	0.58432	D	0.999999	B	0.14438	0.01	B	0.23419	0.046	T	0.04635	-1.0937	10	0.19147	T	0.46	-0.5151	10.5672	0.45179	0.9231:0.0:0.0769:0.0	.	107	Q15363	TMED2_HUMAN	L	107;107;75;22	ENSP00000262225:M107L;ENSP00000405845:M107L;ENSP00000441161:M22L	ENSP00000262225:M107L	M	+	1	0	TMED2	122637385	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	7.452000	0.80683	0.803000	0.34113	0.454000	0.30748	ATG		0.393	TMED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400606.1	NM_006815	
PDS5B	23047	broad.mit.edu	37	13	33262606	33262606	+	Missense_Mutation	SNP	C	C	T	rs369886085		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr13:33262606C>T	ENST00000315596.10	+	13	1555	c.1369C>T	c.(1369-1371)Cgg>Tgg	p.R457W		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	457					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.R457W(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		ACTTGTTGAACGGATCTTTGC	0.308																																					p.R457W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1369T	13						.	C	TRP/ARG	1,3673		0,1,1836	174.0	163.0	167.0		1369	3.8	1.0	13		167	0,8174		0,0,4087	no	missense	PDS5B	NM_015032.3	101	0,1,5923	TT,TC,CC		0.0,0.0272,0.0084	probably-damaging	457/1448	33262606	1,11847	1837	4087	5924	32160606	SO:0001583	missense	23047	exon13			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1369C>T	13.37:g.33262606C>T	ENSP00000313851:p.Arg457Trp	Somatic		Capture	Illumina HiSeq	Phase_I	32160606	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648950	0.67358	2.72E-4	0.0	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.49	3.77	0.43336	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	L	0.49778	1.585	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67382	0.929;0.951	T	0.68123	-0.5492	9	0.66056	D	0.02	-2.3564	11.821	0.52238	0.0:0.8581:0.0:0.1419	.	457;457	Q9NTI5;Q9NTI5-3	PDS5B_HUMAN;.	W	457	.	ENSP00000313851:R457W	R	+	1	2	PDS5B	32160606	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	1.811000	0.38942	0.691000	0.31592	0.460000	0.39030	CGG		0.308	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
FREM2	341640	broad.mit.edu	37	13	39261957	39261957	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr13:39261957C>T	ENST00000280481.7	+	1	692	c.476C>T	c.(475-477)gCg>gTg	p.A159V		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	159					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A159V(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CGCTATGACGCGCCCGGAGGG	0.667																																					p.A159V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C476T	13						.						44.0	44.0	44.0					13																	39261957		2198	4296	6494	38159957	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.476C>T	13.37:g.39261957C>T	ENSP00000280481:p.Ala159Val	Somatic		Capture	Illumina HiSeq	Phase_I	38159957	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684441	0.47991	.	.	ENSG00000150893	ENST00000280481	T	0.19532	2.14	5.46	4.56	0.56223	.	0.195816	0.42172	D	0.000742	T	0.25232	0.0613	M	0.62723	1.935	0.31001	N	0.720334	B	0.31949	0.348	B	0.32583	0.148	T	0.30268	-0.9984	10	0.72032	D	0.01	.	14.3018	0.66357	0.0:0.7271:0.2729:0.0	.	159	Q5SZK8	FREM2_HUMAN	V	159	ENSP00000280481:A159V	ENSP00000280481:A159V	A	+	2	0	FREM2	38159957	0.414000	0.25408	0.761000	0.31378	0.150000	0.21749	4.609000	0.61148	2.551000	0.86045	0.655000	0.94253	GCG		0.667	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
SPERT	220082	broad.mit.edu	37	13	46287386	46287386	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr13:46287386G>A	ENST00000310521.1	+	3	306	c.226G>A	c.(226-228)Gcc>Acc	p.A76T	SPERT_ENST00000378966.3_Missense_Mutation_p.A40T	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	76						cytoplasmic membrane-bounded vesicle (GO:0016023)		p.A76T(1)		NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		GCAGCAGGCCGCCCTGCCCCG	0.657																																					p.A76T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G226A	13						.						33.0	34.0	33.0					13																	46287386		2202	4298	6500	45185387	SO:0001583	missense	220082	exon3			AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.226G>A	13.37:g.46287386G>A	ENSP00000309189:p.Ala76Thr	Somatic		Capture	Illumina HiSeq	Phase_I	45185387	NM_152719	A8K8I5|Q8NHV2	Missense_Mutation	SNP	ENST00000310521.1	37	CCDS9399.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671715	0.29693	.	.	ENSG00000174015	ENST00000310521;ENST00000533564;ENST00000378966	T;T	0.46451	0.87;0.87	5.04	-0.223	0.13118	.	0.302095	0.24024	N	0.042254	T	0.17450	0.0419	N	0.22421	0.69	0.29253	N	0.871831	B;P	0.35011	0.265;0.48	B;B	0.20384	0.02;0.029	T	0.11131	-1.0600	10	0.52906	T	0.07	.	0.9891	0.01453	0.181:0.1459:0.3416:0.3314	.	40;76	Q8NA61-2;Q8NA61	.;SPERT_HUMAN	T	76;49;40	ENSP00000309189:A76T;ENSP00000368249:A40T	ENSP00000309189:A76T	A	+	1	0	SPERT	45185387	0.049000	0.20398	0.991000	0.47740	0.530000	0.34684	0.337000	0.19841	0.046000	0.15833	-0.230000	0.12252	GCC		0.657	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
GPC6	10082	broad.mit.edu	37	13	95055305	95055305	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr13:95055305G>T	ENST00000377047.4	+	9	2117	c.1502G>T	c.(1501-1503)tGc>tTc	p.C501F		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	501					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.C501F(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GGCAGTGGGTGCATGGATGAC	0.547																																					p.C501F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1502T	13						.						163.0	173.0	170.0					13																	95055305		2203	4300	6503	93853306	SO:0001583	missense	10082	exon9			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.1502G>T	13.37:g.95055305G>T	ENSP00000366246:p.Cys501Phe	Somatic		Capture	Illumina HiSeq	Phase_I	93853306	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.393064	0.83011	.	.	ENSG00000183098	ENST00000377047	T	0.51325	0.71	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.69396	0.3106	M	0.74467	2.265	0.40828	D	0.983564	D	0.69078	0.997	D	0.74023	0.982	T	0.64521	-0.6388	10	0.27785	T	0.31	.	20.1432	0.98067	0.0:0.0:1.0:0.0	.	501	Q9Y625	GPC6_HUMAN	F	501	ENSP00000366246:C501F	ENSP00000366246:C501F	C	+	2	0	GPC6	93853306	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.160000	0.94734	2.769000	0.95229	0.561000	0.74099	TGC		0.547	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
MYO16	23026	broad.mit.edu	37	13	109617156	109617156	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr13:109617156C>T	ENST00000357550.2	+	19	2250	c.2209C>T	c.(2209-2211)Cga>Tga	p.R737*	MYO16_ENST00000251041.5_Nonsense_Mutation_p.R737*|MYO16_ENST00000356711.2_Nonsense_Mutation_p.R737*|MYO16_ENST00000457511.2_Nonsense_Mutation_p.R249*	NM_001198950.1	NP_001185879.1			myosin XVI									p.R737*(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGAGTTTTTCCGAGACCTCTT	0.423																																					p.R759X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2275T	13						.						272.0	243.0	253.0					13																	109617156		2203	4300	6503	108415157	SO:0001587	stop_gained	23026	exon20				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.2209C>T	13.37:g.109617156C>T	ENSP00000350160:p.Arg737*	Somatic		Capture	Illumina HiSeq	Phase_I	108415157	NM_001198950		Nonsense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	36	5.919536	0.97105	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	.	.	.	5.21	4.36	0.52297	.	0.000000	0.36854	U	0.002379	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1345	0.65279	0.1512:0.8488:0.0:0.0	.	.	.	.	X	737;737;737;737;525;249	.	.	R	+	1	2	MYO16	108415157	1.000000	0.71417	0.989000	0.46669	0.168000	0.22595	3.723000	0.54955	1.154000	0.42482	-0.293000	0.09583	CGA		0.423	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
FLVCR2	55640	broad.mit.edu	37	14	76045320	76045320	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr14:76045320T>G	ENST00000238667.4	+	1	361	c.5T>G	c.(4-6)gTg>gGg	p.V2G	AC007182.6_ENST00000455232.1_RNA	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	2					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)	p.V2G(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTGGCGATGGTGAATGAAGGT	0.592											OREG0022816	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V2G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5G	14						.						51.0	55.0	53.0					14																	76045320		2203	4300	6503	75115073	SO:0001583	missense	55640	exon1			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.5T>G	14.37:g.76045320T>G	ENSP00000238667:p.Val2Gly	Somatic	1165	Capture	Illumina HiSeq	Phase_I	75115073	NM_017791	B7Z485|Q53ZT9|Q96JY3|Q9NX90	Missense_Mutation	SNP	ENST00000238667.4	37	CCDS9844.1	.	.	.	.	.	.	.	.	.	.	T	14.01	2.408436	0.42715	.	.	ENSG00000119686	ENST00000238667	D	0.89681	-2.55	4.29	1.8	0.24995	.	0.527164	0.16375	N	0.217180	T	0.80665	0.4666	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.70850	-0.4760	10	0.39692	T	0.17	-0.9122	8.6957	0.34293	0.0:0.0:0.3758:0.6242	.	2	Q9UPI3	FLVC2_HUMAN	G	2	ENSP00000238667:V2G	ENSP00000238667:V2G	V	+	2	0	AC007182.1	75115073	0.997000	0.39634	1.000000	0.80357	0.703000	0.40648	0.340000	0.19892	0.383000	0.24910	0.528000	0.53228	GTG		0.592	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413672.1	NM_017791	
SNW1	22938	broad.mit.edu	37	14	78184620	78184620	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr14:78184620G>A	ENST00000261531.7	-	14	1484	c.1422C>T	c.(1420-1422)ccC>ccT	p.P474P	SLIRP_ENST00000557623.1_Intron|SNW1_ENST00000554775.1_Silent_p.P312P|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000555761.1_Missense_Mutation_p.P501L	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	474					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)	p.P474P(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ACTCCTTGTCGGGAACAAATC	0.428																																					p.P474P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1422T	14						.						129.0	138.0	135.0					14																	78184620		2203	4300	6503	77254373	SO:0001819	synonymous_variant	22938	exon14			AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.1422C>T	14.37:g.78184620G>A		Somatic		Capture	Illumina HiSeq	Phase_I	77254373	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Silent	SNP	ENST00000261531.7	37	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064534	0.36470	.	.	ENSG00000100603	ENST00000555761	.	.	.	5.37	-1.05	0.10036	.	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	.	.	.	0.35139	D	0.768661	B	0.02656	0.0	B	0.01281	0.0	T	0.05131	-1.0904	7	.	.	.	.	1.1842	0.01851	0.3543:0.258:0.2584:0.1292	.	501	G3V3A4	.	L	501	.	.	P	-	2	0	SNW1	77254373	0.000000	0.05858	0.996000	0.52242	0.991000	0.79684	-1.771000	0.01789	-0.136000	0.11475	0.460000	0.39030	CCG		0.428	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
CCDC88C	440193	broad.mit.edu	37	14	91780018	91780018	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr14:91780018C>T	ENST00000389857.6	-	15	2228	c.2142G>A	c.(2140-2142)gaG>gaA	p.E714E		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	714					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.E714E(2)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				AGCGCATGGTCTCCACCAGCC	0.602																																					p.E714E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2142A	14						.						55.0	57.0	56.0					14																	91780018		2159	4269	6428	90849771	SO:0001819	synonymous_variant	440193	exon15				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2142G>A	14.37:g.91780018C>T		Somatic		Capture	Illumina HiSeq	Phase_I	90849771	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1																																																																																				0.602	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
SERPINA10	51156	broad.mit.edu	37	14	94756516	94756516	+	Missense_Mutation	SNP	C	C	T	rs56137907	byFrequency	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr14:94756516C>T	ENST00000393096.1	-	2	880	c.415G>A	c.(415-417)Ggg>Agg	p.G139R	SERPINA10_ENST00000261994.4_Missense_Mutation_p.G139R|SERPINA10_ENST00000554173.1_Missense_Mutation_p.G139R|SERPINA10_ENST00000554723.1_Missense_Mutation_p.G179R	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	139	Heparin-binding.		G -> R (in dbSNP:rs56137907). {ECO:0000269|Ref.4}.		blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G139R(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GGCAGGAGCCCGGGCTTGGTG	0.597													C|||	11	0.00219649	0.0083	0.0	5008	,	,		16283	0.0		0.0	False		,,,				2504	0.0				p.G139R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G415A	14						.	C	ARG/GLY,ARG/GLY	25,4381	30.8+/-60.4	0,25,2178	47.0	53.0	51.0		415,415	-6.1	0.0	14	dbSNP_129	51	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	SERPINA10	NM_001100607.1,NM_016186.2	125,125	0,26,6477	TT,TC,CC		0.0116,0.5674,0.1999	benign,benign	139/445,139/445	94756516	26,12980	2203	4300	6503	93826269	SO:0001583	missense	51156	exon2			AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.415G>A	14.37:g.94756516C>T	ENSP00000376809:p.Gly139Arg	Somatic		Capture	Illumina HiSeq	Phase_I	93826269	NM_016186	A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	ENST00000393096.1	37	CCDS9923.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	C	0.463	-0.887997	0.02511	0.005674	1.16E-4	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	4.63	-6.09	0.02145	Serpin domain (3);	5.218930	0.00465	N	0.000119	T	0.56016	0.1957	N	0.20807	0.61	0.09310	N	1	B	0.29115	0.233	B	0.13407	0.009	T	0.51631	-0.8681	10	0.27082	T	0.32	.	2.7347	0.05237	0.1286:0.3074:0.3308:0.2333	rs56137907	139	Q9UK55	ZPI_HUMAN	R	179;139;139;139	ENSP00000450896:G179R;ENSP00000376809:G139R;ENSP00000261994:G139R;ENSP00000450971:G139R	ENSP00000261994:G139R	G	-	1	0	SERPINA10	93826269	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-0.424000	0.07025	-0.835000	0.04234	0.313000	0.20887	GGG		0.597	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186	
TECPR2	9895	broad.mit.edu	37	14	102904391	102904391	+	Silent	SNP	C	C	A	rs200127253		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr14:102904391C>A	ENST00000359520.7	+	10	2653	c.2427C>A	c.(2425-2427)ccC>ccA	p.P809P	TECPR2_ENST00000558678.1_Silent_p.P809P	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	809					autophagy (GO:0006914)|cell death (GO:0008219)			p.P809P(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						ACTCGGGTCCCGGCTATGGCA	0.577											OREG0022547	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P809P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2427A	14						.						150.0	158.0	155.0					14																	102904391		2203	4300	6503	101974144	SO:0001819	synonymous_variant	9895	exon10			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.2427C>A	14.37:g.102904391C>A		Somatic	1370	Capture	Illumina HiSeq	Phase_I	101974144	NM_014844	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Silent	SNP	ENST00000359520.7	37	CCDS32162.1																																																																																				0.577	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
ATP10A	57194	broad.mit.edu	37	15	25924863	25924863	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr15:25924863C>T	ENST00000356865.6	-	21	4236	c.4125G>A	c.(4123-4125)atG>atA	p.M1375I		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1375					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.M1375I(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CTGGCATGCTCATGTCCACTG	0.672																																					p.M1375I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4125A	15						.						52.0	49.0	50.0					15																	25924863		2203	4300	6503	23475956	SO:0001583	missense	57194	exon21			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4125G>A	15.37:g.25924863C>T	ENSP00000349325:p.Met1375Ile	Somatic		Capture	Illumina HiSeq	Phase_I	23475956	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	7.513	0.655127	0.14580	.	.	ENSG00000206190	ENST00000356865	T	0.09445	2.98	5.12	-2.62	0.06152	.	2.236990	0.01555	N	0.019861	T	0.07908	0.0198	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	10	0.37606	T	0.19	-1.1831	6.0512	0.19787	0.0:0.2305:0.4026:0.3669	.	1375	O60312	AT10A_HUMAN	I	1375	ENSP00000349325:M1375I	ENSP00000349325:M1375I	M	-	3	0	ATP10A	23475956	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.515000	0.06290	-0.702000	0.05056	-0.910000	0.02820	ATG		0.672	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
AQR	9716	broad.mit.edu	37	15	35219301	35219301	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr15:35219301A>T	ENST00000156471.5	-	13	1278	c.1053T>A	c.(1051-1053)ttT>ttA	p.F351L		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	351					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.F351L(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TTGAGAGGGCAAAATCATAGA	0.313																																					p.F351L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1053A	15						.						56.0	52.0	53.0					15																	35219301		1809	4069	5878	33006593	SO:0001583	missense	9716	exon13			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1053T>A	15.37:g.35219301A>T	ENSP00000156471:p.Phe351Leu	Somatic		Capture	Illumina HiSeq	Phase_I	33006593	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.051655	0.75960	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.91894	-2.93	5.93	1.11	0.20524	.	0.000000	0.85682	D	0.000000	T	0.81983	0.4938	L	0.31371	0.925	0.51012	D	0.999901	B	0.32893	0.389	B	0.31442	0.13	T	0.73733	-0.3890	10	0.02654	T	1	-20.1107	9.4867	0.38933	0.7356:0.0:0.2644:0.0	.	351	O60306	AQR_HUMAN	L	351	ENSP00000156471:F351L	ENSP00000156471:F351L	F	-	3	2	AQR	33006593	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.422000	0.44696	0.149000	0.19098	0.533000	0.62120	TTT		0.313	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
MAPKBP1	23005	broad.mit.edu	37	15	42111074	42111074	+	Missense_Mutation	SNP	G	G	A	rs534654016		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr15:42111074G>A	ENST00000456763.2	+	21	2424	c.2228G>A	c.(2227-2229)cGt>cAt	p.R743H	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.R737H|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.R620H|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.R576H|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.R737H	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	743								p.R737H(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		ATGAGGCAGCGTCTGGCCGAG	0.602																																					p.R737H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2210A	15						.						63.0	55.0	58.0					15																	42111074		2203	4300	6503	39898366	SO:0001583	missense	23005	exon20			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.2228G>A	15.37:g.42111074G>A	ENSP00000393099:p.Arg743His	Somatic		Capture	Illumina HiSeq	Phase_I	39898366	NM_014994	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	g	23.5	4.426476	0.83667	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.51574	0.9;1.01;0.7;0.95;1.06	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.58892	0.2154	L	0.34521	1.04	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.812;1.0;1.0;1.0	D;B;D;D;D	0.91635	0.999;0.388;0.996;0.998;0.999	T	0.49551	-0.8928	10	0.20046	T	0.44	-12.2992	19.3625	0.94446	0.0:0.0:1.0:0.0	.	576;620;737;743;737	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	H	737;620;576;743;737	ENSP00000397570:R737H;ENSP00000221214:R620H;ENSP00000260357:R576H;ENSP00000393099:R743H;ENSP00000426154:R737H	ENSP00000221214:R620H	R	+	2	0	MAPKBP1	39898366	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.577000	0.98196	2.673000	0.90976	0.556000	0.70494	CGT		0.602	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
DUOX2	50506	broad.mit.edu	37	15	45392269	45392269	+	Missense_Mutation	SNP	C	C	T	rs367803824		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr15:45392269C>T	ENST00000603300.1	-	24	3365	c.3163G>A	c.(3163-3165)Gtg>Atg	p.V1055M	DUOX2_ENST00000389039.6_Missense_Mutation_p.V1055M	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1055	Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)	p.V1055M(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TCTGCAAACACGCCAACACAG	0.557																																					p.V1055M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3163A	15						.						149.0	124.0	133.0					15																	45392269		2198	4298	6496	43179561	SO:0001583	missense	50506	exon24			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3163G>A	15.37:g.45392269C>T	ENSP00000475084:p.Val1055Met	Somatic		Capture	Illumina HiSeq	Phase_I	43179561	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.628889	0.28978	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.45	3.58	0.41010	.	0.154514	0.43919	D	0.000514	T	0.19846	0.0477	N	0.08118	0	0.26452	N	0.975597	B	0.31256	0.316	B	0.34824	0.19	T	0.14811	-1.0459	9	0.87932	D	0	-9.4474	7.4873	0.27441	0.1462:0.2628:0.591:0.0	.	1055	Q9NRD8	DUOX2_HUMAN	M	1055	.	ENSP00000373691:V1055M	V	-	1	0	DUOX2	43179561	0.996000	0.38824	1.000000	0.80357	0.352000	0.29268	1.947000	0.40293	0.690000	0.31570	-1.193000	0.01689	GTG		0.557	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
RBBP6	5930	broad.mit.edu	37	16	24583666	24583666	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr16:24583666G>A	ENST00000319715.4	+	18	5711	c.5279G>A	c.(5278-5280)aGc>aAc	p.S1760N	RBBP6_ENST00000381039.3_Missense_Mutation_p.S920N|RBBP6_ENST00000348022.2_Missense_Mutation_p.S1726N	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1760					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1760N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		ttggaaaaaagccaaaaacac	0.328																																					p.S1726N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5177A	16						.						30.0	28.0	29.0					16																	24583666		2099	4149	6248	24491167	SO:0001583	missense	5930	exon17				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.5279G>A	16.37:g.24583666G>A	ENSP00000317872:p.Ser1760Asn	Somatic		Capture	Illumina HiSeq	Phase_I	24491167	NM_018703	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187023	0.38609	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.23754	1.89;2.2;2.18	5.91	5.91	0.95273	.	0.075745	0.56097	D	0.000027	T	0.21145	0.0509	N	0.19112	0.55	0.31351	N	0.682517	B;B;B	0.30361	0.277;0.277;0.181	B;B;B	0.29942	0.109;0.109;0.051	T	0.05533	-1.0879	10	0.32370	T	0.25	-6.8151	20.2963	0.98556	0.0:0.0:1.0:0.0	.	920;1726;1760	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	N	920;1760;1726	ENSP00000370427:S920N;ENSP00000317872:S1760N;ENSP00000316291:S1726N	ENSP00000317872:S1760N	S	+	2	0	RBBP6	24491167	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.033000	0.88852	2.813000	0.96785	0.655000	0.94253	AGC		0.328	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
DCTPP1	79077	broad.mit.edu	37	16	30440430	30440430	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr16:30440430G>A	ENST00000319285.4	-	2	254	c.160C>T	c.(160-162)Cgg>Tgg	p.R54W	DCTPP1_ENST00000567983.1_Intron|ZNF771_ENST00000566625.1_3'UTR|DCTPP1_ENST00000568973.1_5'UTR|DCTPP1_ENST00000565758.1_5'UTR|DCTPP1_ENST00000568434.1_5'UTR	NM_024096.1	NP_077001.1	Q9H773	DCTP1_HUMAN	dCTP pyrophosphatase 1	54					nucleoside triphosphate catabolic process (GO:0009143)|protein homotetramerization (GO:0051289)	cytosol (GO:0005829)	dCTP diphosphatase activity (GO:0047840)|magnesium ion binding (GO:0000287)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|pyrimidine deoxyribonucleotide binding (GO:0032556)	p.R54W(1)		kidney(1)|large_intestine(3)|upper_aerodigestive_tract(1)	5						AGGAGATTCCGAGGCTGATGG	0.557																																					p.R54W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C160T	16						.						113.0	102.0	106.0					16																	30440430		2197	4300	6497	30347931	SO:0001583	missense	79077	exon2			BC001344	CCDS10680.1	16p11.2	2009-02-11			ENSG00000179958	ENSG00000179958	3.6.1.12		28777	protein-coding gene	gene with protein product	"""XTP3-transactivated protein A"""	615840				15740738	Standard	NM_024096		Approved	MGC5627, RS21C6, CDA03, XTP3TPA	uc002dyf.3	Q9H773	OTTHUMG00000132416	ENST00000319285.4:c.160C>T	16.37:g.30440430G>A	ENSP00000322524:p.Arg54Trp	Somatic		Capture	Illumina HiSeq	Phase_I	30347931	NM_024096		Missense_Mutation	SNP	ENST00000319285.4	37	CCDS10680.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743359	0.89663	.	.	ENSG00000179958	ENST00000319285	.	.	.	5.81	3.84	0.44239	NTP pyrophosphohydrolase MazG, putative catalytic core (1);	0.057448	0.64402	N	0.000002	T	0.79364	0.4433	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79745	-0.1674	9	0.87932	D	0	-7.5674	7.9879	0.30222	0.0737:0.0:0.6425:0.2838	.	54	Q9H773	DCTP1_HUMAN	W	54	.	ENSP00000322524:R54W	R	-	1	2	DCTPP1	30347931	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.887000	0.63156	0.795000	0.33922	0.650000	0.86243	CGG		0.557	DCTPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255553.2	NM_024096	
TUSC5	286753	broad.mit.edu	37	17	1198906	1198906	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr17:1198906T>A	ENST00000333813.3	+	2	848	c.509T>A	c.(508-510)gTc>gAc	p.V170D		NM_172367.2	NP_758955.2	Q8IXB3	TUSC5_HUMAN	tumor suppressor candidate 5	170					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|prostate(4)|skin(2)	15				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCCGTGACCGTCAACTTCACA	0.627																																					p.V170D												.	.	0			c.T509A	17						.						83.0	93.0	90.0					17																	1198906		2144	4239	6383	1145656	SO:0001583	missense	286753	exon2			AB090231	CCDS42225.1	17p13.3	2009-10-16			ENSG00000184811	ENSG00000184811			29592	protein-coding gene	gene with protein product	"""located at seventeen p thirteen point three 1"", ""interferon induced transmembrane protein domain containing 3"""	612211				12660825	Standard	NM_172367		Approved	LOST1, IFITMD3	uc002fsi.1	Q8IXB3	OTTHUMG00000132196	ENST00000333813.3:c.509T>A	17.37:g.1198906T>A	ENSP00000329548:p.Val170Asp	None		Capture	Illumina HiSeq	Phase_I	1145656	NM_172367	A6NMK4	Missense_Mutation	SNP	ENST00000333813.3	37	CCDS42225.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.926180	0.52759	.	.	ENSG00000184811	ENST00000333813	T	0.76709	-1.04	5.56	5.56	0.83823	.	0.199564	0.32028	U	0.006700	D	0.82903	0.5138	M	0.72894	2.215	0.30676	N	0.75287	D	0.61080	0.989	P	0.53450	0.726	D	0.84646	0.0698	10	0.87932	D	0	-39.5516	13.0902	0.59162	0.0:0.0:0.0:1.0	.	170	Q8IXB3	TUSC5_HUMAN	D	170	ENSP00000329548:V170D	ENSP00000329548:V170D	V	+	2	0	TUSC5	1145656	0.995000	0.38212	0.867000	0.34043	0.616000	0.37450	4.083000	0.57643	2.124000	0.65301	0.496000	0.49642	GTC		0.627	TUSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255249.1	NM_172367	
CPD	1362	broad.mit.edu	37	17	28791682	28791682	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr17:28791682G>A	ENST00000225719.4	+	21	4069	c.3993G>A	c.(3991-3993)aaG>aaA	p.K1331K	CPD_ENST00000543464.2_Silent_p.K1084K	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	1331						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)	p.K1331K(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						ATAGACACAAGGATGGCTTTC	0.448																																					p.K1084K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3252A	17						.						194.0	175.0	182.0					17																	28791682		2203	4300	6503	25815808	SO:0001819	synonymous_variant	1362	exon21			U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.3993G>A	17.37:g.28791682G>A		Somatic		Capture	Illumina HiSeq	Phase_I	25815808	NM_001199775	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	37	CCDS11257.1																																																																																				0.448	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
SLFN5	162394	broad.mit.edu	37	17	33586311	33586311	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr17:33586311C>T	ENST00000299977.4	+	2	750	c.602C>T	c.(601-603)tCg>tTg	p.S201L	SLFN5_ENST00000542451.1_Missense_Mutation_p.S201L|SLFN5_ENST00000592325.1_Missense_Mutation_p.S201L	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	201					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.S201L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		GTAATGTTCTCGACAGACGTG	0.398																																					p.S201L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C602T	17						.						171.0	161.0	164.0					17																	33586311		2203	4300	6503	30610424	SO:0001583	missense	162394	exon2			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.602C>T	17.37:g.33586311C>T	ENSP00000299977:p.Ser201Leu	Somatic		Capture	Illumina HiSeq	Phase_I	30610424	NM_144975	Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	ENST00000299977.4	37	CCDS32619.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723550	0.48728	.	.	ENSG00000166750	ENST00000299977;ENST00000542451	T;T	0.27720	1.65;1.65	3.55	2.57	0.30868	.	0.750787	0.10420	N	0.676835	T	0.19327	0.0464	N	0.20986	0.625	0.09310	N	1	P;B;P	0.41345	0.695;0.256;0.746	B;B;B	0.36766	0.055;0.04;0.232	T	0.11131	-1.0600	10	0.72032	D	0.01	.	7.124	0.25461	0.0:0.8723:0.0:0.1277	.	201;201;201	B4E128;Q08AF3;Q08AF3-2	.;SLFN5_HUMAN;.	L	201	ENSP00000299977:S201L;ENSP00000440537:S201L	ENSP00000299977:S201L	S	+	2	0	SLFN5	30610424	0.000000	0.05858	0.019000	0.16419	0.019000	0.09904	0.919000	0.28692	0.811000	0.34303	0.563000	0.77884	TCG		0.398	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2	NM_144975	
MEOX1	4222	broad.mit.edu	37	17	41738541	41738541	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr17:41738541A>G	ENST00000318579.4	-	1	781	c.362T>C	c.(361-363)cTg>cCg	p.L121P	MEOX1_ENST00000393661.2_Missense_Mutation_p.L6P|MEOX1_ENST00000329168.3_Missense_Mutation_p.L121P|MEOX1_ENST00000549132.1_Missense_Mutation_p.W92R	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	121					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.L121P(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		CACCAGGCCCAGGCTGCTGGT	0.632																																					p.L121P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T362C	17						.						68.0	79.0	75.0					17																	41738541		2203	4300	6503	39094067	SO:0001583	missense	4222	exon1				CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.362T>C	17.37:g.41738541A>G	ENSP00000321684:p.Leu121Pro	Somatic		Capture	Illumina HiSeq	Phase_I	39094067	NM_004527	A8K524|A8MWF9|Q15069	Missense_Mutation	SNP	ENST00000318579.4	37	CCDS11466.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.001|7.001	0.554946|0.554946	0.13436|0.13436	.|.	.|.	ENSG00000005102|ENSG00000005102	ENST00000318579;ENST00000329168;ENST00000393661|ENST00000549132	D;T;D|.	0.91686|.	-2.89;1.05;-2.81|.	4.68|4.68	3.71|3.71	0.42584|0.42584	.|.	0.176243|.	0.50627|.	N|.	0.000101|.	T|T	0.12050|0.12050	0.0293|0.0293	N|N	0.00182|0.00182	-1.905|-1.905	0.40234|0.40234	D|D	0.97788|0.97788	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.12091|0.12091	-1.0561|-1.0561	10|6	0.27785|0.87932	T|D	0.31|0	-19.7959|-19.7959	7.3741|7.3741	0.26818|0.26818	0.0926:0.1687:0.7387:0.0|0.0926:0.1687:0.7387:0.0	.|.	121;121|.	Q15069;P50221|.	.;MEOX1_HUMAN|.	P|R	121;121;6|92	ENSP00000321684:L121P;ENSP00000328678:L121P;ENSP00000377271:L6P|.	ENSP00000321684:L121P|ENSP00000449049:W92R	L|W	-|-	2|1	0|0	MEOX1|MEOX1	39094067|39094067	0.993000|0.993000	0.37304|0.37304	0.967000|0.967000	0.41034|0.41034	0.943000|0.943000	0.58893|0.58893	2.229000|2.229000	0.42990|0.42990	1.173000|1.173000	0.42796|0.42796	-0.242000|-0.242000	0.12053|0.12053	CTG|TGG		0.632	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409452.1		
DNAH2	146754	broad.mit.edu	37	17	7669696	7669696	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr17:7669696C>G	ENST00000572933.1	+	22	5032	c.3572C>G	c.(3571-3573)gCc>gGc	p.A1191G	DNAH2_ENST00000389173.2_Missense_Mutation_p.A1191G			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1191	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A1191G(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAAGTGCGGGCCATGCTGATG	0.552																																					p.A1191G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3572G	17						.						117.0	95.0	103.0					17																	7669696		2203	4300	6503	7610421	SO:0001583	missense	146754	exon21			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.3572C>G	17.37:g.7669696C>G	ENSP00000458355:p.Ala1191Gly	Somatic		Capture	Illumina HiSeq	Phase_I	7610421	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518253	0.27211	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.23147	1.92	5.71	3.59	0.41128	.	0.454010	0.23149	N	0.051370	T	0.15046	0.0363	N	0.22421	0.69	0.40716	D	0.982611	B	0.06786	0.001	B	0.08055	0.003	T	0.08330	-1.0727	10	0.22706	T	0.39	.	8.3618	0.32363	0.2623:0.5905:0.1472:0.0	.	1191	Q9P225	DYH2_HUMAN	G	1191	ENSP00000373825:A1191G	ENSP00000353818:A1191G	A	+	2	0	DNAH2	7610421	0.884000	0.30299	0.993000	0.49108	0.815000	0.46073	1.197000	0.32211	1.396000	0.46663	0.561000	0.74099	GCC		0.552	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
ITGB4	3691	broad.mit.edu	37	17	73746878	73746878	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr17:73746878G>A	ENST00000200181.3	+	29	3779	c.3592G>A	c.(3592-3594)Gcc>Acc	p.A1198T	ITGB4_ENST00000339591.3_Missense_Mutation_p.A1198T|ITGB4_ENST00000579662.1_Missense_Mutation_p.A1198T|ITGB4_ENST00000450894.3_Missense_Mutation_p.A1198T|ITGB4_ENST00000449880.2_Missense_Mutation_p.A1198T	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1198	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)	p.A1198T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAAGGTGTGCGCCTACGGGGC	0.627																																					p.A1198T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3592A	17						.						97.0	101.0	100.0					17																	73746878		2203	4300	6503	71258473	SO:0001583	missense	3691	exon29				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.3592G>A	17.37:g.73746878G>A	ENSP00000200181:p.Ala1198Thr	Somatic		Capture	Illumina HiSeq	Phase_I	71258473	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.973846	0.53720	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.67523	-0.27;-0.27;-0.27	5.34	5.34	0.76211	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.202636	0.41500	D	0.000872	D	0.87196	0.6117	H	0.94734	3.575	0.51767	D	0.999936	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.74348	0.96;0.944;0.983	D	0.90595	0.4540	10	0.72032	D	0.01	.	19.0364	0.92980	0.0:0.0:1.0:0.0	.	1198;1198;1198	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	T	1198	ENSP00000200181:A1198T;ENSP00000344079:A1198T;ENSP00000400217:A1198T	ENSP00000200181:A1198T	A	+	1	0	ITGB4	71258473	1.000000	0.71417	0.987000	0.45799	0.889000	0.51656	5.736000	0.68597	2.504000	0.84457	0.561000	0.74099	GCC		0.627	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
SMAD2	4087	broad.mit.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr18:45368211G>T	ENST00000402690.2	-	11	1785	c.1391C>A	c.(1390-1392)tCa>tAa	p.S464*	SMAD2_ENST00000586040.1_Nonsense_Mutation_p.S434*|SMAD2_ENST00000262160.6_Nonsense_Mutation_p.S464*|SMAD2_ENST00000356825.4_Nonsense_Mutation_p.S434*	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	464	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.S464*(4)|p.R462fs*>4(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						TGACATGCTTGAGCAACGCAC	0.423																																					p.S434X												.	.	5	Substitution - Nonsense(4)|Deletion - Frameshift(1)	large_intestine(4)|kidney(1)	c.C1301A	18						.						162.0	130.0	141.0					18																	45368211		2203	4300	6503	43622209	SO:0001587	stop_gained	4087	exon10			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1391C>A	18.37:g.45368211G>T	ENSP00000384449:p.Ser464*	Somatic		Capture	Illumina HiSeq	Phase_I	43622209	NM_001135937		Nonsense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	G	41	8.784024	0.98952	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	.	.	.	X	464;434;464	.	ENSP00000262160:S464X	S	-	2	0	SMAD2	43622209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.781000	0.99029	2.824000	0.97209	0.655000	0.94253	TCA		0.423	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
LAMA1	284217	broad.mit.edu	37	18	7008592	7008592	+	Silent	SNP	T	T	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr18:7008592T>A	ENST00000389658.3	-	28	4110	c.4017A>T	c.(4015-4017)tcA>tcT	p.S1339S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1339	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.S1339S(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CAACCTCCATTGAAATGTCTG	0.423																																					p.S1339S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A4017T	18						.						117.0	110.0	112.0					18																	7008592		2203	4300	6503	6998592	SO:0001819	synonymous_variant	284217	exon28			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4017A>T	18.37:g.7008592T>A		Somatic		Capture	Illumina HiSeq	Phase_I	6998592	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.423	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ZNF532	55205	broad.mit.edu	37	18	56651515	56651515	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr18:56651515G>A	ENST00000336078.4	+	11	4499	c.3723G>A	c.(3721-3723)ggG>ggA	p.G1241G	ZNF532_ENST00000591083.1_Silent_p.G1241G|ZNF532_ENST00000591230.1_Silent_p.G1241G|ZNF532_ENST00000591808.1_Silent_p.G1241G|ZNF532_ENST00000588956.1_3'UTR|ZNF532_ENST00000589288.1_Silent_p.G1241G	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1241					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1241G(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						ATGGGGCTGGGGAAGATAACC	0.512																																					p.G1241G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3723A	18						.						27.0	30.0	29.0					18																	56651515		2203	4297	6500	54802495	SO:0001819	synonymous_variant	55205	exon11			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3723G>A	18.37:g.56651515G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54802495	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	ENST00000336078.4	37	CCDS11969.1																																																																																				0.512	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
ZNF208	7757	broad.mit.edu	37	19	22155763	22155763	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:22155763T>G	ENST00000397126.4	-	4	2221	c.2073A>C	c.(2071-2073)aaA>aaC	p.K691N	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	691					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K591N(2)|p.K691N(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTTGTAGGGTTTCTCTCCAG	0.383																																					p.K691N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A2073C	19						.																																			21947603	SO:0001583	missense	7757	exon4			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2073A>C	19.37:g.22155763T>G	ENSP00000380315:p.Lys691Asn	Somatic		Capture	Illumina HiSeq	Phase_I	21947603	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	10.16	1.275117	0.23307	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.26067	1.76	2.43	2.43	0.29744	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43344	0.1243	.	.	.	0.27405	N	0.954749	D	0.89917	1.0	D	0.91635	0.999	T	0.18398	-1.0338	8	0.62326	D	0.03	.	5.1152	0.14831	0.0:0.1549:0.0:0.8451	.	591	O43345	ZN208_HUMAN	N	691;591	ENSP00000380315:K691N	ENSP00000380315:K691N	K	-	3	2	ZNF208	21947603	0.005000	0.15991	0.200000	0.23457	0.174000	0.22865	-0.448000	0.06820	0.761000	0.33130	0.232000	0.17820	AAA		0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
TSHZ3	57616	broad.mit.edu	37	19	31769340	31769340	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:31769340C>T	ENST00000240587.4	-	2	1686	c.1359G>A	c.(1357-1359)acG>acA	p.T453T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	453					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T453T(1)|p.T270T(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TGGAGGGGGACGTGAAGGTGG	0.557																																					p.T453T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1359A	19						.						102.0	104.0	104.0					19																	31769340		2203	4300	6503	36461180	SO:0001819	synonymous_variant	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1359G>A	19.37:g.31769340C>T		Somatic		Capture	Illumina HiSeq	Phase_I	36461180	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																				0.557	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
ZNF114	163071	broad.mit.edu	37	19	48789803	48789803	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:48789803G>T	ENST00000595607.1	+	6	1416	c.922G>T	c.(922-924)Gaa>Taa	p.E308*	ZNF114_ENST00000315849.1_Nonsense_Mutation_p.E308*|ZNF114_ENST00000600687.1_Nonsense_Mutation_p.E308*|ZNF114_ENST00000597695.1_Nonsense_Mutation_p.E274*			Q8NC26	ZN114_HUMAN	zinc finger protein 114	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E308*(1)		endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		TAAATGCCCCGAATGTGGGAG	0.438																																					p.E308X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G922T	19						.						74.0	81.0	78.0					19																	48789803		2203	4300	6503	53481615	SO:0001587	stop_gained	163071	exon5			BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.922G>T	19.37:g.48789803G>T	ENSP00000469998:p.Glu308*	Somatic		Capture	Illumina HiSeq	Phase_I	53481615	NM_153608	A8K6B0|Q08AQ6	Nonsense_Mutation	SNP	ENST00000595607.1	37	CCDS12713.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415010	0.62511	.	.	ENSG00000178150	ENST00000315849	.	.	.	2.49	0.218	0.15270	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	4.6991	0.12818	0.1313:0.0:0.6546:0.2141	.	.	.	.	X	308	.	ENSP00000318898:E308X	E	+	1	0	ZNF114	53481615	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	0.118000	0.15605	0.151000	0.19162	0.411000	0.27672	GAA		0.438	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465601.1	NM_153608	
U2AF2	11338	broad.mit.edu	37	19	56172518	56172518	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:56172518G>A	ENST00000308924.4	+	5	489	c.449G>A	c.(448-450)cGc>cAc	p.R150H	U2AF2_ENST00000450554.2_Missense_Mutation_p.R150H|CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000590551.1_5'Flank|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	150	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R150H(1)		biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CAAGCCCGGCGCCTCTACGTG	0.657																																					p.R150H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G449A	19						.						75.0	70.0	72.0					19																	56172518		2203	4300	6503	60864330	SO:0001583	missense	11338	exon5			BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.449G>A	19.37:g.56172518G>A	ENSP00000307863:p.Arg150His	Somatic		Capture	Illumina HiSeq	Phase_I	60864330	NM_007279	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	37	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	g	24.5	4.540042	0.85917	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.15487	2.44;2.42	3.56	3.56	0.40772	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.64402	U	0.000001	T	0.50292	0.1607	M	0.93016	3.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.65500	-0.6153	10	0.87932	D	0	-20.3532	14.4878	0.67629	0.0:0.0:1.0:0.0	.	150;150	P26368;P26368-2	U2AF2_HUMAN;.	H	150	ENSP00000307863:R150H;ENSP00000388475:R150H	ENSP00000307863:R150H	R	+	2	0	U2AF2	60864330	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.777000	0.91781	1.994000	0.58287	0.466000	0.42574	CGC		0.657	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
NLRP4	147945	broad.mit.edu	37	19	56370011	56370011	+	Missense_Mutation	SNP	G	G	A	rs370476091		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:56370011G>A	ENST00000301295.6	+	3	1674	c.1252G>A	c.(1252-1254)Gac>Aac	p.D418N	NLRP4_ENST00000346986.5_Missense_Mutation_p.D418N|NLRP4_ENST00000587891.1_Missense_Mutation_p.D343N	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	418	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.D418N(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTGTGAAGACGACCTCCGGAG	0.582																																					p.D418N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1252A	19						.						106.0	105.0	106.0					19																	56370011		2203	4300	6503	61061823	SO:0001583	missense	147945	exon3			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1252G>A	19.37:g.56370011G>A	ENSP00000301295:p.Asp418Asn	Somatic		Capture	Illumina HiSeq	Phase_I	61061823	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361476	0.24684	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.90900	-2.75;-2.75	4.09	3.05	0.35203	.	.	.	.	.	D	0.93510	0.7929	M	0.66378	2.025	0.09310	N	1	D;D;D	0.76494	0.999;0.994;0.981	D;P;B	0.72338	0.977;0.61;0.383	D	0.85130	0.0974	9	0.54805	T	0.06	.	9.6901	0.40123	0.104:0.0:0.896:0.0	.	418;343;418	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	N	418	ENSP00000301295:D418N;ENSP00000344787:D418N	ENSP00000301295:D418N	D	+	1	0	NLRP4	61061823	0.995000	0.38212	0.001000	0.08648	0.003000	0.03518	5.433000	0.66520	1.063000	0.40649	0.650000	0.86243	GAC		0.582	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
TUBB4A	10382	broad.mit.edu	37	19	6495587	6495587	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:6495587C>G	ENST00000264071.2	-	4	1294	c.923G>C	c.(922-924)gGc>gCc	p.G308A	CTD-2396E7.10_ENST00000596027.1_RNA|CTD-2396E7.9_ENST00000599292.1_RNA|TUBB4A_ENST00000540257.1_Missense_Mutation_p.G308A			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	308					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G308A(1)									CAGGTAGCGGCCGTGGCGCGG	0.662																																					p.G308A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G923C	19						.						69.0	66.0	67.0					19																	6495587		2203	4299	6502	6446587	SO:0001583	missense	10382	exon4			AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.923G>C	19.37:g.6495587C>G	ENSP00000264071:p.Gly308Ala	Somatic		Capture	Illumina HiSeq	Phase_I	6446587	NM_006087	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670344	0.47677	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	D;D	0.86694	-2.16;-2.16	3.71	3.71	0.42584	.	0.000000	0.64402	D	0.000001	D	0.96528	0.8867	H	0.99746	4.745	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.98019	1.0370	10	0.87932	D	0	.	14.2842	0.66235	0.0:1.0:0.0:0.0	.	308	P04350	TBB4A_HUMAN	A	308;308;226	ENSP00000264071:G308A;ENSP00000443590:G308A	ENSP00000264071:G308A	G	-	2	0	TUBB4	6446587	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	7.603000	0.82811	1.639000	0.50556	0.485000	0.47835	GGC		0.662	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
ZNF560	147741	broad.mit.edu	37	19	9578277	9578277	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:9578277C>T	ENST00000301480.4	-	10	1559	c.1346G>A	c.(1345-1347)gGa>gAa	p.G449E		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G449E(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TCTCAAATGTCCAAAAAGAGA	0.398																																					p.G449E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1346A	19						.						132.0	145.0	141.0					19																	9578277		2203	4300	6503	9439277	SO:0001583	missense	147741	exon10			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1346G>A	19.37:g.9578277C>T	ENSP00000301480:p.Gly449Glu	Somatic		Capture	Illumina HiSeq	Phase_I	9439277	NM_152476	Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.800261	0.00611	.	.	ENSG00000198028	ENST00000301480	T	0.34667	1.35	1.77	-3.53	0.04667	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10252	0.0251	N	0.04043	-0.29	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.18935	-1.0321	9	0.02654	T	1	.	0.8679	0.01207	0.4357:0.1391:0.2477:0.1775	.	449	Q96MR9	ZN560_HUMAN	E	449	ENSP00000301480:G449E	ENSP00000301480:G449E	G	-	2	0	ZNF560	9439277	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-10.902000	0.00005	-2.544000	0.00483	-0.373000	0.07131	GGA		0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
ZIK1	284307	broad.mit.edu	37	19	58101721	58101721	+	Missense_Mutation	SNP	G	G	A	rs368879763		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr19:58101721G>A	ENST00000597850.1	+	4	757	c.542G>A	c.(541-543)cGg>cAg	p.R181Q	ZIK1_ENST00000599456.1_Missense_Mutation_p.R126Q|ZIK1_ENST00000307468.4_3'UTR|ZIK1_ENST00000536878.2_Missense_Mutation_p.R168Q	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R181Q(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCCATGTTGCGGCTTCTGAGG	0.493																																					p.R181Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G542A	19						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	67.0	66.0	66.0		542	-2.3	0.0	19		66	0,8600		0,0,4300	no	missense	ZIK1	NM_001010879.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	181/488	58101721	1,13005	2203	4300	6503	62793533	SO:0001583	missense	284307	exon4			AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.542G>A	19.37:g.58101721G>A	ENSP00000472867:p.Arg181Gln	Somatic		Capture	Illumina HiSeq	Phase_I	62793533	NM_001010879	O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.643907	0.29246	2.27E-4	0.0	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.04917	3.53	2.97	-2.26	0.06867	.	.	.	.	.	T	0.02119	0.0066	N	0.03304	-0.355	0.09310	N	1	B;B	0.26602	0.048;0.154	B;B	0.15484	0.013;0.012	T	0.45556	-0.9253	9	0.26408	T	0.33	.	3.4506	0.07496	0.4347:0.2062:0.3591:0.0	.	168;181	F5H435;Q3SY52	.;ZIK1_HUMAN	Q	168;162;181	ENSP00000438487:R168Q	ENSP00000303820:R181Q	R	+	2	0	ZIK1	62793533	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.814000	0.04486	-0.360000	0.08138	-0.378000	0.06908	CGG		0.493	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879	
VCAM1	7412	broad.mit.edu	37	1	101196853	101196853	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:101196853G>A	ENST00000294728.2	+	6	1405	c.1304G>A	c.(1303-1305)cGg>cAg	p.R435Q	VCAM1_ENST00000370115.1_Intron|VCAM1_ENST00000370119.4_Missense_Mutation_p.R373Q|VCAM1_ENST00000347652.2_Missense_Mutation_p.R343Q	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	435	Ig-like C2-type 5.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.R435Q(2)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	CCCCTTGACCGGCTGGAGATT	0.458																																					p.R373Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1118A	1						.						66.0	70.0	69.0					1																	101196853		2203	4300	6503	100969441	SO:0001583	missense	7412	exon6			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1304G>A	1.37:g.101196853G>A	ENSP00000294728:p.Arg435Gln	Somatic		Capture	Illumina HiSeq	Phase_I	100969441	NM_001199834	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	G	7.881	0.730127	0.15507	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728	T;T;T	0.24151	1.87;1.87;1.87	5.52	2.53	0.30540	Immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	0.343065	0.29515	N	0.011922	T	0.06645	0.0170	M	0.68317	2.08	0.22424	N	0.999112	B;P;B	0.37276	0.057;0.589;0.117	B;B;B	0.25987	0.004;0.065;0.005	T	0.35624	-0.9781	10	0.12103	T	0.63	-0.8498	7.2465	0.26125	0.4448:0.0:0.5552:0.0	.	373;343;435	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	Q	373;343;435	ENSP00000359137:R373Q;ENSP00000304611:R343Q;ENSP00000294728:R435Q	ENSP00000294728:R435Q	R	+	2	0	VCAM1	100969441	0.000000	0.05858	0.023000	0.16930	0.274000	0.26718	0.253000	0.18296	0.368000	0.24481	0.563000	0.77884	CGG		0.458	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
KCND3	3752	broad.mit.edu	37	1	112524657	112524657	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:112524657G>A	ENST00000315987.2	-	2	1171	c.692C>T	c.(691-693)aCg>aTg	p.T231M	KCND3_ENST00000369697.1_Missense_Mutation_p.T231M|KCND3_ENST00000302127.4_Missense_Mutation_p.T231M	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	231					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.T231M(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GACGCACGCCGTGTCCAGGCA	0.657																																					p.T231M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C692T	1						.						34.0	35.0	34.0					1																	112524657		2203	4300	6503	112326180	SO:0001583	missense	3752	exon2			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.692C>T	1.37:g.112524657G>A	ENSP00000319591:p.Thr231Met	Somatic		Capture	Illumina HiSeq	Phase_I	112326180	NM_004980	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	CCDS843.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285395	0.80803	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.98400	-4.91;-4.91;-4.91	5.51	5.51	0.81932	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98820	0.9602	M	0.76433	2.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.99895	1.1146	10	0.87932	D	0	.	18.9981	0.92821	0.0:0.0:1.0:0.0	.	231;231	Q14D71;Q9UK17	.;KCND3_HUMAN	M	231	ENSP00000358711:T231M;ENSP00000319591:T231M;ENSP00000306923:T231M	ENSP00000306923:T231M	T	-	2	0	KCND3	112326180	1.000000	0.71417	0.959000	0.39883	0.993000	0.82548	9.869000	0.99810	2.590000	0.87494	0.563000	0.77884	ACG		0.657	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
TRIM45	80263	broad.mit.edu	37	1	117661317	117661317	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:117661317C>T	ENST00000256649.4	-	2	1087	c.561G>A	c.(559-561)aaG>aaA	p.K187K	TRIM45_ENST00000369461.3_Silent_p.K130K|TRIM45_ENST00000369464.3_Silent_p.K187K	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	187					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.K187K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		ACAGGATGGGCTTCCCAATCC	0.552																																					p.K187K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G561A	1						.						91.0	95.0	93.0					1																	117661317		2199	4287	6486	117462840	SO:0001819	synonymous_variant	80263	exon2				CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.561G>A	1.37:g.117661317C>T		Somatic		Capture	Illumina HiSeq	Phase_I	117462840	NM_001145635	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Silent	SNP	ENST00000256649.4	37	CCDS893.1																																																																																				0.552	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033503.1	NM_025188	
TCHH	7062	broad.mit.edu	37	1	152080843	152080843	+	Missense_Mutation	SNP	C	C	T	rs370364413		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:152080843C>T	ENST00000368804.1	-	2	4849	c.4850G>A	c.(4849-4851)cGc>cAc	p.R1617H		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1617	23 X 26 AA approximate tandem repeats.			Missing (in Ref. 1; AAA65582). {ECO:0000305}.	keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.R1617H(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTTCTGTCGCGCTCCTGGCG	0.577																																					p.R1617H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4850A	1						.	C	HIS/ARG	1,3855		0,1,1927	68.0	69.0	69.0		4850	-0.7	0.0	1		69	0,8280		0,0,4140	no	missense	TCHH	NM_007113.2	29	0,1,6067	TT,TC,CC		0.0,0.0259,0.0082	possibly-damaging	1617/1944	152080843	1,12135	1928	4140	6068	150347467	SO:0001583	missense	7062	exon2			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.4850G>A	1.37:g.152080843C>T	ENSP00000357794:p.Arg1617His	Somatic		Capture	Illumina HiSeq	Phase_I	150347467	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	C	10.48	1.363206	0.24684	2.59E-4	0.0	ENSG00000159450	ENST00000368804	T	0.06294	3.32	3.97	-0.673	0.11373	.	.	.	.	.	T	0.01592	0.0051	M	0.73962	2.25	0.09310	N	1	P	0.39624	0.681	B	0.21151	0.033	T	0.43589	-0.9382	9	0.33940	T	0.23	-1.9397	1.8403	0.03148	0.1611:0.4839:0.1575:0.1975	.	1617	Q07283	TRHY_HUMAN	H	1617	ENSP00000357794:R1617H	ENSP00000357794:R1617H	R	-	2	0	TCHH	150347467	0.000000	0.05858	0.015000	0.15790	0.048000	0.14542	-0.643000	0.05421	0.007000	0.14760	0.460000	0.39030	CGC		0.577	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
XPR1	9213	broad.mit.edu	37	1	180832984	180832984	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:180832984C>T	ENST00000367590.4	+	12	1840	c.1642C>T	c.(1642-1644)Cgg>Tgg	p.R548W	XPR1_ENST00000367589.3_Missense_Mutation_p.R483W	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	548	EXS. {ECO:0000255|PROSITE- ProRule:PRU00712}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)	p.R548W(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						CACTTTCCTCCGGGAAGAGAT	0.403																																					p.R483W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1447T	1						.						102.0	102.0	102.0					1																	180832984		2203	4300	6503	179099607	SO:0001583	missense	9213	exon11			AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.1642C>T	1.37:g.180832984C>T	ENSP00000356562:p.Arg548Trp	Somatic		Capture	Illumina HiSeq	Phase_I	179099607	NM_001135669	O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	ENST00000367590.4	37	CCDS1340.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.272762	0.80580	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	T;T	0.67523	-0.27;-0.27	5.49	4.57	0.56435	EXS, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.85141	0.5629	M	0.91612	3.225	0.45822	D	0.998694	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88800	0.3284	10	0.87932	D	0	-10.5268	15.3244	0.74147	0.1412:0.8588:0.0:0.0	.	483;548	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	W	548;483	ENSP00000356562:R548W;ENSP00000356561:R483W	ENSP00000356561:R483W	R	+	1	2	XPR1	179099607	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	3.938000	0.56583	1.303000	0.44873	0.655000	0.94253	CGG		0.403	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2	NM_004736	
RCOR3	55758	broad.mit.edu	37	1	211486259	211486259	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:211486259G>A	ENST00000367005.4	+	10	1240	c.1099G>A	c.(1099-1101)Gct>Act	p.A367T	RCOR3_ENST00000419091.2_Missense_Mutation_p.A425T|RCOR3_ENST00000526255.1_3'UTR|RCOR3_ENST00000452621.2_Missense_Mutation_p.A425T|RCOR3_ENST00000367006.4_Intron	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.A367T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		GACAAAAAGTGCTTCTAATGT	0.438																																					p.A425T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1273A	1						.						140.0	133.0	135.0					1																	211486259		2203	4300	6503	209552882	SO:0001583	missense	55758	exon11			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.1099G>A	1.37:g.211486259G>A	ENSP00000355972:p.Ala367Thr	Somatic		Capture	Illumina HiSeq	Phase_I	209552882	NM_001136223	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	G	8.426	0.847462	0.17034	.	.	ENSG00000117625	ENST00000452621;ENST00000419091;ENST00000367005	T;T;T	0.45276	0.9;1.56;1.56	5.11	5.11	0.69529	.	0.271358	0.40385	N	0.001119	T	0.15219	0.0367	N	0.01874	-0.695	0.26921	N	0.96667	B;B;B	0.13594	0.002;0.0;0.008	B;B;B	0.08055	0.003;0.001;0.003	T	0.15122	-1.0448	10	0.17832	T	0.49	-9.4594	6.9761	0.24677	0.2169:0.0:0.7831:0.0	.	425;367;425	Q9P2K3-3;Q9P2K3;Q9P2K3-4	.;RCOR3_HUMAN;.	T	425;425;367	ENSP00000398558:A425T;ENSP00000413929:A425T;ENSP00000355972:A367T	ENSP00000355972:A367T	A	+	1	0	RCOR3	209552882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.711000	0.54868	2.532000	0.85374	0.650000	0.86243	GCT		0.438	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
GJA9	81025	broad.mit.edu	37	1	39340449	39340449	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:39340449C>A	ENST00000360786.3	-	1	1574	c.1322G>T	c.(1321-1323)gGt>gTt	p.G441V	MYCBP_ENST00000489803.1_5'UTR|RP5-864K19.4_ENST00000443161.1_RNA|MYCBP_ENST00000397572.2_5'Flank|GJA9_ENST00000357771.3_Missense_Mutation_p.G441V|RP5-864K19.4_ENST00000456813.1_RNA|GJA9_ENST00000454994.2_Splice_Site|RP5-864K19.4_ENST00000433671.2_RNA			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	441					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.G441V(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			CTTGAGGTTACCTTTAGGAGG	0.493																																					p.G441V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1322T	1						.						115.0	113.0	113.0					1																	39340449		2203	4300	6503	39113036	SO:0001583	missense	81025	exon2			AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.1322G>T	1.37:g.39340449C>A	ENSP00000354020:p.Gly441Val	Somatic		Capture	Illumina HiSeq	Phase_I	39113036	NM_030772	B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000360786.3	37	CCDS432.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.25|11.25	1.583083|1.583083	0.28268|0.28268	.|.	.|.	ENSG00000131233|ENSG00000131233	ENST00000454994|ENST00000357771;ENST00000360786	.|D;D	.|0.98249	.|-4.82;-4.82	4.18|4.18	2.23|2.23	0.28157|0.28157	.|.	.|671.095000	.|0.00166	.|U	.|0.000004	.|D	.|0.95329	.|0.8484	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	0.999999|0.999999	.|P	.|0.41313	.|0.745	.|B	.|0.38562	.|0.276	.|D	.|0.91309	.|0.5073	.|10	.|0.72032	.|D	.|0.01	.|.	5.1909|5.1909	0.15209|0.15209	0.0:0.4818:0.3288:0.1893|0.0:0.4818:0.3288:0.1893	.|.	.|441	.|P57773	.|CXA9_HUMAN	.|V	-1|441	.|ENSP00000350415:G441V;ENSP00000354020:G441V	.|ENSP00000350415:G441V	.|G	-|-	.|2	.|0	GJA9|GJA9	39113036|39113036	0.000000|0.000000	0.05858|0.05858	0.010000|0.010000	0.14722|0.14722	0.402000|0.402000	0.30811|0.30811	-0.015000|-0.015000	0.12634|0.12634	0.465000|0.465000	0.27167|0.27167	0.655000|0.655000	0.94253|0.94253	.|GGT		0.493	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001205.1	NM_030772	
DPH2	1802	broad.mit.edu	37	1	44438184	44438184	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:44438184C>T	ENST00000255108.3	+	6	1615	c.1443C>T	c.(1441-1443)atC>atT	p.I481I	ATP6V0B_ENST00000471859.2_5'Flank|ATP6V0B_ENST00000532642.1_5'Flank|ATP6V0B_ENST00000472174.2_5'Flank|DPH2_ENST00000412950.2_Silent_p.I346I|DPH2_ENST00000396758.2_Silent_p.I253I|ATP6V0B_ENST00000236067.4_5'Flank	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	481					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)		p.I481I(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				GGATTGCCATCGCCTATGAGG	0.577																																					p.I253I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C759T	1						.						126.0	103.0	111.0					1																	44438184		2203	4300	6503	44210771	SO:0001819	synonymous_variant	1802	exon5			AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.1443C>T	1.37:g.44438184C>T		Somatic		Capture	Illumina HiSeq	Phase_I	44210771	NM_001039589	A8MVC9|B2RDE3|B4DNI8|O60623	Silent	SNP	ENST00000255108.3	37	CCDS504.1																																																																																				0.577	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022832.1	NM_001384	
ZRANB2	9406	broad.mit.edu	37	1	71530818	71530818	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:71530818C>T	ENST00000370920.3	-	10	1233	c.932G>A	c.(931-933)cGc>cAc	p.R311H	ZRANB2_ENST00000477096.1_5'UTR|ZRANB2-AS1_ENST00000450461.1_RNA|ZRANB2-AS1_ENST00000426999.1_RNA|MIR186_ENST00000384988.1_RNA|ZRANB2_ENST00000254821.6_3'UTR	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	311	Required for nuclear targeting.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R311H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						TGACCTGTGGCGTCTGTAAGA	0.353																																					p.R311H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G932A	1						.						74.0	72.0	73.0					1																	71530818		2202	4299	6501	71303406	SO:0001583	missense	9406	exon10			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.932G>A	1.37:g.71530818C>T	ENSP00000359958:p.Arg311His	Somatic		Capture	Illumina HiSeq	Phase_I	71303406	NM_203350	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Missense_Mutation	SNP	ENST00000370920.3	37	CCDS659.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013010	0.35511	.	.	ENSG00000132485	ENST00000370920	T	0.65732	-0.17	5.65	2.06	0.26882	.	.	.	.	.	T	0.24509	0.0594	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06463	-1.0825	9	0.36615	T	0.2	.	7.7413	0.28843	0.0:0.5416:0.0:0.4584	.	311	O95218	ZRAB2_HUMAN	H	311	ENSP00000359958:R311H	ENSP00000359958:R311H	R	-	2	0	ZRANB2	71303406	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	1.187000	0.32090	0.443000	0.26582	0.591000	0.81541	CGC		0.353	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026636.1	NM_203350	
ITPKB	3707	broad.mit.edu	37	1	226827337	226827337	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr1:226827337C>T	ENST00000272117.3	-	5	2473	c.2474G>A	c.(2473-2475)cGg>cAg	p.R825Q	ITPKB_ENST00000429204.1_Missense_Mutation_p.R825Q			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	825					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.R351Q(1)|p.R825Q(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CTTGAAGTCCCGGTTCACGGT	0.562																																					p.R825Q	Colon(84;110 1851 5306 33547)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2474A	1						.						163.0	147.0	152.0					1																	226827337		2203	4300	6503	224893960	SO:0001583	missense	3707	exon6			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2474G>A	1.37:g.226827337C>T	ENSP00000272117:p.Arg825Gln	Somatic		Capture	Illumina HiSeq	Phase_I	224893960	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559096	0.65538	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.17854	2.25;2.25	4.35	4.35	0.52113	.	0.051945	0.64402	D	0.000001	T	0.19127	0.0459	L	0.49513	1.565	0.36530	D	0.870708	P	0.42337	0.776	B	0.38803	0.282	T	0.23226	-1.0194	10	0.49607	T	0.09	-13.3239	16.8853	0.86074	0.0:1.0:0.0:0.0	.	825	P27987	IP3KB_HUMAN	Q	825	ENSP00000272117:R825Q;ENSP00000411152:R825Q	ENSP00000272117:R825Q	R	-	2	0	ITPKB	224893960	0.704000	0.27836	1.000000	0.80357	0.969000	0.65631	1.374000	0.34283	1.993000	0.58246	0.305000	0.20034	CGG		0.562	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
ATRN	8455	broad.mit.edu	37	20	3527935	3527935	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr20:3527935G>T	ENST00000262919.5	+	5	810	c.742G>T	c.(742-744)Gat>Tat	p.D248Y	ATRN_ENST00000446916.2_Missense_Mutation_p.D248Y	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	248	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.D248Y(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						TTACAGTTTTGATATGTGTCC	0.393																																					p.D248Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G742T	20						.						157.0	147.0	150.0					20																	3527935		2203	4300	6503	3475935	SO:0001583	missense	8455	exon5			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.742G>T	20.37:g.3527935G>T	ENSP00000262919:p.Asp248Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	3475935	NM_139322	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	ENST00000262919.5	37	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.406524	0.42715	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.59364	0.27;0.27	4.99	4.99	0.66335	CUB (2);Epidermal growth factor-like, type 3 (1);	0.265381	0.41712	D	0.000824	T	0.65893	0.2735	L	0.52573	1.65	0.40637	D	0.981919	D;D	0.63880	0.966;0.993	P;D	0.63113	0.492;0.911	T	0.68682	-0.5344	10	0.72032	D	0.01	-13.4863	9.857	0.41092	0.1272:0.0:0.8728:0.0	.	248;248	O75882;O75882-2	ATRN_HUMAN;.	Y	248;248;174	ENSP00000262919:D248Y;ENSP00000416587:D248Y	ENSP00000262919:D248Y	D	+	1	0	ATRN	3475935	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	3.309000	0.51903	2.576000	0.86940	0.557000	0.71058	GAT		0.393	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
SLC32A1	140679	broad.mit.edu	37	20	37356167	37356167	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr20:37356167G>A	ENST00000217420.1	+	2	726	c.463G>A	c.(463-465)Gcc>Acc	p.A155T		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	155					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.A155T(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CATCATCTTCGCCGCCGTTGT	0.637																																					p.A155T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463A	20						.						72.0	58.0	63.0					20																	37356167		2203	4300	6503	36789581	SO:0001583	missense	140679	exon2			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.463G>A	20.37:g.37356167G>A	ENSP00000217420:p.Ala155Thr	Somatic		Capture	Illumina HiSeq	Phase_I	36789581	NM_080552	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.868767	0.32977	.	.	ENSG00000101438	ENST00000217420	T	0.02579	4.24	4.58	4.58	0.56647	.	0.053454	0.85682	D	0.000000	T	0.02156	0.0067	N	0.08118	0	0.80722	D	1	B	0.22909	0.077	B	0.20184	0.028	T	0.60505	-0.7250	10	0.38643	T	0.18	-19.6328	14.9054	0.70715	0.0:0.0:1.0:0.0	.	155	Q9H598	VIAAT_HUMAN	T	155	ENSP00000217420:A155T	ENSP00000217420:A155T	A	+	1	0	SLC32A1	36789581	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.631000	0.98424	2.387000	0.81309	0.563000	0.77884	GCC		0.637	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
GRIK1	2897	broad.mit.edu	37	21	31062247	31062247	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr21:31062247G>A	ENST00000399907.1	-	3	756	c.345C>T	c.(343-345)tcC>tcT	p.S115S	GRIK1_ENST00000389125.3_Silent_p.S115S|GRIK1_ENST00000399913.1_Silent_p.S115S|GRIK1_ENST00000389124.2_Silent_p.S115S|GRIK1_ENST00000309434.7_Silent_p.S115S|GRIK1_ENST00000535441.1_Silent_p.S115S|GRIK1_ENST00000327783.4_Silent_p.S115S|GRIK1_ENST00000399909.1_Silent_p.S115S|GRIK1_ENST00000472429.1_5'UTR|GRIK1_ENST00000399914.1_Silent_p.S115S	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	115					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.S115S(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CAGCACTGACGGAGGAGCTAT	0.542																																					p.S115S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C345T	21						.						90.0	83.0	85.0					21																	31062247		2203	4300	6503	29984118	SO:0001819	synonymous_variant	2897	exon3				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.345C>T	21.37:g.31062247G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29984118	NM_175611	Q13001|Q86SU9	Silent	SNP	ENST00000399907.1	37	CCDS42913.1																																																																																				0.542	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
PATZ1	23598	broad.mit.edu	37	22	31740525	31740525	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr22:31740525A>C	ENST00000266269.5	-	1	1693	c.1064T>G	c.(1063-1065)gTg>gGg	p.V355G	PATZ1_ENST00000351933.4_Missense_Mutation_p.V355G|PATZ1_ENST00000405309.3_Missense_Mutation_p.V355G|AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000215919.3_Missense_Mutation_p.V355G	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	355					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						CTCACAAGCCACCTGCTTCCT	0.592																																					p.V355G												.	.	0			c.T1064G	22						.						76.0	75.0	75.0					22																	31740525		2203	4300	6503	30070525	SO:0001583	missense	23598	exon1			AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1064T>G	22.37:g.31740525A>C	ENSP00000266269:p.Val355Gly	None		Capture	Illumina HiSeq	Phase_I	30070525	NM_032051	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	ENST00000266269.5	37	CCDS13894.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.601774	0.66445	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	4.78	4.78	0.61160	Zinc finger, C2H2-like (1);AT hook, DNA-binding motif (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.41236	0.1150	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.89917	0.99;0.981;1.0;0.981	P;D;D;D	0.83275	0.818;0.978;0.996;0.978	T	0.41928	-0.9481	10	0.87932	D	0	-17.7358	13.5015	0.61459	1.0:0.0:0.0:0.0	.	355;355;355;355	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	G	355	ENSP00000266269:V355G;ENSP00000384173:V355G;ENSP00000337520:V355G;ENSP00000215919:V355G	ENSP00000215919:V355G	V	-	2	0	PATZ1	30070525	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.797000	0.69087	1.795000	0.52594	0.459000	0.35465	GTG		0.592	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1	NM_032052	
A4GALT	53947	broad.mit.edu	37	22	43089433	43089433	+	Silent	SNP	G	G	A	rs201965177		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr22:43089433G>A	ENST00000401850.1	-	2	1014	c.525C>T	c.(523-525)tcC>tcT	p.S175S	A4GALT_ENST00000249005.2_Silent_p.S175S|A4GALT_ENST00000381278.3_Silent_p.S175S|A4GALT_ENST00000465765.2_5'Flank			Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	175					globoside biosynthetic process (GO:0001576)|glycosphingolipid biosynthetic process (GO:0006688)|plasma membrane organization (GO:0007009)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	galactosyltransferase activity (GO:0008378)|lactosylceramide 4-alpha-galactosyltransferase activity (GO:0050512)|toxic substance binding (GO:0015643)	p.S175S(1)		NS(1)|central_nervous_system(2)|large_intestine(6)|skin(1)|urinary_tract(1)	11						TGGAGGCGTCGGAGAGCACGG	0.652																																					p.S175S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525T	22						.						53.0	51.0	52.0					22																	43089433		2203	4300	6503	41419377	SO:0001819	synonymous_variant	53947	exon3				CCDS14041.1	22q13.2	2014-07-18	2008-07-31		ENSG00000128274	ENSG00000128274	2.4.1.228		18149	protein-coding gene	gene with protein product	"""Gb3 synthase"", ""CD77 synthase"", ""globotriaosylceramide synthase"", ""lactosylceramide 4-alpha-galactosyltransferase"""	607922	"""alpha 1,4-galactosyltransferase (globotriaosylceramide synthase, P blood group)"""			10854428	Standard	XM_005261643		Approved	A14GALT, Gb3S, P(k)	uc003bdb.3	Q9NPC4	OTTHUMG00000150744	ENST00000401850.1:c.525C>T	22.37:g.43089433G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41419377	NM_017436	B2R7C4|Q9P1X5	Silent	SNP	ENST00000401850.1	37	CCDS14041.1																																																																																				0.652	A4GALT-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319917.1	NM_017436	
LRP1B	53353	broad.mit.edu	37	2	140990838	140990838	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr2:140990838G>A	ENST00000389484.3	-	91	14688	c.13717C>T	c.(13717-13719)Cga>Tga	p.R4573*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4573					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R4573*(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAGGAGTTTCGACAGTTTTGC	0.323										TSP Lung(27;0.18)																											p.R4573X	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C13717T	2						.						96.0	95.0	96.0					2																	140990838		2202	4300	6502	140707308	SO:0001587	stop_gained	53353	exon91			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13717C>T	2.37:g.140990838G>A	ENSP00000374135:p.Arg4573*	Somatic		Capture	Illumina HiSeq	Phase_I	140707308	NM_018557	Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	57	29.533317	0.99975	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.69	5.69	0.88448	.	0.000000	0.56097	U	0.000028	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8102	0.96543	0.0:0.0:1.0:0.0	.	.	.	.	X	4573;4511	.	ENSP00000374135:R4573X	R	-	1	2	LRP1B	140707308	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.336000	0.65935	2.682000	0.91365	0.585000	0.79938	CGA		0.323	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
PXDN	7837	broad.mit.edu	37	2	1684064	1684064	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr2:1684064C>T	ENST00000252804.4	-	7	681	c.631G>A	c.(631-633)Gcg>Acg	p.A211T		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	211	LRRCT.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.A211T(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCCGACTCCGCGTAGGTTTTC	0.582																																					p.A211T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G631A	2						.						78.0	82.0	81.0					2																	1684064		2187	4284	6471	1663071	SO:0001583	missense	7837	exon7			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.631G>A	2.37:g.1684064C>T	ENSP00000252804:p.Ala211Thr	Somatic		Capture	Illumina HiSeq	Phase_I	1663071	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	16.08|16.08	3.021880|3.021880	0.54576|0.54576	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000252804;ENST00000425171|ENST00000447941	T;D|.	0.89939|.	0.65;-2.59|.	4.64|4.64	4.64|4.64	0.57946|0.57946	Cysteine-rich flanking region, C-terminal (1);|.	0.232058|.	0.35040|.	N|.	0.003484|.	T|T	0.63943|0.63943	0.2554|0.2554	L|L	0.60455|0.60455	1.87|1.87	0.35126|0.35126	D|D	0.767469|0.767469	B;P|.	0.36010|.	0.429;0.532|.	B;B|.	0.32533|.	0.147;0.098|.	T|T	0.71879|0.71879	-0.4459|-0.4459	10|5	0.51188|.	T|.	0.08|.	-43.4879|-43.4879	12.6666|12.6666	0.56846|0.56846	0.1652:0.8348:0.0:0.0|0.1652:0.8348:0.0:0.0	.|.	211;211|.	Q92626-2;Q92626|.	.;PXDN_HUMAN|.	T|H	211;187|134	ENSP00000252804:A211T;ENSP00000398363:A187T|.	ENSP00000252804:A211T|.	A|R	-|-	1|2	0|0	PXDN|PXDN	1663071|1663071	1.000000|1.000000	0.71417|0.71417	0.150000|0.150000	0.22450|0.22450	0.033000|0.033000	0.12548|0.12548	4.624000|4.624000	0.61254|0.61254	2.139000|2.139000	0.66308|0.66308	0.444000|0.444000	0.29173|0.29173	GCG|CGC		0.582	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
LRP1B	53353	broad.mit.edu	37	2	141115596	141115596	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr2:141115596G>A	ENST00000389484.3	-	74	12318	c.11347C>T	c.(11347-11349)Cga>Tga	p.R3783*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3783	LDL-receptor class A 32. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R3783*(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCATCAAGTCGATCACACTGG	0.413										TSP Lung(27;0.18)																											p.R3783X	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C11347T	2						.						162.0	149.0	154.0					2																	141115596		2203	4299	6502	140832066	SO:0001587	stop_gained	53353	exon74			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11347C>T	2.37:g.141115596G>A	ENSP00000374135:p.Arg3783*	Somatic		Capture	Illumina HiSeq	Phase_I	140832066	NM_018557	Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	57	27.487858	0.99971	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.82	-1.48	0.08745	.	0.695530	0.13003	N	0.421513	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	6.0534	0.19799	0.0613:0.1816:0.2268:0.5302	.	.	.	.	X	3783;3721	.	ENSP00000374135:R3783X	R	-	1	2	LRP1B	140832066	0.959000	0.32827	0.005000	0.12908	0.739000	0.42172	1.617000	0.36943	-0.655000	0.05387	-0.158000	0.13435	CGA		0.413	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ALS2CR11	151254	broad.mit.edu	37	2	202352479	202352479	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr2:202352479C>T	ENST00000286195.3	-	15	1772	c.1728G>A	c.(1726-1728)ccG>ccA	p.P576P	ALS2CR11_ENST00000439802.1_3'UTR|ALS2CR11_ENST00000482942.1_5'Flank|ALS2CR11_ENST00000439140.1_Silent_p.P1773P	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	576								p.P576P(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TGTTAACCTCCGGAGCAGTAT	0.378																																					p.P576P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1728A	2						.						345.0	331.0	336.0					2																	202352479		2203	4300	6503	202060724	SO:0001819	synonymous_variant	151254	exon15			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1728G>A	2.37:g.202352479C>T		Somatic		Capture	Illumina HiSeq	Phase_I	202060724	NM_152525	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Silent	SNP	ENST00000286195.3	37	CCDS2349.1																																																																																				0.378	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525	
ASXL2	55252	broad.mit.edu	37	2	25976476	25976476	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr2:25976476G>A	ENST00000435504.4	-	11	1362	c.1069C>T	c.(1069-1071)Cga>Tga	p.R357*	ASXL2_ENST00000336112.4_Nonsense_Mutation_p.R329*|ASXL2_ENST00000404843.1_Nonsense_Mutation_p.R97*|ASXL2_ENST00000272341.4_Nonsense_Mutation_p.R97*			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	357					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.R97*(1)|p.R357*(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCTCTTGTCGAATTCTCACC	0.358																																					p.R357X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1069T	2						.						203.0	194.0	197.0					2																	25976476		1828	4095	5923	25829980	SO:0001587	stop_gained	55252	exon10					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1069C>T	2.37:g.25976476G>A	ENSP00000391447:p.Arg357*	Somatic		Capture	Illumina HiSeq	Phase_I	25829980	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Nonsense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	G	46	12.202324	0.99646	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	.	.	.	5.72	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6413	14.8828	0.70545	0.0:0.0:0.8563:0.1437	.	.	.	.	X	357;329;97;97	.	ENSP00000272341:R97X	R	-	1	2	ASXL2	25829980	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.932000	0.48940	2.714000	0.92807	0.643000	0.83706	CGA		0.358	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
GTF2A1L	11036	broad.mit.edu	37	2	48896984	48896984	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr2:48896984G>A	ENST00000403751.3	+	7	1139	c.1102G>A	c.(1102-1104)Gat>Aat	p.D368N	GTF2A1L_ENST00000430487.2_Missense_Mutation_p.D334N|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.D1072N|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.D1072N|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.D1072N|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.D1025N|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.D1072N|LHCGR_ENST00000420913.3_5'Flank	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	368					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.D1072N(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AAGAGATGCAGATGAGAATGA	0.393																																					p.D368N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1102A	2						.						108.0	113.0	111.0					2																	48896984		2203	4300	6503	48750488	SO:0001583	missense	286749	exon7			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.1102G>A	2.37:g.48896984G>A	ENSP00000384597:p.Asp368Asn	Somatic		Capture	Illumina HiSeq	Phase_I	48750488	NM_006872	B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	ENST00000403751.3	37	CCDS46281.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349122	0.61183	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000430487;ENST00000403751;ENST00000508440	T;T;T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13	5.65	4.77	0.60923	.	0.361717	0.28284	N	0.015901	T	0.65852	0.2731	M	0.70595	2.14	0.80722	D	1	P;B;B;P;P	0.44344	0.525;0.011;0.322;0.833;0.833	B;B;B;P;B	0.49140	0.164;0.008;0.253;0.601;0.332	T	0.70051	-0.4978	10	0.72032	D	0.01	.	13.3046	0.60345	0.0768:0.0:0.9232:0.0	.	334;1025;1072;368;1072	Q9UNN4-2;A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;.;TF2AY_HUMAN;.	N	1072;1072;1072;1072;1025;367;334;368;17	ENSP00000385499:D1072N;ENSP00000385701:D1072N;ENSP00000378236:D1072N;ENSP00000311493:D1072N;ENSP00000378234:D1025N;ENSP00000387896:D334N;ENSP00000384597:D368N;ENSP00000421474:D17N	ENSP00000384597:D368N	D	+	1	0	STON1-GTF2A1L;GTF2A1L	48750488	0.988000	0.35896	0.996000	0.52242	0.302000	0.27658	2.675000	0.46875	1.397000	0.46682	0.561000	0.74099	GAT		0.393	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872	
GIGYF2	26058	broad.mit.edu	37	2	233626112	233626112	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr2:233626112C>T	ENST00000409547.1	+	10	809	c.498C>T	c.(496-498)gaC>gaT	p.D166D	GIGYF2_ENST00000373566.3_Silent_p.D166D|AC064852.4_ENST00000427571.1_RNA|GIGYF2_ENST00000373563.4_Silent_p.D166D|GIGYF2_ENST00000409196.3_Silent_p.D166D|GIGYF2_ENST00000409451.3_Silent_p.D166D|GIGYF2_ENST00000409480.1_Silent_p.D166D	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	166	Arg-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.D166D(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CCAGGGGTGACAGACGTTTTG	0.348																																					p.D166D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C498T	2						.						90.0	86.0	87.0					2																	233626112		2203	4300	6503	233334356	SO:0001819	synonymous_variant	26058	exon7			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.498C>T	2.37:g.233626112C>T		Somatic		Capture	Illumina HiSeq	Phase_I	233334356	NM_001103148	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Silent	SNP	ENST00000409547.1	37	CCDS33401.1																																																																																				0.348	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
C3orf20	84077	broad.mit.edu	37	3	14745941	14745941	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:14745941C>T	ENST00000253697.3	+	7	1428	c.976C>T	c.(976-978)Cgc>Tgc	p.R326C	C3orf20_ENST00000435614.1_Missense_Mutation_p.R204C|C3orf20_ENST00000412910.1_Missense_Mutation_p.R204C|C3orf20_ENST00000495387.1_3'UTR	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	326						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R326C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						AATGTTGGCCCGCAAAGGAGA	0.517																																					p.R204C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C610T	3						.						133.0	143.0	140.0					3																	14745941		2203	4300	6503	14720945	SO:0001583	missense	84077	exon7			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.976C>T	3.37:g.14745941C>T	ENSP00000253697:p.Arg326Cys	Somatic		Capture	Illumina HiSeq	Phase_I	14720945	NM_001184958	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	C	9.024	0.985517	0.18889	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.08634	3.36;3.07;3.07	4.25	-0.711	0.11230	.	2.180750	0.01920	N	0.040451	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	P	0.45044	0.849	B	0.38562	0.276	T	0.11767	-1.0574	10	0.38643	T	0.18	-9.0E-4	0.7003	0.00906	0.1769:0.3703:0.1734:0.2794	.	326	Q8ND61	CC020_HUMAN	C	326;204;204	ENSP00000253697:R326C;ENSP00000402933:R204C;ENSP00000396081:R204C	ENSP00000253697:R326C	R	+	1	0	C3orf20	14720945	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.072000	0.03434	-0.072000	0.12864	-0.302000	0.09304	CGC		0.517	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
CASR	846	broad.mit.edu	37	3	121976187	121976187	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:121976187G>A	ENST00000490131.1	+	3	817	c.445G>A	c.(445-447)Gtc>Atc	p.V149I	CASR_ENST00000498619.1_Missense_Mutation_p.V149I|CASR_ENST00000296154.5_Missense_Mutation_p.V149I	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	149					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.V149I(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TGGCTCAGGCGTCTCCACGGC	0.532																																					p.V149I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G445A	3						.						68.0	66.0	67.0					3																	121976187		2203	4300	6503	123458877	SO:0001583	missense	846	exon3			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.445G>A	3.37:g.121976187G>A	ENSP00000418685:p.Val149Ile	Somatic		Capture	Illumina HiSeq	Phase_I	123458877	NM_000388	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	11.30	1.596881	0.28445	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.84589	-1.87;-1.87;-1.87	5.75	2.45	0.29901	Extracellular ligand-binding receptor (1);	0.160821	0.53938	N	0.000047	T	0.74061	0.3667	L	0.33093	0.98	0.43508	D	0.995766	B;B	0.13594	0.002;0.008	B;B	0.14023	0.003;0.01	T	0.60010	-0.7346	10	0.14656	T	0.56	.	9.6226	0.39730	0.4107:0.0:0.5893:0.0	.	149;149	E7ENE0;P41180	.;CASR_HUMAN	I	149	ENSP00000418685:V149I;ENSP00000420194:V149I;ENSP00000296154:V149I	ENSP00000296154:V149I	V	+	1	0	CASR	123458877	0.983000	0.35010	0.996000	0.52242	0.991000	0.79684	2.226000	0.42963	0.209000	0.20645	0.591000	0.81541	GTC		0.532	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
PLSCR4	57088	broad.mit.edu	37	3	145912209	145912209	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:145912209G>A	ENST00000354952.2	-	9	1219	c.979C>T	c.(979-981)Cgt>Tgt	p.R327C	PLSCR4_ENST00000383083.2_Missense_Mutation_p.R237C|PLSCR4_ENST00000493382.1_Missense_Mutation_p.R327C|PLSCR4_ENST00000433593.2_Missense_Mutation_p.R222C|PLSCR4_ENST00000446574.2_Missense_Mutation_p.R327C	NM_020353.2	NP_065086.2	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4	327					cellular response to lipopolysaccharide (GO:0071222)|phospholipid scrambling (GO:0017121)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|enzyme binding (GO:0019899)|phospholipid scramblase activity (GO:0017128)	p.R327C(1)		kidney(1)|large_intestine(6)|lung(9)|urinary_tract(1)	17						TATCTTGAACGTTGTGGTGGA	0.343																																					p.R327C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C979T	3						.						137.0	137.0	137.0					3																	145912209		2203	4300	6503	147394899	SO:0001583	missense	57088	exon9			AF199023	CCDS3133.1, CCDS54651.1	3q24	2008-07-18			ENSG00000114698	ENSG00000114698			16497	protein-coding gene	gene with protein product		607612				10930526	Standard	NM_020353		Approved		uc003evt.4	Q9NRQ2	OTTHUMG00000159415	ENST00000354952.2:c.979C>T	3.37:g.145912209G>A	ENSP00000347038:p.Arg327Cys	Somatic		Capture	Illumina HiSeq	Phase_I	147394899	NM_020353	A8K2E9|Q2TTR3|Q658L3|Q6ZR73|Q7Z505	Missense_Mutation	SNP	ENST00000354952.2	37	CCDS3133.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839600	0.32513	.	.	ENSG00000114698	ENST00000354952;ENST00000383083;ENST00000433593;ENST00000446574;ENST00000493382	T;T;T;T;T	0.35048	2.0;1.33;1.34;2.0;2.0	4.76	2.75	0.32379	.	1.908320	0.02560	N	0.096617	T	0.36138	0.0956	M	0.67953	2.075	0.09310	N	1	P;D	0.56968	0.83;0.978	B;B	0.34346	0.165;0.18	T	0.48364	-0.9042	10	0.72032	D	0.01	.	9.4067	0.38466	0.0:0.0:0.5851:0.4148	.	237;327	E9PHR9;Q9NRQ2	.;PLS4_HUMAN	C	327;237;222;327;327	ENSP00000347038:R327C;ENSP00000372561:R237C;ENSP00000415605:R222C;ENSP00000399315:R327C;ENSP00000419040:R327C	ENSP00000347038:R327C	R	-	1	0	PLSCR4	147394899	0.062000	0.20869	0.001000	0.08648	0.087000	0.18053	1.753000	0.38359	1.294000	0.44707	0.585000	0.79938	CGT		0.343	PLSCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355172.1	NM_020353	
ZIC4	84107	broad.mit.edu	37	3	147120551	147120551	+	Nonsense_Mutation	SNP	G	G	A	rs201698839		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:147120551G>A	ENST00000383075.3	-	2	546	c.34C>T	c.(34-36)Cga>Tga	p.R12*	ZIC4_ENST00000484399.1_Nonsense_Mutation_p.R12*|ZIC4_ENST00000525172.2_Nonsense_Mutation_p.R62*|ZIC4_ENST00000491672.1_Nonsense_Mutation_p.R12*|ZIC4_ENST00000425731.3_Nonsense_Mutation_p.R50*|ZIC4_ENST00000473123.1_Nonsense_Mutation_p.R12*	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	12						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R12*(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AGCCGTAATCGTTTCCTCATC	0.358																																					p.R62X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C184T	3						.	G	stop/ARG,stop/ARG,stop/ARG	0,3748		0,0,1874	161.0	147.0	151.0		184,148,34	4.1	1.0	3		151	2,8192		0,2,4095	yes	stop-gained,stop-gained,stop-gained	ZIC4	NM_001168378.1,NM_001168379.1,NM_032153.5	,,	0,2,5969	AA,AG,GG		0.0244,0.0,0.0167	,,	62/385,50/373,12/335	147120551	2,11940	1874	4097	5971	148603241	SO:0001587	stop_gained	84107	exon2			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.34C>T	3.37:g.147120551G>A	ENSP00000372553:p.Arg12*	Somatic		Capture	Illumina HiSeq	Phase_I	148603241	NM_001168378	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Nonsense_Mutation	SNP	ENST00000383075.3	37	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	G	35	5.583642	0.96578	0.0	2.44E-4	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672;ENST00000462748;ENST00000484586;ENST00000463250	.	.	.	6.06	4.09	0.47781	.	0.000000	0.36591	N	0.002501	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7516	0.57312	0.0:0.0:0.4131:0.5869	.	.	.	.	X	12;50;62;12;12;12;12;12;12	.	ENSP00000372553:R12X	R	-	1	2	ZIC4	148603241	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	1.399000	0.34566	1.532000	0.49169	0.655000	0.94253	CGA		0.358	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
CP	1356	broad.mit.edu	37	3	148904317	148904317	+	Silent	SNP	A	A	C	rs386134147		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:148904317A>C	ENST00000264613.6	-	11	2329	c.2067T>G	c.(2065-2067)ccT>ccG	p.P689P	CP_ENST00000462336.1_5'UTR	NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	689	F5/8 type A 2.|Plastocyanin-like 4.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.P689P(1)		breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CCTCTGTGTCAGGCCACATGT	0.408																																					p.P689P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2067G	3						.						146.0	133.0	137.0					3																	148904317		2203	4300	6503	150387007	SO:0001819	synonymous_variant	1356	exon11			M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.2067T>G	3.37:g.148904317A>C		Somatic		Capture	Illumina HiSeq	Phase_I	150387007	NM_000096	Q14063|Q2PP18|Q9UKS4	Silent	SNP	ENST00000264613.6	37	CCDS3141.1																																																																																				0.408	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
KCNH8	131096	broad.mit.edu	37	3	19575027	19575027	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:19575027G>A	ENST00000328405.2	+	16	3026	c.2760G>A	c.(2758-2760)gaG>gaA	p.E920E		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	920					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.E920E(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CCTCCAGGGAGAGCTTACAGA	0.512																																					p.E920E	NSCLC(124;1625 1765 8018 24930 42026)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2760A	3						.						100.0	92.0	95.0					3																	19575027		2203	4300	6503	19550031	SO:0001819	synonymous_variant	131096	exon16			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2760G>A	3.37:g.19575027G>A		Somatic		Capture	Illumina HiSeq	Phase_I	19550031	NM_144633	B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	37	CCDS2632.1																																																																																				0.512	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
ACVR2B	93	broad.mit.edu	37	3	38519664	38519664	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:38519664C>T	ENST00000352511.4	+	4	875	c.403C>T	c.(403-405)Ctg>Ttg	p.L135L		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	135					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.L135L(1)		lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		AGCCCCCACCCTGCTCACGGT	0.637																																					p.L135L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C403T	3						.						48.0	48.0	48.0					3																	38519664		2203	4300	6503	38494668	SO:0001819	synonymous_variant	93	exon4			X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.403C>T	3.37:g.38519664C>T		Somatic		Capture	Illumina HiSeq	Phase_I	38494668	NM_001106	Q4VAV0	Silent	SNP	ENST00000352511.4	37	CCDS2679.1																																																																																				0.637	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
SCN5A	6331	broad.mit.edu	37	3	38592125	38592125	+	Missense_Mutation	SNP	C	C	T	rs199473327		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:38592125C>T	ENST00000333535.4	-	28	5887	c.5738G>A	c.(5737-5739)cGc>cAc	p.R1913H	SCN5A_ENST00000443581.1_Missense_Mutation_p.R1912H|SCN5A_ENST00000455624.2_Missense_Mutation_p.R1880H|SCN5A_ENST00000425664.1_Missense_Mutation_p.R1895H|SCN5A_ENST00000413689.1_Missense_Mutation_p.R1913H|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000450102.2_Missense_Mutation_p.R1859H|SCN5A_ENST00000451551.2_Missense_Mutation_p.R1859H|SCN5A_ENST00000449557.2_Missense_Mutation_p.R1859H|SCN5A_ENST00000423572.2_Missense_Mutation_p.R1912H|SCN5A_ENST00000414099.2_Missense_Mutation_p.R1895H			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1913	IQ.				AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.R1913H(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CAGGTGCCTGCGGAAGGCTCT	0.622																																					p.R1895H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5684A	3	GRCh37	CM057206	SCN5A	M		.						121.0	132.0	128.0					3																	38592125		2124	4213	6337	38567129	SO:0001583	missense	6331	exon27			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5738G>A	3.37:g.38592125C>T	ENSP00000328968:p.Arg1913His	Somatic		Capture	Illumina HiSeq	Phase_I	38567129	NM_001099405	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701751	0.88924	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.97791	-4.38;-4.38;-4.38;-4.54;-4.38;-4.38;-4.38;-4.48;-4.54;-4.53	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.99070	0.9681	M	0.93550	3.43	0.54753	D	0.999984	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.991;0.998;0.997;1.0;0.994	D	0.99418	1.0932	10	0.87932	D	0	.	18.1641	0.89719	0.0:1.0:0.0:0.0	.	1859;1880;1895;1913;1912;1913	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	H	1895;1912;1913;1859;1912;1895;1913;1880;1859;1859	ENSP00000398962:R1895H;ENSP00000398266:R1912H;ENSP00000410257:R1913H;ENSP00000388797:R1859H;ENSP00000397915:R1912H;ENSP00000416634:R1895H;ENSP00000328968:R1913H;ENSP00000399524:R1880H;ENSP00000403355:R1859H;ENSP00000413996:R1859H	ENSP00000328968:R1913H	R	-	2	0	SCN5A	38567129	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.651000	0.83577	2.525000	0.85131	0.591000	0.81541	CGC		0.622	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
RBM5	10181	broad.mit.edu	37	3	50131237	50131237	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:50131237G>A	ENST00000347869.3	+	4	443	c.268G>A	c.(268-270)Gac>Aac	p.D90N	RBM5_ENST00000469838.1_Missense_Mutation_p.D90N	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	90					apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.D90N(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTATAGGCATGACATCAGTGA	0.493																																					p.D90N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G268A	3						.						308.0	230.0	257.0					3																	50131237		2203	4300	6503	50106241	SO:0001583	missense	10181	exon4			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.268G>A	3.37:g.50131237G>A	ENSP00000343054:p.Asp90Asn	Somatic		Capture	Illumina HiSeq	Phase_I	50106241	NM_005778	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	37	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	G	37	6.012916	0.97200	.	.	ENSG00000003756	ENST00000347869;ENST00000469838;ENST00000441305;ENST00000437500;ENST00000417905;ENST00000543047;ENST00000539538	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.88	5.88	0.94601	Nucleotide-binding, alpha-beta plait (1);	0.045337	0.85682	D	0.000000	T	0.59972	0.2233	L	0.47716	1.5	0.80722	D	1	D;D	0.67145	0.978;0.996	P;D	0.73708	0.554;0.981	T	0.52041	-0.8628	9	.	.	.	-23.0371	20.236	0.98356	0.0:0.0:1.0:0.0	.	90;90	P52756;E1CJT4	RBM5_HUMAN;.	N	90;90;90;90;90;89;89	ENSP00000343054:D90N;ENSP00000419534:D90N;ENSP00000390711:D90N;ENSP00000406119:D90N	.	D	+	1	0	RBM5	50106241	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.173000	0.94815	2.799000	0.96334	0.637000	0.83480	GAC		0.493	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
GPR87	53836	broad.mit.edu	37	3	151012866	151012866	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr3:151012866G>T	ENST00000260843.4	-	3	632	c.168C>A	c.(166-168)agC>agA	p.S56R	MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000491549.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	56					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.S56R(1)		endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCAGCAAGATGCTTGCCACAA	0.423																																					p.S56R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C168A	3						.						82.0	80.0	81.0					3																	151012866		2203	4300	6503	152495556	SO:0001583	missense	53836	exon3			AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.168C>A	3.37:g.151012866G>T	ENSP00000260843:p.Ser56Arg	Somatic		Capture	Illumina HiSeq	Phase_I	152495556	NM_023915	Q5KU35|Q96JZ8|Q9BXC2	Missense_Mutation	SNP	ENST00000260843.4	37	CCDS3157.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908060	0.52333	.	.	ENSG00000138271	ENST00000260843	T	0.40476	1.03	5.31	4.41	0.53225	.	0.110972	0.64402	D	0.000007	T	0.43366	0.1244	L	0.27053	0.805	0.40669	D	0.982195	D	0.67145	0.996	P	0.56788	0.806	T	0.42766	-0.9432	10	0.87932	D	0	-12.2655	11.1879	0.48669	0.071:0.0:0.8002:0.1288	.	56	Q9BY21	GPR87_HUMAN	R	56	ENSP00000260843:S56R	ENSP00000260843:S56R	S	-	3	2	GPR87	152495556	0.742000	0.28228	1.000000	0.80357	0.945000	0.59286	0.702000	0.25631	2.632000	0.89209	0.655000	0.94253	AGC		0.423	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357788.1		
EMCN	51705	broad.mit.edu	37	4	101338276	101338276	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr4:101338276A>T	ENST00000296420.4	-	9	865	c.687T>A	c.(685-687)gaT>gaA	p.D229E	EMCN_ENST00000305864.3_Missense_Mutation_p.D146E|EMCN_ENST00000511970.1_Missense_Mutation_p.D216E	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	229						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D229E(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		TTACTTACTGATCATTTCCAT	0.368																																					p.D216E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T648A	4						.						173.0	159.0	164.0					4																	101338276		2203	4300	6503	101557299	SO:0001583	missense	51705	exon8			AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.687T>A	4.37:g.101338276A>T	ENSP00000296420:p.Asp229Glu	Somatic		Capture	Illumina HiSeq	Phase_I	101557299	NM_001159694	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Missense_Mutation	SNP	ENST00000296420.4	37	CCDS3655.1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.550720	0.45383	.	.	ENSG00000164035	ENST00000296420;ENST00000305864;ENST00000511970	.	.	.	4.85	-0.322	0.12713	.	0.388883	0.18905	N	0.127927	T	0.15522	0.0374	N	0.11560	0.145	0.25928	N	0.983027	D;D;D	0.55385	0.964;0.971;0.971	P;P;P	0.49752	0.621;0.606;0.606	T	0.20605	-1.0270	9	0.12766	T	0.61	-0.0381	3.8322	0.08879	0.2506:0.0:0.4598:0.2896	.	146;216;229	Q9ULC0-2;B4E347;Q9ULC0	.;.;MUCEN_HUMAN	E	229;146;216	.	ENSP00000296420:D229E	D	-	3	2	EMCN	101557299	0.991000	0.36638	0.995000	0.50966	0.965000	0.64279	-0.046000	0.11983	-0.334000	0.08463	0.528000	0.53228	GAT		0.368	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242	
ANK2	287	broad.mit.edu	37	4	114267059	114267059	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr4:114267059C>T	ENST00000357077.4	+	35	4305	c.4252C>T	c.(4252-4254)Cgc>Tgc	p.R1418C	ANK2_ENST00000264366.6_Missense_Mutation_p.R1385C|ANK2_ENST00000506722.1_Missense_Mutation_p.R1409C|ANK2_ENST00000510275.2_Missense_Mutation_p.R70C|ANK2_ENST00000509550.1_Missense_Mutation_p.R594C|ANK2_ENST00000394537.3_Missense_Mutation_p.R1418C	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1418	UPA domain.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R1418C(2)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTTCAAGGTACGCGATACGAC	0.398																																					p.R1418C												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C4252T	4						.						109.0	95.0	100.0					4																	114267059		2203	4300	6503	114486508	SO:0001583	missense	287	exon35			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4252C>T	4.37:g.114267059C>T	ENSP00000349588:p.Arg1418Cys	Somatic		Capture	Illumina HiSeq	Phase_I	114486508	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.975923|3.975923	0.74360|0.74360	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275|ENST00000514960;ENST00000504415	T;T;T;T;T;T;T;T|.	0.28069|.	1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.000000|.	0.53938|.	D|.	0.000057|.	D|D	0.82504|0.82504	0.5051|0.5051	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	0.994;0.998;0.992;0.998;1.0;0.999;0.999|.	T|T	0.81326|0.81326	-0.0983|-0.0983	10|5	0.87932|.	D|.	0|.	.|.	20.6721|20.6721	0.99693|0.99693	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	594;1385;464;430;1418;1418;1409|.	E9PCH6;Q01484;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5|.	.;ANK2_HUMAN;.;.;.;.;.|.	C|M	1331;1409;464;1433;1418;1418;1385;1409;594;70|430;70	ENSP00000421011:R1331C;ENSP00000421067:R1409C;ENSP00000424722:R1433C;ENSP00000378044:R1418C;ENSP00000349588:R1418C;ENSP00000264366:R1385C;ENSP00000426944:R594C;ENSP00000421023:R70C|.	ENSP00000264366:R1385C|.	R|T	+|+	1|2	0|0	ANK2|ANK2	114486508|114486508	0.997000|0.997000	0.39634|0.39634	0.995000|0.995000	0.50966|0.50966	0.402000|0.402000	0.30811|0.30811	3.299000|3.299000	0.51826|0.51826	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CGC|ACG		0.398	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ANK2	287	broad.mit.edu	37	4	114275007	114275007	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr4:114275007C>T	ENST00000357077.4	+	38	5286	c.5233C>T	c.(5233-5235)Cct>Tct	p.P1745S	ANK2_ENST00000264366.6_Missense_Mutation_p.P1712S|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1745					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.P1745S(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGGTTTAGCCCCTGAACCCCT	0.448																																					p.P1745S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5233T	4						.						278.0	290.0	286.0					4																	114275007		2203	4300	6503	114494456	SO:0001583	missense	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5233C>T	4.37:g.114275007C>T	ENSP00000349588:p.Pro1745Ser	Somatic		Capture	Illumina HiSeq	Phase_I	114494456	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.999476	0.35320	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.66280	-0.2;-0.2	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000018	T	0.54175	0.1842	L	0.52364	1.645	0.80722	D	1	B;B	0.34200	0.085;0.441	B;B	0.32805	0.049;0.153	T	0.52343	-0.8588	9	.	.	.	.	11.7462	0.51821	0.137:0.7308:0.1321:0.0	.	1712;1745	Q01484;Q01484-4	ANK2_HUMAN;.	S	1745;1712	ENSP00000349588:P1745S;ENSP00000264366:P1712S	.	P	+	1	0	ANK2	114494456	0.820000	0.29190	0.943000	0.38184	0.945000	0.59286	1.454000	0.35178	2.683000	0.91414	0.655000	0.94253	CCT		0.448	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
LRBA	987	broad.mit.edu	37	4	151511866	151511866	+	Splice_Site	SNP	G	G	A	rs201176491	byFrequency	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr4:151511866G>A	ENST00000357115.3	-	40	6468	c.6225C>T	c.(6223-6225)gcC>gcT	p.A2075A	LRBA_ENST00000510413.1_Splice_Site_p.A2064A|LRBA_ENST00000507224.1_Splice_Site_p.A2064A|LRBA_ENST00000535741.1_Splice_Site_p.A2064A	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2075						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A2075A(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CAAATTTACCGGCAAGATTCT	0.413													g|||	2	0.000399361	0.0015	0.0	5008	,	,		18695	0.0		0.0	False		,,,				2504	0.0				p.A2075A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6225T	4						.	A	,	4,4402	8.1+/-20.4	0,4,2199	104.0	103.0	103.0		6225,6225	-4.9	0.1	4		103	0,8600		0,0,4300	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	LRBA	NM_001199282.2,NM_006726.4	,	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	,	2075/2864,2075/2864	151511866	4,13002	2203	4300	6503	151731316	SO:0001630	splice_region_variant	987	exon40			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6226+1C>T	4.37:g.151511866G>A		Somatic		Capture	Illumina HiSeq	Phase_I	151731316	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	g	4.755	0.140364	0.09083	9.08E-4	0.0	ENSG00000198589	ENST00000509835	.	.	.	5.85	-4.89	0.03103	.	.	.	.	.	T	0.38026	0.1025	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32771	-0.9894	4	.	.	.	.	2.272	0.04093	0.3711:0.2434:0.2598:0.1258	.	.	.	.	L	717	.	.	P	-	2	0	LRBA	151731316	0.000000	0.05858	0.061000	0.19648	0.819000	0.46315	-2.748000	0.00794	-1.598000	0.01607	-2.473000	0.00201	CCG		0.413	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		Silent
FSTL5	56884	broad.mit.edu	37	4	162954792	162954792	+	Missense_Mutation	SNP	T	T	A	rs377562641		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr4:162954792T>A	ENST00000306100.5	-	3	581	c.145A>T	c.(145-147)Agt>Tgt	p.S49C	RP11-497K21.1_ENST00000513093.1_RNA|FSTL5_ENST00000536695.1_Missense_Mutation_p.S48C|FSTL5_ENST00000427802.2_Missense_Mutation_p.S48C|FSTL5_ENST00000379164.4_Missense_Mutation_p.S48C	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	49						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.S49C(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		ACTCTTGAACTTTCTTGATTT	0.259																																					p.S49C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A145T	4						.						30.0	31.0	31.0					4																	162954792		2161	4243	6404	163174242	SO:0001583	missense	56884	exon3			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.145A>T	4.37:g.162954792T>A	ENSP00000305334:p.Ser49Cys	Somatic		Capture	Illumina HiSeq	Phase_I	163174242	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	T	12.43	1.935506	0.34189	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.74002	-0.77;-0.76;-0.8;-0.76	4.99	3.8	0.43715	.	0.324948	0.26099	N	0.026359	T	0.66177	0.2763	L	0.47716	1.5	0.39908	D	0.973994	P;P;P	0.51653	0.947;0.771;0.661	B;B;B	0.42555	0.322;0.391;0.219	T	0.66221	-0.5978	10	0.46703	T	0.11	.	9.1439	0.36921	0.0:0.0:0.1998:0.8002	.	48;48;49	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	C	49;48;48;48	ENSP00000305334:S49C;ENSP00000368462:S48C;ENSP00000389270:S48C;ENSP00000440409:S48C	ENSP00000305334:S49C	S	-	1	0	FSTL5	163174242	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.758000	0.38410	0.827000	0.34685	0.533000	0.62120	AGT		0.259	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
NEIL3	55247	broad.mit.edu	37	4	178281689	178281689	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr4:178281689G>A	ENST00000264596.3	+	9	1611	c.1493G>A	c.(1492-1494)cGt>cAt	p.R498H		NM_018248.2	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3 (E. coli)	498					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)|zinc ion binding (GO:0008270)	p.R498H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		GATGGCCCTCGTACCTTAAAT	0.463								Base excision repair (BER), DNA glycosylases																													p.R498H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1493A	4						.						104.0	100.0	101.0					4																	178281689		2203	4300	6503	178518683	SO:0001583	missense	55247	exon9			AB079071	CCDS3828.1	4q34	2014-02-18			ENSG00000109674	ENSG00000109674			24573	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 3"""	608934				12713815, 12509226	Standard	NM_018248		Approved	FLJ10858, hFPG2, FPG2, hNEI3, ZGRF3	uc003iut.2	Q8TAT5	OTTHUMG00000160722	ENST00000264596.3:c.1493G>A	4.37:g.178281689G>A	ENSP00000264596:p.Arg498His	Somatic		Capture	Illumina HiSeq	Phase_I	178518683	NM_018248	Q2PPJ3|Q8NG51|Q9NV95	Missense_Mutation	SNP	ENST00000264596.3	37	CCDS3828.1	.	.	.	.	.	.	.	.	.	.	g	5.833	0.337969	0.11013	.	.	ENSG00000109674	ENST00000264596	T	0.03920	3.76	6.04	4.32	0.51571	.	0.725827	0.14358	N	0.324678	T	0.02610	0.0079	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48103	-0.9064	10	0.15066	T	0.55	1.7202	7.9049	0.29757	0.1924:0.1158:0.6919:0.0	.	498	Q8TAT5	NEIL3_HUMAN	H	498	ENSP00000264596:R498H	ENSP00000264596:R498H	R	+	2	0	NEIL3	178518683	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.040000	0.12104	0.883000	0.36040	-0.215000	0.12644	CGT		0.463	NEIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361914.1	NM_018248	
FAM149A	25854	broad.mit.edu	37	4	187088179	187088179	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr4:187088179C>T	ENST00000356371.5	+	12	2095	c.2095C>T	c.(2095-2097)Cga>Tga	p.R699*	FAM149A_ENST00000514153.1_Nonsense_Mutation_p.R408*|FAM149A_ENST00000502970.1_Nonsense_Mutation_p.R408*|FAM149A_ENST00000503432.1_Nonsense_Mutation_p.R408*|FAM149A_ENST00000389354.5_Nonsense_Mutation_p.R408*|FAM149A_ENST00000227065.4_Nonsense_Mutation_p.R408*			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	699								p.R408*(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		CGGTACAGAACGATCGCGTCT	0.463																																					p.R408X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1222T	4						.						86.0	80.0	82.0					4																	187088179		2203	4300	6503	187325173	SO:0001587	stop_gained	25854	exon11			AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.2095C>T	4.37:g.187088179C>T	ENSP00000348732:p.Arg699*	Somatic		Capture	Illumina HiSeq	Phase_I	187325173	NM_001006655	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Nonsense_Mutation	SNP	ENST00000356371.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.78|13.78	2.338350|2.338350	0.41398|0.41398	.|.	.|.	ENSG00000109794|ENSG00000109794	ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354|ENST00000512271	.|.	.|.	.|.	5.72|5.72	-5.77|-5.77	0.02369|0.02369	.|.	0.294710|.	0.28307|.	N|.	0.015836|.	.|T	.|0.29458	.|0.0734	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.41875	.|-0.9484	.|3	0.02654|.	T|.	1|.	-5.1428|-5.1428	8.2681|8.2681	0.31827|0.31827	0.5541:0.3045:0.0813:0.0601|0.5541:0.3045:0.0813:0.0601	.|.	.|.	.|.	.|.	X|M	408;699;408;408;408;408|85	.|.	ENSP00000227065:R408X|.	R|T	+|+	1|2	2|0	FAM149A|FAM149A	187325173|187325173	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.222000|-0.222000	0.09190|0.09190	-0.879000|-0.879000	0.04002|0.04002	-0.218000|-0.218000	0.12543|0.12543	CGA|ACG		0.463	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
APC	324	broad.mit.edu	37	5	112174241	112174241	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr5:112174241G>T	ENST00000457016.1	+	16	3330	c.2950G>T	c.(2950-2952)Gaa>Taa	p.E984*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.E984*|APC_ENST00000257430.4_Nonsense_Mutation_p.E984*			P25054	APC_HUMAN	adenomatous polyposis coli	984	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E984*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACCCTCGATTGAATCCTATTC	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E966X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.G2896T	5						.						80.0	75.0	77.0					5																	112174241		2202	4300	6502	112202140	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2950G>T	5.37:g.112174241G>T	ENSP00000413133:p.Glu984*	Somatic		Capture	Illumina HiSeq	Phase_I	112202140	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	38	7.284057	0.98186	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-22.7017	19.94	0.97155	0.0:0.0:1.0:0.0	.	.	.	.	X	984;966;984;984;984	.	ENSP00000257430:E984X	E	+	1	0	APC	112202140	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	7.420000	0.80191	2.721000	0.93114	0.650000	0.86243	GAA		0.343	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ADCY2	108	broad.mit.edu	37	5	7789859	7789859	+	Silent	SNP	C	C	T	rs370476148		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr5:7789859C>T	ENST00000338316.4	+	20	2663	c.2574C>T	c.(2572-2574)aaC>aaT	p.N858N	ADCY2_ENST00000537121.1_Silent_p.N678N	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	858					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.N858N(2)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TGCTGGAGAACGTGCTTCCCG	0.557																																					p.N858N												.	.	2	Substitution - coding silent(2)	large_intestine(1)|pancreas(1)	c.C2574T	5						.						70.0	70.0	70.0					5																	7789859		2203	4300	6503	7842859	SO:0001819	synonymous_variant	108	exon20			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2574C>T	5.37:g.7789859C>T		Somatic		Capture	Illumina HiSeq	Phase_I	7842859	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																				0.557	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
FBXL7	23194	broad.mit.edu	37	5	15928372	15928372	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr5:15928372C>A	ENST00000504595.1	+	3	982	c.501C>A	c.(499-501)gaC>gaA	p.D167E	FBXL7_ENST00000510662.1_Missense_Mutation_p.D120E|FBXL7_ENST00000329673.7_Missense_Mutation_p.D155E	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	167					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.D167E(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TCAACGTGGACCGCGCCCTCA	0.662																																					p.D167E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C501A	5						.						25.0	30.0	28.0					5																	15928372		2125	4232	6357	15981372	SO:0001583	missense	23194	exon3			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.501C>A	5.37:g.15928372C>A	ENSP00000423630:p.Asp167Glu	Somatic		Capture	Illumina HiSeq	Phase_I	15981372	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989892	0.74589	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.56776	0.44;0.44;0.44	5.36	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.67211	0.2869	M	0.83223	2.63	0.58432	D	0.999995	D	0.62365	0.991	P	0.57204	0.815	T	0.66236	-0.5974	10	0.21540	T	0.41	.	14.4301	0.67243	0.0:0.9274:0.0:0.0726	.	167	Q9UJT9	FBXL7_HUMAN	E	167;120;155	ENSP00000423630:D167E;ENSP00000425184:D120E;ENSP00000329632:D155E	ENSP00000329632:D155E	D	+	3	2	FBXL7	15981372	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.240000	0.51368	2.520000	0.84964	0.561000	0.74099	GAC		0.662	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
PDZD2	23037	broad.mit.edu	37	5	32088820	32088820	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr5:32088820A>G	ENST00000438447.1	+	20	5654	c.5266A>G	c.(5266-5268)Agt>Ggt	p.S1756G	PDZD2_ENST00000282493.3_Missense_Mutation_p.S1756G			O15018	PDZD2_HUMAN	PDZ domain containing 2	1756					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.S1756G(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TGCAGCTGCCAGTCTGTCCTC	0.453																																					p.S1756G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5266G	5						.						104.0	92.0	96.0					5																	32088820		2203	4300	6503	32124577	SO:0001583	missense	23037	exon19			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5266A>G	5.37:g.32088820A>G	ENSP00000402033:p.Ser1756Gly	Somatic		Capture	Illumina HiSeq	Phase_I	32124577	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	A	11.66	1.705769	0.30232	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.09163	3.01;3.01	5.58	-1.97	0.07503	.	1.187640	0.06094	N	0.664101	T	0.08313	0.0207	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41395	-0.9511	10	0.45353	T	0.12	.	8.651	0.34035	0.2859:0.6208:0.0933:0.0	.	1756	O15018	PDZD2_HUMAN	G	1756;1557;1756	ENSP00000402033:S1756G;ENSP00000282493:S1756G	ENSP00000282493:S1756G	S	+	1	0	PDZD2	32124577	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.088000	0.14979	-0.587000	0.05890	-0.396000	0.06452	AGT		0.453	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
PCDHB2	56133	broad.mit.edu	37	5	140475679	140475679	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr5:140475679C>T	ENST00000194155.4	+	1	1453	c.1305C>T	c.(1303-1305)acC>acT	p.T435T		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	435	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T435T(2)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCTGAAAACCGAGCACAACA	0.577																																					p.T435T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.C1305T	5						.						148.0	136.0	140.0					5																	140475679		2203	4300	6503	140455863	SO:0001819	synonymous_variant	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1305C>T	5.37:g.140475679C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140455863	NM_018936	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																				0.577	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
COL19A1	1310	broad.mit.edu	37	6	70875844	70875845	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr6:70875844_70875845insC	ENST00000322773.4	+	37	2514_2515	c.2412_2413insC	c.(2413-2415)cccfs	p.P805fs	COL19A1_ENST00000393344.1_Frame_Shift_Ins_p.P427fs	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	805	Collagen-like 8.|Triple-helical region 4 (COL4).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GCAGCGACGGACCCCCTGGGAA	0.436																																					p.G804fs												.	.	0			c.2412_2413insC	6						.																																			70932566	SO:0001589	frameshift_variant	1310	exon37				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2417dupC	6.37:g.70875849_70875849dupC	ENSP00000316030:p.Pro805fs	None		Capture	Illumina HiSeq	Phase_I	70932565	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Frame_Shift_Ins	INS	ENST00000322773.4	37	CCDS4970.1																																																																																				0.436	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
PTPRK	5796	broad.mit.edu	37	6	128385903	128385903	+	Splice_Site	SNP	C	C	G			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr6:128385903C>G	ENST00000368215.3	-	13	2193	c.2194G>C	c.(2194-2196)Gca>Cca	p.A732P	PTPRK_ENST00000368227.3_Splice_Site_p.A732P|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368226.4_Splice_Site_p.A732P|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000532331.1_Splice_Site_p.A732P|PTPRK_ENST00000368207.3_Splice_Site_p.A732P|PTPRK_ENST00000368210.3_Splice_Site_p.A732P|PTPRK_ENST00000368213.5_Splice_Site_p.A732P			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	732					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A732P(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AACCTCTTACCTTTTGTAGCA	0.358																																					p.A732P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2194C	6						.						118.0	120.0	119.0					6																	128385903		2203	4300	6503	128427596	SO:0001630	splice_region_variant	5796	exon13			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2194+1G>C	6.37:g.128385903C>G		Somatic		Capture	Illumina HiSeq	Phase_I	128427596	NM_002844	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.04|16.04	3.009075|3.009075	0.54361|0.54361	.|.	.|.	ENSG00000152894|ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676|ENST00000415046	T;T;T;T;T;T;T|T	0.08984|0.09817	3.07;3.05;3.06;3.08;3.05;3.03;3.06|2.94	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	0.199308|.	0.43579|.	D|.	0.000557|.	T|T	0.07143|0.07143	0.0181|0.0181	L|L	0.28400|0.28400	0.85|0.85	0.50313|0.50313	D|D	0.999862|0.999862	P;P;P;P;P;P|.	0.44090|.	0.826;0.651;0.763;0.531;0.518;0.763|.	B;B;B;B;B;B|.	0.41202|.	0.278;0.19;0.35;0.346;0.133;0.35|.	T|T	0.38329|0.38329	-0.9666|-0.9666	9|6	.|.	.|.	.|.	.|.	13.3158|13.3158	0.60407|0.60407	0.0:0.9281:0.0:0.0719|0.0:0.9281:0.0:0.0719	.|.	732;732;732;589;732;732|.	B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2|.	.;.;.;.;PTPRK_HUMAN;.|.	P|N	732;732;732;732;732;732;732;589|2	ENSP00000357209:A732P;ENSP00000357210:A732P;ENSP00000432973:A732P;ENSP00000357196:A732P;ENSP00000357193:A732P;ENSP00000357198:A732P;ENSP00000357190:A732P|ENSP00000406825:K2N	.|.	A|K	-|-	1|3	0|2	PTPRK|PTPRK	128427596|128427596	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	5.553000|5.553000	0.67287|0.67287	2.760000|2.760000	0.94817|0.94817	0.655000|0.655000	0.94253|0.94253	GCA|AAG		0.358	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		Missense_Mutation
CCHCR1	54535	broad.mit.edu	37	6	31117916	31117917	+	Missense_Mutation	DNP	AC	AC	GG			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	AC	AC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr6:31117916_31117917AC>GG	ENST00000376266.5	-	8	1143_1144	c.1021_1022GT>CC	c.(1021-1023)GTg>CCg	p.V341P	CCHCR1_ENST00000451521.2_Missense_Mutation_p.V394P|CCHCR1_ENST00000480060.1_Intron|CCHCR1_ENST00000396263.2_Missense_Mutation_p.V341P|CCHCR1_ENST00000396268.3_Missense_Mutation_p.V430P	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	341					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V430>?(1)|p.V341>?(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						GAGGGCAAACACCTTCTCCCGC	0.55																																					.												.	.	2	Complex(2)	large_intestine(2)	c.1180_1181CC	6						.																																			31225896	SO:0001583	missense	54535	exon8			AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1021_1022delinsGG	6.37:g.31117916_31117917delinsGG	ENSP00000365442:p.Val341Pro	Somatic		Capture	Illumina HiSeq	Phase_I	31225895	NM_001105563	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	DNP	ENST00000376266.5	37	CCDS4695.1																																																																																				0.550	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076190.5	NM_019052	
CSNK2B	1460	broad.mit.edu	37	6	31637260	31637260	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr6:31637260A>T	ENST00000375882.2	+	6	688	c.532A>T	c.(532-534)Aga>Tga	p.R178*	CSNK2B_ENST00000375885.4_Nonsense_Mutation_p.R197*|CSNK2B_ENST00000375866.2_Nonsense_Mutation_p.R178*|CSNK2B-LY6G5B-1181_ENST00000375880.2_Nonsense_Mutation_p.R178*|LY6G5B_ENST00000409525.1_5'Flank|LY6G5B_ENST00000375864.4_5'Flank|CSNK2B_ENST00000375865.2_Nonsense_Mutation_p.R178*	NM_001282385.1|NM_001320.5	NP_001269314.1|NP_001311.3	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	178					adiponectin-activated signaling pathway (GO:0033211)|axon guidance (GO:0007411)|cellular protein complex assembly (GO:0043623)|endothelial tube morphogenesis (GO:0061154)|mitotic cell cycle (GO:0000278)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|protein phosphorylation (GO:0006468)|regulation of DNA binding (GO:0051101)|regulation of protein kinase activity (GO:0045859)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein kinase CK2 complex (GO:0005956)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase regulator activity (GO:0019887)|receptor binding (GO:0005102)|transcription factor binding (GO:0008134)	p.R178>?(1)|p.R178>T*(1)|p.R178*(1)		central_nervous_system(5)|endometrium(1)|large_intestine(2)|liver(1)|urinary_tract(1)	10						CCGGCCCAAGAGACCTGCCAA	0.577																																					p.R178X												.	.	3	Substitution - Nonsense(1)|Complex(1)|Complex - insertion inframe(1)	central_nervous_system(2)|large_intestine(1)	c.A532T	6						.						108.0	104.0	105.0					6																	31637260		2203	4300	6503	31745239	SO:0001587	stop_gained	1460	exon6			M30448	CCDS4712.1	6p21.33	2013-01-17			ENSG00000204435	ENSG00000204435	2.7.11.1		2460	protein-coding gene	gene with protein product		115441				2276748, 9503014	Standard	NM_001320		Approved		uc003nvr.1	P67870	OTTHUMG00000177888	ENST00000375882.2:c.532A>T	6.37:g.31637260A>T	ENSP00000365042:p.Arg178*	Somatic		Capture	Illumina HiSeq	Phase_I	31745239	NM_001320	B0UXA9|P07312|P13862|Q4VX47	Nonsense_Mutation	SNP	ENST00000375882.2	37	CCDS4712.1	.	.	.	.	.	.	.	.	.	.	A	36	5.779714	0.96929	.	.	ENSG00000204435	ENST00000375885;ENST00000375882;ENST00000375880;ENST00000375865;ENST00000375866	.	.	.	5.65	1.77	0.24775	.	0.055956	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-26.8939	8.1593	0.31190	0.5791:0.3453:0.0:0.0755	.	.	.	.	X	197;178;178;178;178	.	ENSP00000365025:R178X	R	+	1	2	CSNK2B	31745239	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	1.223000	0.32527	0.142000	0.18901	-0.168000	0.13345	AGA		0.577	CSNK2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076063.8	NM_001320	
FILIP1	27145	broad.mit.edu	37	6	76022510	76022510	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr6:76022510G>C	ENST00000237172.7	-	5	3368	c.3038C>G	c.(3037-3039)tCt>tGt	p.S1013C	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Missense_Mutation_p.S914C|FILIP1_ENST00000393004.2_Missense_Mutation_p.S1013C	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1013								p.S1013C(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TGCTGATGTAGACACCGTCAT	0.488																																					p.S1013C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3038G	6						.						138.0	134.0	136.0					6																	76022510		2203	4300	6503	76079230	SO:0001583	missense	27145	exon5			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.3038C>G	6.37:g.76022510G>C	ENSP00000237172:p.Ser1013Cys	Somatic		Capture	Illumina HiSeq	Phase_I	76079230	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546330	0.86022	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.20069	2.1;2.1;2.11	6.03	6.03	0.97812	.	0.109585	0.64402	D	0.000004	T	0.32526	0.0832	L	0.55481	1.735	0.52501	D	0.99995	D;D;D	0.61697	0.99;0.958;0.975	P;P;P	0.58172	0.754;0.687;0.834	T	0.01504	-1.1338	10	0.72032	D	0.01	-6.5444	20.5568	0.99304	0.0:0.0:1.0:0.0	.	1013;1013;1013	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	C	1013;1013;914	ENSP00000376728:S1013C;ENSP00000237172:S1013C;ENSP00000359037:S914C	ENSP00000237172:S1013C	S	-	2	0	FILIP1	76079230	1.000000	0.71417	0.972000	0.41901	0.974000	0.67602	5.569000	0.67391	2.861000	0.98227	0.655000	0.94253	TCT		0.488	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
SYNE1	23345	broad.mit.edu	37	6	152749408	152749408	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr6:152749408G>A	ENST00000367255.5	-	37	5509	c.4908C>T	c.(4906-4908)taC>taT	p.Y1636Y	SYNE1_ENST00000367253.4_Silent_p.Y1636Y|SYNE1_ENST00000341594.5_Silent_p.Y1706Y|SYNE1_ENST00000265368.4_Silent_p.Y1636Y|SYNE1_ENST00000423061.1_Silent_p.Y1643Y|SYNE1_ENST00000448038.1_Silent_p.Y1643Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1636					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.Y1636Y(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGATGTCCTCGTATTGCTGCT	0.567										HNSCC(10;0.0054)																											p.Y1643Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4929T	6						.						171.0	172.0	172.0					6																	152749408		2203	4300	6503	152791101	SO:0001819	synonymous_variant	23345	exon37			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4908C>T	6.37:g.152749408G>A		Somatic		Capture	Illumina HiSeq	Phase_I	152791101	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.567	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
MEST	4232	broad.mit.edu	37	7	130144793	130144793	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:130144793C>T	ENST00000223215.4	+	12	1125	c.904C>T	c.(904-906)Cgg>Tgg	p.R302W	RP11-2E11.9_ENST00000604965.1_RNA|MEST_ENST00000437945.1_Silent_p.R280R|MEST_ENST00000341441.5_Missense_Mutation_p.R293W|MEST_ENST00000378576.4_Missense_Mutation_p.R259W|MEST_ENST00000416162.2_Missense_Mutation_p.R259W|MEST_ENST00000393187.1_Missense_Mutation_p.R293W	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	302					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.R302W(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					AACGCTGCCGCGGTCCACAGT	0.527																																					p.R302W	Colon(126;2182 2305 6517 35181)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C904T	7						.						94.0	86.0	89.0					7																	130144793		2203	4300	6503	129932029	SO:0001583	missense	4232	exon12				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.904C>T	7.37:g.130144793C>T	ENSP00000223215:p.Arg302Trp	Somatic		Capture	Illumina HiSeq	Phase_I	129932029	NM_002402	B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	ENST00000223215.4	37	CCDS5822.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.382010	0.42207	.	.	ENSG00000106484	ENST00000341441;ENST00000416162;ENST00000378576;ENST00000393187;ENST00000223215	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	5.77	4.87	0.63330	.	0.195686	0.52532	D	0.000070	T	0.63534	0.2519	M	0.65975	2.015	0.44388	D	0.997293	B;B;B	0.24426	0.103;0.086;0.07	B;B;B	0.25405	0.06;0.015;0.013	T	0.63550	-0.6612	10	0.62326	D	0.03	.	9.3611	0.38197	0.4208:0.4542:0.1249:0.0	.	288;302;259	B4DQW6;Q5EB52;Q5EB52-3	.;MEST_HUMAN;.	W	293;259;259;293;302	ENSP00000342749:R293W;ENSP00000408933:R259W;ENSP00000367839:R259W;ENSP00000376884:R293W;ENSP00000223215:R302W	ENSP00000223215:R302W	R	+	1	2	MEST	129932029	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	2.553000	0.45837	1.368000	0.46115	0.655000	0.94253	CGG		0.527	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345183.2	NM_002402	
CHRM2	1129	broad.mit.edu	37	7	136700564	136700564	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:136700564G>A	ENST00000445907.2	+	3	1480	c.952G>A	c.(952-954)Gag>Aag	p.E318K	CHRM2_ENST00000401861.1_Missense_Mutation_p.E318K|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000453373.1_Missense_Mutation_p.E318K|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.E318K|CHRM2_ENST00000397608.3_Missense_Mutation_p.E318K|CHRM2_ENST00000402486.3_Missense_Mutation_p.E318K|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000425981.2_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	318					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)	p.E318K(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TTCCAAAGATGAGAACTCTAA	0.468																																					p.E318K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G952A	7						.						96.0	98.0	98.0					7																	136700564		2203	4300	6503	136351104	SO:0001583	missense	1129	exon4				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.952G>A	7.37:g.136700564G>A	ENSP00000399745:p.Glu318Lys	Somatic		Capture	Illumina HiSeq	Phase_I	136351104	NM_000739	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	G	5.030	0.191169	0.09547	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.180851	0.37012	N	0.002300	T	0.42720	0.1215	N	0.19112	0.55	0.39824	D	0.972878	B	0.13145	0.007	B	0.15052	0.012	T	0.39292	-0.9621	10	0.07482	T	0.82	-5.9838	19.1729	0.93588	0.0:0.0:1.0:0.0	.	318	P08172	ACM2_HUMAN	K	318	ENSP00000399745:E318K;ENSP00000415386:E318K;ENSP00000319984:E318K;ENSP00000380733:E318K;ENSP00000384937:E318K;ENSP00000384401:E318K	ENSP00000319984:E318K	E	+	1	0	CHRM2	136351104	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.817000	0.86213	2.541000	0.85698	0.655000	0.94253	GAG		0.468	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
DGKB	1607	broad.mit.edu	37	7	14188819	14188819	+	Silent	SNP	C	C	T	rs372943958	byFrequency	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:14188819C>T	ENST00000403951.2	-	26	2771	c.2352G>A	c.(2350-2352)ccG>ccA	p.P784P	DGKB_ENST00000444700.2_Silent_p.P765P|DGKB_ENST00000258767.5_Silent_p.P784P|DGKB_ENST00000407950.1_Silent_p.P776P|DGKB_ENST00000402815.1_Silent_p.P783P|DGKB_ENST00000399322.3_Silent_p.P784P			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	784					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.P784P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TTTTTGGAGGCGGGCCCATCA	0.398													c|||	3	0.000599042	0.0023	0.0	5008	,	,		14220	0.0		0.0	False		,,,				2504	0.0				p.P784P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2352A	7						.	C		19,3631		0,19,1806	130.0	124.0	126.0		2352	-1.0	1.0	7		126	0,8160		0,0,4080	no	coding-synonymous	DGKB	NM_004080.2		0,19,5886	TT,TC,CC		0.0,0.5205,0.1609		784/805	14188819	19,11791	1825	4080	5905	14155344	SO:0001819	synonymous_variant	1607	exon25			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2352G>A	7.37:g.14188819C>T		Somatic		Capture	Illumina HiSeq	Phase_I	14155344	NM_004080	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Silent	SNP	ENST00000403951.2	37	CCDS47547.1																																																																																				0.398	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
WBSCR17	64409	broad.mit.edu	37	7	70853284	70853284	+	Silent	SNP	C	C	T	rs368749036		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:70853284C>T	ENST00000333538.5	+	3	1120	c.486C>T	c.(484-486)aaC>aaT	p.N162N	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	162	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.N162N(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TCTTCGTGAACGAGGCCCTGT	0.542																																					p.N162N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C486T	7						.	C		0,4406		0,0,2203	125.0	108.0	114.0		486	2.1	1.0	7		114	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	WBSCR17	NM_022479.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		162/599	70853284	1,13005	2203	4300	6503	70491220	SO:0001819	synonymous_variant	64409	exon3			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.486C>T	7.37:g.70853284C>T		Somatic		Capture	Illumina HiSeq	Phase_I	70491220	NM_022479	Q8NFV9|Q9NTA8	De_novo_Start_OutOfFrame	SNP	ENST00000333538.5	37	CCDS5540.1																																																																																				0.542	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
CACNA2D1	781	broad.mit.edu	37	7	81643757	81643757	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:81643757A>T	ENST00000356253.5	-	13	1437	c.1182T>A	c.(1180-1182)taT>taA	p.Y394*	CACNA2D1_ENST00000464354.1_5'UTR|MIR1255B1_ENST00000439234.1_RNA|MIR1255B1_ENST00000454066.1_RNA|CACNA2D1_ENST00000356860.3_Nonsense_Mutation_p.Y394*			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	394	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.Y394*(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GTCCTCTGTCATAATTGTGTT	0.308																																					p.Y394X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1182A	7						.						88.0	85.0	86.0					7																	81643757		2203	4300	6503	81481693	SO:0001587	stop_gained	781	exon13			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1182T>A	7.37:g.81643757A>T	ENSP00000348589:p.Tyr394*	Somatic		Capture	Illumina HiSeq	Phase_I	81481693	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Nonsense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	A	39	7.558539	0.98358	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	.	.	.	5.24	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-18.0739	9.8786	0.41220	0.9179:0.0:0.0821:0.0	.	.	.	.	X	394	.	ENSP00000284088:Y394X	Y	-	3	2	CACNA2D1	81481693	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	1.764000	0.38471	0.849000	0.35215	0.254000	0.18369	TAT		0.308	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
KIAA1324L	222223	broad.mit.edu	37	7	86542424	86542424	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:86542424C>T	ENST00000450689.2	-	14	2013	c.1828G>A	c.(1828-1830)Ggt>Agt	p.G610S	KIAA1324L_ENST00000416314.1_Missense_Mutation_p.G443S|KIAA1324L_ENST00000490995.1_5'UTR|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.G370S|KIAA1324L_ENST00000444627.1_Intron	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	610						integral component of membrane (GO:0016021)		p.G370S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					TGTTCAGAACCGAGGGCACAG	0.507																																					p.G443S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1327A	7						.						145.0	121.0	129.0					7																	86542424		2203	4300	6503	86380360	SO:0001583	missense	222223	exon13			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1828G>A	7.37:g.86542424C>T	ENSP00000413445:p.Gly610Ser	Somatic		Capture	Illumina HiSeq	Phase_I	86380360	NM_152748	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.56|15.56	2.869343|2.869343	0.51588|0.51588	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000416314|ENST00000423294	T;T;T|.	0.70045|.	-0.45;-0.44;-0.44|.	5.82|5.82	5.82|5.82	0.92795|0.92795	Growth factor, receptor (1);|.	0.043553|.	0.85682|.	D|.	0.000000|.	T|T	0.72779|0.72779	0.3503|0.3503	L|L	0.56769|0.56769	1.78|1.78	0.50632|0.50632	D|D	0.999886|0.999886	P;B;B|.	0.35894|.	0.526;0.196;0.196|.	B;B;B|.	0.28849|.	0.095;0.051;0.051|.	T|T	0.68595|0.68595	-0.5367|-0.5367	10|5	0.52906|.	T|.	0.07|.	.|.	19.0872|19.0872	0.93209|0.93209	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	610;370;443|.	A8MWY0;A8MWY0-2;B4DJV3|.	K132L_HUMAN;.;.|.	S|Q	610;370;443|570	ENSP00000413445:G610S;ENSP00000297222:G370S;ENSP00000402390:G443S|.	ENSP00000297222:G370S|.	G|R	-|-	1|2	0|0	KIAA1324L|KIAA1324L	86380360|86380360	0.980000|0.980000	0.34600|0.34600	0.998000|0.998000	0.56505|0.56505	0.973000|0.973000	0.67179|0.67179	2.874000|2.874000	0.48483|0.48483	2.752000|2.752000	0.94435|0.94435	0.655000|0.655000	0.94253|0.94253	GGT|CGG		0.507	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
AKAP9	10142	broad.mit.edu	37	7	91631176	91631176	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:91631176C>T	ENST00000359028.2	+	9	2206	c.1981C>T	c.(1981-1983)Cga>Tga	p.R661*	AKAP9_ENST00000358100.2_Nonsense_Mutation_p.R661*|AKAP9_ENST00000356239.3_Nonsense_Mutation_p.R649*			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	661	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.R661*(1)|p.R649*(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AATTGAACATCGAATAAATAT	0.328			T	BRAF	papillary thyroid																																p.R649X			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1945T	7						.						48.0	52.0	51.0					7																	91631176		2201	4296	6497	91469112	SO:0001587	stop_gained	10142	exon8			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.1981C>T	7.37:g.91631176C>T	ENSP00000351922:p.Arg661*	Somatic		Capture	Illumina HiSeq	Phase_I	91469112	NM_147185	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Nonsense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	C	38	6.768217	0.97825	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	.	.	.	5.49	4.59	0.56863	.	0.587348	0.13114	N	0.412742	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5244	0.27647	0.3668:0.5554:0.0:0.0778	.	.	.	.	X	649;661;661;661;661	.	ENSP00000348573:R649X	R	+	1	2	AKAP9	91469112	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	2.501000	0.45389	1.426000	0.47256	0.650000	0.86243	CGA		0.328	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0 	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu	Somatic		Capture	Illumina HiSeq	Phase_I	140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
CYP7B1	9420	broad.mit.edu	37	8	65527680	65527680	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr8:65527680G>A	ENST00000310193.3	-	4	1133	c.960C>T	c.(958-960)gaC>gaT	p.D320D	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	320					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.D320D(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				GGTCAATTTCGTCACGCACTG	0.488																																					p.D320D												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C960T	8						.						105.0	97.0	100.0					8																	65527680		2203	4300	6503	65690234	SO:0001819	synonymous_variant	9420	exon4			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.960C>T	8.37:g.65527680G>A		Somatic		Capture	Illumina HiSeq	Phase_I	65690234	NM_004820	B2RN07|Q9UNF5	Silent	SNP	ENST00000310193.3	37	CCDS6180.1																																																																																				0.488	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		
ZFHX4	79776	broad.mit.edu	37	8	77765385	77765385	+	Silent	SNP	G	G	A	rs374769887		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr8:77765385G>A	ENST00000521891.2	+	10	6676	c.6228G>A	c.(6226-6228)ccG>ccA	p.P2076P	ZFHX4_ENST00000050961.6_Silent_p.P2031P|ZFHX4_ENST00000518282.1_Silent_p.P2050P|ZFHX4_ENST00000455469.2_Silent_p.P2031P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2031					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P2060P(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGGACCTGCCGCTCTTTCCTT	0.622										HNSCC(33;0.089)																											p.P2076P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6228A	8						.	T		0,3800		0,0,1900	14.0	14.0	14.0		6228	-7.5	0.0	8		14	1,7969		0,1,3984	no	coding-synonymous	ZFHX4	NM_024721.4		0,1,5884	AA,AG,GG		0.0125,0.0,0.0085		2076/3617	77765385	1,11769	1900	3985	5885	77927940	SO:0001819	synonymous_variant	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6228G>A	8.37:g.77765385G>A		Somatic		Capture	Illumina HiSeq	Phase_I	77927940	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				0.622	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
PKIA	5569	broad.mit.edu	37	8	79510705	79510705	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr8:79510705C>T	ENST00000396418.2	+	3	572	c.86C>T	c.(85-87)tCc>tTc	p.S29F	PKIA_ENST00000352966.5_Missense_Mutation_p.S29F|PKIA_ENST00000518467.1_Missense_Mutation_p.S29F	NM_006823.3|NM_181839.2	NP_006814.1|NP_862822.1	P61925	IPKA_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor alpha	29					negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP-dependent protein kinase inhibitor activity (GO:0004862)|protein kinase A catalytic subunit binding (GO:0034236)	p.S29F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	6						ATCCTGGTTTCCTCTGCAAGT	0.393																																					p.S29F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C86T	8						.						169.0	155.0	160.0					8																	79510705		2203	4300	6503	79673260	SO:0001583	missense	5569	exon3			S76965	CCDS6222.1	8q21.13	2014-08-12			ENSG00000171033	ENSG00000171033			9017	protein-coding gene	gene with protein product		606059		PRKACN1		1770951	Standard	NM_006823		Approved		uc003ybb.3	P61925	OTTHUMG00000164618	ENST00000396418.2:c.86C>T	8.37:g.79510705C>T	ENSP00000379696:p.Ser29Phe	Somatic		Capture	Illumina HiSeq	Phase_I	79673260	NM_006823	P04541|Q6IAV2	Missense_Mutation	SNP	ENST00000396418.2	37	CCDS6222.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740192	0.69304	.	.	ENSG00000171033	ENST00000396418;ENST00000352966;ENST00000518467	.	.	.	5.41	5.41	0.78517	.	0.065552	0.64402	D	0.000008	T	0.75474	0.3854	.	.	.	0.53688	D	0.999974	D	0.61697	0.99	P	0.57679	0.825	T	0.75363	-0.3344	7	.	.	.	.	19.1925	0.93672	0.0:1.0:0.0:0.0	.	29	P61925	IPKA_HUMAN	F	29	.	.	S	+	2	0	PKIA	79673260	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.842000	0.55858	2.529000	0.85273	0.585000	0.79938	TCC		0.393	PKIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379420.1		
BAAT	570	broad.mit.edu	37	9	104124985	104124985	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr9:104124985C>T	ENST00000395051.3	-	3	1052	c.982G>A	c.(982-984)Gat>Aat	p.D328N	BAAT_ENST00000259407.2_Missense_Mutation_p.D328N			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	328					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)	p.D328N(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	ATAGTCTTATCACCTTCTCCT	0.483																																					p.D328N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G982A	9						.						169.0	146.0	154.0					9																	104124985		2203	4300	6503	103164806	SO:0001583	missense	570	exon4			L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.982G>A	9.37:g.104124985C>T	ENSP00000378491:p.Asp328Asn	Somatic		Capture	Illumina HiSeq	Phase_I	103164806	NM_001701	Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	CCDS6752.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852818	0.71719	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	D;D	0.85484	-1.99;-1.99	4.96	4.96	0.65561	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.000000	0.64402	D	0.000001	D	0.92821	0.7717	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93778	0.7081	10	0.87932	D	0	-41.204	15.78	0.78252	0.0:1.0:0.0:0.0	.	328	Q14032	BAAT_HUMAN	N	328	ENSP00000259407:D328N;ENSP00000378491:D328N	ENSP00000259407:D328N	D	-	1	0	BAAT	103164806	1.000000	0.71417	0.964000	0.40570	0.189000	0.23516	6.747000	0.74872	2.565000	0.86533	0.655000	0.94253	GAT		0.483	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053433.1		
RAD23B	5887	broad.mit.edu	37	9	110091864	110091864	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr9:110091864C>T	ENST00000358015.3	+	10	1508	c.1157C>T	c.(1156-1158)gCg>gTg	p.A386V	RAD23B_ENST00000416373.2_Missense_Mutation_p.A314V	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	386	UBA 2. {ECO:0000255|PROSITE- ProRule:PRU00212}.				DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)	p.A386V(1)		breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						GTGATACAAGCGTATTTTGCT	0.333								Direct reversal of damage;Nucleotide excision repair (NER)																													p.A386V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1157T	9						.						86.0	87.0	87.0					9																	110091864		2203	4300	6503	109131685	SO:0001583	missense	5887	exon10				CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.1157C>T	9.37:g.110091864C>T	ENSP00000350708:p.Ala386Val	Somatic		Capture	Illumina HiSeq	Phase_I	109131685	NM_002874	B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	ENST00000358015.3	37	CCDS6769.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205755	0.79127	.	.	ENSG00000119318	ENST00000358015;ENST00000416373	T;T	0.64438	-0.1;-0.1	4.85	4.85	0.62838	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.75737	0.3890	L	0.55213	1.73	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.954	T	0.76252	-0.3027	10	0.48119	T	0.1	-0.4639	18.3185	0.90229	0.0:1.0:0.0:0.0	.	365;386	B7Z4W4;P54727	.;RD23B_HUMAN	V	386;314	ENSP00000350708:A386V;ENSP00000405623:A314V	ENSP00000350708:A386V	A	+	2	0	RAD23B	109131685	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.459000	0.80802	2.399000	0.81585	0.563000	0.77884	GCG		0.333	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053548.1	NM_002874	
CD274	29126	broad.mit.edu	37	9	5465594	5465594	+	Missense_Mutation	SNP	C	C	T	rs568608390		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr9:5465594C>T	ENST00000381577.3	+	5	864	c.778C>T	c.(778-780)Cgt>Tgt	p.R260C	CD274_ENST00000381573.4_Missense_Mutation_p.R146C|CD274_ENST00000498261.1_Intron	NM_014143.3	NP_054862.1	Q9NZQ7	PD1L1_HUMAN	CD274 molecule	260					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R260C(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		ATTCATCTTCCGTTTAAGAAA	0.458			T	CIITA	"""PMBL, Hodgkin Lymphona, """								T|||	1	0.000199681	0.0	0.0	5008	,	,		21712	0.0		0.0	False		,,,				2504	0.001				p.R260C			Dom	yes		9	9p24	29126	CD274 molecule		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C778T	9						.						160.0	136.0	144.0					9																	5465594		2203	4300	6503	5455594	SO:0001583	missense	29126	exon5			AF177937	CCDS6464.1, CCDS59118.1	9p24.1	2014-01-30	2006-03-28	2005-02-25	ENSG00000120217	ENSG00000120217		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17635	protein-coding gene	gene with protein product	"""B7 homolog 1"""	605402	"""programmed cell death 1 ligand 1"", ""CD274 antigen"""	PDCD1LG1		11015443, 10581077	Standard	NM_014143		Approved	B7-H, B7H1, PD-L1, PDL1, B7-H1	uc003zje.3	Q9NZQ7	OTTHUMG00000019503	ENST00000381577.3:c.778C>T	9.37:g.5465594C>T	ENSP00000370989:p.Arg260Cys	Somatic		Capture	Illumina HiSeq	Phase_I	5455594	NM_014143	B2RBA2|B4DU27|Q14CJ2|Q2V8D5|Q66RK1|Q6WEX4|Q9NUZ5	Missense_Mutation	SNP	ENST00000381577.3	37	CCDS6464.1	.	.	.	.	.	.	.	.	.	.	T	8.302	0.820133	0.16678	.	.	ENSG00000120217	ENST00000381573;ENST00000381577	T;T	0.33216	1.42;5.13	4.44	3.3	0.37823	.	1.169200	0.06169	N	0.677305	T	0.12944	0.0314	N	0.01668	-0.77	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26087	-1.0113	10	0.37606	T	0.19	-41.7511	6.3369	0.21300	0.0:0.2078:0.0:0.7922	.	146;260	Q2V8D5;Q9NZQ7	.;PD1L1_HUMAN	C	146;260	ENSP00000370985:R146C;ENSP00000370989:R260C	ENSP00000370985:R146C	R	+	1	0	CD274	5455594	0.014000	0.17966	0.004000	0.12327	0.001000	0.01503	0.481000	0.22260	0.324000	0.23333	-0.360000	0.07572	CGT		0.458	CD274-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051631.2	NM_014143	
HAUS6	54801	broad.mit.edu	37	9	19058052	19058052	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr9:19058052G>A	ENST00000380502.3	-	16	3180	c.2713C>T	c.(2713-2715)Cgg>Tgg	p.R905W	HAUS6_ENST00000380496.1_Missense_Mutation_p.R769W	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	905					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.R905W(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAAAGAGACCGTTTTCTTTCA	0.383																																					p.R905W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2713T	9						.						135.0	128.0	130.0					9																	19058052		2203	4300	6503	19048052	SO:0001583	missense	54801	exon16			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.2713C>T	9.37:g.19058052G>A	ENSP00000369871:p.Arg905Trp	Somatic		Capture	Illumina HiSeq	Phase_I	19048052	NM_017645	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781807	0.70222	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	T;T	0.25414	1.8;1.81	4.93	4.93	0.64822	.	1.067580	0.07115	N	0.842929	T	0.40473	0.1118	L	0.51422	1.61	0.29597	N	0.848007	D;D;D	0.65815	0.987;0.987;0.995	P;P;P	0.50049	0.534;0.534;0.629	T	0.47142	-0.9140	10	0.62326	D	0.03	0.051	18.0023	0.89201	0.0:0.0:1.0:0.0	.	870;769;905	Q7Z4H7-3;Q5VY60;Q7Z4H7	.;.;HAUS6_HUMAN	W	905;769	ENSP00000369871:R905W;ENSP00000369865:R769W	ENSP00000369865:R769W	R	-	1	2	HAUS6	19048052	0.911000	0.30947	0.978000	0.43139	0.771000	0.43674	1.819000	0.39022	2.662000	0.90505	0.467000	0.42956	CGG		0.383	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
DMRTA1	63951	broad.mit.edu	37	9	22451794	22451794	+	Missense_Mutation	SNP	C	C	T	rs148996315		TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr9:22451794C>T	ENST00000325870.2	+	2	1624	c.1399C>T	c.(1399-1401)Cgg>Tgg	p.R467W		NM_022160.2	NP_071443.2	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	467					male mating behavior (GO:0060179)|ovarian follicle development (GO:0001541)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R467W(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		CTTACCTTTTCGGCCAGCTTT	0.428													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19343	0.0		0.0	False		,,,				2504	0.0				p.R467W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1399T	9						.	C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	105.0	93.0	97.0		1399	4.0	1.0	9	dbSNP_134	97	0,8600		0,0,4300	no	missense	DMRTA1	NM_022160.2	101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	467/505	22451794	2,13004	2203	4300	6503	22441794	SO:0001583	missense	63951	exon2			AJ290954	CCDS6514.1	9p21.3	2008-05-15			ENSG00000176399	ENSG00000176399			13826	protein-coding gene	gene with protein product		614803					Standard	NM_022160		Approved		uc003zpp.1	Q5VZB9	OTTHUMG00000019693	ENST00000325870.2:c.1399C>T	9.37:g.22451794C>T	ENSP00000319651:p.Arg467Trp	Somatic		Capture	Illumina HiSeq	Phase_I	22441794	NM_022160	A1L481|Q8N8Y9|Q9H4B9	Missense_Mutation	SNP	ENST00000325870.2	37	CCDS6514.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909379	0.72868	4.54E-4	0.0	ENSG00000176399	ENST00000325870	T	0.47528	0.84	5.92	4.04	0.47022	.	0.290766	0.29876	N	0.010970	T	0.68146	0.2969	M	0.80982	2.52	0.43377	D	0.995472	D	0.89917	1.0	D	0.65987	0.94	T	0.72880	-0.4158	10	0.87932	D	0	-9.986	14.2881	0.66258	0.2717:0.7283:0.0:0.0	.	467	Q5VZB9	DMRTA_HUMAN	W	467	ENSP00000319651:R467W	ENSP00000319651:R467W	R	+	1	2	DMRTA1	22441794	0.996000	0.38824	1.000000	0.80357	0.972000	0.66771	1.238000	0.32707	0.794000	0.33899	0.650000	0.86243	CGG		0.428	DMRTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051935.2		
GTF3C5	9328	broad.mit.edu	37	9	135933281	135933281	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chr9:135933281G>T	ENST00000372097.5	+	11	1797	c.1474G>T	c.(1474-1476)Gag>Tag	p.E492*	GTF3C5_ENST00000342018.8_Nonsense_Mutation_p.E430*|GTF3C5_ENST00000372108.5_Nonsense_Mutation_p.E499*|GTF3C5_ENST00000372099.6_Nonsense_Mutation_p.E483*	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	492	Glu-rich.|Poly-Glu.				5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.E492*(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		ggaggatgaggaggaggagga	0.572																																					p.E499X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1495T	9						.						92.0	74.0	80.0					9																	135933281		2203	4300	6503	134923102	SO:0001587	stop_gained	9328	exon12			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.1474G>T	9.37:g.135933281G>T	ENSP00000361169:p.Glu492*	Somatic		Capture	Illumina HiSeq	Phase_I	134923102	NM_001122823	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Nonsense_Mutation	SNP	ENST00000372097.5	37	CCDS6958.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352558	0.61293	.	.	ENSG00000148308	ENST00000372097;ENST00000372099;ENST00000372108;ENST00000342018	.	.	.	4.99	4.09	0.47781	.	0.517876	0.20105	N	0.099149	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-8.1757	12.6314	0.56659	0.0815:0.0:0.9185:0.0	.	.	.	.	X	492;483;499;430	.	ENSP00000339530:E430X	E	+	1	0	GTF3C5	134923102	1.000000	0.71417	0.021000	0.16686	0.196000	0.23810	9.291000	0.96070	1.079000	0.41038	0.491000	0.48974	GAG		0.572	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	
PRPS2	5634	broad.mit.edu	37	X	12817462	12817462	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chrX:12817462G>T	ENST00000380668.5	+	2	387	c.259G>T	c.(259-261)Gcc>Tcc	p.A87S	PRPS2_ENST00000489404.1_Missense_Mutation_p.A87S|PRPS2_ENST00000398491.2_Missense_Mutation_p.A87S	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	87					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.A87S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						CAGAGTAACTGCCGTGATCCC	0.502																																					p.A87S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G259T	X						.						158.0	136.0	143.0					X																	12817462		2203	4300	6503	12727383	SO:0001583	missense	5634	exon2			Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.259G>T	X.37:g.12817462G>T	ENSP00000370043:p.Ala87Ser	Somatic		Capture	Illumina HiSeq	Phase_I	12727383	NM_001039091	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	ENST00000380668.5	37	CCDS14150.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056159	0.76074	.	.	ENSG00000101911	ENST00000380663;ENST00000380668;ENST00000398491;ENST00000489404	D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.97383	0.9144	H	0.98238	4.18	0.80722	D	1	B;P	0.40144	0.375;0.704	P;P	0.52957	0.714;0.712	D	0.98132	1.0431	10	0.87932	D	0	-18.4152	19.1045	0.93287	0.0:0.0:1.0:0.0	.	87;87	P11908;P11908-2	PRPS2_HUMAN;.	S	87	ENSP00000370038:A87S;ENSP00000370043:A87S;ENSP00000381504:A87S;ENSP00000419380:A87S	ENSP00000370038:A87S	A	+	1	0	PRPS2	12727383	1.000000	0.71417	0.088000	0.20740	0.204000	0.24138	9.273000	0.95719	2.462000	0.83206	0.513000	0.50165	GCC		0.502	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
TFDP3	51270	broad.mit.edu	37	X	132351198	132351198	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chrX:132351198C>T	ENST00000310125.4	-	1	1178	c.1090G>A	c.(1090-1092)Ggg>Agg	p.G364R		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	364					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G304R(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					GCCAGCATCCCAATCGCAATG	0.562																																					p.G364R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1090A	X						.						106.0	104.0	105.0					X																	132351198		2203	4300	6503	132178864	SO:0001583	missense	51270	exon1			AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.1090G>A	X.37:g.132351198C>T	ENSP00000385461:p.Gly364Arg	Somatic		Capture	Illumina HiSeq	Phase_I	132178864	NM_016521	Q6DK49|Q9NZ54	Missense_Mutation	SNP	ENST00000310125.4	37	CCDS14636.2	.	.	.	.	.	.	.	.	.	.	C	6.460	0.452975	0.12283	.	.	ENSG00000183434	ENST00000310125	T	0.31510	1.49	0.602	0.602	0.17535	.	.	.	.	.	T	0.21186	0.0510	L	0.45137	1.4	0.36397	D	0.862902	B	0.14805	0.011	B	0.15870	0.014	T	0.18524	-1.0334	9	0.62326	D	0.03	.	2.895	0.05688	0.0:0.624:0.0:0.376	.	364	Q5H9I0	TFDP3_HUMAN	R	364	ENSP00000385461:G364R	ENSP00000385461:G364R	G	-	1	0	TFDP3	132178864	1.000000	0.71417	0.005000	0.12908	0.004000	0.04260	2.483000	0.45233	0.543000	0.28864	0.292000	0.19580	GGG		0.562	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	NM_016521	
KAL1	3730	broad.mit.edu	37	X	8538695	8538695	+	Missense_Mutation	SNP	C	C	T	rs144634904	byFrequency	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chrX:8538695C>T	ENST00000262648.3	-	7	1056	c.907G>A	c.(907-909)Gtc>Atc	p.V303I		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	303	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V303I(2)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						TCACTGTTGACGGTGGAGTTG	0.522																																					p.V303I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G907A	X						.	C	ILE/VAL	0,3835		0,0,0,1632,571	57.0	46.0	50.0		907	-7.1	0.0	X	dbSNP_134	50	1,6727		0,0,1,2428,1871	no	missense	KAL1	NM_000216.2	29	0,0,1,4060,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	benign	303/681	8538695	1,10562	2203	4300	6503	8498695	SO:0001583	missense	3730	exon7				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.907G>A	X.37:g.8538695C>T	ENSP00000262648:p.Val303Ile	Somatic		Capture	Illumina HiSeq	Phase_I	8498695	NM_000216	B2RPF8	Missense_Mutation	SNP	ENST00000262648.3	37	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.118920	0.00346	0.0	1.49E-4	ENSG00000011201	ENST00000262648	T	0.59502	0.26	4.11	-7.11	0.01542	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.246520	0.05408	N	0.541834	T	0.44477	0.1295	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.38156	-0.9674	10	0.13470	T	0.59	-1.0617	14.1879	0.65617	0.0:0.4689:0.0:0.5311	.	303	P23352	KALM_HUMAN	I	303	ENSP00000262648:V303I	ENSP00000262648:V303I	V	-	1	0	KAL1	8498695	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.370000	0.07523	-1.977000	0.00994	-0.507000	0.04495	GTC		0.522	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	
SYP	6855	broad.mit.edu	37	X	49054293	49054293	+	Silent	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chrX:49054293G>A	ENST00000263233.4	-	3	180	c.108C>T	c.(106-108)ttC>ttT	p.F36F	SYP_ENST00000538567.1_Intron|SYP-AS1_ENST00000433499.1_RNA|SYP_ENST00000479808.1_Silent_p.F36F	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	36	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)	p.F36F(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				CGAAGATGGCGAAGACCTTGG	0.622																																					p.F36F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C108T	X						.						63.0	35.0	45.0					X																	49054293		2203	4300	6503	48941237	SO:0001819	synonymous_variant	6855	exon3			X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.108C>T	X.37:g.49054293G>A		Somatic		Capture	Illumina HiSeq	Phase_I	48941237	NM_003179	B2R7L6|B7Z359|Q6P2F7	Silent	SNP	ENST00000263233.4	37	CCDS14321.1																																																																																				0.622	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083625.2	NM_003179	
PAGE2	203569	broad.mit.edu	37	X	55116494	55116494	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chrX:55116494G>A	ENST00000374968.4	+	2	145	c.41G>A	c.(40-42)aGa>aAa	p.R14K	PAGE2_ENST00000374965.1_Missense_Mutation_p.R14K	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)	14								p.R14K(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						TCCTCAGAAAGAGGAAATGAC	0.328																																					p.R14K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G41A	X						.						89.0	78.0	82.0					X																	55116494		2168	4294	6462	55133219	SO:0001583	missense	203569	exon2			BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.41G>A	X.37:g.55116494G>A	ENSP00000364107:p.Arg14Lys	Somatic		Capture	Illumina HiSeq	Phase_I	55133219	NM_207339	Q5JRK7|Q5JRK8	Missense_Mutation	SNP	ENST00000374968.4	37	CCDS14367.1	.	.	.	.	.	.	.	.	.	.	g	13.08	2.129790	0.37630	.	.	ENSG00000234068	ENST00000374968;ENST00000374965;ENST00000449097	T;T;T	0.14022	2.54;2.54;2.54	0.921	0.921	0.19403	.	.	.	.	.	T	0.30696	0.0773	M	0.78637	2.42	0.09310	N	1	D	0.63046	0.992	D	0.76071	0.987	T	0.07139	-1.0788	9	0.38643	T	0.18	.	4.885	0.13699	0.0:0.0:1.0:0.0	.	14	Q7Z2X7	GGEE2_HUMAN	K	14	ENSP00000364107:R14K;ENSP00000364104:R14K;ENSP00000392976:R14K	ENSP00000364104:R14K	R	+	2	0	PAGE2	55133219	0.001000	0.12720	0.006000	0.13384	0.146000	0.21551	-0.266000	0.08631	0.736000	0.32559	0.181000	0.17075	AGA		0.328	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056857.1	NM_207339	
POU3F4	5456	broad.mit.edu	37	X	82763851	82763851	+	Silent	SNP	C	C	T			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chrX:82763851C>T	ENST00000373200.2	+	1	583	c.519C>T	c.(517-519)ggC>ggT	p.G173G	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	173					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G173G(2)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CGGATCACGGCGAACTGGGCT	0.607																																					p.G173G												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C519T	X						.						22.0	22.0	22.0					X																	82763851		2203	4299	6502	82650507	SO:0001819	synonymous_variant	5456	exon1			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.519C>T	X.37:g.82763851C>T		Somatic		Capture	Illumina HiSeq	Phase_I	82650507	NM_000307	B2RC71|Q5H9G9|Q99410	Silent	SNP	ENST00000373200.2	37	CCDS14450.1																																																																																				0.607	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
MAGEC1	9947	broad.mit.edu	37	X	140995680	140995680	+	Silent	SNP	T	T	A			TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3684-01A-02W-0900-09	TCGA-AA-3684-10A-01W-0900-09	g.chrX:140995680T>A	ENST00000285879.4	+	4	2776	c.2490T>A	c.(2488-2490)ccT>ccA	p.P830P	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	830								p.P830P(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGTTCTCCTGTGAGCTCCT	0.567										HNSCC(15;0.026)																											p.P830P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2490A	X						.						137.0	140.0	139.0					X																	140995680		2203	4300	6503	140823346	SO:0001819	synonymous_variant	9947	exon4			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2490T>A	X.37:g.140995680T>A		Somatic		Capture	Illumina HiSeq	Phase_I	140823346	NM_005462	A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																				0.567	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
