#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MGEA5	10724	broad.mit.edu	37	10	103563619	103563619	+	Silent	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:103563619G>A	ENST00000361464.3	-	7	1304	c.909C>T	c.(907-909)ctC>ctT	p.L303L	MGEA5_ENST00000439817.1_Silent_p.L303L|MGEA5_ENST00000370094.3_Silent_p.L303L|MGEA5_ENST00000357797.5_Silent_p.L303L	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	303					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)	p.L303L(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		ACCGTGGGATGAGTTCTGTGG	0.418																																					p.L303L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C909T	10						.						206.0	194.0	198.0					10																	103563619		2203	4300	6503	103553609	SO:0001819	synonymous_variant	10724	exon7			AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.909C>T	10.37:g.103563619G>A		Somatic		Capture	Illumina HiSeq	Phase_I	103553609	NM_012215	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Silent	SNP	ENST00000361464.3	37	CCDS7520.1																																																																																				0.418	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
C10orf76	79591	broad.mit.edu	37	10	103607293	103607293	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:103607293T>C	ENST00000370033.4	-	26	2181	c.2062A>G	c.(2062-2064)Atc>Gtc	p.I688V	C10orf76_ENST00000495001.1_5'UTR	NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	688						integral component of membrane (GO:0016021)		p.I688V(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		CCTCAGGAGATAGTGGAGAAC	0.602																																					p.I688V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2062G	10						.						106.0	112.0	110.0					10																	103607293		1993	4169	6162	103597283	SO:0001583	missense	79591	exon26			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.2062A>G	10.37:g.103607293T>C	ENSP00000359050:p.Ile688Val	Somatic		Capture	Illumina HiSeq	Phase_I	103597283	NM_024541	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	37	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.064697	0.76187	.	.	ENSG00000120029	ENST00000370033	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.57725	0.2073	M	0.64997	1.995	0.80722	D	1	P	0.45902	0.868	B	0.40940	0.344	T	0.62835	-0.6770	9	0.52906	T	0.07	-14.1052	15.9721	0.80027	0.0:0.0:0.0:1.0	.	688	Q5T2E6	CJ076_HUMAN	V	688	.	ENSP00000359050:I688V	I	-	1	0	C10orf76	103597283	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.520000	0.81821	2.257000	0.74773	0.459000	0.35465	ATC		0.602	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
TCF7L2	6934	broad.mit.edu	37	10	114901015	114901015	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:114901015G>T	ENST00000355995.4	+	6	1132	c.625G>T	c.(625-627)Gaa>Taa	p.E209*	TCF7L2_ENST00000369395.1_Nonsense_Mutation_p.E234*|TCF7L2_ENST00000543371.1_Nonsense_Mutation_p.E209*|TCF7L2_ENST00000369389.1_5'Flank|TCF7L2_ENST00000534894.1_Nonsense_Mutation_p.E209*|TCF7L2_ENST00000369397.4_Nonsense_Mutation_p.E186*|TCF7L2_ENST00000349937.2_Nonsense_Mutation_p.E209*|TCF7L2_ENST00000545257.1_Nonsense_Mutation_p.E209*|TCF7L2_ENST00000542695.1_5'UTR|TCF7L2_ENST00000536810.1_Nonsense_Mutation_p.E209*|TCF7L2_ENST00000352065.5_Nonsense_Mutation_p.E186*|TCF7L2_ENST00000538897.1_Nonsense_Mutation_p.E209*|TCF7L2_ENST00000355717.4_Nonsense_Mutation_p.E233*			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	209	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.E186*(1)|p.E233*(1)|p.E209*(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GTACAGCAATGAACACTTCAC	0.567			T	VTI1A	colorectal																																p.E186X			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.G556T	10						.						187.0	154.0	165.0					10																	114901015		2203	4300	6503	114891005	SO:0001587	stop_gained	6934	exon5			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.625G>T	10.37:g.114901015G>T	ENSP00000348274:p.Glu209*	Somatic		Capture	Illumina HiSeq	Phase_I	114891005	NM_001146284	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Nonsense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	g	41	8.590640	0.98877	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000349937;ENST00000352065;ENST00000369395;ENST00000346198	.	.	.	5.45	5.45	0.79879	.	0.114400	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.2015	19.2979	0.94131	0.0:0.0:1.0:0.0	.	.	.	.	X	209;209;209;209;233;209;209;186;209;186;234;203	.	ENSP00000345640:E203X	E	+	1	0	TCF7L2	114891005	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.864000	0.99589	2.559000	0.86315	0.650000	0.86243	GAA		0.567	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
HSPA12A	259217	broad.mit.edu	37	10	118434523	118434523	+	Silent	SNP	G	G	A	rs367596673	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:118434523G>A	ENST00000369209.3	-	12	1901	c.1797C>T	c.(1795-1797)gtC>gtT	p.V599V	RP11-498B4.5_ENST00000433600.1_RNA	NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	599						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.V1220V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		AGATGTTGATGACAATGACCA	0.572													G|||	7	0.00139776	0.0045	0.0014	5008	,	,		17838	0.0		0.0	False		,,,				2504	0.0				p.V599V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1797T	10						.	G		13,4177		1,11,2083	84.0	89.0	88.0		1797	4.0	1.0	10		88	0,8424		0,0,4212	no	coding-synonymous	HSPA12A	NM_025015.2		1,11,6295	AA,AG,GG		0.0,0.3103,0.1031		599/676	118434523	13,12601	2095	4212	6307	118424513	SO:0001819	synonymous_variant	259217	exon12			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1797C>T	10.37:g.118434523G>A		Somatic		Capture	Illumina HiSeq	Phase_I	118424513	NM_025015		Silent	SNP	ENST00000369209.3	37	CCDS41569.1																																																																																				0.572	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015	
CPXM2	119587	broad.mit.edu	37	10	125521583	125521583	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:125521583C>T	ENST00000241305.3	-	11	1736	c.1582G>A	c.(1582-1584)Gac>Aac	p.D528N	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	528					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.D528N(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CGCACCAGGTCGTAGGGGTAC	0.647																																					p.D528N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1582A	10						.						77.0	78.0	78.0					10																	125521583		2203	4300	6503	125511573	SO:0001583	missense	119587	exon11			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1582G>A	10.37:g.125521583C>T	ENSP00000241305:p.Asp528Asn	Somatic		Capture	Illumina HiSeq	Phase_I	125511573	NM_198148	B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	37	CCDS7637.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280304	0.80692	.	.	ENSG00000121898	ENST00000368854;ENST00000241305;ENST00000540123;ENST00000418782	T	0.03607	3.87	5.25	4.36	0.52297	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.16811	0.0404	H	0.96943	3.91	0.58432	D	0.999994	B	0.31949	0.348	B	0.38458	0.274	T	0.02991	-1.1085	10	0.87932	D	0	-1.7698	13.9495	0.64106	0.0:0.9274:0.0:0.0726	.	528	Q8N436	CPXM2_HUMAN	N	24;528;361;503	ENSP00000241305:D528N	ENSP00000241305:D528N	D	-	1	0	CPXM2	125511573	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	7.544000	0.82117	1.456000	0.47831	-0.192000	0.12808	GAC		0.647	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
CUBN	8029	broad.mit.edu	37	10	16970253	16970253	+	Silent	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:16970253G>T	ENST00000377833.4	-	41	6239	c.6174C>A	c.(6172-6174)atC>atA	p.I2058I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2058	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.I2058I(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGGCCCAGGGATCTCTCTGC	0.483																																					p.I2058I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6174A	10						.						70.0	66.0	67.0					10																	16970253		2203	4300	6503	17010259	SO:0001819	synonymous_variant	8029	exon41			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6174C>A	10.37:g.16970253G>T		Somatic		Capture	Illumina HiSeq	Phase_I	17010259	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1																																																																																				0.483	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
MLLT10	8028	broad.mit.edu	37	10	21884349	21884349	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:21884349C>T	ENST00000307729.7	+	5	563	c.385C>T	c.(385-387)Ccg>Tcg	p.P129S	MLLT10_ENST00000377059.3_Missense_Mutation_p.P129S|MLLT10_ENST00000495130.1_3'UTR|MLLT10_ENST00000377072.3_Missense_Mutation_p.P129S|MLLT10_ENST00000446906.2_Missense_Mutation_p.P129S			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	129	Self-association.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P129S(1)		NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						ACAGTCTGTTCCGCATGATCG	0.348			T	"""MLL, PICALM, CDK6"""	AL																																p.P129S			Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C385T	10						.						99.0	91.0	94.0					10																	21884349		2203	4300	6503	21924355	SO:0001583	missense	8028	exon4			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.385C>T	10.37:g.21884349C>T	ENSP00000307411:p.Pro129Ser	Somatic		Capture	Illumina HiSeq	Phase_I	21924355	NM_001195626	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	ENST00000307729.7	37	CCDS55708.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733689	0.89482	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000377059	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	4.1	4.1	0.47936	.	0.069317	0.64402	U	0.000018	T	0.30541	0.0768	M	0.79693	2.465	0.80722	D	1	P;P;P	0.44380	0.834;0.785;0.834	P;P;P	0.49421	0.61;0.567;0.61	T	0.28332	-1.0047	10	0.72032	D	0.01	.	16.4955	0.84242	0.0:1.0:0.0:0.0	.	129;129;129	E9PBP4;Q5VX90;P55197	.;.;AF10_HUMAN	S	129	ENSP00000366272:P129S;ENSP00000401406:P129S;ENSP00000307411:P129S;ENSP00000366258:P129S	ENSP00000307411:P129S	P	+	1	0	MLLT10	21924355	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.647000	0.83462	2.098000	0.63641	0.313000	0.20887	CCG		0.348	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1		
GPR158	57512	broad.mit.edu	37	10	25877984	25877984	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:25877984G>A	ENST00000376351.3	+	8	2161	c.1802G>A	c.(1801-1803)cGg>cAg	p.R601Q		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	601					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R601Q(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TATGCAGTGCGGACAGTCCCA	0.403																																					p.R601Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1802A	10						.						114.0	106.0	109.0					10																	25877984		2203	4300	6503	25917990	SO:0001583	missense	57512	exon8			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1802G>A	10.37:g.25877984G>A	ENSP00000365529:p.Arg601Gln	Somatic		Capture	Illumina HiSeq	Phase_I	25917990	NM_020752	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	35	5.513191	0.96402	.	.	ENSG00000151025	ENST00000376351	D	0.91124	-2.79	4.94	4.94	0.65067	GPCR, family 3, C-terminal (2);	0.082130	0.48767	D	0.000171	D	0.96147	0.8744	M	0.88906	2.99	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	D	0.96878	0.9644	10	0.87932	D	0	.	18.5361	0.91011	0.0:0.0:1.0:0.0	.	601	Q5T848	GP158_HUMAN	Q	601	ENSP00000365529:R601Q	ENSP00000365529:R601Q	R	+	2	0	GPR158	25917990	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.406000	0.97321	2.447000	0.82792	0.655000	0.94253	CGG		0.403	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
LDB3	11155	broad.mit.edu	37	10	88441414	88441414	+	Silent	SNP	C	C	T	rs148324530		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:88441414C>T	ENST00000361373.4	+	4	564	c.543C>T	c.(541-543)ctC>ctT	p.L181L	LDB3_ENST00000458213.2_Intron|LDB3_ENST00000372066.3_Intron|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000372056.4_Silent_p.L181L|LDB3_ENST00000429277.2_Silent_p.L181L|LDB3_ENST00000542786.1_Silent_p.L181L|LDB3_ENST00000310944.6_Silent_p.L181L|LDB3_ENST00000352360.5_Intron	NM_007078.2	NP_009009.1			LIM domain binding 3									p.L181L(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						GGGACCTACTCGGCCCAAAAG	0.677																																					p.L181L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C543T	10						.	C	,,,,,	0,4406		0,0,2203	27.0	33.0	31.0		,543,,543,543,543	-2.4	0.0	10	dbSNP_134	31	1,8595		0,1,4297	no	intron,coding-synonymous,intron,coding-synonymous,coding-synonymous,coding-synonymous	LDB3	NM_001080114.1,NM_001080115.1,NM_001080116.1,NM_001171610.1,NM_001171611.1,NM_007078.2	,,,,,	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,,,,,	,181/331,,181/733,181/399,181/728	88441414	1,13001	2203	4298	6501	88431394	SO:0001819	synonymous_variant	11155	exon4			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.543C>T	10.37:g.88441414C>T		Somatic		Capture	Illumina HiSeq	Phase_I	88431394	NM_001080115		Silent	SNP	ENST00000361373.4	37	CCDS7377.1																																																																																				0.677	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
CHST15	51363	broad.mit.edu	37	10	125805389	125805389	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr10:125805389C>T	ENST00000346248.5	-	2	982	c.340G>A	c.(340-342)Gga>Aga	p.G114R	CHST15_ENST00000421115.1_Missense_Mutation_p.G114R|CHST15_ENST00000435907.1_Missense_Mutation_p.G114R|CHST15_ENST00000462406.1_5'Flank	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	114					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)	p.G114R(1)		endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						GGGAAGCCTCCGTAATGGAAA	0.453																																					p.G114R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340A	10						.						106.0	118.0	114.0					10																	125805389		2203	4300	6503	125795379	SO:0001583	missense	51363	exon2			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.340G>A	10.37:g.125805389C>T	ENSP00000333947:p.Gly114Arg	Somatic		Capture	Illumina HiSeq	Phase_I	125795379	NM_015892	O60338|O60474|Q86VM4	Missense_Mutation	SNP	ENST00000346248.5	37	CCDS7638.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.643829	0.29246	.	.	ENSG00000182022	ENST00000346248;ENST00000435907;ENST00000434607;ENST00000546346;ENST00000421115	.	.	.	5.56	3.33	0.38152	.	0.312791	0.36303	N	0.002664	T	0.16727	0.0402	N	0.04508	-0.205	0.09310	N	1	B;B	0.17667	0.023;0.007	B;B	0.12156	0.007;0.002	T	0.15407	-1.0438	9	0.46703	T	0.11	-6.8023	8.8147	0.34989	0.0:0.7235:0.1346:0.1419	.	114;114	Q7LFX5-2;Q7LFX5	.;CHSTF_HUMAN	R	114	.	ENSP00000333947:G114R	G	-	1	0	CHST15	125795379	0.095000	0.21747	0.169000	0.22859	0.798000	0.45092	1.812000	0.38952	1.317000	0.45149	0.555000	0.69702	GGA		0.453	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	NM_015892	
ARHGAP20	57569	broad.mit.edu	37	11	110561320	110561320	+	Silent	SNP	G	G	A	rs150049858	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:110561320G>A	ENST00000260283.4	-	3	422	c.138C>T	c.(136-138)agC>agT	p.S46S	ARHGAP20_ENST00000357139.3_Silent_p.S20S|ARHGAP20_ENST00000528829.1_Silent_p.S10S|ARHGAP20_ENST00000524756.1_Silent_p.S23S|ARHGAP20_ENST00000527598.1_Silent_p.S10S|ARHGAP20_ENST00000533353.1_Silent_p.S20S	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	46					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.S46S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GAGATGGAGCGCTCCTCCTCC	0.388																																					p.S46S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C138T	11						.	G		4,4398	8.1+/-20.4	0,4,2197	122.0	103.0	110.0		138	-3.6	0.9	11	dbSNP_134	110	0,8594		0,0,4297	yes	coding-synonymous	ARHGAP20	NM_020809.2		0,4,6494	AA,AG,GG		0.0,0.0909,0.0308		46/1192	110561320	4,12992	2201	4297	6498	110066530	SO:0001819	synonymous_variant	57569	exon3			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.138C>T	11.37:g.110561320G>A		Somatic		Capture	Illumina HiSeq	Phase_I	110066530	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Silent	SNP	ENST00000260283.4	37	CCDS31673.1																																																																																				0.388	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
HYOU1	10525	broad.mit.edu	37	11	118925720	118925720	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:118925720G>A	ENST00000404233.3	-	6	596	c.472C>T	c.(472-474)Cgt>Tgt	p.R158C	HYOU1_ENST00000525859.1_Missense_Mutation_p.R158C|HYOU1_ENST00000529972.1_Missense_Mutation_p.R158C|HYOU1_ENST00000543287.1_Missense_Mutation_p.R71C	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	158					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.R158C(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		GCTAGAGAACGAGAATAATTG	0.537																																					p.R158C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C472T	11						.						117.0	98.0	105.0					11																	118925720		2200	4295	6495	118430930	SO:0001583	missense	10525	exon6			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.472C>T	11.37:g.118925720G>A	ENSP00000384144:p.Arg158Cys	Somatic		Capture	Illumina HiSeq	Phase_I	118430930	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	37	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418794	0.83559	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.01106	5.33;5.33;5.33;5.33;5.33	4.96	4.96	0.65561	.	0.049673	0.85682	D	0.000000	T	0.04724	0.0128	M	0.87038	2.855	0.80722	D	1	D;P;P;P	0.53151	0.958;0.839;0.928;0.928	P;B;P;P	0.48063	0.565;0.33;0.565;0.565	T	0.08330	-1.0727	10	0.87932	D	0	-8.7309	16.5649	0.84576	0.0:0.0:1.0:0.0	.	149;202;158;158	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	C	158;149;158;158;7;158;201;71;158	ENSP00000384144:R158C;ENSP00000437313:R158C;ENSP00000433397:R158C;ENSP00000442727:R71C;ENSP00000431874:R158C	ENSP00000278752:R149C	R	-	1	0	HYOU1	118430930	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	3.777000	0.55364	2.564000	0.86499	0.561000	0.74099	CGT		0.537	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
ARHGEF12	23365	broad.mit.edu	37	11	120352004	120352004	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:120352004C>A	ENST00000397843.2	+	39	4439	c.4273C>A	c.(4273-4275)Cag>Aag	p.Q1425K	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.Q1322K|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.Q1406K	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1425					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q1425K(1)		NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TGACCCAGTGCAGGAGAGTTC	0.478			T	MLL	AML																																p.Q1406K			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4216A	11						.						85.0	82.0	83.0					11																	120352004		1979	4154	6133	119857214	SO:0001583	missense	23365	exon38			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.4273C>A	11.37:g.120352004C>A	ENSP00000380942:p.Gln1425Lys	Somatic		Capture	Illumina HiSeq	Phase_I	119857214	NM_001198665	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442334	0.83993	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.75154	-0.8;-0.91;-0.74	5.98	5.98	0.97165	.	0.145126	0.31897	N	0.006893	T	0.80093	0.4560	L	0.32530	0.975	0.33511	D	0.591119	D	0.54964	0.969	D	0.64877	0.93	T	0.78929	-0.2010	10	0.26408	T	0.33	-12.1739	20.4293	0.99080	0.0:1.0:0.0:0.0	.	1425	Q9NZN5	ARHGC_HUMAN	K	1425;1406;1322	ENSP00000380942:Q1425K;ENSP00000349056:Q1406K;ENSP00000432984:Q1322K	ENSP00000349056:Q1406K	Q	+	1	0	ARHGEF12	119857214	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.024000	0.57218	2.833000	0.97629	0.655000	0.94253	CAG		0.478	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
KRTAP5-5	439915	broad.mit.edu	37	11	1651229	1651229	+	Silent	SNP	G	G	A	rs553119014	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:1651229G>A	ENST00000399676.2	+	1	197	c.159G>A	c.(157-159)gcG>gcA	p.A53A		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.A53A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtgcgggctgtgggg	0.682													g|||	17	0.00339457	0.0045	0.0014	5008	,	,		5663	0.0		0.005	False		,,,				2504	0.0051				p.A53A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G159A	11						.						35.0	47.0	43.0					11																	1651229		2115	4180	6295	1607805	SO:0001819	synonymous_variant	439915	exon1			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.159G>A	11.37:g.1651229G>A		Somatic		Capture	Illumina HiSeq	Phase_I	1607805	NM_001001480	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																				0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
OR51I2	390064	broad.mit.edu	37	11	5475616	5475616	+	Missense_Mutation	SNP	C	C	T	rs202023944	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:5475616C>T	ENST00000341449.2	+	1	979	c.898C>T	c.(898-900)Cgc>Tgc	p.R300C	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	300					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R300C(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAGGAAATCCGCCGAGCCAT	0.443													C|||	2	0.000399361	0.0	0.0	5008	,	,		19524	0.001		0.0	False		,,,				2504	0.001				p.R300C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C898T	11						.						130.0	129.0	129.0					11																	5475616		2201	4297	6498	5432192	SO:0001583	missense	390064	exon1			BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.898C>T	11.37:g.5475616C>T	ENSP00000341987:p.Arg300Cys	Somatic		Capture	Illumina HiSeq	Phase_I	5432192	NM_001004754	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	37	CCDS31383.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.17	2.157088	0.38119	.	.	ENSG00000187918	ENST00000341449	T	0.58358	0.34	5.3	4.35	0.52113	.	0.000000	0.64402	D	0.000014	T	0.75693	0.3884	M	0.89968	3.075	0.44155	D	0.99695	D	0.89917	1.0	D	0.79784	0.993	T	0.80183	-0.1488	10	0.72032	D	0.01	.	13.2713	0.60161	0.1582:0.8418:0.0:0.0	.	300	Q9H344	O51I2_HUMAN	C	300	ENSP00000341987:R300C	ENSP00000341987:R300C	R	+	1	0	OR51I2	5432192	0.568000	0.26635	1.000000	0.80357	0.167000	0.22549	1.895000	0.39778	2.762000	0.94881	0.563000	0.77884	CGC		0.443	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
OR5P2	120065	broad.mit.edu	37	11	7818480	7818480	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:7818480G>T	ENST00000329434.2	-	1	40	c.10C>A	c.(10-12)Ctg>Atg	p.L4M	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L4M(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCGTCCTTCAGGGAATTCATG	0.408																																					p.L4M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10A	11						.						47.0	55.0	52.0					11																	7818480		2095	4291	6386	7775056	SO:0001583	missense	120065	exon1			AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.10C>A	11.37:g.7818480G>T	ENSP00000331823:p.Leu4Met	Somatic		Capture	Illumina HiSeq	Phase_I	7775056	NM_153444	Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	37	CCDS7782.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.774617	0.00640	.	.	ENSG00000183303	ENST00000329434	T	0.00115	8.71	5.2	4.29	0.51040	.	0.363029	0.22658	N	0.057223	T	0.00039	0.0001	N	0.00399	-1.545	0.26313	N	0.977799	B	0.24576	0.106	B	0.27608	0.081	T	0.16424	-1.0403	10	0.02654	T	1	5.2615	6.6417	0.22913	0.0892:0.0:0.7335:0.1773	.	4	Q8WZ92	OR5P2_HUMAN	M	4	ENSP00000331823:L4M	ENSP00000331823:L4M	L	-	1	2	OR5P2	7775056	0.005000	0.15991	0.838000	0.33150	0.003000	0.03518	0.862000	0.27899	1.557000	0.49525	0.555000	0.69702	CTG		0.408	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
KCNA4	3739	broad.mit.edu	37	11	30034118	30034118	+	Silent	SNP	G	G	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:30034118G>C	ENST00000328224.6	-	2	1341	c.108C>G	c.(106-108)tcC>tcG	p.S36S	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	36					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.S36S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CAGCTGCCCTGGAGTGAGCAA	0.657																																					p.S36S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C108G	11						.						39.0	42.0	41.0					11																	30034118		1883	4094	5977	29990694	SO:0001819	synonymous_variant	3739	exon2			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.108C>G	11.37:g.30034118G>C		Somatic		Capture	Illumina HiSeq	Phase_I	29990694	NM_002233		Silent	SNP	ENST00000328224.6	37	CCDS41629.1																																																																																				0.657	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
NPAS4	266743	broad.mit.edu	37	11	66188810	66188810	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:66188810G>A	ENST00000311034.2	+	1	336	c.160G>A	c.(160-162)Gtc>Atc	p.V54I		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	54					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.V54I(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						TCGCAAGGGCGTCTTCTTCGC	0.657																																					p.V54I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G160A	11						.						73.0	61.0	65.0					11																	66188810		2200	4295	6495	65945386	SO:0001583	missense	266743	exon1			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.160G>A	11.37:g.66188810G>A	ENSP00000311196:p.Val54Ile	Somatic		Capture	Illumina HiSeq	Phase_I	65945386	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085215	0.76642	.	.	ENSG00000174576	ENST00000311034	T	0.45276	0.9	5.19	5.19	0.71726	.	0.000000	0.49305	D	0.000149	T	0.43144	0.1234	N	0.19112	0.55	0.58432	D	0.999994	D	0.63880	0.993	P	0.55545	0.778	T	0.24728	-1.0152	10	0.37606	T	0.19	-18.29	16.2538	0.82501	0.0:0.0:1.0:0.0	.	54	Q8IUM7	NPAS4_HUMAN	I	54	ENSP00000311196:V54I	ENSP00000311196:V54I	V	+	1	0	NPAS4	65945386	1.000000	0.71417	0.998000	0.56505	0.835000	0.47333	3.983000	0.56916	2.691000	0.91804	0.563000	0.77884	GTC		0.657	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
CABP4	57010	broad.mit.edu	37	11	67223827	67223827	+	Missense_Mutation	SNP	G	G	A	rs143257000	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:67223827G>A	ENST00000325656.5	+	3	532	c.455G>A	c.(454-456)cGg>cAg	p.R152Q	CABP4_ENST00000438189.2_Missense_Mutation_p.R47Q	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	152	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)	p.R152Q(1)		central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			ATCAGCCACCGGGAGCTGGGT	0.632													G|||	6	0.00119808	0.0045	0.0	5008	,	,		17612	0.0		0.0	False		,,,				2504	0.0				p.R152Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G455A	11						.	G	GLN/ARG	19,4381	26.2+/-53.5	0,19,2181	69.0	64.0	66.0		455	4.1	1.0	11	dbSNP_134	66	0,8590		0,0,4295	yes	missense	CABP4	NM_145200.3	43	0,19,6476	AA,AG,GG		0.0,0.4318,0.1463	possibly-damaging	152/276	67223827	19,12971	2200	4295	6495	66980403	SO:0001583	missense	57010	exon3			AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.455G>A	11.37:g.67223827G>A	ENSP00000324960:p.Arg152Gln	Somatic		Capture	Illumina HiSeq	Phase_I	66980403	NM_145200	Q8N4Z2|Q8WWY5	Missense_Mutation	SNP	ENST00000325656.5	37	CCDS8166.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	17.53	3.413321	0.62511	0.004318	0.0	ENSG00000175544	ENST00000438189;ENST00000325656	T;T	0.61627	0.09;0.09	4.07	4.07	0.47477	EF-hand-like domain (1);	0.067059	0.64402	D	0.000014	T	0.43211	0.1237	L	0.31926	0.97	0.36172	D	0.848814	D;P	0.69078	0.997;0.952	P;B	0.51582	0.674;0.15	T	0.59963	-0.7355	10	0.87932	D	0	-24.7866	6.3437	0.21337	0.2068:0.0:0.7932:0.0	.	152;47	P57796;P57796-2	CABP4_HUMAN;.	Q	47;152	ENSP00000401555:R47Q;ENSP00000324960:R152Q	ENSP00000324960:R152Q	R	+	2	0	CABP4	66980403	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	3.683000	0.54663	2.273000	0.75805	0.561000	0.74099	CGG		0.632	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397624.2		
FOLR1	2348	broad.mit.edu	37	11	71906691	71906691	+	Silent	SNP	C	C	T	rs61735636	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:71906691C>T	ENST00000393679.1	+	4	829	c.393C>T	c.(391-393)aaC>aaT	p.N131N	RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000312293.4_Silent_p.N131N|FOLR1_ENST00000393676.3_Silent_p.N131N|FOLR1_ENST00000393681.2_Silent_p.N131N			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	131					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)	p.N131N(1)		cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	GGGTACTGAACGTGCCCCTGT	0.537																																					p.N131N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C393T	11						.						77.0	67.0	70.0					11																	71906691		2200	4293	6493	71584339	SO:0001819	synonymous_variant	2348	exon5			J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.393C>T	11.37:g.71906691C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71584339	NM_016724	Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Silent	SNP	ENST00000393679.1	37	CCDS8211.1																																																																																				0.537	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396773.1	NM_016725	
KIRREL3	84623	broad.mit.edu	37	11	126333181	126333181	+	Missense_Mutation	SNP	G	G	A	rs370309110		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr11:126333181G>A	ENST00000525144.2	-	6	862	c.613C>T	c.(613-615)Cgg>Tgg	p.R205W	KIRREL3_ENST00000525704.2_Missense_Mutation_p.R205W|KIRREL3_ENST00000529097.2_Missense_Mutation_p.R205W	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	205	Ig-like C2-type 2.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R164W(1)		central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		ATGCTCTCCCGCTTGCCGTCC	0.607																																					p.R205W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C613T	11						.	G	TRP/ARG,TRP/ARG	0,4230		0,0,2115	66.0	67.0	66.0		613,613	4.2	1.0	11		66	1,8445		0,1,4222	no	missense,missense	KIRREL3	NM_001161707.1,NM_032531.3	101,101	0,1,6337	AA,AG,GG		0.0118,0.0,0.0079	probably-damaging,probably-damaging	205/601,205/779	126333181	1,12675	2115	4223	6338	125838391	SO:0001583	missense	84623	exon6			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.613C>T	11.37:g.126333181G>A	ENSP00000435466:p.Arg205Trp	Somatic		Capture	Illumina HiSeq	Phase_I	125838391	NM_032531	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346951	0.61183	0.0	1.18E-4	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.75938	-0.98;-0.98;-0.98	5.1	4.17	0.49024	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87018	0.6073	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.995;0.999	D	0.88443	0.3043	10	0.87932	D	0	.	11.5433	0.50679	0.0:0.0:0.5423:0.4576	.	205;205;205	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	W	205	ENSP00000435466:R205W;ENSP00000434081:R205W;ENSP00000435094:R205W	ENSP00000435466:R205W	R	-	1	2	KIRREL3	125838391	1.000000	0.71417	0.991000	0.47740	0.552000	0.35366	2.961000	0.49168	1.110000	0.41699	0.448000	0.29417	CGG		0.607	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531	
CD163	9332	broad.mit.edu	37	12	7640611	7640611	+	Missense_Mutation	SNP	G	G	T	rs143287536	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:7640611G>T	ENST00000359156.4	-	7	1695	c.1493C>A	c.(1492-1494)aCg>aAg	p.T498K	CD163_ENST00000396620.3_Missense_Mutation_p.T498K|CD163_ENST00000541972.1_Missense_Mutation_p.T486K|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000432237.2_Missense_Mutation_p.T498K	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	498	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.T498K(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	GGAGCCCCACGTGTCACCATG	0.507																																					p.T498K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1493A	12						.						68.0	57.0	61.0					12																	7640611		2203	4300	6503	7531878	SO:0001583	missense	9332	exon7			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1493C>A	12.37:g.7640611G>T	ENSP00000352071:p.Thr498Lys	Somatic		Capture	Illumina HiSeq	Phase_I	7531878	NM_203416	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	g	9.034	0.987950	0.18966	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.33	-3.64	0.04515	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.436520	0.04171	N	0.324879	T	0.22475	0.0542	L	0.38838	1.175	0.09310	N	1	B;B;B	0.14438	0.01;0.001;0.005	B;B;B	0.17098	0.017;0.002;0.007	T	0.22243	-1.0222	10	0.21540	T	0.41	.	7.7796	0.29058	0.1502:0.0:0.3158:0.534	.	498;498;498	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	K	498;486;498;498	ENSP00000352071:T498K;ENSP00000444071:T486K;ENSP00000379863:T498K;ENSP00000403885:T498K	ENSP00000352071:T498K	T	-	2	0	CD163	7531878	0.000000	0.05858	0.000000	0.03702	0.822000	0.46500	-4.973000	0.00164	-0.859000	0.04105	-0.713000	0.03633	ACG		0.507	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
A2ML1	144568	broad.mit.edu	37	12	8990976	8990976	+	Silent	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:8990976C>A	ENST00000299698.7	+	9	1080	c.900C>A	c.(898-900)acC>acA	p.T300T		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.T300T(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						ACATGGCCACCTTTGACCTCA	0.458																																					p.T300T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C900A	12						.						180.0	169.0	172.0					12																	8990976		1965	4166	6131	8882243	SO:0001819	synonymous_variant	144568	exon9			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.900C>A	12.37:g.8990976C>A		Somatic		Capture	Illumina HiSeq	Phase_I	8882243	NM_144670		Silent	SNP	ENST00000299698.7	37	CCDS8596.2																																																																																				0.458	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
PDE3A	5139	broad.mit.edu	37	12	20766410	20766410	+	Missense_Mutation	SNP	G	G	A	rs150253039		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:20766410G>A	ENST00000359062.3	+	3	1085	c.1045G>A	c.(1045-1047)Gtc>Atc	p.V349I	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	349					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.V349I(2)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GGACATCGCCGTCATGGGCGA	0.517													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18125	0.0		0.0	False		,,,				2504	0.0				p.V349I												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G1045A	12						.	G	ILE/VAL	7,4399	12.9+/-30.5	0,7,2196	94.0	85.0	88.0		1045	5.9	1.0	12	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PDE3A	NM_000921.4	29	0,8,6495	AA,AG,GG		0.0116,0.1589,0.0615	probably-damaging	349/1142	20766410	8,12998	2203	4300	6503	20657677	SO:0001583	missense	5139	exon3				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1045G>A	12.37:g.20766410G>A	ENSP00000351957:p.Val349Ile	Somatic		Capture	Illumina HiSeq	Phase_I	20657677	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	29.0	4.967825	0.92855	0.001589	1.16E-4	ENSG00000172572	ENST00000359062	T	0.55413	0.52	5.86	5.86	0.93980	.	3.182960	0.00541	N	0.000228	T	0.78916	0.4359	M	0.71206	2.165	0.58432	D	0.999995	D	0.76494	0.999	D	0.75020	0.985	T	0.62627	-0.6814	10	0.51188	T	0.08	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	349	Q14432	PDE3A_HUMAN	I	349	ENSP00000351957:V349I	ENSP00000351957:V349I	V	+	1	0	PDE3A	20657677	1.000000	0.71417	0.991000	0.47740	0.671000	0.39405	8.848000	0.92172	2.937000	0.99478	0.650000	0.86243	GTC		0.517	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
SSPN	8082	broad.mit.edu	37	12	26377303	26377303	+	Silent	SNP	T	T	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:26377303T>C	ENST00000242729.2	+	2	534	c.357T>C	c.(355-357)ttT>ttC	p.F119F	SSPN_ENST00000422622.2_Silent_p.F16F|SSPN_ENST00000540266.1_Silent_p.F16F|RP11-283G6.4_ENST00000540392.1_RNA|SSPN_ENST00000535504.1_Silent_p.F119F	NM_005086.4	NP_005077.2	Q14714	SSPN_HUMAN	sarcospan	119					cell adhesion (GO:0007155)|muscle contraction (GO:0006936)	cell junction (GO:0030054)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)		p.F119F(1)		kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10	Colorectal(261;0.0847)					GTATTCAATTTTCTATGAAAG	0.378																																					p.F16F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T48C	12						.						310.0	292.0	298.0					12																	26377303		2203	4300	6503	26268570	SO:0001819	synonymous_variant	8082	exon2			AF016028	CCDS8707.1, CCDS44850.1	12p11.2	2014-09-17	2012-03-14			ENSG00000123096			11322	protein-coding gene	gene with protein product		601599	"""Kras oncogene-associated gene"""	KRAG		9395445, 8661122	Standard	NM_005086		Approved	SPN1, SPN2	uc001rhe.3	Q14714		ENST00000242729.2:c.357T>C	12.37:g.26377303T>C		Somatic		Capture	Illumina HiSeq	Phase_I	26268570	NM_001135823	B3KS67	Silent	SNP	ENST00000242729.2	37	CCDS8707.1																																																																																				0.378	SSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402654.2	NM_005086	
TMTC1	83857	broad.mit.edu	37	12	29757203	29757203	+	Silent	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:29757203G>A	ENST00000539277.1	-	7	1216	c.1158C>T	c.(1156-1158)ggC>ggT	p.G386G	TMTC1_ENST00000381224.2_Silent_p.G340G|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000256062.5_Silent_p.G278G|TMTC1_ENST00000551659.1_Silent_p.G448G|TMTC1_ENST00000552618.1_Silent_p.G448G	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	386						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.G278G(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GGAACAACAAGCCGACTAAAA	0.463																																					p.G386G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1158T	12						.						117.0	106.0	109.0					12																	29757203		2203	4300	6503	29648470	SO:0001819	synonymous_variant	83857	exon7				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.1158C>T	12.37:g.29757203G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29648470	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Silent	SNP	ENST00000539277.1	37	CCDS53772.1																																																																																				0.463	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
LRRK2	120892	broad.mit.edu	37	12	40693002	40693002	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:40693002A>T	ENST00000298910.7	+	25	3497	c.3439A>T	c.(3439-3441)Aac>Tac	p.N1147Y	LRRK2_ENST00000343742.2_Missense_Mutation_p.N1147Y	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1147					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.N1147Y(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CCTATCAGAGAACTTTCTTGA	0.418																																					p.N1147Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3439T	12						.						179.0	192.0	188.0					12																	40693002		2203	4300	6503	38979269	SO:0001583	missense	120892	exon25			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3439A>T	12.37:g.40693002A>T	ENSP00000298910:p.Asn1147Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	38979269	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.298960	0.60195	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.72835	2.16;-0.69	5.29	-0.236	0.13067	.	0.429907	0.26297	N	0.025193	T	0.67739	0.2925	L	0.43152	1.355	0.28788	N	0.899481	P;P	0.49783	0.912;0.928	P;P	0.51487	0.671;0.634	T	0.65635	-0.6120	10	0.51188	T	0.08	.	11.2294	0.48903	0.4979:0.0:0.5021:0.0	.	1147;1147	E9PC85;Q5S007	.;LRRK2_HUMAN	Y	1147	ENSP00000341930:N1147Y;ENSP00000298910:N1147Y	ENSP00000298910:N1147Y	N	+	1	0	LRRK2	38979269	0.848000	0.29623	0.610000	0.28997	0.991000	0.79684	1.127000	0.31357	-0.106000	0.12110	0.402000	0.26972	AAC		0.418	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
ARID2	196528	broad.mit.edu	37	12	46246557	46246557	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:46246557G>A	ENST00000334344.6	+	15	4823	c.4651G>A	c.(4651-4653)Gca>Aca	p.A1551T	ARID2_ENST00000457135.1_Missense_Mutation_p.A159T|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Missense_Mutation_p.A1161T|ARID2_ENST00000422737.1_Missense_Mutation_p.A1402T	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1551					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A1551T(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TGGCTGCAGCGCAACAATGGT	0.463			"""N, S, F"""		hepatocellular carcinoma																																p.A1551T			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4651A	12						.						69.0	61.0	63.0					12																	46246557		2203	4300	6503	44532824	SO:0001583	missense	196528	exon15				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4651G>A	12.37:g.46246557G>A	ENSP00000335044:p.Ala1551Thr	Somatic		Capture	Illumina HiSeq	Phase_I	44532824	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957592	0.73902	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T;T	0.43294	0.95;1.54	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.57873	0.2083	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	T	0.56908	-0.7901	10	0.66056	D	0.02	-12.4594	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1551;1161;1551	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	T	1551;668;668;1402;1161;159	ENSP00000335044:A1551T;ENSP00000388357:A159T	ENSP00000335044:A1551T	A	+	1	0	ARID2	44532824	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.460000	0.80816	2.865000	0.98341	0.655000	0.94253	GCA		0.463	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
KRT85	3891	broad.mit.edu	37	12	52758835	52758835	+	Silent	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:52758835C>A	ENST00000257901.3	-	2	615	c.540G>T	c.(538-540)cgG>cgT	p.R180R	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	180	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R180R(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CGGCCTCCCGCCGCAGAGTCT	0.612																																					p.R180R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G540T	12						.						59.0	68.0	65.0					12																	52758835		2203	4300	6503	51045102	SO:0001819	synonymous_variant	3891	exon2			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.540G>T	12.37:g.52758835C>A		Somatic		Capture	Illumina HiSeq	Phase_I	51045102	NM_002283	Q9NSB1	Silent	SNP	ENST00000257901.3	37	CCDS8824.1																																																																																				0.612	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
ERBB3	2065	broad.mit.edu	37	12	56478854	56478854	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:56478854G>A	ENST00000267101.3	+	3	750	c.310G>A	c.(310-312)Gtg>Atg	p.V104M	ERBB3_ENST00000411731.2_Missense_Mutation_p.V104M|ERBB3_ENST00000415288.2_Missense_Mutation_p.V45M|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	104			V -> M (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.V104M(7)|p.V104L(2)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAACCTCCGCGTGGTGCGAGG	0.517																																					p.V104M												ERBB3,ovary,NS,Substitution - Missense,0 	.	9	Substitution - Missense(9)	large_intestine(5)|endometrium(2)|ovary(1)|NS(1)	c.G310A	12						.						186.0	159.0	168.0					12																	56478854		2203	4300	6503	54765121	SO:0001583	missense	2065	exon3			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.310G>A	12.37:g.56478854G>A	ENSP00000267101:p.Val104Met	Somatic		Capture	Illumina HiSeq	Phase_I	54765121	NM_001005915	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103691	0.56291	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	T;T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.82	4.93	0.64822	EGF receptor, L domain (1);	0.096412	0.43416	D	0.000573	D	0.87438	0.6177	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.59221	0.698;0.854	D	0.88227	0.2901	10	0.59425	D	0.04	.	10.6531	0.45659	0.1547:0.0:0.8453:0.0	.	104;104	P21860;P21860-2	ERBB3_HUMAN;.	M	104;45;104;104;104;45;45	ENSP00000448636:V104M;ENSP00000449138:V45M;ENSP00000267101:V104M;ENSP00000415753:V104M;ENSP00000449713:V45M;ENSP00000408340:V45M	ENSP00000267101:V104M	V	+	1	0	ERBB3	54765121	1.000000	0.71417	0.892000	0.35008	0.052000	0.14988	4.300000	0.59079	1.450000	0.47717	0.655000	0.94253	GTG		0.517	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
ACSS3	79611	broad.mit.edu	37	12	81545790	81545790	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:81545790C>A	ENST00000548058.1	+	7	1923	c.1013C>A	c.(1012-1014)gCa>gAa	p.A338E	ACSS3_ENST00000261206.3_Missense_Mutation_p.A337E|ACSS3_ENST00000548324.1_Missense_Mutation_p.A20E			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	338						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.A338E(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						GTGTGGTGGGCAGCTTCTGAC	0.348																																					p.A338E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1013A	12						.						98.0	98.0	98.0					12																	81545790		2203	4300	6503	80069921	SO:0001583	missense	79611	exon7				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1013C>A	12.37:g.81545790C>A	ENSP00000449535:p.Ala338Glu	Somatic		Capture	Illumina HiSeq	Phase_I	80069921	NM_024560	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.841999	0.91197	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.44482	0.92;0.92;0.92	5.74	5.74	0.90152	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.70833	0.3269	M	0.90082	3.085	0.80722	D	1	P;D	0.67145	0.919;0.996	P;P	0.61940	0.636;0.896	T	0.76852	-0.2806	10	0.87932	D	0	-7.9669	19.9187	0.97077	0.0:1.0:0.0:0.0	.	20;338	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	E	338;337;20	ENSP00000449535:A338E;ENSP00000261206:A337E;ENSP00000448965:A20E	ENSP00000261206:A337E	A	+	2	0	ACSS3	80069921	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.784000	0.85713	2.716000	0.92895	0.557000	0.71058	GCA		0.348	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
DNAH10	196385	broad.mit.edu	37	12	124377793	124377793	+	Silent	SNP	G	G	A	rs374138803		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr12:124377793G>A	ENST00000409039.3	+	52	8680	c.8655G>A	c.(8653-8655)gcG>gcA	p.A2885A		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2885	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A1477A(1)|p.A2885A(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TTGTACCTGCGCTTTTTTCTG	0.512																																					p.A2885A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G8655A	12						.	G		0,3930		0,0,1965	56.0	56.0	56.0		8655	-8.0	0.0	12		56	2,8340		0,2,4169	no	coding-synonymous	DNAH10	NM_207437.3		0,2,6134	AA,AG,GG		0.024,0.0,0.0163		2885/4472	124377793	2,12270	1965	4171	6136	122943746	SO:0001819	synonymous_variant	196385	exon52			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.8655G>A	12.37:g.124377793G>A		Somatic		Capture	Illumina HiSeq	Phase_I	122943746	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																				0.512	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
UGGT2	55757	broad.mit.edu	37	13	96553160	96553161	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr13:96553160_96553161insT	ENST00000376747.3	-	22	2604_2605	c.2534_2535insA	c.(2533-2535)tatfs	p.Y845fs		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	845					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.Y845fs*1(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CAACAGTATTATATTTTTTCTC	0.317																																					p.Y845_N846delinsX												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2535_2536insA	13						.																																			95351162	SO:0001589	frameshift_variant	55757	exon22			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.2535dupA	13.37:g.96553161_96553161dupT	ENSP00000365938:p.Tyr845fs	Somatic		Capture	Illumina HiSeq	Phase_I	95351161	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Frame_Shift_Ins	INS	ENST00000376747.3	37	CCDS9480.1																																																																																				0.317	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
IFT88	8100	broad.mit.edu	37	13	21237643	21237643	+	Missense_Mutation	SNP	G	G	A	rs143840290	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr13:21237643G>A	ENST00000319980.6	+	25	2429	c.2102G>A	c.(2101-2103)cGt>cAt	p.R701H	IFT88_ENST00000382778.4_Silent_p.A742A|IFT88_ENST00000351808.5_Missense_Mutation_p.R692H|IFT88_ENST00000537103.1_Missense_Mutation_p.R673H	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	701					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.R701H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		TTAGGTCTGCGTTTCTTAGTT	0.338													G|||	6	0.00119808	0.0	0.0058	5008	,	,		18602	0.002		0.0	False		,,,				2504	0.0				p.R701H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2102A	13						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	105.0	99.0	101.0		2075,2102	5.8	1.0	13	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IFT88	NM_006531.3,NM_175605.3	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	692/825,701/834	21237643	1,13005	2203	4300	6503	20135643	SO:0001583	missense	8100	exon25			AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.2102G>A	13.37:g.21237643G>A	ENSP00000323580:p.Arg701His	Somatic		Capture	Illumina HiSeq	Phase_I	20135643	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701816	0.88924	0.0	1.16E-4	ENSG00000032742	ENST00000351808;ENST00000319980;ENST00000537103	T;T;T	0.53206	0.63;0.63;0.63	5.84	5.84	0.93424	.	0.106704	0.64402	D	0.000004	T	0.72036	0.3411	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.78314	0.855;0.991	T	0.74090	-0.3777	10	0.66056	D	0.02	-12.7827	18.9266	0.92548	0.0:0.0:1.0:0.0	.	673;701	F5H6C2;Q13099	.;IFT88_HUMAN	H	692;701;673	ENSP00000261632:R692H;ENSP00000323580:R701H;ENSP00000437719:R673H	ENSP00000323580:R701H	R	+	2	0	IFT88	20135643	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.539000	0.82063	2.760000	0.94817	0.655000	0.94253	CGT		0.338	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
SACS	26278	broad.mit.edu	37	13	23911660	23911660	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr13:23911660G>A	ENST00000382292.3	-	9	6628	c.6355C>T	c.(6355-6357)Cga>Tga	p.R2119*	SACS_ENST00000382298.3_Nonsense_Mutation_p.R2119*|SACS_ENST00000402364.1_Nonsense_Mutation_p.R1369*			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2119					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.R1972*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTTGCAACTCGTCCTTCGGGG	0.403																																					p.R2119X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C6355T	13						.						56.0	58.0	57.0					13																	23911660		2202	4299	6501	22809660	SO:0001587	stop_gained	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.6355C>T	13.37:g.23911660G>A	ENSP00000371729:p.Arg2119*	Somatic		Capture	Illumina HiSeq	Phase_I	22809660	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Nonsense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	G	56	25.178079	0.99964	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	.	.	.	5.84	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9833	0.35979	0.0721:0.0:0.6856:0.2422	.	.	.	.	X	2119;1369;2119	.	ENSP00000371729:R2119X	R	-	1	2	SACS	22809660	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	4.556000	0.60775	1.472000	0.48140	-0.136000	0.14681	CGA		0.403	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SLITRK5	26050	broad.mit.edu	37	13	88329550	88329550	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr13:88329550C>T	ENST00000325089.6	+	2	2126	c.1907C>T	c.(1906-1908)gCc>gTc	p.A636V	SLITRK5_ENST00000400028.3_Missense_Mutation_p.A395V	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	636					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.A636V(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					AGGACCAGCGCCGTGACTCCT	0.622																																					p.A636V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1907T	13						.						84.0	86.0	85.0					13																	88329550		2203	4300	6503	87127551	SO:0001583	missense	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1907C>T	13.37:g.88329550C>T	ENSP00000366283:p.Ala636Val	Somatic		Capture	Illumina HiSeq	Phase_I	87127551	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.240883	0.22711	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.59083	0.29;0.65	5.47	2.56	0.30785	.	0.206520	0.42294	D	0.000736	T	0.36826	0.0981	N	0.22421	0.69	0.32009	N	0.602334	B;B	0.26195	0.144;0.003	B;B	0.15484	0.013;0.004	T	0.33624	-0.9861	9	.	.	.	-4.1825	8.9063	0.35526	0.0:0.7331:0.0:0.2669	.	395;636	B4DSH5;O94991	.;SLIK5_HUMAN	V	636;395	ENSP00000366283:A636V;ENSP00000442244:A395V	.	A	+	2	0	SLITRK5	87127551	0.860000	0.29831	0.935000	0.37517	0.595000	0.36748	3.232000	0.51302	0.191000	0.20236	0.555000	0.69702	GCC		0.622	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
SALL2	6297	broad.mit.edu	37	14	21992685	21992685	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr14:21992685G>A	ENST00000327430.3	-	2	1471	c.1177C>T	c.(1177-1179)Cgt>Tgt	p.R393C	SALL2_ENST00000450879.2_Missense_Mutation_p.R256C|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000538754.1_Intron|AE000658.22_ENST00000535893.1_RNA	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R393C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GTGTGGGAACGAAGGTGGATC	0.542																																					p.R393C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1177T	14						.						110.0	97.0	102.0					14																	21992685		2203	4300	6503	21062525	SO:0001583	missense	6297	exon2			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1177C>T	14.37:g.21992685G>A	ENSP00000333537:p.Arg393Cys	Somatic		Capture	Illumina HiSeq	Phase_I	21062525	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174268	0.57692	.	.	ENSG00000165821	ENST00000327430;ENST00000450879;ENST00000541876	T;T	0.25749	1.78;1.78	4.3	3.42	0.39159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38605	N	0.001638	T	0.46756	0.1409	M	0.72894	2.215	0.80722	D	1	D;D;B;D	0.89917	1.0;1.0;0.358;1.0	D;D;B;D	0.87578	0.995;0.995;0.111;0.998	T	0.45731	-0.9241	10	0.87932	D	0	-24.515	9.89	0.41285	0.1005:0.0:0.8995:0.0	.	256;256;391;393	B4DK65;E7EW59;B4DFD9;Q9Y467	.;.;.;SALL2_HUMAN	C	393;256;393	ENSP00000333537:R393C;ENSP00000396773:R256C	ENSP00000333537:R393C	R	-	1	0	SALL2	21062525	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.657000	0.98554	1.031000	0.39867	-0.136000	0.14681	CGT		0.542	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
RABGGTA	5875	broad.mit.edu	37	14	24739554	24739554	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr14:24739554C>A	ENST00000399409.3	-	3	708	c.225G>T	c.(223-225)caG>caT	p.Q75H	RABGGTA_ENST00000559586.1_5'UTR|RABGGTA_ENST00000216840.6_Missense_Mutation_p.Q75H|RABGGTA_ENST00000560777.1_5'Flank	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	75					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.Q75H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		GAGTCTCCAGCTGCTGGAGCA	0.597																																					p.Q75H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G225T	14						.						40.0	44.0	43.0					14																	24739554		1984	4167	6151	23809394	SO:0001583	missense	5875	exon3				CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.225G>T	14.37:g.24739554C>A	ENSP00000382341:p.Gln75His	Somatic		Capture	Illumina HiSeq	Phase_I	23809394	NM_004581	A8K5N2|D3DS69	Missense_Mutation	SNP	ENST00000399409.3	37	CCDS45088.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.151141	0.00325	.	.	ENSG00000100949	ENST00000216840;ENST00000399409;ENST00000543002	T;T	0.40756	1.02;1.02	5.07	-0.537	0.11872	Protein prenyltransferase (1);	0.540943	0.20383	N	0.093418	T	0.14270	0.0345	N	0.03084	-0.415	0.48452	D	0.999654	B	0.02656	0.0	B	0.04013	0.001	T	0.13629	-1.0502	10	0.11182	T	0.66	0.0056	5.8551	0.18714	0.1279:0.4241:0.3732:0.0748	.	75	Q92696	PGTA_HUMAN	H	75;75;38	ENSP00000216840:Q75H;ENSP00000382341:Q75H	ENSP00000216840:Q75H	Q	-	3	2	RABGGTA	23809394	0.651000	0.27340	0.415000	0.26534	0.010000	0.07245	0.475000	0.22164	-0.092000	0.12417	-0.302000	0.09304	CAG		0.597	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836	
MDGA2	161357	broad.mit.edu	37	14	47601007	47601007	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr14:47601007C>A	ENST00000399232.2	-	5	992	c.628G>T	c.(628-630)Gac>Tac	p.D210Y	MDGA2_ENST00000426342.1_5'UTR|MDGA2_ENST00000439988.3_Missense_Mutation_p.D279Y|MDGA2_ENST00000357362.3_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	210	Ig-like 2.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.D279Y(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TTAGCATAGTCCTGAGGTCGA	0.338																																					p.D279Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G835T	14						.						202.0	158.0	172.0					14																	47601007		692	1590	2282	46670757	SO:0001583	missense	161357	exon5			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.628G>T	14.37:g.47601007C>A	ENSP00000382178:p.Asp210Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	46670757	NM_001113498	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.401327|4.401327	0.83120|0.83120	.|.	.|.	ENSG00000139915|ENSG00000139915	ENST00000439988;ENST00000399232|ENST00000554762	T;T|.	0.62232|.	0.04;0.04|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.53938|.	U|.	0.000056|.	T|T	0.75459|0.75459	0.3852|0.3852	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.74589|0.74589	-0.3615|-0.3615	10|5	0.87932|.	D|.	0|.	.|.	17.9584|17.9584	0.89076|0.89076	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	210|.	Q7Z553|.	MDGA2_HUMAN|.	Y|V	210;279|12	ENSP00000400011:D210Y;ENSP00000382178:D279Y|.	ENSP00000382178:D279Y|.	D|G	-|-	1|2	0|0	MDGA2|MDGA2	46670757|46670757	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.299000|7.299000	0.78831|0.78831	2.655000|2.655000	0.90218|0.90218	0.585000|0.585000	0.79938|0.79938	GAC|GGA		0.338	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
FLRT2	23768	broad.mit.edu	37	14	86089049	86089049	+	Silent	SNP	T	T	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr14:86089049T>A	ENST00000330753.4	+	2	1958	c.1191T>A	c.(1189-1191)ccT>ccA	p.P397P	FLRT2_ENST00000554746.1_Silent_p.P397P	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	397					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.P397P(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GCTACACGCCTCCAACTCCTA	0.557																																					p.P397P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1191A	14						.						76.0	77.0	77.0					14																	86089049		2203	4300	6503	85158802	SO:0001819	synonymous_variant	23768	exon2			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1191T>A	14.37:g.86089049T>A		Somatic		Capture	Illumina HiSeq	Phase_I	85158802	NM_013231	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	CCDS9877.1																																																																																				0.557	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
UNC79	57578	broad.mit.edu	37	14	94156534	94156534	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr14:94156534A>C	ENST00000393151.2	+	46	7274	c.7274A>C	c.(7273-7275)cAc>cCc	p.H2425P	UNC79_ENST00000256339.4_Missense_Mutation_p.H2248P|UNC79_ENST00000555664.1_Missense_Mutation_p.H2386P|UNC79_ENST00000553484.1_Missense_Mutation_p.H2447P			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2425					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H2447P(1)|p.H2248P(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCCCTCACTCACAATGCAGTG	0.488																																					p.H2248P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A6743C	14						.						190.0	160.0	170.0					14																	94156534		2203	4300	6503	93226287	SO:0001583	missense	57578	exon46			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7274A>C	14.37:g.94156534A>C	ENSP00000376858:p.His2425Pro	Somatic		Capture	Illumina HiSeq	Phase_I	93226287	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	A	23.9	4.469041	0.84533	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.20881	2.04;2.06;2.04;2.04	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.45054	0.1323	M	0.62723	1.935	0.80722	D	1	D	0.64830	0.994	D	0.71184	0.972	T	0.36261	-0.9755	10	0.87932	D	0	-22.5219	16.5602	0.84551	1.0:0.0:0.0:0.0	.	2447	C9JQL1	.	P	2248;2386;2447;2425;2447	ENSP00000256339:H2248P;ENSP00000450868:H2386P;ENSP00000451360:H2447P;ENSP00000376858:H2425P	ENSP00000256339:H2248P	H	+	2	0	KIAA1409	93226287	1.000000	0.71417	0.972000	0.41901	0.958000	0.62258	9.287000	0.95975	2.367000	0.80283	0.528000	0.53228	CAC		0.488	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
AHNAK2	113146	broad.mit.edu	37	14	105412363	105412363	+	Missense_Mutation	SNP	T	T	C	rs201377363	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr14:105412363T>C	ENST00000333244.5	-	7	9544	c.9425A>G	c.(9424-9426)aAg>aGg	p.K3142R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3142						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.K3142R(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CATTTTGAACTTGCTGTCTTT	0.592																																					p.K3142R												.	.	1	Substitution - Missense(1)	NS(1)	c.A9425G	14						.						181.0	139.0	152.0					14																	105412363		1912	4076	5988	104483408	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9425A>G	14.37:g.105412363T>C	ENSP00000353114:p.Lys3142Arg	None		Capture	Illumina HiSeq	Phase_I	104483408	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	11.62	1.694140	0.30052	.	.	ENSG00000185567	ENST00000333244	T	0.00882	5.58	3.45	3.45	0.39498	.	.	.	.	.	T	0.05502	0.0145	M	0.85462	2.755	0.23620	N	0.997271	D	0.71674	0.998	D	0.78314	0.991	T	0.12372	-1.0550	9	0.54805	T	0.06	.	9.5748	0.39450	0.0:0.0:0.1761:0.8239	.	3142	Q8IVF2	AHNK2_HUMAN	R	3142	ENSP00000353114:K3142R	ENSP00000353114:K3142R	K	-	2	0	AHNAK2	104483408	0.794000	0.28838	0.977000	0.42913	0.041000	0.13682	3.435000	0.52849	1.195000	0.43115	0.260000	0.18958	AAG		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
TMCO5A	145942	broad.mit.edu	37	15	38229073	38229073	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr15:38229073C>T	ENST00000319669.4	+	3	268	c.166C>T	c.(166-168)Cgg>Tgg	p.R56W	TMCO5A_ENST00000559502.1_Missense_Mutation_p.R56W|TMCO5A_ENST00000558158.1_Missense_Mutation_p.R56W|TMCO5A_ENST00000540944.1_Missense_Mutation_p.R56W	NM_152453.2	NP_689666.2	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A	56						integral component of membrane (GO:0016021)		p.R56W(1)		central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	15						CATTCAGACGCGGGGCCTGGT	0.507																																					p.R56W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C166T	15						.						84.0	81.0	82.0					15																	38229073		2200	4297	6497	36016365	SO:0001583	missense	145942	exon3			BC029221	CCDS10046.1	15q14	2008-06-10	2008-06-10	2008-06-10	ENSG00000166069	ENSG00000166069			28558	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 5"""	TMCO5		12477932	Standard	NM_152453		Approved	MGC35118	uc001zjw.3	Q8N6Q1	OTTHUMG00000129787	ENST00000319669.4:c.166C>T	15.37:g.38229073C>T	ENSP00000327234:p.Arg56Trp	Somatic		Capture	Illumina HiSeq	Phase_I	36016365	NM_152453	Q8NA63	Missense_Mutation	SNP	ENST00000319669.4	37	CCDS10046.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.200599	0.38905	.	.	ENSG00000166069	ENST00000540944;ENST00000319669	.	.	.	4.42	2.4	0.29515	.	0.808981	0.11294	N	0.578978	T	0.29817	0.0745	L	0.51422	1.61	0.09310	N	1	D;P	0.60160	0.987;0.894	B;B	0.43783	0.431;0.311	T	0.18209	-1.0344	9	0.42905	T	0.14	-1.5551	2.739	0.05248	0.3368:0.2532:0.41:0.0	.	56;56	Q8N6Q1;Q8N6Q1-2	TMC5A_HUMAN;.	W	56	.	ENSP00000327234:R56W	R	+	1	2	TMCO5A	36016365	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.167000	0.09940	0.293000	0.22520	-0.120000	0.15030	CGG		0.507	TMCO5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252012.1	NM_152453	
CGNL1	84952	broad.mit.edu	37	15	57730453	57730453	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr15:57730453C>T	ENST00000281282.5	+	2	334	c.256C>T	c.(256-258)Cta>Tta	p.L86L		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	86	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.L86L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		TAACCTGCCTCTACATTCCAG	0.473																																					p.L86L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C256T	15						.						61.0	64.0	63.0					15																	57730453		2192	4292	6484	55517745	SO:0001819	synonymous_variant	84952	exon2			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.256C>T	15.37:g.57730453C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55517745	NM_032866	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Silent	SNP	ENST00000281282.5	37	CCDS10161.1																																																																																				0.473	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
CHRNA5	1138	broad.mit.edu	37	15	78882285	78882285	+	Silent	SNP	T	T	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr15:78882285T>C	ENST00000299565.5	+	5	752	c.552T>C	c.(550-552)tgT>tgC	p.C184C	CHRNA5_ENST00000559554.1_Intron|RP11-650L12.2_ENST00000567141.1_RNA	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	184					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.C184C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	TTCAGAACTGTTCCATGAAAT	0.398																																					p.C184C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T552C	15						.						142.0	128.0	133.0					15																	78882285		2196	4293	6489	76669340	SO:0001819	synonymous_variant	1138	exon5				CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.552T>C	15.37:g.78882285T>C		Somatic		Capture	Illumina HiSeq	Phase_I	76669340	NM_000745	Q15824|Q99554	Silent	SNP	ENST00000299565.5	37	CCDS10304.1																																																																																				0.398	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290106.1		
BNC1	646	broad.mit.edu	37	15	83935683	83935683	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr15:83935683G>A	ENST00000345382.2	-	3	425	c.340C>T	c.(340-342)Cgg>Tgg	p.R114W	BNC1_ENST00000569704.1_Missense_Mutation_p.R107W|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	114					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R114W(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CTGAAGAGCCGGTCCAGTAGG	0.502																																					p.R114W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C340T	15						.						124.0	115.0	118.0					15																	83935683		2203	4300	6503	81726687	SO:0001583	missense	646	exon3			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.340C>T	15.37:g.83935683G>A	ENSP00000307041:p.Arg114Trp	Somatic		Capture	Illumina HiSeq	Phase_I	81726687	NM_001717	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	G	34	5.376325	0.95945	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.03831	3.79	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.24812	0.0602	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00112	-1.2044	10	0.87932	D	0	-26.078	19.614	0.95622	0.0:0.0:1.0:0.0	.	107;114	F5GY04;Q01954	.;BNC1_HUMAN	W	114;107	ENSP00000307041:R114W	ENSP00000307041:R114W	R	-	1	2	BNC1	81726687	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.701000	0.84566	2.873000	0.98535	0.561000	0.74099	CGG		0.502	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
RAB40C	57799	broad.mit.edu	37	16	677579	677580	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr16:677579_677580insC	ENST00000248139.3	+	6	1006_1007	c.803_804insC	c.(802-807)agccccfs	p.SP268fs	RAB40C_ENST00000535977.1_Frame_Shift_Ins_p.SP268fs|RAB40C_ENST00000538492.1_Frame_Shift_Ins_p.SP268fs|RAB40C_ENST00000539661.1_Frame_Shift_Ins_p.SP268fs	NM_021168.4	NP_066991.3	Q96S21	RB40C_HUMAN	RAB40C, member RAS oncogene family	268					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)	p.Q271fs*7(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	6		Hepatocellular(780;0.0218)				CCACCCCAGAGCCCCCCCCAGA	0.678																																					p.S268fs	Melanoma(123;1631 1690 28262 44104 44957)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.803_804insC	16						.																																			617581	SO:0001589	frameshift_variant	57799	exon7			Z84779	CCDS10413.1	16p13.3	2008-07-28	2003-10-14		ENSG00000197562	ENSG00000197562		"""RAB, member RAS oncogene"""	18285	protein-coding gene	gene with protein product			"""RAS-like, family 8, member C"""	RASL8C		11697911, 18485483	Standard	NM_021168		Approved	RARL	uc021szv.1	Q96S21	OTTHUMG00000047854	ENST00000248139.3:c.811dupC	16.37:g.677587_677587dupC	ENSP00000248139:p.Ser268fs	None		Capture	Illumina HiSeq	Phase_I	617580	NM_001172664	A2IDE2|D3DU54|O60795|Q4TT41|Q5PXE8|Q6PIU5	Frame_Shift_Ins	INS	ENST00000248139.3	37	CCDS10413.1																																																																																				0.678	RAB40C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109079.4	NM_021168	
PKD1L2	114780	broad.mit.edu	37	16	81185493	81185494	+	RNA	INS	-	-	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	-	-	-	A	-	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr16:81185493_81185494insA	ENST00000525539.1	-	0	4430_4431				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						ATCACCAGGTCATAGACCAGCA	0.53																																					p.D1478_L1479delinsX												.	.	0			c.4432_4433insT	16						.																																			79742995			114780	exon27			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81185494_81185494dupA		Germline		Capture	Illumina HiSeq	Phase_I	79742994	NM_052892	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Frame_Shift_Ins	INS	ENST00000525539.1	37																																																																																					0.530	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
CREBBP	1387	broad.mit.edu	37	16	3824675	3824675	+	Silent	SNP	G	G	A	rs151083156		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr16:3824675G>A	ENST00000262367.5	-	12	2987	c.2178C>T	c.(2176-2178)ccC>ccT	p.P726P	CREBBP_ENST00000382070.3_Silent_p.P688P	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	726					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P726P(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CCAAGGACATGGGGTTAAATG	0.478			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.P726P			Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2178T	16						.	G	,	0,4394		0,0,2197	100.0	84.0	89.0		2064,2178	-2.9	1.0	16	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CREBBP	NM_001079846.1,NM_004380.2	,	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	,	688/2405,726/2443	3824675	1,12993	2197	4300	6497	3764676	SO:0001819	synonymous_variant	1387	exon12			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2178C>T	16.37:g.3824675G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3764676	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																				0.478	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
SLC6A2	6530	broad.mit.edu	37	16	55705876	55705876	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr16:55705876G>A	ENST00000379906.2	+	3	688	c.433G>A	c.(433-435)Gcc>Acc	p.A145T	SLC6A2_ENST00000568943.1_Missense_Mutation_p.A145T|SLC6A2_ENST00000567238.1_Missense_Mutation_p.A40T|SLC6A2_ENST00000414754.3_Missense_Mutation_p.A145T|SLC6A2_ENST00000219833.8_Missense_Mutation_p.A145T|SLC6A2_ENST00000566163.1_Missense_Mutation_p.A145T|SLC6A2_ENST00000561820.1_Missense_Mutation_p.A145T	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	145					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)	p.A145T(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CATCCTGATCGCCCTGTACGT	0.602																																					p.A145T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G433A	16						.						225.0	144.0	171.0					16																	55705876		2198	4300	6498	54263377	SO:0001583	missense	6530	exon3				CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.433G>A	16.37:g.55705876G>A	ENSP00000369237:p.Ala145Thr	Somatic		Capture	Illumina HiSeq	Phase_I	54263377	NM_001172504	B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	37	CCDS10754.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155446	0.57259	.	.	ENSG00000103546	ENST00000414754;ENST00000379906;ENST00000219833	T;T;T	0.74632	-0.86;-0.86;-0.86	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.81123	0.4757	L	0.39566	1.225	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.986	D;D;P	0.66602	0.914;0.945;0.858	T	0.79500	-0.1778	10	0.38643	T	0.18	.	19.2942	0.94115	0.0:0.0:1.0:0.0	.	145;40;145	Q96KH8;B4DX48;P23975	.;.;SC6A2_HUMAN	T	145	ENSP00000394956:A145T;ENSP00000369237:A145T;ENSP00000219833:A145T	ENSP00000219833:A145T	A	+	1	0	SLC6A2	54263377	1.000000	0.71417	0.942000	0.38095	0.991000	0.79684	8.062000	0.89475	2.557000	0.86248	0.650000	0.86243	GCC		0.602	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2		
CDH8	1006	broad.mit.edu	37	16	61687567	61687567	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr16:61687567C>T	ENST00000577390.1	-	12	3299	c.2345G>A	c.(2344-2346)cGc>cAc	p.R782H	CDH8_ENST00000577730.1_Intron|CDH8_ENST00000299345.6_Intron	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	782					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.R782H(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TCTCTTAAAGCGGGGACCCCA	0.473																																					p.R782H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2345A	16						.						55.0	59.0	58.0					16																	61687567		2203	4300	6503	60245068	SO:0001583	missense	1006	exon12			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.2345G>A	16.37:g.61687567C>T	ENSP00000462701:p.Arg782His	Somatic		Capture	Illumina HiSeq	Phase_I	60245068	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181917	0.57800	.	.	ENSG00000150394	ENST00000299345	.	.	.	5.7	5.7	0.88788	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.83862	0.5346	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84994	0.0896	9	0.59425	D	0.04	.	18.8311	0.92139	0.0:1.0:0.0:0.0	.	782	P55286	CADH8_HUMAN	H	782	.	ENSP00000299345:R782H	R	-	2	0	CDH8	60245068	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.992000	0.70609	2.679000	0.91253	0.655000	0.94253	CGC		0.473	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
RBFOX1	54715	broad.mit.edu	37	16	7726832	7726832	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr16:7726832C>A	ENST00000550418.1	+	14	1975	c.987C>A	c.(985-987)taC>taA	p.Y329*	RBFOX1_ENST00000340209.4_Nonsense_Mutation_p.Y334*|RBFOX1_ENST00000355637.4_Nonsense_Mutation_p.Y350*|RBFOX1_ENST00000436368.2_Nonsense_Mutation_p.Y350*|RBFOX1_ENST00000553186.1_Nonsense_Mutation_p.Y302*|RBFOX1_ENST00000547372.1_Nonsense_Mutation_p.Y372*|RBFOX1_ENST00000552089.1_Nonsense_Mutation_p.Y346*|RBFOX1_ENST00000535565.2_Nonsense_Mutation_p.Y286*|RBFOX1_ENST00000547338.1_Nonsense_Mutation_p.Y329*|RBFOX1_ENST00000311745.5_Nonsense_Mutation_p.Y350*|RBFOX1_ENST00000422070.4_Nonsense_Mutation_p.Y372*	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	329					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.Y350*(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CCGCTGCCTACAGTGACAGGT	0.493																																					p.Y350X	Ovarian(157;934 2567 15163 39509)											.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1050A	16						.						162.0	122.0	136.0					16																	7726832		2197	4300	6497	7666833	SO:0001587	stop_gained	54715	exon11			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.987C>A	16.37:g.7726832C>A	ENSP00000450031:p.Tyr329*	Somatic		Capture	Illumina HiSeq	Phase_I	7666833	NM_145893	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Nonsense_Mutation	SNP	ENST00000550418.1	37	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	C	47	13.073359	0.99717	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6663	12.4233	0.55532	0.0:0.9218:0.0:0.0782	.	.	.	.	X	329;302;372;372;286;346;329;350;350;350;323;334	.	ENSP00000309117:Y350X	Y	+	3	2	RBFOX1	7666833	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.138000	0.50570	2.667000	0.90743	0.650000	0.86243	TAC		0.493	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
KCTD19	146212	broad.mit.edu	37	16	67330089	67330089	+	Silent	SNP	G	G	A	rs201286450		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr16:67330089G>A	ENST00000304372.5	-	8	1276	c.1221C>T	c.(1219-1221)taC>taT	p.Y407Y		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	407	BTB 2.				protein homooligomerization (GO:0051260)			p.Y407Y(1)		endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GGGTGGTTGCGTACCAGTGGC	0.557																																					p.Y407Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1221T	16						.	G		1,4249		0,1,2124	151.0	175.0	167.0		1221	-4.1	0.9	16		167	5,8449		0,5,4222	no	coding-synonymous	KCTD19	NM_001100915.1		0,6,6346	AA,AG,GG		0.0591,0.0235,0.0472		407/927	67330089	6,12698	2125	4227	6352	65887590	SO:0001819	synonymous_variant	146212	exon8			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.1221C>T	16.37:g.67330089G>A		Somatic		Capture	Illumina HiSeq	Phase_I	65887590	NM_001100915	B4DZ49|Q8N804	Silent	SNP	ENST00000304372.5	37	CCDS42179.1																																																																																				0.557	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367	
SLC35G6	643664	broad.mit.edu	37	17	7386030	7386030	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr17:7386030C>T	ENST00000412468.2	+	2	842	c.727C>T	c.(727-729)Ccc>Tcc	p.P243S	POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	243						integral component of membrane (GO:0016021)		p.P243S(1)									TGTGCTGCAGCCCCCCGTGTT	0.602																																					p.P243S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C727T	17						.						62.0	59.0	60.0					17																	7386030		2203	4300	6503	7326754	SO:0001583	missense	643664	exon2				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.727C>T	17.37:g.7386030C>T	ENSP00000396523:p.Pro243Ser	Somatic		Capture	Illumina HiSeq	Phase_I	7326754	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	A	0.130	-1.114361	0.01799	.	.	ENSG00000181222	ENST00000412468	T	0.69561	-0.41	3.92	3.92	0.45320	.	.	.	.	.	T	0.38772	0.1053	N	0.08118	0	0.20638	N	0.999873	B	0.02656	0.0	B	0.01281	0.0	T	0.25745	-1.0123	9	0.11485	T	0.65	-1.3593	3.5858	0.07970	0.6037:0.2022:0.1941:0.0	.	243	P0C7Q6	S35G6_HUMAN	S	243	ENSP00000396523:P243S	ENSP00000396523:P243S	P	+	1	0	SLC35G6	7326754	1.000000	0.71417	0.961000	0.40146	0.138000	0.21146	3.276000	0.51646	0.504000	0.28082	-0.520000	0.04383	CCC		0.602	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
KLHL10	317719	broad.mit.edu	37	17	39994252	39994252	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr17:39994252C>T	ENST00000293303.4	+	1	221	c.68C>T	c.(67-69)gCg>gTg	p.A23V	RN7SL871P_ENST00000583512.1_RNA|NT5C3B_ENST00000435506.2_5'Flank|KLHL10_ENST00000485613.1_3'UTR|NT5C3B_ENST00000269534.8_5'Flank|NT5C3B_ENST00000521789.1_5'Flank	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	23					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.A23V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				AAGATGAGTGCGATGGCCTGT	0.562																																					p.A23V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C68T	17						.						140.0	139.0	140.0					17																	39994252		2083	4210	6293	37247778	SO:0001583	missense	317719	exon1			AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.68C>T	17.37:g.39994252C>T	ENSP00000293303:p.Ala23Val	Somatic		Capture	Illumina HiSeq	Phase_I	37247778	NM_152467	Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.842145	0.51057	.	.	ENSG00000161594	ENST00000448203;ENST00000293303;ENST00000438813	D;T;D	0.83914	-1.78;-0.43;-1.65	4.98	4.98	0.66077	BTB/POZ fold (1);	0.225852	0.38058	N	0.001821	T	0.78110	0.4232	L	0.31926	0.97	0.44523	D	0.997478	D;P	0.55605	0.972;0.942	P;B	0.46049	0.502;0.446	T	0.76963	-0.2764	10	0.31617	T	0.26	.	15.1739	0.72896	0.0:1.0:0.0:0.0	.	23;23	B4DXV2;Q6JEL2	.;KLH10_HUMAN	V	23	ENSP00000391983:A23V;ENSP00000293303:A23V;ENSP00000416221:A23V	ENSP00000293303:A23V	A	+	2	0	KLHL10	37247778	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.245000	0.65405	2.622000	0.88805	0.650000	0.86243	GCG		0.562	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
USP36	57602	broad.mit.edu	37	17	76832230	76832230	+	Silent	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr17:76832230G>T	ENST00000542802.3	-	3	659	c.216C>A	c.(214-216)cgC>cgA	p.R72R	USP36_ENST00000590546.2_Silent_p.R72R|USP36_ENST00000312010.6_Silent_p.R72R|USP36_ENST00000589424.1_Silent_p.R72R			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	72					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.R72R(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CACTCTTGTGGCGACTAGCTC	0.557																																					p.R72R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C216A	17						.						99.0	92.0	94.0					17																	76832230		2203	4300	6503	74343825	SO:0001819	synonymous_variant	57602	exon3			AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.216C>A	17.37:g.76832230G>T		Somatic		Capture	Illumina HiSeq	Phase_I	74343825	NM_025090	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Silent	SNP	ENST00000542802.3	37	CCDS32755.1																																																																																				0.557	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090	
SERPINB11	89778	broad.mit.edu	37	18	61388082	61388082	+	RNA	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr18:61388082G>A	ENST00000382749.5	+	0	881				SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000536691.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V212V(1)		breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				ATGTAACTGTGGAAATGATGT	0.363																																					p.V212V	Ovarian(27;496 784 5942 8975 23930)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G636A	18						.						46.0	44.0	45.0					18																	61388082		1855	4094	5949	59539062			89778	exon7					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61388082G>A		Somatic		Capture	Illumina HiSeq	Phase_I	59539062	NM_080475	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Silent	SNP	ENST00000382749.5	37																																																																																					0.363	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	NM_080475	
PIK3R2	5296	broad.mit.edu	37	19	18273104	18273105	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:18273104_18273105insGG	ENST00000593731.1	+	8	1554_1555	c.994_995insGG	c.(994-996)tggfs	p.W332fs	PIK3R2_ENST00000222254.8_Frame_Shift_Ins_p.W332fs			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	332	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)	p.D334fs*8(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	TGAGTGGTACTGGGGGGACATT	0.653																																					p.W332fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.994_995insGG	19						.																																			18134105	SO:0001589	frameshift_variant	5296	exon8				CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.999_1000dupGG	19.37:g.18273109_18273110dupGG	ENSP00000471914:p.Trp332fs	Somatic		Capture	Illumina HiSeq	Phase_I	18134104	NM_005027	Q5EAT5|Q9UPH9	Frame_Shift_Ins	INS	ENST00000593731.1	37	CCDS12371.1																																																																																				0.653	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027	
HOOK2	29911	broad.mit.edu	37	19	12875856	12875856	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:12875856C>T	ENST00000397668.3	-	19	1753	c.1680G>A	c.(1678-1680)aaG>aaA	p.K560K	HOOK2_ENST00000589965.1_5'Flank|HOOK2_ENST00000264827.5_Silent_p.K558K	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	560	Required for localization to the centrosome and induction of aggresome formation.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)	p.K560K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						TGTACTCCCGCTTCCTCTGCA	0.607											OREG0025273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K558K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1674A	19						.						98.0	108.0	104.0					19																	12875856		2150	4250	6400	12736856	SO:0001819	synonymous_variant	29911	exon18			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1680G>A	19.37:g.12875856C>T		Somatic	683	Capture	Illumina HiSeq	Phase_I	12736856	NM_001100176	O60562	Silent	SNP	ENST00000397668.3	37	CCDS42508.1																																																																																				0.607	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451008.1	NM_013312	
NFIX	4784	broad.mit.edu	37	19	13201145	13201145	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:13201145C>T	ENST00000592199.1	+	10	1435	c.1435C>T	c.(1435-1437)Cgg>Tgg	p.R479W	NFIX_ENST00000360105.4_Silent_p.T391T|NFIX_ENST00000397661.2_Silent_p.T429T|NFIX_ENST00000588228.1_Missense_Mutation_p.R432W|NFIX_ENST00000587760.1_Silent_p.T421T|NFIX_ENST00000587260.1_Silent_p.T428T|NFIX_ENST00000358552.3_Missense_Mutation_p.R437W|NFIX_ENST00000585575.1_Missense_Mutation_p.R471W			Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription factor)	479					astrocyte differentiation (GO:0048708)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell layer development (GO:0021680)|DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T429T(2)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CTCTGCCAACCGGTTTGTCAG	0.652																																					p.T429T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1287T	19						.						100.0	108.0	105.0					19																	13201145		1982	4161	6143	13062145	SO:0001583	missense	4784	exon9			U18761	CCDS45996.1, CCDS59359.1	19p13.3	2008-02-05				ENSG00000008441			7788	protein-coding gene	gene with protein product		164005				8340106, 7590749	Standard	NM_001271043		Approved	NF1A	uc010xmx.2	Q14938		ENST00000592199.1:c.1435C>T	19.37:g.13201145C>T	ENSP00000467512:p.Arg479Trp	Somatic		Capture	Illumina HiSeq	Phase_I	13062145	NM_002501	B4DM25|O60413|Q0VG09|Q12859|Q13050|Q13052|Q5U094|Q9UPH1|Q9Y6R8	Missense_Mutation	SNP	ENST00000592199.1	37		.	.	.	.	.	.	.	.	.	.	c	19.32	3.805243	0.70682	.	.	ENSG00000008441	ENST00000397661;ENST00000358552	T	0.60672	0.17	4.37	4.37	0.52481	.	0.239162	0.30519	U	0.009454	T	0.70422	0.3222	.	.	.	0.42308	D	0.9922	D	0.69078	0.997	P	0.60609	0.877	T	0.75121	-0.3429	9	0.87932	D	0	.	11.0452	0.47855	0.1861:0.8139:0.0:0.0	.	487	B4DHW2	.	W	479;437	ENSP00000351354:R437W	ENSP00000351354:R437W	R	+	1	2	NFIX	13062145	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.888000	0.39708	1.982000	0.57802	0.558000	0.71614	CGG		0.652	NFIX-013	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000452763.1	NM_002501	
OR10H5	284433	broad.mit.edu	37	19	15904971	15904971	+	Missense_Mutation	SNP	C	C	T	rs372682146		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:15904971C>T	ENST00000308940.8	+	1	211	c.113C>T	c.(112-114)aCg>aTg	p.T38M		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T38M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						TACCTGTTCACGCTGCTGGGC	0.577																																					p.T38M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C113T	19						.	C	MET/THR	1,4405		0,1,2202	230.0	185.0	200.0		113	3.5	1.0	19		200	0,8600		0,0,4300	no	missense	OR10H5	NM_001004466.1	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	38/316	15904971	1,13005	2203	4300	6503	15765971	SO:0001583	missense	284433	exon1			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.113C>T	19.37:g.15904971C>T	ENSP00000310704:p.Thr38Met	Somatic		Capture	Illumina HiSeq	Phase_I	15765971	NM_001004466	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	.	.	.	.	.	.	.	.	.	.	.	15.37	2.813962	0.50527	2.27E-4	0.0	ENSG00000172519	ENST00000308940	T	0.01455	4.87	3.47	3.47	0.39725	.	0.000000	0.51477	D	0.000093	T	0.08179	0.0204	M	0.93507	3.425	0.29708	N	0.83962	D	0.61080	0.989	P	0.48738	0.588	T	0.08848	-1.0702	10	0.72032	D	0.01	.	12.818	0.57677	0.0:1.0:0.0:0.0	.	38	Q8NGA6	O10H5_HUMAN	M	38	ENSP00000310704:T38M	ENSP00000310704:T38M	T	+	2	0	OR10H5	15765971	0.249000	0.23941	0.957000	0.39632	0.962000	0.63368	0.951000	0.29135	1.647000	0.50633	0.585000	0.79938	ACG		0.577	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
SLC35E1	79939	broad.mit.edu	37	19	16664644	16664644	+	Missense_Mutation	SNP	C	C	T	rs200335570		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:16664644C>T	ENST00000595753.1	-	6	1096	c.1079G>A	c.(1078-1080)cGt>cAt	p.R360H	CTD-3222D19.11_ENST00000597357.1_RNA|SLC35E1_ENST00000593812.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_3'UTR	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	360					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.R216H(1)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						GCTCCGGTGACGCTCCTTGCT	0.582																																					p.R360H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1079A	19						.	C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	104.0	93.0	97.0		1079	1.0	0.0	19		97	0,8600		0,0,4300	yes	missense	SLC35E1	NM_024881.4	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	360/411	16664644	2,13004	2203	4300	6503	16525644	SO:0001583	missense	79939	exon6			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.1079G>A	19.37:g.16664644C>T	ENSP00000470652:p.Arg360His	Somatic		Capture	Illumina HiSeq	Phase_I	16525644	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	37	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	C	1.950	-0.441539	0.04604	4.54E-4	0.0	ENSG00000127526	ENST00000409648;ENST00000421082	.	.	.	4.53	0.961	0.19638	.	0.908635	0.09654	N	0.773261	T	0.17023	0.0409	N	0.03608	-0.345	0.09310	N	0.999997	B	0.06786	0.001	B	0.04013	0.001	T	0.25710	-1.0124	9	0.36615	T	0.2	-5.8998	9.3407	0.38079	0.0:0.2553:0.0:0.7447	.	360	Q96K37	S35E1_HUMAN	H	360;111	.	ENSP00000387152:R360H	R	-	2	0	SLC35E1	16525644	0.205000	0.23458	0.008000	0.14137	0.525000	0.34531	0.372000	0.20467	-0.176000	0.10707	-0.215000	0.12644	CGT		0.582	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
SLC35E1	79939	broad.mit.edu	37	19	16678926	16678926	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:16678926C>T	ENST00000595753.1	-	3	564	c.547G>A	c.(547-549)Gag>Aag	p.E183K	SLC35E1_ENST00000431408.1_Missense_Mutation_p.E27K|CTD-3222D19.2_ENST00000409035.1_Intron|CTD-3222D19.10_ENST00000597851.1_RNA	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	183					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.E39K(1)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						AAAGACAACTCGGTGACGGTG	0.542																																					p.E183K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G547A	19						.						87.0	85.0	86.0					19																	16678926		2203	4300	6503	16539926	SO:0001583	missense	79939	exon3			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.547G>A	19.37:g.16678926C>T	ENSP00000470652:p.Glu183Lys	Somatic		Capture	Illumina HiSeq	Phase_I	16539926	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	37	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799345	0.90538	.	.	ENSG00000127526	ENST00000409648;ENST00000431408	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.61800	0.2376	M	0.82517	2.595	0.80722	D	1	B;P	0.50369	0.445;0.934	B;B	0.38500	0.068;0.275	T	0.72928	-0.4143	9	0.66056	D	0.02	-37.364	17.5838	0.87976	0.0:1.0:0.0:0.0	.	183;39	Q96K37;Q9H7U6	S35E1_HUMAN;.	K	183;27	.	ENSP00000387152:E183K	E	-	1	0	SLC35E1	16539926	1.000000	0.71417	0.732000	0.30844	0.973000	0.67179	7.201000	0.77847	2.387000	0.81309	0.555000	0.69702	GAG		0.542	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
HNRNPL	3191	broad.mit.edu	37	19	39330776	39330776	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:39330776C>T	ENST00000221419.5	-	8	1559	c.1193G>A	c.(1192-1194)cGa>cAa	p.R398Q	AC104534.3_ENST00000594769.1_Missense_Mutation_p.E15K|HNRNPL_ENST00000600873.1_Missense_Mutation_p.R265Q	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	398	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.R265Q(1)|p.R398Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			ATTGAAGACTCGGTCACAGTT	0.587																																					p.R265Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G794A	19						.						46.0	50.0	49.0					19																	39330776		2185	4260	6445	44022616	SO:0001583	missense	3191	exon8			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1193G>A	19.37:g.39330776C>T	ENSP00000221419:p.Arg398Gln	Somatic		Capture	Illumina HiSeq	Phase_I	44022616	NM_001005335	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225201	0.58668	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	T	0.39997	1.05	5.72	5.72	0.89469	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.51193	0.1660	L	0.54323	1.7	0.50171	D	0.999858	B;B;D	0.76494	0.168;0.083;0.999	B;B;P	0.50537	0.005;0.004;0.643	T	0.49781	-0.8903	10	0.51188	T	0.08	.	18.6604	0.91470	0.0:1.0:0.0:0.0	.	398;265;381	P14866;A6NIT8;Q6NTA2	HNRPL_HUMAN;.;.	Q	398;265;265	ENSP00000221419:R398Q	ENSP00000221419:R398Q	R	-	2	0	HNRNPL	44022616	0.998000	0.40836	0.998000	0.56505	0.989000	0.77384	3.787000	0.55439	2.709000	0.92574	0.555000	0.69702	CGA		0.587	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
LIPE	3991	broad.mit.edu	37	19	42912178	42912178	+	Missense_Mutation	SNP	C	C	T	rs371540113		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:42912178C>T	ENST00000244289.4	-	4	1882	c.1606G>A	c.(1606-1608)Gtg>Atg	p.V536M	LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE_ENST00000602000.1_5'UTR|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	536					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)	p.V536M(1)		breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CAGAAGTGCACGTCCAGGTTC	0.597																																					p.V536M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1606A	19						.	C	MET/VAL	0,4406		0,0,2203	91.0	74.0	80.0		1606	3.0	1.0	19		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	LIPE	NM_005357.2	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	536/1077	42912178	1,13005	2203	4300	6503	47604018	SO:0001583	missense	3991	exon4			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1606G>A	19.37:g.42912178C>T	ENSP00000244289:p.Val536Met	Somatic		Capture	Illumina HiSeq	Phase_I	47604018	NM_005357	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679867	0.68042	0.0	1.16E-4	ENSG00000079435	ENST00000244289	T	0.37752	1.18	4.12	2.98	0.34508	Hormone-sensitive lipase, N-terminal (1);	0.096904	0.41500	D	0.000877	T	0.37210	0.0995	N	0.11427	0.14	0.47441	D	0.999427	D;D	0.89917	0.997;1.0	P;D	0.91635	0.79;0.999	T	0.32134	-0.9918	10	0.45353	T	0.12	-12.8647	11.7329	0.51748	0.1772:0.8228:0.0:0.0	.	536;536	A8K8W7;Q05469	.;LIPS_HUMAN	M	536	ENSP00000244289:V536M	ENSP00000244289:V536M	V	-	1	0	LIPE	47604018	0.846000	0.29590	0.968000	0.41197	0.983000	0.72400	2.881000	0.48538	2.036000	0.60181	0.561000	0.74099	GTG		0.597	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
PSG1	5669	broad.mit.edu	37	19	43383700	43383700	+	Missense_Mutation	SNP	G	G	T	rs143342076		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:43383700G>T	ENST00000436291.2	-	1	150	c.34C>A	c.(34-36)Cgc>Agc	p.R12S	PSG1_ENST00000244296.2_Missense_Mutation_p.R12S|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000403380.3_Missense_Mutation_p.R12S|PSG1_ENST00000595356.1_Missense_Mutation_p.R12S|PSG1_ENST00000595124.1_Missense_Mutation_p.R12S|PSG1_ENST00000312439.6_Missense_Mutation_p.R12S	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	12					female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R12C(2)|p.R12S(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CATTTGATGCGCTGTGTGCAG	0.572																																					p.R12S												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C34A	19						.						182.0	158.0	167.0					19																	43383700		1510	2707	4217	48075540	SO:0001583	missense	5669	exon1				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.34C>A	19.37:g.43383700G>T	ENSP00000413041:p.Arg12Ser	Somatic		Capture	Illumina HiSeq	Phase_I	48075540	NM_006905	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	ENST00000436291.2	37	CCDS54275.1	.	.	.	.	.	.	.	.	.	.	N	4.444	0.082131	0.08533	.	.	ENSG00000231924	ENST00000270059;ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.34275	1.37;5.93;1.37;1.41	1.64	0.549	0.17213	.	.	.	.	.	T	0.24890	0.0604	L	0.28192	0.835	0.09310	N	1	P;B;B;B;B;B;B;B;B	0.35493	0.505;0.013;0.302;0.286;0.242;0.051;0.171;0.389;0.051	B;B;B;B;B;B;B;B;B	0.40038	0.317;0.008;0.087;0.106;0.04;0.017;0.072;0.14;0.064	T	0.20472	-1.0274	9	0.46703	T	0.11	.	3.992	0.09541	0.2332:0.0:0.7668:0.0	.	12;12;12;12;12;12;12;12;12	O75238;P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;Q9UPK8;O75237;P11464-2	.;.;.;PSG1_HUMAN;.;.;.;.;.	S	12	ENSP00000413041:R12S;ENSP00000385386:R12S;ENSP00000308970:R12S;ENSP00000244296:R12S	ENSP00000244296:R12S	R	-	1	0	PSG1	48075540	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.800000	0.04555	0.261000	0.21753	0.184000	0.17185	CGC		0.572	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
IRGC	56269	broad.mit.edu	37	19	44223701	44223701	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:44223701C>T	ENST00000244314.5	+	2	1190	c.991C>T	c.(991-993)Cgc>Tgc	p.R331C		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	331						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)	p.R331C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				CTCGGTCATCCGCTCCCCACT	0.672																																					p.R331C	Colon(189;350 2037 11447 13433 38914)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C991T	19						.						50.0	51.0	50.0					19																	44223701		2203	4300	6503	48915541	SO:0001583	missense	56269	exon2			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.991C>T	19.37:g.44223701C>T	ENSP00000244314:p.Arg331Cys	Somatic		Capture	Illumina HiSeq	Phase_I	48915541	NM_019612	Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	37	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837613	0.50951	.	.	ENSG00000124449	ENST00000244314	T	0.26660	1.72	4.67	4.67	0.58626	.	0.173821	0.35495	N	0.003161	T	0.42787	0.1218	L	0.49778	1.585	0.45502	D	0.998465	D	0.89917	1.0	P	0.62649	0.905	T	0.38802	-0.9644	10	0.87932	D	0	.	15.0651	0.71986	0.0:1.0:0.0:0.0	.	331	Q6NXR0	IIGP5_HUMAN	C	331	ENSP00000244314:R331C	ENSP00000244314:R331C	R	+	1	0	IRGC	48915541	0.047000	0.20315	1.000000	0.80357	0.370000	0.29829	0.238000	0.18004	2.151000	0.67156	0.655000	0.94253	CGC		0.672	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612	
EXOC3L2	90332	broad.mit.edu	37	19	45735072	45735072	+	Silent	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:45735072G>A	ENST00000252482.3	-	1	66	c.39C>T	c.(37-39)ctC>ctT	p.L13L	EXOC3L2_ENST00000413988.1_Silent_p.L13L			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	13					exocytosis (GO:0006887)	exocyst (GO:0000145)		p.L13L(1)		endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		TGCCAGGGGAGAGAAGGGGCC	0.587																																					p.L13L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C39T	19						.						51.0	48.0	49.0					19																	45735072		2203	4300	6503	50426912	SO:0001819	synonymous_variant	90332	exon2			AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.39C>T	19.37:g.45735072G>A		Somatic		Capture	Illumina HiSeq	Phase_I	50426912	NM_138568	Q8N9W2|Q96GV2	Silent	SNP	ENST00000252482.3	37	CCDS12657.1																																																																																				0.587	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568	
ZNF808	388558	broad.mit.edu	37	19	53058570	53058570	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:53058570G>A	ENST00000359798.4	+	5	2581	c.2401G>A	c.(2401-2403)Gtg>Atg	p.V801M		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	801					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CAAGGCTTTCGTGCGTAATTC	0.408																																					p.V801M												.	.	0			c.G2401A	19						.						162.0	166.0	165.0					19																	53058570		2203	4300	6503	57750382	SO:0001583	missense	388558	exon5			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2401G>A	19.37:g.53058570G>A	ENSP00000352846:p.Val801Met	Somatic		Capture	Illumina HiSeq	Phase_I	57750382	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	37	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	7.402	0.632944	0.14322	.	.	ENSG00000198482	ENST00000359798	T	0.07688	3.17	1.58	-3.16	0.05217	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06005	0.0156	L	0.42245	1.32	0.09310	N	1	P	0.34546	0.456	B	0.29440	0.102	T	0.27020	-1.0086	9	0.37606	T	0.19	.	6.3368	0.21300	0.5356:0.0:0.4644:0.0	.	801	Q8N4W9	ZN808_HUMAN	M	801	ENSP00000352846:V801M	ENSP00000352846:V801M	V	+	1	0	ZNF808	57750382	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.810000	0.04505	-0.860000	0.04099	-0.657000	0.03884	GTG		0.408	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
ZNF160	90338	broad.mit.edu	37	19	53571869	53571869	+	Missense_Mutation	SNP	G	G	A	rs568622088		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:53571869G>A	ENST00000429604.1	-	7	2333	c.1918C>T	c.(1918-1920)Cgg>Tgg	p.R640W	ZNF160_ENST00000599056.1_Missense_Mutation_p.R640W|ZNF160_ENST00000601421.1_Missense_Mutation_p.R604W|ZNF160_ENST00000418871.1_Missense_Mutation_p.R640W	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	640					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R640W(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		TGAATTCGCCGATGAGTTGCA	0.408													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22840	0.0		0.0	False		,,,				2504	0.0				p.R640W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1918T	19						.						111.0	108.0	109.0					19																	53571869		2203	4300	6503	58263681	SO:0001583	missense	90338	exon7			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.1918C>T	19.37:g.53571869G>A	ENSP00000406201:p.Arg640Trp	Somatic		Capture	Illumina HiSeq	Phase_I	58263681	NM_198893	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	ENST00000429604.1	37	CCDS12859.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790958	0.50102	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.07688	3.17;3.17	2.34	-4.69	0.03299	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09423	0.0232	M	0.82056	2.57	0.09310	N	1	B	0.19445	0.036	B	0.19148	0.024	T	0.41106	-0.9527	9	0.59425	D	0.04	.	1.6274	0.02726	0.2146:0.1574:0.4674:0.1605	.	640	Q9HCG1	ZN160_HUMAN	W	640	ENSP00000406201:R640W;ENSP00000409597:R640W	ENSP00000409597:R640W	R	-	1	2	ZNF160	58263681	0.000000	0.05858	0.000000	0.03702	0.360000	0.29518	-0.994000	0.03716	-1.142000	0.02869	0.462000	0.41574	CGG		0.408	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288	
NLRP4	147945	broad.mit.edu	37	19	56379149	56379149	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:56379149C>T	ENST00000301295.6	+	6	2683	c.2261C>T	c.(2260-2262)aCg>aTg	p.T754M	NLRP4_ENST00000346986.5_Intron|NLRP4_ENST00000587891.1_Missense_Mutation_p.T679M	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	754					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.T754M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AAGAAGCTGACGTATCTGAAT	0.493																																					p.T754M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2261T	19						.						203.0	163.0	177.0					19																	56379149		2203	4300	6503	61070961	SO:0001583	missense	147945	exon6			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2261C>T	19.37:g.56379149C>T	ENSP00000301295:p.Thr754Met	Somatic		Capture	Illumina HiSeq	Phase_I	61070961	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	6.941	0.543413	0.13250	.	.	ENSG00000160505	ENST00000301295	T	0.13657	2.57	3.06	-0.469	0.12142	.	.	.	.	.	T	0.10508	0.0257	L	0.53780	1.695	0.09310	N	0.999994	B;P	0.51147	0.446;0.942	B;B	0.38056	0.229;0.264	T	0.20207	-1.0282	9	0.54805	T	0.06	.	4.2906	0.10876	0.4402:0.4333:0.1265:0.0	.	679;754	Q96MN2-3;Q96MN2	.;NALP4_HUMAN	M	754	ENSP00000301295:T754M	ENSP00000301295:T754M	T	+	2	0	NLRP4	61070961	0.000000	0.05858	0.006000	0.13384	0.024000	0.10985	-1.839000	0.01686	-0.161000	0.10983	-0.823000	0.03104	ACG		0.493	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
NLRP13	126204	broad.mit.edu	37	19	56423240	56423240	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr19:56423240T>C	ENST00000342929.3	-	5	1942	c.1943A>G	c.(1942-1944)gAa>gGa	p.E648G	NLRP13_ENST00000588751.1_Missense_Mutation_p.E648G	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	648							ATP binding (GO:0005524)	p.E648G(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TGTGAAGTCTTCCTCCTGGGA	0.418																																					p.E648G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1943G	19						.						106.0	101.0	103.0					19																	56423240		2203	4300	6503	61115052	SO:0001583	missense	126204	exon5			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1943A>G	19.37:g.56423240T>C	ENSP00000343891:p.Glu648Gly	Somatic		Capture	Illumina HiSeq	Phase_I	61115052	NM_176810	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.689925	0.48097	.	.	ENSG00000173572	ENST00000342929	D	0.87966	-2.32	2.48	2.48	0.30137	.	.	.	.	.	D	0.89357	0.6692	L	0.45698	1.435	0.25819	N	0.984306	D	0.89917	1.0	D	0.76575	0.988	T	0.78708	-0.2099	9	0.72032	D	0.01	.	7.1595	0.25657	0.0:0.0:0.0:1.0	.	648	Q86W25	NAL13_HUMAN	G	648	ENSP00000343891:E648G	ENSP00000343891:E648G	E	-	2	0	NLRP13	61115052	0.003000	0.15002	0.482000	0.27366	0.133000	0.20885	0.795000	0.26972	1.121000	0.41925	0.443000	0.29094	GAA		0.418	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
AKNAD1	254268	broad.mit.edu	37	1	109377557	109377557	+	Missense_Mutation	SNP	G	G	A	rs202065262		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:109377557G>A	ENST00000370001.3	-	8	1926	c.1658C>T	c.(1657-1659)cCg>cTg	p.P553L	AKNAD1_ENST00000357393.4_Missense_Mutation_p.P260L|AKNAD1_ENST00000369994.1_Missense_Mutation_p.P523L|AKNAD1_ENST00000369995.3_Missense_Mutation_p.P553L	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	553						cytoplasm (GO:0005737)		p.P553L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TCACGTCTGCGGGGCCAGCTC	0.657																																					p.P553L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1658T	1						.						38.0	39.0	38.0					1																	109377557		2202	4300	6502	109179080	SO:0001583	missense	254268	exon8			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.1658C>T	1.37:g.109377557G>A	ENSP00000359018:p.Pro553Leu	Somatic		Capture	Illumina HiSeq	Phase_I	109179080	NM_152763	B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	ENST00000370001.3	37	CCDS791.2	.	.	.	.	.	.	.	.	.	.	G	5.622	0.299461	0.10622	.	.	ENSG00000162641	ENST00000370001;ENST00000357393;ENST00000369994;ENST00000369995	T;T;T;T	0.24908	3.23;2.42;1.83;3.2	2.08	-4.16	0.03869	.	.	.	.	.	T	0.04137	0.0115	L	0.40543	1.245	0.09310	N	1	B;B	0.18968	0.032;0.007	B;B	0.12156	0.007;0.003	T	0.37753	-0.9692	9	0.28530	T	0.3	3.7514	0.1588	0.00101	0.2676:0.1606:0.2132:0.3586	.	260;553	B4DET8;Q5T1N1	.;AKND1_HUMAN	L	553;260;523;553	ENSP00000359018:P553L;ENSP00000349968:P260L;ENSP00000359011:P523L;ENSP00000359012:P553L	ENSP00000349968:P260L	P	-	2	0	AKNAD1	109179080	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.835000	0.01692	-1.667000	0.01473	-1.186000	0.01703	CCG		0.657	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763	
GJA8	2703	broad.mit.edu	37	1	147381247	147381247	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:147381247G>A	ENST00000369235.1	+	1	1165	c.1165G>A	c.(1165-1167)Gag>Aag	p.E389K	GJA8_ENST00000240986.4_Missense_Mutation_p.E389K			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	389					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)	p.E389K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GCCGCAGTCGGAGAAGGTGTC	0.577																																					p.E389K	Melanoma(76;1255 1795 8195 52096)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1165A	1						.						53.0	56.0	55.0					1																	147381247		2203	4300	6503	145847871	SO:0001583	missense	2703	exon2			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.1165G>A	1.37:g.147381247G>A	ENSP00000358238:p.Glu389Lys	Somatic		Capture	Illumina HiSeq	Phase_I	145847871	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	g	1.827	-0.470759	0.04445	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.97404	-4.37;-4.37	5.31	4.4	0.53042	.	3.874450	0.01064	N	0.004693	D	0.88665	0.6498	L	0.36672	1.1	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.81486	-0.0911	10	0.07813	T	0.8	.	9.1207	0.36786	0.1682:0.0:0.8318:0.0	.	389	P48165	CXA8_HUMAN	K	389	ENSP00000240986:E389K;ENSP00000358238:E389K	ENSP00000240986:E389K	E	+	1	0	GJA8	145847871	0.984000	0.35163	0.035000	0.18076	0.311000	0.27955	2.130000	0.42064	1.451000	0.47736	0.655000	0.94253	GAG		0.577	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
TAS1R2	80834	broad.mit.edu	37	1	19180976	19180976	+	Missense_Mutation	SNP	C	C	T	rs370333179		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:19180976C>T	ENST00000375371.3	-	3	1009	c.988G>A	c.(988-990)Gtg>Atg	p.V330M	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	330					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.V330M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGGATGGGCACGCTCTGGATG	0.667																																					p.V330M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G988A	1						.	C	MET/VAL	0,4406		0,0,2203	64.0	64.0	64.0		988	3.8	0.9	1		64	1,8599	1.2+/-3.3	0,1,4299	no	missense	TAS1R2	NM_152232.2	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	330/840	19180976	1,13005	2203	4300	6503	19053563	SO:0001583	missense	80834	exon3				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.988G>A	1.37:g.19180976C>T	ENSP00000364520:p.Val330Met	Somatic		Capture	Illumina HiSeq	Phase_I	19053563	NM_152232	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778828	0.49891	0.0	1.16E-4	ENSG00000179002	ENST00000375371	D	0.83591	-1.74	4.71	3.77	0.43336	Extracellular ligand-binding receptor (1);	0.000000	0.40385	N	0.001107	D	0.87637	0.6227	L	0.59436	1.845	0.25142	N	0.990492	D	0.89917	1.0	D	0.75484	0.986	T	0.78526	-0.2170	10	0.54805	T	0.06	.	11.1073	0.48210	0.0:0.9054:0.0:0.0946	.	330	Q8TE23	TS1R2_HUMAN	M	330	ENSP00000364520:V330M	ENSP00000364520:V330M	V	-	1	0	TAS1R2	19053563	0.004000	0.15560	0.943000	0.38184	0.481000	0.33189	1.102000	0.31050	2.450000	0.82876	0.561000	0.74099	GTG		0.667	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
IGSF9	57549	broad.mit.edu	37	1	159901260	159901260	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:159901260G>A	ENST00000368094.1	-	12	1693	c.1496C>T	c.(1495-1497)aCg>aTg	p.T499M	IGSF9_ENST00000361509.3_Missense_Mutation_p.T483M|IGSF9_ENST00000493195.1_Intron	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	499	Ig-like 5.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.T483M(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GTAGACGTTCGTGGAGGTGGC	0.597																																					p.T499M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1496T	1						.						51.0	54.0	53.0					1																	159901260		2203	4300	6503	158167884	SO:0001583	missense	57549	exon12			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1496C>T	1.37:g.159901260G>A	ENSP00000357073:p.Thr499Met	Somatic		Capture	Illumina HiSeq	Phase_I	158167884	NM_001135050		Missense_Mutation	SNP	ENST00000368094.1	37	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014602	0.35511	.	.	ENSG00000085552	ENST00000361509;ENST00000368094	T;T	0.67345	-0.26;-0.26	4.24	4.24	0.50183	Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40818	N	0.001018	T	0.76637	0.4015	M	0.78637	2.42	0.51012	D	0.999904	D	0.89917	1.0	D	0.77557	0.99	T	0.78788	-0.2067	9	.	.	.	-8.4688	14.4797	0.67573	0.0:0.0:1.0:0.0	.	499	Q9P2J2	TUTLA_HUMAN	M	483;499	ENSP00000355049:T483M;ENSP00000357073:T499M	.	T	-	2	0	IGSF9	158167884	1.000000	0.71417	0.714000	0.30535	0.021000	0.10359	8.905000	0.92613	2.070000	0.61991	0.313000	0.20887	ACG		0.597	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
ZBTB40	9923	broad.mit.edu	37	1	22828008	22828008	+	Silent	SNP	T	T	C	rs545224543		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:22828008T>C	ENST00000375647.4	+	4	1062	c.855T>C	c.(853-855)ggT>ggC	p.G285G	ZBTB40_ENST00000374651.4_Intron|ZBTB40_ENST00000404138.1_Silent_p.G285G	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	285					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G285G(1)		endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GTTTCGAGGGTGAAGGAGGAC	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		19820	0.0		0.0	False		,,,				2504	0.001				p.G285G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T855C	1						.						120.0	111.0	114.0					1																	22828008		2203	4300	6503	22700595	SO:0001819	synonymous_variant	9923	exon4			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.855T>C	1.37:g.22828008T>C		Somatic		Capture	Illumina HiSeq	Phase_I	22700595	NM_014870	O75066|Q5TFU5|Q8N1R1	Silent	SNP	ENST00000375647.4	37	CCDS224.1																																																																																				0.438	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
EPHA8	2046	broad.mit.edu	37	1	22927926	22927926	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:22927926G>A	ENST00000166244.3	+	16	2935	c.2863G>A	c.(2863-2865)Gga>Aga	p.G955R		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	955	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.G955R(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CGCTGCGGGCGGATACTCCTC	0.711																																					p.G955R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2863A	1						.						38.0	44.0	42.0					1																	22927926		2203	4297	6500	22800513	SO:0001583	missense	2046	exon16			BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.2863G>A	1.37:g.22927926G>A	ENSP00000166244:p.Gly955Arg	Somatic		Capture	Illumina HiSeq	Phase_I	22800513	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164929	0.78339	.	.	ENSG00000070886	ENST00000166244	T	0.55930	0.49	5.23	5.23	0.72850	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81870	-0.0734	10	0.87932	D	0	.	11.9179	0.52776	0.0:0.1751:0.8249:0.0	.	955	P29322	EPHA8_HUMAN	R	955	ENSP00000166244:G955R	ENSP00000166244:G955R	G	+	1	0	EPHA8	22800513	1.000000	0.71417	0.350000	0.25708	0.711000	0.40976	9.651000	0.98493	2.722000	0.93159	0.491000	0.48974	GGA		0.711	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
KCNK2	3776	broad.mit.edu	37	1	215259847	215259847	+	Silent	SNP	G	G	A	rs375389536		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:215259847G>A	ENST00000444842.2	+	2	333	c.183G>A	c.(181-183)acG>acA	p.T61T	KCNK2_ENST00000391894.2_Silent_p.T46T|KCNK2_ENST00000391895.2_Silent_p.T57T	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	61					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.T46T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	AATGGAAGACGGTCTCCACGA	0.507																																					p.T57T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G171A	1						.						94.0	79.0	84.0					1																	215259847		2203	4300	6503	213326470	SO:0001819	synonymous_variant	3776	exon2			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.183G>A	1.37:g.215259847G>A		Somatic		Capture	Illumina HiSeq	Phase_I	213326470	NM_001017424	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Silent	SNP	ENST00000444842.2	37	CCDS41467.1																																																																																				0.507	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
OR2L13	284521	broad.mit.edu	37	1	248262906	248262906	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:248262906G>A	ENST00000358120.2	+	2	374	c.229G>A	c.(229-231)Gtc>Atc	p.V77I	OR2L13_ENST00000366478.2_Missense_Mutation_p.V77I			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V77I(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CTCCACCACCGTCCCCAAGAT	0.532																																					p.V77I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G229A	1						.						231.0	205.0	214.0					1																	248262906		2203	4300	6503	246329529	SO:0001583	missense	284521	exon3			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.229G>A	1.37:g.248262906G>A	ENSP00000350836:p.Val77Ile	Somatic		Capture	Illumina HiSeq	Phase_I	246329529	NM_175911	Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	G	7.337	0.620154	0.14193	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.02787	4.16;4.16	4.07	1.04	0.20106	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39407	N	0.001373	T	0.06416	0.0165	L	0.46947	1.48	0.09310	N	1	D	0.76494	0.999	D	0.75020	0.985	T	0.31916	-0.9926	10	0.56958	D	0.05	.	1.0854	0.01651	0.3866:0.1477:0.3147:0.1511	.	77	Q8N349	OR2LD_HUMAN	I	77	ENSP00000355434:V77I;ENSP00000350836:V77I	ENSP00000350836:V77I	V	+	1	0	OR2L13	246329529	0.000000	0.05858	0.053000	0.19242	0.422000	0.31414	-4.011000	0.00314	0.027000	0.15297	-0.157000	0.13467	GTC		0.532	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
AGO3	192669	broad.mit.edu	37	1	36437755	36437755	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:36437755C>T	ENST00000373191.4	+	4	792	c.443C>T	c.(442-444)cCa>cTa	p.P148L	AGO3_ENST00000324350.5_Missense_Mutation_p.P148L|AGO3_ENST00000397828.2_Missense_Mutation_p.P148L|AGO3_ENST00000246314.6_5'UTR	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	148					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)	p.P148L(1)									TTGCCTGAGCCACTGGAATTA	0.498																																					p.P148L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C443T	1						.						169.0	136.0	147.0					1																	36437755		2203	4300	6503	36210342	SO:0001583	missense	192669	exon4			AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.443C>T	1.37:g.36437755C>T	ENSP00000362287:p.Pro148Leu	Somatic		Capture	Illumina HiSeq	Phase_I	36210342	NM_024852	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	C	35	5.530250	0.96446	.	.	ENSG00000126070	ENST00000324350;ENST00000373191;ENST00000397828	T;T;T	0.10668	2.85;2.88;2.85	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.43277	0.1240	M	0.89904	3.07	0.80722	D	1	D;P	0.71674	0.998;0.847	D;B	0.73708	0.981;0.365	T	0.51741	-0.8667	10	0.87932	D	0	-12.8921	19.6201	0.95651	0.0:1.0:0.0:0.0	.	148;148	Q9H9G7;Q5TA56	AGO3_HUMAN;.	L	148	ENSP00000317425:P148L;ENSP00000362287:P148L;ENSP00000380928:P148L	ENSP00000317425:P148L	P	+	2	0	EIF2C3	36210342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.015000	0.70791	2.695000	0.91970	0.563000	0.77884	CCA		0.498	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
HIVEP3	59269	broad.mit.edu	37	1	41990543	41990543	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:41990543C>T	ENST00000372583.1	-	6	6131	c.5246G>A	c.(5245-5247)cGc>cAc	p.R1749H	HIVEP3_ENST00000372584.1_Missense_Mutation_p.R1749H|HIVEP3_ENST00000460604.1_Intron|HIVEP3_ENST00000247584.5_Missense_Mutation_p.R1749H|HIVEP3_ENST00000429157.2_Missense_Mutation_p.R1749H	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1749					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1749H(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CCCTCGGCCGCGGCCTCGCAC	0.502																																					p.R1749H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5246A	1						.						134.0	114.0	121.0					1																	41990543		2203	4300	6503	41763130	SO:0001583	missense	59269	exon6			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5246G>A	1.37:g.41990543C>T	ENSP00000361664:p.Arg1749His	Somatic		Capture	Illumina HiSeq	Phase_I	41763130	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	C	33	5.246737	0.95305	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.11063	2.82;2.81;2.81;2.82	4.85	4.85	0.62838	.	0.000000	0.50627	D	0.000105	T	0.37156	0.0993	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.27226	-1.0080	10	0.87932	D	0	-19.7098	17.7486	0.88428	0.0:1.0:0.0:0.0	.	1749;1749	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	H	1749	ENSP00000361665:R1749H;ENSP00000361664:R1749H;ENSP00000247584:R1749H;ENSP00000410828:R1749H	ENSP00000247584:R1749H	R	-	2	0	HIVEP3	41763130	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.520000	0.84964	0.561000	0.74099	CGC		0.502	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
ZCCHC11	23318	broad.mit.edu	37	1	52962830	52962830	+	Missense_Mutation	SNP	C	C	T	rs150367854		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:52962830C>T	ENST00000371544.3	-	5	1287	c.1025G>A	c.(1024-1026)cGt>cAt	p.R342H	ZCCHC11_ENST00000257177.4_Missense_Mutation_p.R342H|ZCCHC11_ENST00000371541.1_5'UTR	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	342					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.R342H(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						TGGCAGAGAACGAAGCTCACT	0.358																																					p.R342H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1025A	1						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	75.0	71.0	73.0		1025,1025	5.1	1.0	1	dbSNP_134	73	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense	ZCCHC11	NM_001009881.2,NM_015269.2	29,29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging,probably-damaging	342/1646,342/1645	52962830	3,13003	2203	4300	6503	52735418	SO:0001583	missense	23318	exon5			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.1025G>A	1.37:g.52962830C>T	ENSP00000360599:p.Arg342His	Somatic		Capture	Illumina HiSeq	Phase_I	52735418	NM_001009881	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	37	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511620	0.85389	0.0	3.49E-4	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.1	5.1	0.69264	.	0.057213	0.64402	D	0.000001	T	0.60064	0.2240	M	0.66939	2.045	0.80722	D	1	D;P;D	0.89917	1.0;0.87;1.0	D;P;D	0.85130	0.95;0.45;0.997	T	0.61589	-0.7032	10	0.52906	T	0.07	.	18.1145	0.89546	0.0:1.0:0.0:0.0	.	101;342;342	E9PKX1;Q5TAX3-2;Q5TAX3	.;.;TUT4_HUMAN	H	342;342;342;101	ENSP00000257177:R342H;ENSP00000360599:R342H;ENSP00000433486:R342H;ENSP00000435256:R101H	ENSP00000257177:R342H	R	-	2	0	ZCCHC11	52735418	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.421000	0.73353	2.378000	0.81104	0.467000	0.42956	CGT		0.358	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288	
DAB1	1600	broad.mit.edu	37	1	57480729	57480729	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:57480729G>A	ENST00000371231.1	-	13	1404	c.1370C>T	c.(1369-1371)cCg>cTg	p.P457L	DAB1_ENST00000371236.2_Missense_Mutation_p.P424L|DAB1_ENST00000414851.2_Missense_Mutation_p.P406L|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371234.4_Missense_Mutation_p.P424L|DAB1_ENST00000420954.2_Missense_Mutation_p.P422L|DAB1_ENST00000439789.2_Missense_Mutation_p.P338L			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	457					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.P424L(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GGGCACGGGCGGAGGCTGGGC	0.582																																					p.P424L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1271T	1						.						75.0	77.0	77.0					1																	57480729		2203	4300	6503	57253317	SO:0001583	missense	1600	exon14			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1370C>T	1.37:g.57480729G>A	ENSP00000360275:p.Pro457Leu	Somatic		Capture	Illumina HiSeq	Phase_I	57253317	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37		.	.	.	.	.	.	.	.	.	.	G	12.15	1.851692	0.32699	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.61510	0.21;0.21;0.17;0.1;1.23;0.25	5.54	4.62	0.57501	.	0.098623	0.64402	D	0.000001	T	0.50718	0.1632	L	0.42744	1.35	0.80722	D	1	B;B;B;P;B	0.50710	0.082;0.074;0.082;0.938;0.082	B;B;B;B;B	0.39419	0.048;0.02;0.014;0.299;0.014	T	0.59841	-0.7378	10	0.87932	D	0	-0.0069	16.5154	0.84299	0.0:0.1309:0.8691:0.0	.	406;457;424;338;422	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	L	424;424;424;422;406;338;457	ENSP00000360280:P424L;ENSP00000360278:P424L;ENSP00000395296:P422L;ENSP00000387581:P406L;ENSP00000409328:P338L;ENSP00000360275:P457L	ENSP00000360275:P457L	P	-	2	0	DAB1	57253317	1.000000	0.71417	0.901000	0.35422	0.795000	0.44927	9.263000	0.95617	1.559000	0.49555	0.650000	0.86243	CCG		0.582	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
FPGT-TNNI3K	100526835	broad.mit.edu	37	1	74819696	74819696	+	Missense_Mutation	SNP	C	C	T	rs200522674		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:74819696C>T	ENST00000370899.3	+	13	1400	c.1363C>T	c.(1363-1365)Cgc>Tgc	p.R455C	FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.R468C|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.R455C|TNNI3K_ENST00000326637.3_Missense_Mutation_p.R354C|TNNI3K_ENST00000370891.2_Missense_Mutation_p.R455C|RP11-439H8.4_ENST00000415549.2_RNA	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.R354C(1)									CGGTCACATTCGCCTGGTTCA	0.398																																					p.R455C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1363T	1						.	C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	153.0	133.0	140.0		1363,1363,1060	5.2	1.0	1		140	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TNNI3K,FPGT-TNNI3K	NM_001112808.2,NM_001199327.1,NM_015978.2	180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	455/937,455/844,354/836	74819696	1,13005	2203	4300	6503	74592284	SO:0001583	missense	51086	exon13					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1363C>T	1.37:g.74819696C>T	ENSP00000359936:p.Arg455Cys	Somatic		Capture	Illumina HiSeq	Phase_I	74592284	NM_001199327		Missense_Mutation	SNP	ENST00000370899.3	37		.	.	.	.	.	.	.	.	.	.	C	28.2	4.898883	0.91962	0.0	1.16E-4	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	0.104545	0.64402	D	0.000002	T	0.75860	0.3907	M	0.70903	2.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.959;0.978;0.966;0.997	T	0.77210	-0.2671	10	0.66056	D	0.02	.	18.9705	0.92713	0.0:1.0:0.0:0.0	.	354;455;455;455	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	C	455;455;455;455;354	ENSP00000359936:R455C;ENSP00000359932:R455C;ENSP00000450895:R455C;ENSP00000359928:R455C;ENSP00000322251:R354C	ENSP00000322251:R354C	R	+	1	0	RP11-653A5.2;AC093158.1	74592284	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.273000	0.78527	2.715000	0.92844	0.655000	0.94253	CGC		0.398	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
OR2T12	127064	broad.mit.edu	37	1	248458370	248458370	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr1:248458370C>T	ENST00000317996.1	-	1	510	c.511G>A	c.(511-513)Gag>Aag	p.E171K		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E171K(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TGATCGATCTCGTGTGCACCG	0.562																																					p.E171K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G511A	1						.						115.0	98.0	104.0					1																	248458370		2201	4298	6499	246524993	SO:0001583	missense	127064	exon1			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.511G>A	1.37:g.248458370C>T	ENSP00000324583:p.Glu171Lys	Somatic		Capture	Illumina HiSeq	Phase_I	246524993	NM_001004692		Missense_Mutation	SNP	ENST00000317996.1	37	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	c	12.64	1.999421	0.35320	.	.	ENSG00000177201	ENST00000317996	T	0.00123	8.7	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.492213	0.14954	N	0.288779	T	0.00178	0.0005	L	0.52206	1.635	0.09310	N	1	P	0.39940	0.696	P	0.45343	0.477	T	0.24870	-1.0148	10	0.44086	T	0.13	.	5.6681	0.17707	0.0:0.8249:0.0:0.1751	.	171	Q8NG77	O2T12_HUMAN	K	171	ENSP00000324583:E171K	ENSP00000324583:E171K	E	-	1	0	OR2T12	246524993	0.000000	0.05858	0.008000	0.14137	0.038000	0.13279	-5.491000	0.00118	0.645000	0.30675	0.175000	0.17021	GAG		0.562	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
PHACTR3	116154	broad.mit.edu	37	20	58330340	58330340	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr20:58330340C>T	ENST00000371015.1	+	4	929	c.462C>T	c.(460-462)ccC>ccT	p.P154P	PHACTR3_ENST00000541461.1_Silent_p.P113P|PHACTR3_ENST00000359926.3_Silent_p.P151P|PHACTR3_ENST00000395636.2_Silent_p.P113P|PHACTR3_ENST00000395639.4_Silent_p.P113P|PHACTR3_ENST00000355648.4_Silent_p.P113P|PHACTR3_ENST00000361300.4_Silent_p.P113P	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	154			P -> L (in dbSNP:rs2277759).			nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.P154P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			ATGCCCAGCCCGGAAGCCCCT	0.607																																					p.P154P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C462T	20						.						47.0	43.0	44.0					20																	58330340		2203	4300	6503	57763735	SO:0001819	synonymous_variant	116154	exon4			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.462C>T	20.37:g.58330340C>T		Somatic		Capture	Illumina HiSeq	Phase_I	57763735	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Silent	SNP	ENST00000371015.1	37	CCDS13480.1																																																																																				0.607	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
TPTE	7179	broad.mit.edu	37	21	10951333	10951333	+	Missense_Mutation	SNP	G	G	A	rs148393004	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr21:10951333G>A	ENST00000361285.4	-	10	708	c.379C>T	c.(379-381)Cgt>Tgt	p.R127C	TPTE_ENST00000342420.5_Missense_Mutation_p.R89C|TPTE_ENST00000298232.7_Missense_Mutation_p.R109C|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	127					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R109C(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GAAATAGAACGATACTCCAAA	0.338													.|||	2	0.000399361	0.0008	0.0	5008	,	,		31564	0.0		0.0	False		,,,				2504	0.001				p.R109C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C325T	21						.	G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	100.0	108.0	105.0		325,265,379	0.8	0.0	21	dbSNP_134	105	1,8593		0,1,4296	no	missense,missense,missense	TPTE	NM_199259.2,NM_199260.2,NM_199261.2	180,180,180	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	109/534,89/514,127/552	10951333	1,12999	2203	4297	6500	9973204	SO:0001583	missense	7179	exon9			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.379C>T	21.37:g.10951333G>A	ENSP00000355208:p.Arg127Cys	Somatic		Capture	Illumina HiSeq	Phase_I	9973204	NM_199259	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	12.79	2.043253	0.36085	0.0	1.16E-4	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420;ENST00000328758	D;D;D	0.97480	-4.4;-4.4;-4.4	1.8	0.829	0.18847	.	0.456228	0.21930	U	0.067036	D	0.96654	0.8908	L	0.49126	1.545	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70016	0.967;0.967;0.927	D	0.90851	0.4731	10	0.72032	D	0.01	-1.829	5.9254	0.19110	0.0:0.3337:0.6663:0.0	.	89;109;127	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	C	109;127;89;109	ENSP00000298232:R109C;ENSP00000355208:R127C;ENSP00000344441:R89C	ENSP00000298232:R109C	R	-	1	0	TPTE	9973204	0.000000	0.05858	0.023000	0.16930	0.123000	0.20343	0.093000	0.15086	0.290000	0.22444	0.194000	0.17425	CGT		0.338	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
KRTAP22-1	337979	broad.mit.edu	37	21	31973485	31973485	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr21:31973485G>T	ENST00000334680.2	+	1	72	c.46G>T	c.(46-48)Gga>Tga	p.G16*	KRTAP6-2_ENST00000334897.3_5'Flank	NM_181620.1	NP_853651.1	Q3MIV0	KR221_HUMAN	keratin associated protein 22-1	16						intermediate filament (GO:0005882)		p.G16*(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	8						CTATGCCAAAGGAGGCCTGGG	0.483																																					p.G16X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G46T	21						.						178.0	163.0	168.0					21																	31973485		2203	4300	6503	30895356	SO:0001587	stop_gained	337979	exon1			AP001708	CCDS13601.1	21q22.1	2011-02-10			ENSG00000186924	ENSG00000186924		"""Keratin associated proteins"""	18947	protein-coding gene	gene with protein product						12359730	Standard	NM_181620		Approved	KAP22.1	uc011add.2	Q3MIV0	OTTHUMG00000057778	ENST00000334680.2:c.46G>T	21.37:g.31973485G>T	ENSP00000333887:p.Gly16*	Somatic		Capture	Illumina HiSeq	Phase_I	30895356	NM_181620		Nonsense_Mutation	SNP	ENST00000334680.2	37	CCDS13601.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846260	0.32606	.	.	ENSG00000186924	ENST00000334680	.	.	.	3.83	-1.72	0.08107	.	0.319926	0.22090	N	0.064762	.	.	.	.	.	.	0.27774	N	0.943374	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.1639	0.10298	0.3114:0.3309:0.3577:0.0	.	.	.	.	X	16	.	ENSP00000333887:G16X	G	+	1	0	KRTAP22-1	30895356	0.062000	0.20869	0.000000	0.03702	0.011000	0.07611	0.930000	0.28858	-0.508000	0.06540	-0.229000	0.12294	GGA		0.483	KRTAP22-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128230.2		
PNPLA5	150379	broad.mit.edu	37	22	44280193	44280193	+	Missense_Mutation	SNP	G	G	A	rs149836456		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr22:44280193G>A	ENST00000597664.1	-	7	1111	c.982C>T	c.(982-984)Cgg>Tgg	p.R328W	PNPLA5_ENST00000381198.2_Missense_Mutation_p.R214W|PNPLA5_ENST00000216177.4_Missense_Mutation_p.R328W|PNPLA5_ENST00000593866.1_Missense_Mutation_p.R214W			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	328					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)	p.R328W(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CGGGCCCACCGGCTGGGATCC	0.627											OREG0026622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	g|||	1	0.000199681	0.0	0.0	5008	,	,		16523	0.0		0.001	False		,,,				2504	0.0				p.R328W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C982T	22						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	82.0	82.0	82.0		640,982	-7.1	0.0	22	dbSNP_134	82	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	PNPLA5	NM_001177675.1,NM_138814.3	101,101	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging	214/316,328/430	44280193	3,13003	2203	4300	6503	42611526	SO:0001583	missense	150379	exon7			Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.982C>T	22.37:g.44280193G>A	ENSP00000471069:p.Arg328Trp	Somatic	922	Capture	Illumina HiSeq	Phase_I	42611526	NM_138814	B1AHL8|B3KPR1|Q6ZST0	Missense_Mutation	SNP	ENST00000597664.1	37		.	.	.	.	.	.	.	.	.	.	G	11.50	1.657903	0.29425	0.0	3.49E-4	ENSG00000100341	ENST00000216177;ENST00000381198;ENST00000438734	T;T;T	0.43688	1.43;0.94;1.71	3.53	-7.05	0.01573	.	2.309660	0.02520	N	0.092440	T	0.26557	0.0649	N	0.22421	0.69	0.09310	N	1	D;P;P	0.54207	0.965;0.924;0.767	B;B;B	0.43123	0.353;0.409;0.183	T	0.48670	-0.9015	10	0.42905	T	0.14	-1.0046	4.4928	0.11822	0.0805:0.3938:0.1337:0.392	.	236;214;328	E9PGS4;Q7Z6Z6-2;Q7Z6Z6	.;.;PLPL5_HUMAN	W	328;214;236	ENSP00000216177:R328W;ENSP00000370595:R214W;ENSP00000405732:R236W	ENSP00000216177:R328W	R	-	1	2	PNPLA5	42611526	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.531000	0.00943	-3.313000	0.00189	0.313000	0.20887	CGG		0.627	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814	
RIBC2	26150	broad.mit.edu	37	22	45821833	45821833	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr22:45821833C>T	ENST00000342894.3	+	5	876	c.462C>T	c.(460-462)atC>atT	p.I154I	RIBC2_ENST00000466226.1_3'UTR|RIBC2_ENST00000538017.1_Silent_p.I222I			Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	154						nucleus (GO:0005634)		p.I154I(2)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|skin(2)|urinary_tract(1)	10		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTTAGGCCATCGAGTCAGTGG	0.552																																					p.S222L												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C665T	22						.						106.0	94.0	98.0					22																	45821833		2203	4299	6502	44200497	SO:0001819	synonymous_variant	26150	exon5			AK098586		22q13.3	2004-08-18	2004-08-18	2004-08-18	ENSG00000128408	ENSG00000128408			13241	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 11"""	C22orf11		12477932	Standard	NM_015653		Approved	DKFZp566F0546, FLJ25720	uc011aqs.3	Q9H4K1	OTTHUMG00000151332	ENST00000342894.3:c.462C>T	22.37:g.45821833C>T		Somatic		Capture	Illumina HiSeq	Phase_I	44200497	NM_015653	Q6ICD0|Q9Y413	Silent	SNP	ENST00000342894.3	37																																																																																					0.552	RIBC2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000322250.1	NM_015653	
LONRF2	164832	broad.mit.edu	37	2	100906747	100906747	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:100906747C>T	ENST00000393437.3	-	10	2532	c.1893G>A	c.(1891-1893)gcG>gcA	p.A631A	LONRF2_ENST00000409647.1_Silent_p.A388A	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	631	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.A631A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						ATTCAATGTCCGCTGTGTTAT	0.458																																					p.A631A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1893A	2						.						115.0	109.0	111.0					2																	100906747		2203	4300	6503	100273179	SO:0001819	synonymous_variant	164832	exon10			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1893G>A	2.37:g.100906747C>T		Somatic		Capture	Illumina HiSeq	Phase_I	100273179	NM_198461	B9A006|Q6ZSR4	Silent	SNP	ENST00000393437.3	37	CCDS2046.2																																																																																				0.458	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	
NPAS2	4862	broad.mit.edu	37	2	101580613	101580613	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:101580613G>A	ENST00000335681.5	+	8	977	c.692G>A	c.(691-693)cGt>cAt	p.R231H	NPAS2_ENST00000542504.1_Missense_Mutation_p.R296H|NPAS2_ENST00000486017.1_3'UTR	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	231					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.R231H(1)		cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCCACCGTTCGTCTGGCAACA	0.473																																					p.R231H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G692A	2						.						123.0	119.0	120.0					2																	101580613		2203	4300	6503	100947045	SO:0001583	missense	4862	exon8			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.692G>A	2.37:g.101580613G>A	ENSP00000338283:p.Arg231His	Somatic		Capture	Illumina HiSeq	Phase_I	100947045	NM_002518	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	ENST00000335681.5	37	CCDS2048.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998167	0.93227	.	.	ENSG00000170485	ENST00000335681;ENST00000542504	T;T	0.09817	2.96;2.94	5.47	5.47	0.80525	.	0.054750	0.64402	D	0.000001	T	0.41766	0.1173	M	0.87827	2.91	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	T	0.45818	-0.9235	10	0.87932	D	0	.	19.327	0.94265	0.0:0.0:1.0:0.0	.	296;231	F5H027;Q99743	.;NPAS2_HUMAN	H	231;296	ENSP00000338283:R231H;ENSP00000438428:R296H	ENSP00000338283:R231H	R	+	2	0	NPAS2	100947045	1.000000	0.71417	0.307000	0.25127	0.715000	0.41141	9.121000	0.94375	2.566000	0.86566	0.655000	0.94253	CGT		0.473	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		
TPO	7173	broad.mit.edu	37	2	1507809	1507809	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:1507809G>A	ENST00000345913.4	+	14	2567	c.2476G>A	c.(2476-2478)Gcg>Acg	p.A826T	TPO_ENST00000329066.4_Missense_Mutation_p.A826T|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000349624.3_Missense_Mutation_p.A653T|TPO_ENST00000382201.3_Missense_Mutation_p.A769T|TPO_ENST00000337415.3_Missense_Mutation_p.A826T|TPO_ENST00000382198.1_Missense_Mutation_p.A653T|TPO_ENST00000346956.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	826	EGF-like; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.A826T(2)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GTGTCTCTGCGCGGACCCCTA	0.577																																					p.A769T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2305A	2						.						84.0	80.0	81.0					2																	1507809		2203	4300	6503	1486816	SO:0001583	missense	7173	exon13				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2476G>A	2.37:g.1507809G>A	ENSP00000318820:p.Ala826Thr	Somatic		Capture	Illumina HiSeq	Phase_I	1486816	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.447197	0.01089	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000425083	D;D;D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96	4.4	-4.85	0.03142	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	1.607860	0.03854	N	0.272829	T	0.76241	0.3960	N	0.05306	-0.075	0.22330	N	0.99919	B;B;B	0.16166	0.007;0.006;0.016	B;B;B	0.10450	0.005;0.002;0.005	T	0.73332	-0.4016	10	0.02654	T	1	-1.8919	3.9596	0.09405	0.434:0.0:0.3159:0.2501	.	653;769;826	P07202-5;P07202-2;P07202	.;.;PERT_HUMAN	T	826;826;653;826;769;653;47	ENSP00000337263:A826T;ENSP00000318820:A826T;ENSP00000332044:A653T;ENSP00000329869:A826T;ENSP00000371636:A769T;ENSP00000371633:A653T;ENSP00000389659:A47T	ENSP00000329869:A826T	A	+	1	0	TPO	1486816	0.000000	0.05858	0.002000	0.10522	0.149000	0.21700	-0.452000	0.06787	-1.025000	0.03334	0.297000	0.19635	GCG		0.577	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
LRP1B	53353	broad.mit.edu	37	2	141641427	141641427	+	Silent	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:141641427G>T	ENST00000389484.3	-	25	5099	c.4128C>A	c.(4126-4128)gcC>gcA	p.A1376A		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1376					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.A1376A(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGTGTTCCATGGCTCCTGCTA	0.408										TSP Lung(27;0.18)																											p.A1376A	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4128A	2						.						156.0	155.0	155.0					2																	141641427		2203	4300	6503	141357897	SO:0001819	synonymous_variant	53353	exon25			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4128C>A	2.37:g.141641427G>T		Somatic		Capture	Illumina HiSeq	Phase_I	141357897	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																				0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SLC4A10	57282	broad.mit.edu	37	2	162751222	162751222	+	Missense_Mutation	SNP	C	C	T	rs558073659		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:162751222C>T	ENST00000446997.1	+	11	1321	c.1228C>T	c.(1228-1230)Cgt>Tgt	p.R410C	SLC4A10_ENST00000272716.5_Missense_Mutation_p.R380C|SLC4A10_ENST00000415876.2_Missense_Mutation_p.R380C|SLC4A10_ENST00000375514.5_Missense_Mutation_p.R391C|SLC4A10_ENST00000421911.1_Missense_Mutation_p.R410C|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000535165.1_Silent_p.I380I	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	410					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)	p.R380C(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	AGCTAAAGATCGTAATGACTT	0.328													C|||	1	0.000199681	0.0	0.0	5008	,	,		9117	0.001		0.0	False		,,,				2504	0.0				p.R391C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1171T	2						.						111.0	101.0	104.0					2																	162751222		1821	4076	5897	162459468	SO:0001583	missense	57282	exon11				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1228C>T	2.37:g.162751222C>T	ENSP00000393066:p.Arg410Cys	Somatic		Capture	Illumina HiSeq	Phase_I	162459468	NM_001178016	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523665	0.85600	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51	5.43	5.43	0.79202	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	D	0.88522	0.6459	M	0.92784	3.345	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;0.951;1.0;0.998	D	0.90703	0.4622	10	0.87932	D	0	.	19.6166	0.95636	0.0:1.0:0.0:0.0	.	391;410;380;410	F8W675;E7EW28;Q6U841-2;Q6U841	.;.;.;S4A10_HUMAN	C	391;380;380;379;410;410;409	ENSP00000364664:R391C;ENSP00000395797:R380C;ENSP00000272716:R380C;ENSP00000393066:R410C;ENSP00000404486:R410C	ENSP00000272716:R380C	R	+	1	0	SLC4A10	162459468	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.880000	0.69698	2.721000	0.93114	0.655000	0.94253	CGT		0.328	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
SCN1A	6323	broad.mit.edu	37	2	166870322	166870322	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:166870322G>A	ENST00000303395.4	-	18	3636	c.3637C>T	c.(3637-3639)Cga>Tga	p.R1213*	AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Nonsense_Mutation_p.R1202*|SCN1A_ENST00000409050.1_Nonsense_Mutation_p.R1185*|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Nonsense_Mutation_p.R1213*			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1213					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.R1202*(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCAACTATTCGGAAACACGTC	0.413																																					p.R1185X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3553T	2	GRCh37	CM032366	SCN1A	M		.						244.0	209.0	221.0					2																	166870322		2203	4300	6503	166578568	SO:0001587	stop_gained	6323	exon18			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3637C>T	2.37:g.166870322G>A	ENSP00000303540:p.Arg1213*	Somatic		Capture	Illumina HiSeq	Phase_I	166578568	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Nonsense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	G	41	8.775516	0.98950	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	.	.	.	5.43	4.47	0.54385	.	0.115626	0.37857	N	0.001901	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9286	0.58275	0.0:0.0:0.7198:0.2802	.	.	.	.	X	1213;1213;1202;1185	.	ENSP00000303540:R1213X	R	-	1	2	SCN1A	166578568	0.991000	0.36638	1.000000	0.80357	0.996000	0.88848	1.708000	0.37899	2.538000	0.85594	0.650000	0.86243	CGA		0.413	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
WDR35	57539	broad.mit.edu	37	2	20174291	20174291	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:20174291G>A	ENST00000345530.3	-	7	789	c.674C>T	c.(673-675)cCt>cTt	p.P225L	WDR35_ENST00000281405.4_Missense_Mutation_p.P225L|WDR35_ENST00000416055.2_5'UTR	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	225					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)		p.P225L(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCAAGGCAAGGGCAATCAGG	0.378																																					p.P225L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C674T	2						.						69.0	61.0	64.0					2																	20174291		2203	4300	6503	20037772	SO:0001583	missense	57539	exon7			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.674C>T	2.37:g.20174291G>A	ENSP00000314444:p.Pro225Leu	Somatic		Capture	Illumina HiSeq	Phase_I	20037772	NM_001006657	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	37	CCDS33152.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.920224	0.92249	.	.	ENSG00000118965	ENST00000345530;ENST00000281405	T;T	0.28895	1.59;1.59	5.35	5.35	0.76521	.	0.049787	0.85682	D	0.000000	T	0.59569	0.2203	M	0.83692	2.655	0.80722	D	1	D;P	0.76494	0.999;0.939	D;P	0.75020	0.985;0.777	T	0.59075	-0.7522	10	0.37606	T	0.19	-15.8987	18.4351	0.90643	0.0:0.0:1.0:0.0	.	225;225	Q9P2L0-2;Q9P2L0	.;WDR35_HUMAN	L	225	ENSP00000314444:P225L;ENSP00000281405:P225L	ENSP00000281405:P225L	P	-	2	0	WDR35	20037772	1.000000	0.71417	0.991000	0.47740	0.927000	0.56198	9.713000	0.98740	2.675000	0.91044	0.591000	0.81541	CCT		0.378	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
GAD1	2571	broad.mit.edu	37	2	171687519	171687519	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:171687519G>T	ENST00000358196.3	+	5	914	c.364G>T	c.(364-366)Gac>Tac	p.D122Y	GAD1_ENST00000429023.1_3'UTR|GAD1_ENST00000375272.1_Missense_Mutation_p.D122Y|GAD1_ENST00000344257.5_Missense_Mutation_p.D122Y	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	122					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.D122Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						GGAAGTGGTGGACATACTCCT	0.507																																					p.D122Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G364T	2						.						106.0	91.0	96.0					2																	171687519		2203	4300	6503	171395765	SO:0001583	missense	2571	exon5				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.364G>T	2.37:g.171687519G>T	ENSP00000350928:p.Asp122Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	171395765	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	G	33	5.274721	0.95459	.	.	ENSG00000128683	ENST00000358196;ENST00000375272;ENST00000344257	T;T;T	0.46819	0.86;0.86;0.86	5.9	5.9	0.94986	Pyridoxal phosphate-dependent transferase, major domain (1);	0.044404	0.85682	D	0.000000	T	0.63792	0.2541	L	0.49778	1.585	0.80722	D	1	D;D	0.63880	0.989;0.993	P;P	0.61592	0.815;0.891	T	0.63765	-0.6563	10	0.87932	D	0	-27.4391	20.2673	0.98463	0.0:0.0:1.0:0.0	.	122;122	Q99259;Q99259-3	DCE1_HUMAN;.	Y	122	ENSP00000350928:D122Y;ENSP00000364421:D122Y;ENSP00000341167:D122Y	ENSP00000341167:D122Y	D	+	1	0	GAD1	171395765	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.658000	0.83755	2.786000	0.95864	0.643000	0.83706	GAC		0.507	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
ERBB4	2066	broad.mit.edu	37	2	212566741	212566741	+	Silent	SNP	T	T	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:212566741T>A	ENST00000342788.4	-	12	1750	c.1440A>T	c.(1438-1440)acA>acT	p.T480T	ERBB4_ENST00000402597.1_Silent_p.T480T|ERBB4_ENST00000436443.1_Silent_p.T480T	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	480					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T480T(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TCTGGTTGATTGTGCTGAAGA	0.363										TSP Lung(8;0.080)																											p.T480T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1440T	2						.						168.0	155.0	160.0					2																	212566741		2203	4300	6503	212274986	SO:0001819	synonymous_variant	2066	exon12			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1440A>T	2.37:g.212566741T>A		Somatic		Capture	Illumina HiSeq	Phase_I	212274986	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	T	8.500	0.863996	0.17250	.	.	ENSG00000178568	ENST00000260943	.	.	.	5.71	-11.4	0.00090	.	.	.	.	.	T	0.39145	0.1067	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48514	-0.9029	4	.	.	.	.	4.2748	0.10804	0.0997:0.1396:0.3928:0.3679	.	.	.	.	L	480	.	.	Q	-	2	0	ERBB4	212274986	0.000000	0.05858	0.101000	0.21167	0.995000	0.86356	-3.710000	0.00387	-2.917000	0.00306	-0.263000	0.10527	CAA		0.363	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
TNS1	7145	broad.mit.edu	37	2	218713327	218713327	+	Missense_Mutation	SNP	G	G	A	rs116507626	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:218713327G>A	ENST00000171887.4	-	17	1990	c.1538C>T	c.(1537-1539)gCg>gTg	p.A513V	TNS1_ENST00000430930.1_Missense_Mutation_p.A513V|TNS1_ENST00000419504.1_Missense_Mutation_p.A513V|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	513					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.A513V(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CATGCTGCCCGCACTGTGACC	0.597													G|||	2	0.000399361	0.0	0.0	5008	,	,		19788	0.0		0.002	False		,,,				2504	0.0				p.A513V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1538T	2						.	G	VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	88.0	86.0	86.0		1538	-0.5	0.9	2	dbSNP_132	86	4,8596	3.7+/-12.6	0,4,4296	yes	missense	TNS1	NM_022648.4	64	0,6,6497	AA,AG,GG		0.0465,0.0454,0.0461	benign	513/1736	218713327	6,13000	2203	4300	6503	218421572	SO:0001583	missense	7145	exon17			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1538C>T	2.37:g.218713327G>A	ENSP00000171887:p.Ala513Val	Somatic		Capture	Illumina HiSeq	Phase_I	218421572	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	0.009	-1.816341	0.00595	4.54E-4	4.65E-4	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	D;D;D;D	0.90788	-2.1;-2.13;-2.11;-2.73	4.63	-0.487	0.12060	.	0.134414	0.49305	N	0.000141	T	0.57272	0.2042	N	0.00152	-1.975	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.53258	-0.8464	10	0.07325	T	0.83	.	5.21	0.15312	0.6102:0.1475:0.2424:0.0	.	513;567;513;513;513	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	V	513;513;513;638	ENSP00000171887:A513V;ENSP00000408724:A513V;ENSP00000406016:A513V;ENSP00000405460:A638V	ENSP00000171887:A513V	A	-	2	0	TNS1	218421572	1.000000	0.71417	0.942000	0.38095	0.019000	0.09904	2.481000	0.45215	-0.156000	0.11079	-0.302000	0.09304	GCG		0.597	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
TTLL4	9654	broad.mit.edu	37	2	219611887	219611887	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:219611887C>G	ENST00000392102.1	+	9	2476	c.2136C>G	c.(2134-2136)agC>agG	p.S712R	TTLL4_ENST00000457313.1_Missense_Mutation_p.S547R|TTLL4_ENST00000258398.4_Missense_Mutation_p.S712R|TTLL4_ENST00000442769.1_Intron	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	712	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)	p.S712R(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		CGTGGGAGAGCAGCAGCCGCC	0.552																																					p.S712R	GBM(172;1818 2053 15407 20943 49753)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2136G	2						.						58.0	62.0	61.0					2																	219611887		2203	4300	6503	219320131	SO:0001583	missense	9654	exon9				CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2136C>G	2.37:g.219611887C>G	ENSP00000375951:p.Ser712Arg	Somatic		Capture	Illumina HiSeq	Phase_I	219320131	NM_014640	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.17|14.17	2.456021|2.456021	0.43634|0.43634	.|.	.|.	ENSG00000135912|ENSG00000135912	ENST00000448224|ENST00000457313;ENST00000392102;ENST00000258398	.|T;T;T	.|0.05199	.|3.48;3.48;3.48	5.91|5.91	3.13|3.13	0.36017|0.36017	.|.	.|0.193178	.|0.56097	.|N	.|0.000038	T|T	0.02418|0.02418	0.0074|0.0074	N|N	0.02830|0.02830	-0.485|-0.485	0.32635|0.32635	N|N	0.521407|0.521407	.|B;B	.|0.28512	.|0.214;0.084	.|B;B	.|0.29077	.|0.076;0.098	T|T	0.35450|0.35450	-0.9788|-0.9788	5|10	.|0.22706	.|T	.|0.39	.|.	5.607|5.607	0.17385|0.17385	0.0:0.5582:0.1431:0.2987|0.0:0.5582:0.1431:0.2987	.|.	.|547;712	.|E9PH58;Q14679	.|.;TTLL4_HUMAN	G|R	44|547;712;712	.|ENSP00000393332:S547R;ENSP00000375951:S712R;ENSP00000258398:S712R	.|ENSP00000258398:S712R	A|S	+|+	2|3	0|2	TTLL4|TTLL4	219320131|219320131	0.735000|0.735000	0.28153|0.28153	0.998000|0.998000	0.56505|0.56505	0.986000|0.986000	0.74619|0.74619	-0.180000|-0.180000	0.09754|0.09754	0.834000|0.834000	0.34852|0.34852	0.655000|0.655000	0.94253|0.94253	GCA|AGC		0.552	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
COL4A4	1286	broad.mit.edu	37	2	227872153	227872153	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:227872153G>A	ENST00000396625.3	-	48	5168	c.4961C>T	c.(4960-4962)aCg>aTg	p.T1654M	COL4A4_ENST00000329662.7_Missense_Mutation_p.T1651M	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1654	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.T1654M(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGCTTTCACCGTTGTGAGCCA	0.527																																					p.T1654M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4961T	2						.						254.0	261.0	259.0					2																	227872153		1963	4165	6128	227580397	SO:0001583	missense	1286	exon48				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4961C>T	2.37:g.227872153G>A	ENSP00000379866:p.Thr1654Met	Somatic		Capture	Illumina HiSeq	Phase_I	227580397	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447682	0.43429	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.87650	-2.28;-2.28	5.79	5.79	0.91817	C-type lectin fold (1);	.	.	.	.	D	0.95683	0.8596	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	D	0.96256	0.9187	9	0.87932	D	0	.	20.0371	0.97565	0.0:0.0:1.0:0.0	.	1654	P53420	CO4A4_HUMAN	M	1654;1651	ENSP00000379866:T1654M;ENSP00000328553:T1651M	ENSP00000328553:T1651M	T	-	2	0	COL4A4	227580397	1.000000	0.71417	0.012000	0.15200	0.205000	0.24178	6.701000	0.74624	2.734000	0.93682	0.655000	0.94253	ACG		0.527	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
PPP1CB	5500	broad.mit.edu	37	2	28999824	28999824	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:28999824T>G	ENST00000395366.2	+	2	432	c.160T>G	c.(160-162)Ttg>Gtg	p.L54V	PPP1CB_ENST00000296122.6_Missense_Mutation_p.L54V|PPP1CB_ENST00000358506.2_Missense_Mutation_p.L54V	NM_002709.2	NP_002700.1	P62140	PP1B_HUMAN	protein phosphatase 1, catalytic subunit, beta isozyme	54					cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|G2/M transition of mitotic cell cycle (GO:0000086)|glycogen metabolic process (GO:0005977)|mitotic cell cycle (GO:0000278)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|myosin phosphatase activity (GO:0017018)|myosin-light-chain-phosphatase activity (GO:0050115)|phosphatase activity (GO:0016791)|protein kinase binding (GO:0019901)	p.L54V(1)		cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					TCTTTTGGAATTGGAAGCACC	0.403																																					p.L54V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T160G	2						.						138.0	139.0	139.0					2																	28999824		2203	4300	6503	28853328	SO:0001583	missense	5500	exon3				CCDS33169.1	2p23	2013-01-18	2010-03-05		ENSG00000213639	ENSG00000213639	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9282	protein-coding gene	gene with protein product		600590	"""protein phosphatase 1, catalytic subunit, beta isoform"""			8312365	Standard	NM_002709		Approved	PP1B, PP-1B, PP1beta	uc002rmg.3	P62140	OTTHUMG00000152011	ENST00000395366.2:c.160T>G	2.37:g.28999824T>G	ENSP00000378769:p.Leu54Val	Somatic		Capture	Illumina HiSeq	Phase_I	28853328	NM_206876	B2R5V4|D6W565|P37140|Q5U087|Q6FG45	Missense_Mutation	SNP	ENST00000395366.2	37	CCDS33169.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.091933	0.76756	.	.	ENSG00000213639	ENST00000455580;ENST00000420282;ENST00000441461;ENST00000358506;ENST00000296122;ENST00000395366	T;T;T;T;T;T	0.46819	3.44;0.86;0.87;3.44;3.44;3.44	5.36	4.2	0.49525	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.000000	0.64402	D	0.000001	T	0.48840	0.1522	M	0.80847	2.515	0.50813	D	0.999892	B;B	0.20261	0.043;0.024	B;B	0.21546	0.035;0.029	T	0.51076	-0.8751	10	0.87932	D	0	-7.1558	7.8095	0.29221	0.0:0.2082:0.0:0.7918	.	26;54	B4E163;P62140	.;PP1B_HUMAN	V	26;54;54;54;54;54	ENSP00000390715:L26V;ENSP00000398839:L54V;ENSP00000414918:L54V;ENSP00000351298:L54V;ENSP00000296122:L54V;ENSP00000378769:L54V	ENSP00000296122:L54V	L	+	1	2	PPP1CB	28853328	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.034000	0.57289	0.963000	0.38082	0.533000	0.62120	TTG		0.403	PPP1CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324841.1		
PRKCE	5581	broad.mit.edu	37	2	46211732	46211732	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:46211732G>A	ENST00000306156.3	+	6	1063	c.736G>A	c.(736-738)Ggt>Agt	p.G246S		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	246					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)	p.G246S(1)	MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	CCACAAGTTCGGTATCCACAA	0.567																																					p.G246S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G736A	2						.						148.0	160.0	156.0					2																	46211732		2121	4231	6352	46065236	SO:0001583	missense	5581	exon6				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.736G>A	2.37:g.46211732G>A	ENSP00000306124:p.Gly246Ser	Somatic		Capture	Illumina HiSeq	Phase_I	46065236	NM_005400	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	ENST00000306156.3	37	CCDS1824.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455045	0.26161	.	.	ENSG00000171132	ENST00000306156	D	0.92348	-3.02	4.74	1.72	0.24424	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.138072	0.64402	N	0.000004	T	0.68604	0.3019	N	0.00289	-1.7	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.60219	-0.7306	10	0.33141	T	0.24	.	6.7305	0.23381	0.4207:0.0:0.5793:0.0	.	246	Q02156	KPCE_HUMAN	S	246	ENSP00000306124:G246S	ENSP00000306124:G246S	G	+	1	0	PRKCE	46065236	0.995000	0.38212	0.196000	0.23383	0.954000	0.61252	2.902000	0.48703	0.605000	0.29947	0.655000	0.94253	GGT		0.567	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
CCDC88A	55704	broad.mit.edu	37	2	55562081	55562081	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:55562081G>A	ENST00000436346.1	-	15	2717	c.1876C>T	c.(1876-1878)Cga>Tga	p.R626*	CCDC88A_ENST00000336838.6_Nonsense_Mutation_p.R626*|AC012358.8_ENST00000600219.1_RNA|CCDC88A_ENST00000413716.2_Nonsense_Mutation_p.R626*|AC012358.8_ENST00000594078.1_RNA|AC012358.8_ENST00000599475.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000608103.1_RNA|CCDC88A_ENST00000263630.8_Nonsense_Mutation_p.R626*	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	626					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.R626*(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TCTTCAGCTCGTTCTCCTTTT	0.244																																					p.R626X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1876T	2						.						29.0	26.0	27.0					2																	55562081		2199	4294	6493	55415585	SO:0001587	stop_gained	55704	exon15			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.1876C>T	2.37:g.55562081G>A	ENSP00000410608:p.Arg626*	Somatic		Capture	Illumina HiSeq	Phase_I	55415585	NM_001135597	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Nonsense_Mutation	SNP	ENST00000436346.1	37		.	.	.	.	.	.	.	.	.	.	G	37	6.561442	0.97667	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	.	.	.	5.18	-2.62	0.06152	.	0.000000	0.45361	U	0.000371	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.1003	12.9343	0.58305	0.0:0.0856:0.1603:0.754	.	.	.	.	X	626	.	ENSP00000263630:R626X	R	-	1	2	CCDC88A	55415585	1.000000	0.71417	0.979000	0.43373	0.937000	0.57800	1.118000	0.31246	-0.331000	0.08501	-1.053000	0.02334	CGA		0.244	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
ACKR3	57007	broad.mit.edu	37	2	237490066	237490066	+	Missense_Mutation	SNP	C	C	T	rs371364738		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr2:237490066C>T	ENST00000272928.3	+	2	1268	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	320					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.R320C(1)									CTTCATCAATCGCAACTACAG	0.572																																					p.R320C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958T	2						.	C	CYS/ARG	0,4406		0,0,2203	88.0	72.0	77.0		958	4.5	1.0	2		77	2,8598	2.2+/-6.3	0,2,4298	no	missense	CXCR7	NM_020311.2	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	320/363	237490066	2,13004	2203	4300	6503	237154805	SO:0001583	missense	57007	exon2			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.958C>T	2.37:g.237490066C>T	ENSP00000272928:p.Arg320Cys	Somatic		Capture	Illumina HiSeq	Phase_I	237154805	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	37	CCDS2516.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463794	0.63513	0.0	2.33E-4	ENSG00000144476	ENST00000272928	T	0.40225	1.04	5.41	4.53	0.55603	.	0.056062	0.64402	D	0.000001	T	0.47655	0.1457	N	0.24115	0.695	0.54753	D	0.99998	D	0.89917	1.0	D	0.68621	0.959	T	0.39800	-0.9596	9	.	.	.	.	13.9777	0.64284	0.0:0.9275:0.0:0.0725	.	320	P25106	CXCR7_HUMAN	C	320	ENSP00000272928:R320C	.	R	+	1	0	CXCR7	237154805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.763000	0.47605	1.288000	0.44600	0.655000	0.94253	CGC		0.572	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
SERPINI1	5274	broad.mit.edu	37	3	167508293	167508294	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr3:167508293_167508294insA	ENST00000295777.5	+	3	815_816	c.384_385insA	c.(385-387)aaafs	p.K129fs	SERPINI1_ENST00000446050.2_Frame_Shift_Ins_p.K129fs	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	129					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						TGCAAATGATGAAAAAATATTT	0.356																																					p.M128fs												.	.	0			c.384_385insA	3						.																																			168990988	SO:0001589	frameshift_variant	5274	exon3			Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.390dupA	3.37:g.167508299_167508299dupA	ENSP00000295777:p.Lys129fs	None		Capture	Illumina HiSeq	Phase_I	168990987	NM_001122752	A8K217|D3DNP1|Q6AHZ4	Frame_Shift_Ins	INS	ENST00000295777.5	37	CCDS3203.1																																																																																				0.356	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351056.1		
KALRN	8997	broad.mit.edu	37	3	124174098	124174098	+	Silent	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr3:124174098G>A	ENST00000240874.3	+	22	3778	c.3621G>A	c.(3619-3621)acG>acA	p.T1207T	KALRN_ENST00000360013.3_Silent_p.T1207T|KALRN_ENST00000460856.1_Silent_p.T1198T	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1207					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T1207T(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TTCATGCCACGGAGATAAGGA	0.488																																					p.T1207T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3621A	3						.						143.0	132.0	135.0					3																	124174098		2203	4300	6503	125656788	SO:0001819	synonymous_variant	8997	exon22			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3621G>A	3.37:g.124174098G>A		Somatic		Capture	Illumina HiSeq	Phase_I	125656788	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	37	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	G	9.751	1.167560	0.21621	.	.	ENSG00000160145	ENST00000354186	.	.	.	4.71	-2.29	0.06805	.	.	.	.	.	T	0.38825	0.1055	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33189	-0.9878	4	.	.	.	.	1.2277	0.01937	0.3933:0.108:0.3117:0.1869	.	.	.	.	Q	1176	.	.	R	+	2	0	KALRN	125656788	0.541000	0.26417	0.998000	0.56505	0.996000	0.88848	-0.159000	0.10056	-0.127000	0.11661	0.446000	0.29264	CGG		0.488	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
EPHB1	2047	broad.mit.edu	37	3	134851573	134851573	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr3:134851573C>T	ENST00000398015.3	+	5	1349	c.979C>T	c.(979-981)Cgc>Tgc	p.R327C	EPHB1_ENST00000493838.1_5'UTR|EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	327	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.R327C(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						ATCAGGTCCCCGCAATGTTAT	0.547																																					p.R327C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C979T	3						.						51.0	52.0	52.0					3																	134851573		2003	4181	6184	136334263	SO:0001583	missense	2047	exon5			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.979C>T	3.37:g.134851573C>T	ENSP00000381097:p.Arg327Cys	Somatic		Capture	Illumina HiSeq	Phase_I	136334263	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.257985	0.59321	.	.	ENSG00000154928	ENST00000398015	T	0.59083	0.29	5.69	4.81	0.61882	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81103	0.4753	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86075	0.1540	10	0.87932	D	0	.	15.9966	0.80256	0.1358:0.8642:0.0:0.0	.	327	P54762	EPHB1_HUMAN	C	327	ENSP00000381097:R327C	ENSP00000381097:R327C	R	+	1	0	EPHB1	136334263	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	4.962000	0.63687	1.383000	0.46405	0.655000	0.94253	CGC		0.547	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
ITPR1	3708	broad.mit.edu	37	3	4752034	4752034	+	Missense_Mutation	SNP	G	G	A	rs561526280		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr3:4752034G>A	ENST00000443694.2	+	35	4823	c.4823G>A	c.(4822-4824)cGt>cAt	p.R1608H	ITPR1_ENST00000423119.2_Missense_Mutation_p.R1614H|ITPR1_ENST00000354582.6_Missense_Mutation_p.R1623H|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000302640.8_Missense_Mutation_p.R1608H|ITPR1_ENST00000357086.4_Missense_Mutation_p.R1614H|ITPR1_ENST00000456211.2_Missense_Mutation_p.R1599H			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1623					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.R1599H(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CTGGAGGACCGTCTCAGGCCC	0.562																																					p.R1614H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4841A	3						.						32.0	35.0	34.0					3																	4752034		2095	4216	6311	4727034	SO:0001583	missense	3708	exon38			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4823G>A	3.37:g.4752034G>A	ENSP00000401671:p.Arg1608His	Somatic		Capture	Illumina HiSeq	Phase_I	4727034	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793190	0.90453	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.76601	0.4010	L	0.50333	1.59	0.80722	D	1	B;D	0.71674	0.022;0.998	B;D	0.66497	0.01;0.944	T	0.70163	-0.4947	10	0.20046	T	0.44	.	19.6126	0.95616	0.0:0.0:1.0:0.0	.	1623;1614	Q14643;G5E9P1	ITPR1_HUMAN;.	H	1623;1608;1623;1614;69;1614;1599;1608	ENSP00000306253:R1608H;ENSP00000346595:R1623H;ENSP00000405934:R1614H;ENSP00000349597:R1614H;ENSP00000397885:R1599H;ENSP00000401671:R1608H	ENSP00000306253:R1608H	R	+	2	0	ITPR1	4727034	1.000000	0.71417	0.962000	0.40283	0.968000	0.65278	6.737000	0.74816	2.647000	0.89833	0.650000	0.86243	CGT		0.562	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
ROBO2	6092	broad.mit.edu	37	3	77651418	77651418	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr3:77651418G>A	ENST00000461745.1	+	20	3812	c.2912G>A	c.(2911-2913)gGa>gAa	p.G971E	ROBO2_ENST00000487694.3_Missense_Mutation_p.G987E|ROBO2_ENST00000332191.8_Missense_Mutation_p.G971E	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	971					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.G971E(1)|p.G987E(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CTCTCAGATGGAGCCATTTAT	0.458																																					p.W951X												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2853A	3						.						115.0	110.0	111.0					3																	77651418		2006	4197	6203	77734108	SO:0001583	missense	6092	exon19			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2912G>A	3.37:g.77651418G>A	ENSP00000417164:p.Gly971Glu	Somatic		Capture	Illumina HiSeq	Phase_I	77734108	NM_001128929	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.99|18.99|18.99	3.740404|3.740404|3.740404	0.69304|0.69304|0.69304	.|.|.	.|.|.	ENSG00000185008|ENSG00000185008|ENSG00000185008	ENST00000490991|ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191|ENST00000471893	.|T;T;T|.	.|0.66460|.	.|-0.21;-0.17;-0.11|.	5.83|5.83|5.83	5.83|5.83|5.83	0.93111|0.93111|0.93111	.|.|.	.|0.000000|.	.|0.44902|.	.|D|.	.|0.000406|.	T|T|.	0.75961|0.75961|.	0.3921|0.3921|.	M|M|M	0.65498|0.65498|0.65498	2.005|2.005|2.005	.|0.39048|.	.|D|.	.|0.960278|.	.|D;D;D|.	.|0.89917|.	.|1.0;1.0;0.999|.	.|D;D;D|.	.|0.79108|.	.|0.973;0.992;0.974|.	T|T|.	0.72606|0.72606|.	-0.4242|-0.4242|.	4|9|.	.|0.72032|.	.|D|.	.|0.01|.	.|.|.	20.1236|20.1236|20.1236	0.97970|0.97970|0.97970	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|987;971;971|.	.|Q19AB5;F8W703;Q9HCK4|.	.|.;.;ROBO2_HUMAN|.	K|E|X	128|987;987;991;971;971|45	.|ENSP00000417335:G987E;ENSP00000417164:G971E;ENSP00000327536:G971E|.	.|ENSP00000327536:G971E|.	E|G|W	+|+|+	1|2|3	0|0|0	ROBO2|ROBO2|ROBO2	77734108|77734108|77734108	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.987000|0.987000|0.987000	0.75469|0.75469|0.75469	9.476000|9.476000|9.476000	0.97823|0.97823|0.97823	2.765000|2.765000|2.765000	0.95021|0.95021|0.95021	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	GAG|GGA|TGG		0.458	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
SMCO1	255798	broad.mit.edu	37	3	196234795	196234795	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr3:196234795G>T	ENST00000397537.2	-	3	764	c.608C>A	c.(607-609)tCa>tAa	p.S203*		NM_001077657.1	NP_001071125.1	Q147U7	SMCO1_HUMAN	single-pass membrane protein with coiled-coil domains 1	203						integral component of membrane (GO:0016021)		p.S203*(1)									TTCGAGGGATGACTTTTGCTT	0.438																																					p.S203X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C608A	3						.						109.0	103.0	105.0					3																	196234795		1905	4137	6042	197719192	SO:0001587	stop_gained	255798	exon3			AK123917	CCDS43192.1	3q29	2013-03-08	2013-03-08	2013-03-08	ENSG00000214097	ENSG00000214097			27407	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 43"""	C3orf43			Standard	NM_001077657		Approved	FLJ41923, DKFZp313B0440		Q147U7	OTTHUMG00000155581	ENST00000397537.2:c.608C>A	3.37:g.196234795G>T	ENSP00000380671:p.Ser203*	Somatic		Capture	Illumina HiSeq	Phase_I	197719192	NM_001077657	B3KW20	Nonsense_Mutation	SNP	ENST00000397537.2	37	CCDS43192.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.558999	0.65538	.	.	ENSG00000214097	ENST00000397537	.	.	.	5.39	3.36	0.38483	.	.	.	.	.	.	.	.	.	.	.	0.30900	N	0.729342	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.9569	9.6874	0.40107	0.0:0.1503:0.6947:0.155	.	.	.	.	X	203	.	ENSP00000380671:S203X	S	-	2	0	C3orf43	197719192	0.017000	0.18338	0.033000	0.17914	0.004000	0.04260	2.196000	0.42686	2.537000	0.85549	0.655000	0.94253	TCA		0.438	SMCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340776.1	NM_001006109	
SEC24B	10427	broad.mit.edu	37	4	110448493	110448493	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr4:110448493G>A	ENST00000265175.5	+	18	3036	c.2981G>A	c.(2980-2982)aGa>aAa	p.R994K	SEC24B_ENST00000504968.2_Missense_Mutation_p.R1024K|SEC24B_ENST00000399100.2_Missense_Mutation_p.R959K	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	994					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.R994K(1)|p.R959K(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CGGAGAATTAGAGTACATACA	0.373																																					p.R994K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2981A	4						.						134.0	121.0	125.0					4																	110448493		1844	4099	5943	110667942	SO:0001583	missense	10427	exon18			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.2981G>A	4.37:g.110448493G>A	ENSP00000265175:p.Arg994Lys	Somatic		Capture	Illumina HiSeq	Phase_I	110667942	NM_006323	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725161	0.68959	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	D;D;D	0.89617	-2.54;-2.54;-2.54	5.64	4.78	0.61160	Sec23/Sec24 beta-sandwich (1);	0.103026	0.64402	D	0.000006	D	0.96605	0.8892	H	0.98133	4.155	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	1.0;0.992;1.0;1.0;0.992	D	0.97432	1.0016	10	0.72032	D	0.01	-20.2592	15.6174	0.76778	0.0693:0.0:0.9307:0.0	.	908;593;1024;959;994	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	K	1024;959;994	ENSP00000428564:R1024K;ENSP00000382051:R959K;ENSP00000265175:R994K	ENSP00000265175:R994K	R	+	2	0	SEC24B	110667942	0.999000	0.42202	0.967000	0.41034	0.103000	0.19146	8.013000	0.88655	2.832000	0.97577	0.655000	0.94253	AGA		0.373	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		
ALPK1	80216	broad.mit.edu	37	4	113360986	113360986	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr4:113360986T>A	ENST00000458497.1	+	14	3775	c.3496T>A	c.(3496-3498)Tat>Aat	p.Y1166N	ALPK1_ENST00000504176.2_Missense_Mutation_p.Y1088N|ALPK1_ENST00000177648.9_Missense_Mutation_p.Y1166N	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1166	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Y1166N(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CCATTTTTCTTATGAGTTTTC	0.308																																					p.Y1166N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3496A	4						.						54.0	55.0	55.0					4																	113360986		2203	4300	6503	113580435	SO:0001583	missense	80216	exon14			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.3496T>A	4.37:g.113360986T>A	ENSP00000398048:p.Tyr1166Asn	Somatic		Capture	Illumina HiSeq	Phase_I	113580435	NM_025144	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410549	0.83340	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.30714	1.52;1.52;1.52	5.05	5.05	0.67936	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	M	0.90705	3.14	0.49687	D	0.999817	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.72354	-0.4319	10	0.87932	D	0	-21.398	14.7988	0.69898	0.0:0.0:0.0:1.0	.	1088;1088;1166	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	N	1166;1166;1088	ENSP00000398048:Y1166N;ENSP00000177648:Y1166N;ENSP00000426044:Y1088N	ENSP00000177648:Y1166N	Y	+	1	0	ALPK1	113580435	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	5.685000	0.68204	1.900000	0.55004	0.445000	0.29226	TAT		0.308	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
LRRC66	339977	broad.mit.edu	37	4	52860944	52860944	+	Silent	SNP	C	C	T	rs76309529	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr4:52860944C>T	ENST00000343457.3	-	4	2250	c.2244G>A	c.(2242-2244)acG>acA	p.T748T		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	748						integral component of membrane (GO:0016021)		p.T748T(1)		central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TGTCTACAGCCGTCACATTGT	0.483													C|||	17	0.00339457	0.0129	0.0	5008	,	,		23075	0.0		0.0	False		,,,				2504	0.0				p.T748T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2244A	4						.	C		22,3998		0,22,1988	129.0	128.0	128.0		2244	-6.1	0.0	4	dbSNP_131	128	1,8369		0,1,4184	no	coding-synonymous	LRRC66	NM_001024611.1		0,23,6172	TT,TC,CC		0.0119,0.5473,0.1856		748/881	52860944	23,12367	2010	4185	6195	52555701	SO:0001819	synonymous_variant	339977	exon4			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2244G>A	4.37:g.52860944C>T		Somatic		Capture	Illumina HiSeq	Phase_I	52555701	NM_001024611		Silent	SNP	ENST00000343457.3	37	CCDS43229.1																																																																																				0.483	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
KDR	3791	broad.mit.edu	37	4	55972081	55972081	+	Silent	SNP	C	C	T	rs200769864		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr4:55972081C>T	ENST00000263923.4	-	12	1858	c.1563G>A	c.(1561-1563)gcG>gcA	p.A521A		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	521	Ig-like C2-type 5.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.A521A(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACACATTTGCCGCTTGGATAA	0.498			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.A521A			Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1563A	4						.						230.0	222.0	225.0					4																	55972081		2203	4300	6503	55666838	SO:0001819	synonymous_variant	3791	exon12			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1563G>A	4.37:g.55972081C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55666838	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	CCDS3497.1																																																																																				0.498	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
FRAS1	80144	broad.mit.edu	37	4	79238600	79238600	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr4:79238600G>A	ENST00000325942.6	+	17	2338	c.1898G>A	c.(1897-1899)cGt>cAt	p.R633H	FRAS1_ENST00000264895.6_Missense_Mutation_p.R633H|FRAS1_ENST00000264899.6_Missense_Mutation_p.R633H	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	633					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.R633H(2)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AAGGCTCTGCGTCAAGGCCAC	0.562																																					p.R633H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1898A	4						.						80.0	85.0	84.0					4																	79238600		2032	4188	6220	79457624	SO:0001583	missense	80144	exon17			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.1898G>A	4.37:g.79238600G>A	ENSP00000326330:p.Arg633His	Somatic		Capture	Illumina HiSeq	Phase_I	79457624	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.454|0.454	-0.892558|-0.892558	0.02491|0.02491	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000264899|ENST00000502446	D;D;D|.	0.89875|.	-2.58;-2.58;-2.58|.	5.71|5.71	1.9|1.9	0.25705|0.25705	Growth factor, receptor (1);|.	0.408252|.	0.25708|.	N|.	0.028822|.	T|T	0.19327|0.19327	0.0464|0.0464	N|N	0.17278|0.17278	0.47|0.47	0.24844|0.24844	N|N	0.992447|0.992447	B;B;B;B|.	0.14438|.	0.01;0.003;0.01;0.002|.	B;B;B;B|.	0.06405|.	0.001;0.001;0.002;0.001|.	T|T	0.21348|0.21348	-1.0248|-1.0248	10|5	0.30854|.	T|.	0.27|.	.|.	3.2844|3.2844	0.06926|0.06926	0.4452:0.0:0.3705:0.1844|0.4452:0.0:0.3705:0.1844	.|.	633;633;633;633|.	E9PHH6;Q86XX4;E7EWM9;A2RRR8|.	.;FRAS1_HUMAN;.;.|.	H|I	633|562	ENSP00000326330:R633H;ENSP00000264895:R633H;ENSP00000264899:R633H|.	ENSP00000264895:R633H|.	R|V	+|+	2|1	0|0	FRAS1|FRAS1	79457624|79457624	0.000000|0.000000	0.05858|0.05858	0.974000|0.974000	0.42286|0.42286	0.020000|0.020000	0.10135|0.10135	-0.674000|-0.674000	0.05233|0.05233	0.481000|0.481000	0.27557|0.27557	0.561000|0.561000	0.74099|0.74099	CGT|GTC		0.562	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
DDX60	55601	broad.mit.edu	37	4	169204654	169204654	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr4:169204654C>T	ENST00000393743.3	-	13	1956	c.1665G>A	c.(1663-1665)gtG>gtA	p.V555V		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	555					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.V555V(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TAGTTTGAGTCACGATGATTT	0.348																																					p.V555V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1665A	4						.						66.0	68.0	68.0					4																	169204654		2203	4300	6503	169441229	SO:0001819	synonymous_variant	55601	exon13			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1665G>A	4.37:g.169204654C>T		Somatic		Capture	Illumina HiSeq	Phase_I	169441229	NM_017631	Q6PK35|Q9NVE3	Silent	SNP	ENST00000393743.3	37	CCDS34097.1																																																																																				0.348	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
NUDT12	83594	broad.mit.edu	37	5	102887953	102887953	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:102887953C>T	ENST00000230792.2	-	6	1339	c.1243G>A	c.(1243-1245)Gaa>Aaa	p.E415K	NUDT12_ENST00000507423.1_Missense_Mutation_p.E397K|NUDT12_ENST00000515407.1_5'Flank	NM_031438.2	NP_113626.1	Q9BQG2	NUD12_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 12	415	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				NAD catabolic process (GO:0019677)|NADP catabolic process (GO:0006742)	nucleus (GO:0005634)|peroxisome (GO:0005777)	metal ion binding (GO:0046872)|NAD+ diphosphatase activity (GO:0000210)|NADH pyrophosphatase activity (GO:0035529)	p.E415K(1)		endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|urinary_tract(1)	12		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		TCCTCTATTTCATTCTTGTCA	0.398																																					p.E415K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1243A	5						.						165.0	157.0	160.0					5																	102887953		2202	4300	6502	102915852	SO:0001583	missense	83594	exon6			AL136592	CCDS4096.1, CCDS75284.1	5q15	2013-01-10			ENSG00000112874	ENSG00000112874		"""Nudix motif containing"", ""Ankyrin repeat domain containing"""	18826	protein-coding gene	gene with protein product	"""nucleoside diphosphate linked moiety X-type motif 12"""	609232				11230166	Standard	XM_005272095		Approved	DKFZP761I172	uc003koi.3	Q9BQG2	OTTHUMG00000128739	ENST00000230792.2:c.1243G>A	5.37:g.102887953C>T	ENSP00000230792:p.Glu415Lys	Somatic		Capture	Illumina HiSeq	Phase_I	102915852	NM_031438	B3KUW2|Q8TAL7	Missense_Mutation	SNP	ENST00000230792.2	37	CCDS4096.1	.	.	.	.	.	.	.	.	.	.	C	34	5.411661	0.96072	.	.	ENSG00000112874	ENST00000230792;ENST00000507423	T;T	0.67523	-0.27;-0.27	5.76	5.76	0.90799	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	D	0.88164	0.6363	H	0.95611	3.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90944	0.4800	10	0.87932	D	0	-25.5347	19.9664	0.97271	0.0:1.0:0.0:0.0	.	397;415	E7EM93;Q9BQG2	.;NUD12_HUMAN	K	415;397	ENSP00000230792:E415K;ENSP00000424521:E397K	ENSP00000230792:E415K	E	-	1	0	NUDT12	102915852	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.724000	0.93272	0.650000	0.86243	GAA		0.398	NUDT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250650.1	NM_031438	
APC	324	broad.mit.edu	37	5	112116592	112116592	+	Nonsense_Mutation	SNP	C	C	T	rs587781392		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:112116592C>T	ENST00000457016.1	+	6	1017	c.637C>T	c.(637-639)Cga>Tga	p.R213*	APC_ENST00000508376.2_Nonsense_Mutation_p.R213*|RNU6-482P_ENST00000391068.1_RNA|APC_ENST00000257430.4_Nonsense_Mutation_p.R213*			P25054	APC_HUMAN	adenomatous polyposis coli	213	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R213*(20)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TATGGAAAAACGAGCACAGGT	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R223X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	20	Substitution - Nonsense(20)	large_intestine(19)|lung(1)	c.C667T	5	GRCh37	CM920027	APC	M		.						58.0	57.0	58.0					5																	112116592		2202	4300	6502	112144491	SO:0001587	stop_gained	324	exon5	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.637C>T	5.37:g.112116592C>T	ENSP00000413133:p.Arg213*	Somatic		Capture	Illumina HiSeq	Phase_I	112144491	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.046788	0.97231	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.56	3.74	0.42951	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0079	14.2561	0.66053	0.4075:0.5925:0.0:0.0	.	.	.	.	X	213;223;213;213;213	.	ENSP00000257430:R213X	R	+	1	2	APC	112144491	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.672000	0.46850	0.659000	0.30945	0.655000	0.94253	CGA		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DNAH5	1767	broad.mit.edu	37	5	13714550	13714550	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:13714550C>A	ENST00000265104.4	-	75	13193	c.13089G>T	c.(13087-13089)atG>atT	p.M4363I		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4363					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.M4363I(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCTTCTCCAGCATATCATCAG	0.567									Kartagener syndrome																												p.M4363I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13089T	5						.						73.0	75.0	74.0					5																	13714550		2203	4300	6503	13767550	SO:0001583	missense	1767	exon75	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13089G>T	5.37:g.13714550C>A	ENSP00000265104:p.Met4363Ile	Somatic		Capture	Illumina HiSeq	Phase_I	13767550	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750777	0.89753	.	.	ENSG00000039139	ENST00000265104	T	0.04809	3.55	5.22	5.22	0.72569	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.09113	0.0225	N	0.25825	0.765	0.80722	D	1	P	0.36874	0.572	P	0.48952	0.596	T	0.49560	-0.8927	10	0.21014	T	0.42	.	18.7863	0.91955	0.0:1.0:0.0:0.0	.	4363	Q8TE73	DYH5_HUMAN	I	4363	ENSP00000265104:M4363I	ENSP00000265104:M4363I	M	-	3	0	DNAH5	13767550	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.746000	0.85057	2.446000	0.82766	0.655000	0.94253	ATG		0.567	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
TRPC7	57113	broad.mit.edu	37	5	135692564	135692564	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:135692564G>A	ENST00000513104.1	-	2	794	c.512C>T	c.(511-513)gCg>gTg	p.A171V	TRPC7_ENST00000426057.2_Missense_Mutation_p.A171V|TRPC7_ENST00000355180.3_Missense_Mutation_p.A171V	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	171					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A171V(4)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCAGTGCGCCGCCAGGATGAT	0.632																																					p.A171V												.	.	4	Substitution - Missense(4)	large_intestine(2)|kidney(2)	c.C512T	5						.						129.0	140.0	136.0					5																	135692564		2203	4300	6503	135720463	SO:0001583	missense	57113	exon2			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.512C>T	5.37:g.135692564G>A	ENSP00000426070:p.Ala171Val	Somatic		Capture	Illumina HiSeq	Phase_I	135720463	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	G	34	5.374382	0.95923	.	.	ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	D;D;D	0.87491	-2.26;-2.26;-2.26	5.26	5.26	0.73747	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	D	0.95101	0.8413	M	0.91818	3.245	0.47949	D	0.999559	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.97;1.0;0.995;0.998	D	0.95713	0.8759	10	0.87932	D	0	-17.8179	19.0783	0.93171	0.0:0.0:1.0:0.0	.	171;171;171;171	Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.;.;.;TRPC7_HUMAN	V	171	ENSP00000347312:A171V;ENSP00000441628:A171V;ENSP00000426070:A171V	ENSP00000265193:A171V	A	-	2	0	TRPC7	135720463	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	9.657000	0.98554	2.731000	0.93534	0.650000	0.86243	GCG		0.632	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHB1	29930	broad.mit.edu	37	5	140432177	140432177	+	Silent	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:140432177G>A	ENST00000306549.3	+	1	1199	c.1122G>A	c.(1120-1122)cgG>cgA	p.R374R		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	374	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R374R(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAGAGACCGGGACATTCGAG	0.493																																					p.R374R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1122A	5						.						111.0	102.0	105.0					5																	140432177		2203	4300	6503	140412361	SO:0001819	synonymous_variant	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1122G>A	5.37:g.140432177G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140412361	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	37	CCDS4243.1																																																																																				0.493	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PCDHB1	29930	broad.mit.edu	37	5	140432535	140432535	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:140432535C>A	ENST00000306549.3	+	1	1557	c.1480C>A	c.(1480-1482)Cca>Aca	p.P494T		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	494	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P494T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTGTTGCCTCCAAAAAACGG	0.423																																					p.P494T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1480A	5						.						58.0	56.0	57.0					5																	140432535		2203	4300	6503	140412719	SO:0001583	missense	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1480C>A	5.37:g.140432535C>A	ENSP00000307234:p.Pro494Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140412719	NM_013340	Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995653	0.54147	.	.	ENSG00000171815	ENST00000306549	T	0.50277	0.75	6.17	6.17	0.99709	Cadherin (4);Cadherin-like (1);	0.000000	0.44483	D	0.000455	T	0.49150	0.1540	L	0.28274	0.84	0.37966	D	0.933136	D	0.57257	0.979	P	0.54759	0.76	T	0.51679	-0.8675	10	0.51188	T	0.08	.	14.327	0.66528	0.0:0.811:0.189:0.0	.	494	Q9Y5F3	PCDB1_HUMAN	T	494	ENSP00000307234:P494T	ENSP00000307234:P494T	P	+	1	0	PCDHB1	140412719	0.000000	0.05858	1.000000	0.80357	0.925000	0.55904	0.321000	0.19558	2.941000	0.99782	0.655000	0.94253	CCA		0.423	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PCDHGA6	56109	broad.mit.edu	37	5	140755262	140755262	+	Missense_Mutation	SNP	G	G	A	rs540188136	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:140755262G>A	ENST00000517434.1	+	1	1612	c.1612G>A	c.(1612-1614)Ggg>Agg	p.G538R	PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	538	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G538R(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCGACAGCGGGGACCCGCC	0.602																																					p.G538R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1612A	5						.						103.0	124.0	116.0					5																	140755262		2199	4299	6498	140735446	SO:0001583	missense	56109	exon1			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1612G>A	5.37:g.140755262G>A	ENSP00000429601:p.Gly538Arg	Somatic		Capture	Illumina HiSeq	Phase_I	140735446	NM_032086	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	15.30	2.792704	0.50102	.	.	ENSG00000253731	ENST00000517434	T	0.67698	-0.28	4.52	4.52	0.55395	Cadherin (4);Cadherin-like (1);	0.000000	0.31589	U	0.007381	D	0.89462	0.6722	H	0.98818	4.34	0.38430	D	0.946419	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94599	0.7794	10	0.87932	D	0	.	17.7909	0.88552	0.0:0.0:1.0:0.0	.	538;538	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	R	538	ENSP00000429601:G538R	ENSP00000429601:G538R	G	+	1	0	PCDHGA6	140735446	1.000000	0.71417	0.439000	0.26833	0.508000	0.34012	9.657000	0.98554	2.503000	0.84419	0.467000	0.42956	GGG		0.602	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
HCN1	348980	broad.mit.edu	37	5	45262483	45262483	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:45262483A>G	ENST00000303230.4	-	8	2270	c.2213T>C	c.(2212-2214)gTa>gCa	p.V738A		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	738	Gln-rich.				apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.V738A(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						ggactgctgtacctgctgctg	0.637																																					p.V738A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2213C	5						.						28.0	30.0	29.0					5																	45262483		2203	4298	6501	45298240	SO:0001583	missense	348980	exon8			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2213T>C	5.37:g.45262483A>G	ENSP00000307342:p.Val738Ala	Somatic		Capture	Illumina HiSeq	Phase_I	45298240	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.306788	0.00240	.	.	ENSG00000164588	ENST00000303230	T	0.75477	-0.94	4.36	-5.33	0.02713	.	4.338630	0.01892	N	0.038633	T	0.47967	0.1474	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37267	-0.9713	10	0.14252	T	0.57	.	4.2227	0.10565	0.2813:0.0:0.4176:0.3011	.	738	O60741	HCN1_HUMAN	A	738	ENSP00000307342:V738A	ENSP00000307342:V738A	V	-	2	0	HCN1	45298240	0.018000	0.18449	0.000000	0.03702	0.043000	0.13939	-0.525000	0.06214	-0.660000	0.05352	0.455000	0.32223	GTA		0.637	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
IQGAP2	10788	broad.mit.edu	37	5	75996959	75996959	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:75996959G>A	ENST00000274364.6	+	34	4723	c.4426G>A	c.(4426-4428)Gcg>Acg	p.A1476T	IQGAP2_ENST00000379730.3_Missense_Mutation_p.A978T|IQGAP2_ENST00000502745.1_Missense_Mutation_p.A972T|CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000396234.3_Missense_Mutation_p.A972T	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1476					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.A1476T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GGCGAAGAGAGCGAAGCCAGT	0.413																																					p.A1476T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4426A	5						.						128.0	120.0	123.0					5																	75996959		2203	4300	6503	76032715	SO:0001583	missense	10788	exon34			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4426G>A	5.37:g.75996959G>A	ENSP00000274364:p.Ala1476Thr	Somatic		Capture	Illumina HiSeq	Phase_I	76032715	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	0.616	-0.823160	0.02755	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000396234;ENST00000502745	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.46	3.65	0.41850	RasGAP protein, C-terminal (1);	0.598733	0.18458	N	0.140624	T	0.23054	0.0557	N	0.19112	0.55	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.16722	0.005;0.005;0.016	T	0.17379	-1.0371	10	0.20519	T	0.43	-2.2012	4.1204	0.10103	0.0762:0.1845:0.4909:0.2484	.	978;972;1476	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	T	1476;978;972;972	ENSP00000274364:A1476T;ENSP00000442313:A978T;ENSP00000379535:A972T;ENSP00000426027:A972T	ENSP00000274364:A1476T	A	+	1	0	IQGAP2	76032715	0.663000	0.27448	0.409000	0.26459	0.020000	0.10135	1.227000	0.32576	0.750000	0.32877	-0.169000	0.13324	GCG		0.413	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
CMYA5	202333	broad.mit.edu	37	5	79032515	79032515	+	Missense_Mutation	SNP	C	C	T	rs199557617		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:79032515C>T	ENST00000446378.2	+	2	7958	c.7927C>T	c.(7927-7929)Cgt>Tgt	p.R2643C		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2643					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.R2643C(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TCTTTCTTGTCGTGATGAAAT	0.408																																					p.R2643C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7927T	5						.	C	CYS/ARG	2,3622		0,2,1810	50.0	51.0	51.0		7927	1.4	0.0	5		51	1,8161		0,1,4080	yes	missense	CMYA5	NM_153610.3	180	0,3,5890	TT,TC,CC		0.0123,0.0552,0.0255	probably-damaging	2643/4070	79032515	3,11783	1812	4081	5893	79068271	SO:0001583	missense	202333	exon2			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7927C>T	5.37:g.79032515C>T	ENSP00000394770:p.Arg2643Cys	Somatic		Capture	Illumina HiSeq	Phase_I	79068271	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.528576	0.44969	5.52E-4	1.23E-4	ENSG00000164309	ENST00000446378	T	0.45668	0.89	3.52	1.4	0.22301	.	.	.	.	.	T	0.35970	0.0950	L	0.27053	0.805	0.09310	N	1	D	0.76494	0.999	P	0.51657	0.676	T	0.15235	-1.0444	9	0.72032	D	0.01	.	5.6216	0.17459	0.1951:0.4898:0.3151:0.0	.	2643	Q8N3K9	CMYA5_HUMAN	C	2643	ENSP00000394770:R2643C	ENSP00000394770:R2643C	R	+	1	0	CMYA5	79068271	0.000000	0.05858	0.001000	0.08648	0.303000	0.27691	-0.058000	0.11750	0.566000	0.29273	0.393000	0.25936	CGT		0.408	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
VCAN	1462	broad.mit.edu	37	5	82817967	82817967	+	Missense_Mutation	SNP	C	C	T	rs570361402		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:82817967C>T	ENST00000265077.3	+	7	4407	c.3842C>T	c.(3841-3843)aCg>aTg	p.T1281M	VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.T1233M|VCAN_ENST00000342785.4_Missense_Mutation_p.T1281M	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1281	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.T1281M(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAGTATTTCACGACTTCAAGT	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		19236	0.001		0.0	False		,,,				2504	0.0				p.T1281M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3842T	5						.						92.0	90.0	91.0					5																	82817967		2203	4300	6503	82853723	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3842C>T	5.37:g.82817967C>T	ENSP00000265077:p.Thr1281Met	Somatic		Capture	Illumina HiSeq	Phase_I	82853723	NM_001164098	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.690707	0.29962	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	D;D;D	0.88046	-2.33;-2.26;-2.28	5.81	3.98	0.46160	.	0.090500	0.48767	N	0.000167	T	0.76162	0.3949	L	0.33485	1.01	0.29487	N	0.855933	P;D	0.53312	0.889;0.959	B;B	0.35655	0.154;0.207	T	0.70905	-0.4745	10	0.35671	T	0.21	.	10.0294	0.42092	0.1388:0.7895:0.0:0.0717	.	1281;1281	P13611-3;P13611	.;CSPG2_HUMAN	M	1281;1281;1233	ENSP00000265077:T1281M;ENSP00000342768:T1281M;ENSP00000425959:T1233M	ENSP00000265077:T1281M	T	+	2	0	VCAN	82853723	1.000000	0.71417	0.977000	0.42913	0.848000	0.48234	2.553000	0.45837	0.755000	0.32990	0.655000	0.94253	ACG		0.478	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
TENM2	57451	broad.mit.edu	37	5	167617469	167617469	+	Silent	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr5:167617469G>T	ENST00000518659.1	+	14	2736	c.2697G>T	c.(2695-2697)gtG>gtT	p.V899V	TENM2_ENST00000545108.1_Silent_p.V899V|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000403607.2_Silent_p.V723V|TENM2_ENST00000519204.1_Silent_p.V778V|TENM2_ENST00000520394.1_Silent_p.V667V	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	899					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.V899V(1)|p.V732V(1)									GGCCCGCAGTGAAGTCCTTCT	0.587																																					p.V890V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2670T	5						.						56.0	55.0	55.0					5																	167617469		1976	4156	6132	167550047	SO:0001819	synonymous_variant	57451	exon14			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2697G>T	5.37:g.167617469G>T		Somatic		Capture	Illumina HiSeq	Phase_I	167550047	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																					0.587	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
LYRM2	57226	broad.mit.edu	37	6	90347014	90347015	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:90347014_90347015insT	ENST00000523377.1	-	3	280_281	c.244_245insA	c.(244-246)acafs	p.T82fs	LYRM2_ENST00000520441.1_Intron|LYRM2_ENST00000517396.1_5'UTR|LYRM2_ENST00000520318.1_3'UTR	NM_020466.4	NP_065199.1	Q9NU23	LYRM2_HUMAN	LYR motif containing 2	82						mitochondrion (GO:0005739)		p.T82fs*>8(1)		kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		TAAAGCAAGTGTTTTTTCTAAC	0.337																																					p.T82fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.245_246insA	6						.																																			90403736	SO:0001589	frameshift_variant	57226	exon3			BC009782	CCDS5023.1	6q15	2006-09-19			ENSG00000083099	ENSG00000083099		"""LYR motif containing"""	25229	protein-coding gene	gene with protein product						12477932	Standard	NM_020466		Approved	DJ122O8.2	uc003pnm.3	Q9NU23	OTTHUMG00000015203	ENST00000523377.1:c.245dupA	6.37:g.90347020_90347020dupT	ENSP00000430025:p.Thr82fs	Somatic		Capture	Illumina HiSeq	Phase_I	90403735	NM_020466	B2R4U2|E1P517	Frame_Shift_Ins	INS	ENST00000523377.1	37	CCDS5023.1																																																																																				0.337	LYRM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041498.2	NM_020466	
TXLNB	167838	broad.mit.edu	37	6	139564223	139564223	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:139564223C>T	ENST00000358430.3	-	10	1727	c.1495G>A	c.(1495-1497)Gcc>Acc	p.A499T	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	499						cytoplasm (GO:0005737)		p.A499T(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		TTTTTCACGGCGGTTTGGACA	0.483																																					p.A499T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1495A	6						.						111.0	119.0	116.0					6																	139564223		2203	4300	6503	139605916	SO:0001583	missense	167838	exon10				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1495G>A	6.37:g.139564223C>T	ENSP00000351206:p.Ala499Thr	Somatic		Capture	Illumina HiSeq	Phase_I	139605916	NM_153235	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	ENST00000358430.3	37	CCDS34545.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381662	0.42207	.	.	ENSG00000164440	ENST00000358430	T	0.15372	2.43	6.06	5.19	0.71726	.	0.700286	0.14639	N	0.307319	T	0.03305	0.0096	L	0.34521	1.04	0.09310	N	1	P	0.39250	0.665	B	0.23150	0.044	T	0.29119	-1.0022	9	.	.	.	-11.0212	7.5326	0.27691	0.0:0.7301:0.0:0.2699	.	499	Q8N3L3	TXLNB_HUMAN	T	499	ENSP00000351206:A499T	.	A	-	1	0	TXLNB	139605916	0.633000	0.27181	0.076000	0.20297	0.016000	0.09150	2.125000	0.42016	1.576000	0.49790	0.655000	0.94253	GCC		0.483	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235	
EXOC2	55770	broad.mit.edu	37	6	564658	564658	+	Silent	SNP	G	G	A	rs114105090	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:564658G>A	ENST00000230449.4	-	15	1689	c.1554C>T	c.(1552-1554)cgC>cgT	p.R518R	EXOC2_ENST00000448181.3_Silent_p.R113R	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	518					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R518R(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GCAGGGCTCCGCGGGTAAGCT	0.537													G|||	20	0.00399361	0.0144	0.0014	5008	,	,		17730	0.0		0.0	False		,,,				2504	0.0				p.R518R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1554T	6						.	G		32,4374	37.6+/-69.7	0,32,2171	72.0	70.0	71.0		1554	-10.5	0.1	6	dbSNP_132	71	0,8600		0,0,4300	no	coding-synonymous	EXOC2	NM_018303.4		0,32,6471	AA,AG,GG		0.0,0.7263,0.246		518/925	564658	32,12974	2203	4300	6503	509658	SO:0001819	synonymous_variant	55770	exon15			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.1554C>T	6.37:g.564658G>A		Somatic		Capture	Illumina HiSeq	Phase_I	509658	NM_018303	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Silent	SNP	ENST00000230449.4	37	CCDS34327.1																																																																																				0.537	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303	
UHRF1BP1	54887	broad.mit.edu	37	6	34824701	34824701	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:34824701C>T	ENST00000192788.5	+	11	1597	c.1426C>T	c.(1426-1428)Cac>Tac	p.H476Y	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.H476Y	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	476							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.H476Y(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						CCTGGACATCCACCAGGTGAG	0.527																																					p.H476Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1426T	6						.						47.0	44.0	45.0					6																	34824701		1970	4148	6118	34932679	SO:0001583	missense	54887	exon11			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1426C>T	6.37:g.34824701C>T	ENSP00000192788:p.His476Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	34932679	NM_017754	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	C	6.857	0.527399	0.13066	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.06449	3.3;3.3	5.93	4.15	0.48705	.	0.054647	0.64402	D	0.000001	T	0.01029	0.0034	N	0.16307	0.4	0.47994	D	0.999566	P	0.40660	0.726	B	0.32583	0.148	T	0.27739	-1.0065	10	0.02654	T	1	-13.2914	11.6275	0.51153	0.0:0.8604:0.0:0.1396	.	476	Q6BDS2	URFB1_HUMAN	Y	476	ENSP00000192788:H476Y;ENSP00000400628:H476Y	ENSP00000192788:H476Y	H	+	1	0	UHRF1BP1	34932679	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.448000	0.44926	1.532000	0.49169	0.655000	0.94253	CAC		0.527	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
TRERF1	55809	broad.mit.edu	37	6	42233501	42233501	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:42233501G>A	ENST00000372922.4	-	6	2034	c.1472C>T	c.(1471-1473)tCc>tTc	p.S491F	TRERF1_ENST00000354325.2_Missense_Mutation_p.S491F|TRERF1_ENST00000372917.4_Missense_Mutation_p.S491F|TRERF1_ENST00000541110.1_Missense_Mutation_p.S491F|TRERF1_ENST00000340840.2_Missense_Mutation_p.S491F	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	491	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S491F(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGACTCAGGGGACCCTGGCTG	0.458																																					p.S491F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1472T	6						.						55.0	55.0	55.0					6																	42233501		2203	4300	6503	42341479	SO:0001583	missense	55809	exon6			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.1472C>T	6.37:g.42233501G>A	ENSP00000362013:p.Ser491Phe	Somatic		Capture	Illumina HiSeq	Phase_I	42341479	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749377	0.69533	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.21191	2.65;2.02;2.64;2.02;2.02	4.65	4.65	0.58169	.	0.000000	0.56097	D	0.000023	T	0.24736	0.0600	L	0.32530	0.975	0.44295	D	0.997168	D;D;D;P;D	0.69078	0.997;0.995;0.995;0.914;0.997	D;D;D;D;D	0.78314	0.991;0.979;0.979;0.917;0.991	T	0.02161	-1.1203	10	0.62326	D	0.03	-18.7836	13.3858	0.60795	0.0:0.0:1.0:0.0	.	491;491;491;330;330	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	F	491	ENSP00000439689:S491F;ENSP00000362008:S491F;ENSP00000362013:S491F;ENSP00000339438:S491F;ENSP00000346285:S491F	ENSP00000339438:S491F	S	-	2	0	TRERF1	42341479	1.000000	0.71417	0.863000	0.33907	0.985000	0.73830	5.251000	0.65438	2.297000	0.77311	0.491000	0.48974	TCC		0.458	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
KLC4	89953	broad.mit.edu	37	6	43029098	43029098	+	Missense_Mutation	SNP	C	C	T	rs201506218		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:43029098C>T	ENST00000394056.2	+	3	520	c.25C>T	c.(25-27)Cgg>Tgg	p.R9W	KLC4_ENST00000347162.5_Missense_Mutation_p.R9W|MRPL2_ENST00000487429.1_5'Flank|MRPL2_ENST00000489623.1_5'Flank|KLC4_ENST00000458460.2_Missense_Mutation_p.R9W|MRPL2_ENST00000468957.1_5'Flank|MRPL2_ENST00000388752.3_5'Flank|KLC4_ENST00000259708.3_Missense_Mutation_p.R27W|MRPL2_ENST00000230413.5_5'Flank|KLC4_ENST00000394058.1_Missense_Mutation_p.R9W|KLC4_ENST00000453940.2_Missense_Mutation_p.R9W|KLC4_ENST00000479388.1_Missense_Mutation_p.R9W			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	9						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.R9W(1)		endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			GTTGGGGCAGCGGGATGAGCC	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		20556	0.0		0.001	False		,,,				2504	0.0				p.R9W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C25T	6						.						41.0	45.0	43.0					6																	43029098		2203	4297	6500	43137076	SO:0001583	missense	89953	exon2			AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.25C>T	6.37:g.43029098C>T	ENSP00000377620:p.Arg9Trp	Somatic		Capture	Illumina HiSeq	Phase_I	43137076	NM_201521	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	37	CCDS4883.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	31	5.077039	0.94000	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000470728;ENST00000458460;ENST00000259708;ENST00000479388;ENST00000472792;ENST00000460283;ENST00000394056;ENST00000394058;ENST00000481888	T;T;T;T;T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.11	5.11	0.69529	.	0.143992	0.32503	N	0.006008	T	0.29914	0.0748	N	0.14661	0.345	0.43678	D	0.996114	D;D;D;D	0.69078	0.993;0.996;0.993;0.997	B;P;B;P	0.53861	0.446;0.736;0.446;0.642	T	0.30416	-0.9979	10	0.87932	D	0	-2.9864	15.694	0.77481	0.0:1.0:0.0:0.0	.	9;27;9;9	B4DME9;Q9NSK0-3;Q9NSK0;Q96EG6	.;.;KLC4_HUMAN;.	W	9;9;9;9;27;9;9;9;9;9;9	ENSP00000340221:R9W;ENSP00000395806:R9W;ENSP00000417652:R9W;ENSP00000410358:R9W;ENSP00000259708:R27W;ENSP00000418031:R9W;ENSP00000419102:R9W;ENSP00000420144:R9W;ENSP00000377620:R9W;ENSP00000377622:R9W;ENSP00000419634:R9W	ENSP00000259708:R27W	R	+	1	2	KLC4	43137076	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.666000	0.54540	2.392000	0.81423	0.561000	0.74099	CGG		0.617	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
PHF3	23469	broad.mit.edu	37	6	64394458	64394458	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:64394458A>G	ENST00000262043.3	+	4	1175	c.835A>G	c.(835-837)Aag>Gag	p.K279E	PHF3_ENST00000393387.1_Missense_Mutation_p.K279E|PHF3_ENST00000509330.1_Missense_Mutation_p.K279E			Q92576	PHF3_HUMAN	PHD finger protein 3	279					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.K279E(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			ATGTAAAGCCAAGCCTGTTGG	0.338																																					p.K279E	GBM(135;136 1820 29512 34071 46235)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A835G	6						.						91.0	95.0	94.0					6																	64394458		2202	4300	6502	64452417	SO:0001583	missense	23469	exon3			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.835A>G	6.37:g.64394458A>G	ENSP00000262043:p.Lys279Glu	Somatic		Capture	Illumina HiSeq	Phase_I	64452417	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	A	0.520	-0.862795	0.02610	.	.	ENSG00000118482	ENST00000506783;ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387	T;T;T;T;T;T	0.41758	2.16;1.99;2.31;1.99;0.99;2.31	5.73	4.58	0.56647	.	0.188059	0.25909	N	0.027517	T	0.13415	0.0325	L	0.43152	1.355	0.23371	N	0.997812	B;B	0.20671	0.001;0.047	B;B	0.20767	0.002;0.031	T	0.15665	-1.0429	10	0.29301	T	0.29	-6.6913	4.8752	0.13653	0.7033:0.0:0.1575:0.1392	.	279;279	Q92576;D6R9X2	PHF3_HUMAN;.	E	93;191;279;232;279;279	ENSP00000424694:K93E;ENSP00000425227:K191E;ENSP00000262043:K279E;ENSP00000424078:K232E;ENSP00000422841:K279E;ENSP00000377048:K279E	ENSP00000262043:K279E	K	+	1	0	PHF3	64452417	0.002000	0.14202	0.089000	0.20774	0.152000	0.21847	0.653000	0.24902	1.001000	0.39076	0.528000	0.53228	AAG		0.338	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
FILIP1	27145	broad.mit.edu	37	6	76024794	76024794	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:76024794C>T	ENST00000237172.7	-	5	1084	c.754G>A	c.(754-756)Gat>Aat	p.D252N	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000393004.2_Missense_Mutation_p.D252N|FILIP1_ENST00000370020.1_Missense_Mutation_p.D153N	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	252								p.D252N(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TGTCTTTCATCCACCAGCATG	0.413																																					p.D252N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G754A	6						.						192.0	183.0	186.0					6																	76024794		2203	4300	6503	76081514	SO:0001583	missense	27145	exon5			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.754G>A	6.37:g.76024794C>T	ENSP00000237172:p.Asp252Asn	Somatic		Capture	Illumina HiSeq	Phase_I	76081514	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.000553	0.54254	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.45668	0.89;0.89;0.89	5.75	5.75	0.90469	Cortactin-binding protein-2, N-terminal (1);	0.049682	0.85682	D	0.000000	T	0.43100	0.1232	L	0.48642	1.525	0.49299	D	0.999779	B;P;P	0.40681	0.248;0.727;0.68	B;P;P	0.49085	0.064;0.6;0.465	T	0.22312	-1.0220	10	0.52906	T	0.07	-36.7028	20.3046	0.98621	0.0:1.0:0.0:0.0	.	252;252;252	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	N	252;252;153	ENSP00000376728:D252N;ENSP00000237172:D252N;ENSP00000359037:D153N	ENSP00000237172:D252N	D	-	1	0	FILIP1	76081514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.380000	0.52448	2.878000	0.98634	0.650000	0.86243	GAT		0.413	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
GRM1	2911	broad.mit.edu	37	6	146480606	146480606	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr6:146480606C>T	ENST00000282753.1	+	2	1058	c.823C>T	c.(823-825)Cgc>Tgc	p.R275C	GRM1_ENST00000392299.2_Missense_Mutation_p.R275C|GRM1_ENST00000361719.2_Missense_Mutation_p.R275C|GRM1_ENST00000507907.1_Missense_Mutation_p.R275C|GRM1_ENST00000492807.2_Missense_Mutation_p.R275C|GRM1_ENST00000355289.4_Missense_Mutation_p.R275C			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	275					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R275C(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CCGACTCTTGCGCAAACTCCG	0.577																																					p.R275C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C823T	6						.						94.0	84.0	88.0					6																	146480606		2203	4300	6503	146522299	SO:0001583	missense	2911	exon3			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.823C>T	6.37:g.146480606C>T	ENSP00000282753:p.Arg275Cys	Somatic		Capture	Illumina HiSeq	Phase_I	146522299	NM_001114329	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375525	0.82682	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.32	4.39	0.52855	Extracellular ligand-binding receptor (1);	0.053988	0.64402	D	0.000002	D	0.87613	0.6221	M	0.77616	2.38	0.80722	D	1	D;D;D;D	0.76494	0.997;0.999;0.997;0.997	P;D;P;P	0.63597	0.761;0.916;0.846;0.761	D	0.88912	0.3360	10	0.87932	D	0	.	12.6999	0.57026	0.2888:0.7112:0.0:0.0	.	275;275;270;275	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	C	275	ENSP00000354896:R275C;ENSP00000376119:R275C;ENSP00000424095:R275C;ENSP00000282753:R275C;ENSP00000347437:R275C;ENSP00000425599:R275C	ENSP00000282753:R275C	R	+	1	0	GRM1	146522299	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.886000	0.48578	2.495000	0.84180	0.655000	0.94253	CGC		0.577	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
RELN	5649	broad.mit.edu	37	7	103185655	103185655	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:103185655T>C	ENST00000428762.1	-	42	6598	c.6439A>G	c.(6439-6441)Aaa>Gaa	p.K2147E	RELN_ENST00000343529.5_Missense_Mutation_p.K2147E|RELN_ENST00000424685.2_Missense_Mutation_p.K2147E	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2147	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.K2147E(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CATATACATTTGGTTCCATTG	0.448																																					p.K2147E	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6439G	7						.						130.0	121.0	124.0					7																	103185655		2203	4300	6503	102972891	SO:0001583	missense	5649	exon42				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6439A>G	7.37:g.103185655T>C	ENSP00000392423:p.Lys2147Glu	Somatic		Capture	Illumina HiSeq	Phase_I	102972891	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964323	0.53507	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	D;D;D	0.91577	-2.87;-2.87;-2.87	5.5	5.5	0.81552	Neuraminidase (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.256171	0.46442	D	0.000291	D	0.86830	0.6027	N	0.14661	0.345	0.40197	D	0.977471	P;D	0.54397	0.648;0.966	B;P	0.49799	0.174;0.622	D	0.88281	0.2936	10	0.42905	T	0.14	.	15.8953	0.79329	0.0:0.0:0.0:1.0	.	2147;2147	P78509-2;P78509	.;RELN_HUMAN	E	2147	ENSP00000392423:K2147E;ENSP00000345694:K2147E;ENSP00000388446:K2147E	ENSP00000345694:K2147E	K	-	1	0	RELN	102972891	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.854000	0.62918	2.216000	0.71823	0.402000	0.26972	AAA		0.448	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
SLC26A3	1811	broad.mit.edu	37	7	107416912	107416912	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:107416912C>T	ENST00000340010.5	-	15	1846	c.1662G>A	c.(1660-1662)cgG>cgA	p.R554R	SLC26A3_ENST00000422236.2_Silent_p.R519R	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	554	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.		R -> Q (in dbSNP:rs2301635).		anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.R554R(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						CGATAAGTTTCCGCCTAAAGA	0.368																																					p.R554R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1662A	7						.						114.0	110.0	111.0					7																	107416912		2203	4300	6503	107204148	SO:0001819	synonymous_variant	1811	exon15			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1662G>A	7.37:g.107416912C>T		Somatic		Capture	Illumina HiSeq	Phase_I	107204148	NM_000111		Silent	SNP	ENST00000340010.5	37	CCDS5748.1																																																																																				0.368	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111	
NRCAM	4897	broad.mit.edu	37	7	107838419	107838419	+	Silent	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:107838419G>A	ENST00000425651.2	-	11	1331	c.1332C>T	c.(1330-1332)aaC>aaT	p.N444N	NRCAM_ENST00000413765.2_Silent_p.N425N|NRCAM_ENST00000379028.3_Silent_p.N444N|NRCAM_ENST00000351718.4_Silent_p.N438N|NRCAM_ENST00000379024.4_Silent_p.N425N|NRCAM_ENST00000379022.4_Silent_p.N444N	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	444	Ig-like 4.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.N438N(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TTACAAATGCGTTTGCCAGTA	0.313																																					p.N444N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1332T	7						.						89.0	80.0	83.0					7																	107838419		2203	4299	6502	107625655	SO:0001819	synonymous_variant	4897	exon11				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.1332C>T	7.37:g.107838419G>A		Somatic		Capture	Illumina HiSeq	Phase_I	107625655	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	37	CCDS47686.1																																																																																				0.313	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
FLNC	2318	broad.mit.edu	37	7	128492763	128492763	+	Silent	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:128492763C>T	ENST00000325888.8	+	36	6222	c.5961C>T	c.(5959-5961)aaC>aaT	p.N1987N	FLNC_ENST00000346177.6_Silent_p.N1954N|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1987					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.N1987N(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CCTCGGGCAACGAGGAGCCCT	0.662																																					p.N1987N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5961T	7						.						39.0	45.0	43.0					7																	128492763		2041	4190	6231	128279999	SO:0001819	synonymous_variant	2318	exon36			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5961C>T	7.37:g.128492763C>T		Somatic		Capture	Illumina HiSeq	Phase_I	128279999	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	CCDS43644.1																																																																																				0.662	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
PLXNA4	91584	broad.mit.edu	37	7	131872351	131872351	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:131872351C>A	ENST00000359827.3	-	15	3834	c.2872G>T	c.(2872-2874)Gat>Tat	p.D958Y	PLXNA4_ENST00000321063.4_Missense_Mutation_p.D958Y			Q9HCM2	PLXA4_HUMAN	plexin A4	958	IPT/TIG 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.D958Y(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGCTTCAGATCTGAGAGAGTC	0.597																																					p.D958Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2872T	7						.						138.0	149.0	145.0					7																	131872351		2058	4196	6254	131522891	SO:0001583	missense	91584	exon15			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2872G>T	7.37:g.131872351C>A	ENSP00000352882:p.Asp958Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	131522891	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278271	0.40294	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.77620	-1.11;-1.11	5.5	5.5	0.81552	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	1339.440000	0.00166	N	0.000000	T	0.78953	0.4365	L	0.38531	1.155	0.35917	D	0.831502	B	0.20671	0.047	B	0.33121	0.158	T	0.52449	-0.8574	10	0.46703	T	0.11	.	14.9951	0.71425	0.0:0.858:0.142:0.0	.	958	Q9HCM2	PLXA4_HUMAN	Y	958	ENSP00000323194:D958Y;ENSP00000352882:D958Y	ENSP00000323194:D958Y	D	-	1	0	PLXNA4	131522891	0.008000	0.16893	1.000000	0.80357	0.994000	0.84299	0.934000	0.28910	2.611000	0.88343	0.549000	0.68633	GAT		0.597	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CHRM2	1129	broad.mit.edu	37	7	136700754	136700754	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:136700754G>A	ENST00000445907.2	+	3	1670	c.1142G>A	c.(1141-1143)cGg>cAg	p.R381Q	hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.R381Q|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|CHRM2_ENST00000401861.1_Missense_Mutation_p.R381Q|CHRM2_ENST00000453373.1_Missense_Mutation_p.R381Q|CHRM2_ENST00000402486.3_Missense_Mutation_p.R381Q|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.R381Q|hsa-mir-490_ENST00000586239.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	381					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)	p.R381Q(1)|p.R381L(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CCTCCTTCCCGGGAAAAGAAA	0.458																																					p.R381Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1142A	7						.						101.0	98.0	99.0					7																	136700754		2203	4300	6503	136351294	SO:0001583	missense	1129	exon4				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.1142G>A	7.37:g.136700754G>A	ENSP00000399745:p.Arg381Gln	Somatic		Capture	Illumina HiSeq	Phase_I	136351294	NM_000739	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.613250	0.66672	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	5.67	5.67	0.87782	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85375	0.5682	M	0.86028	2.79	0.54753	D	0.999986	D	0.65815	0.995	P	0.62491	0.903	D	0.86828	0.2009	10	0.66056	D	0.02	-12.9181	19.773	0.96379	0.0:0.0:1.0:0.0	.	381	P08172	ACM2_HUMAN	Q	381	ENSP00000399745:R381Q;ENSP00000415386:R381Q;ENSP00000319984:R381Q;ENSP00000380733:R381Q;ENSP00000384937:R381Q;ENSP00000384401:R381Q	ENSP00000319984:R381Q	R	+	2	0	CHRM2	136351294	1.000000	0.71417	0.994000	0.49952	0.693000	0.40251	8.003000	0.88520	2.677000	0.91161	0.655000	0.94253	CGG		0.458	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
OR2A5	393046	broad.mit.edu	37	7	143748162	143748162	+	Missense_Mutation	SNP	C	C	T	rs201829543	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:143748162C>T	ENST00000408906.2	+	1	702	c.668C>T	c.(667-669)gCg>gTg	p.A223V		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A223V(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					CGCATCCTGGCGGCCATCTTG	0.607																																					p.A223V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C668T	7						.						106.0	108.0	107.0					7																	143748162		2017	4179	6196	143379095	SO:0001583	missense	393046	exon1			U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.668C>T	7.37:g.143748162C>T	ENSP00000386208:p.Ala223Val	Somatic		Capture	Illumina HiSeq	Phase_I	143379095	NM_012365	B9EGX2|O43885|O43888	Missense_Mutation	SNP	ENST00000408906.2	37	CCDS43668.1	.	.	.	.	.	.	.	.	.	.	C	0.592	-0.832653	0.02713	.	.	ENSG00000221836	ENST00000408906	T	0.36157	1.27	5.37	-7.37	0.01412	GPCR, rhodopsin-like superfamily (1);	3.036110	0.01925	U	0.040822	T	0.15522	0.0374	N	0.11000	0.08	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13124	-1.0521	10	0.15952	T	0.53	.	5.1497	0.15004	0.1076:0.4826:0.2196:0.1902	.	223	Q96R48	OR2A5_HUMAN	V	223	ENSP00000386208:A223V	ENSP00000386208:A223V	A	+	2	0	OR2A5	143379095	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.985000	0.00660	-0.803000	0.04415	-0.355000	0.07637	GCG		0.607	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1		
SSPO	23145	broad.mit.edu	37	7	149529906	149529906	+	RNA	SNP	C	C	T	rs369846163		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:149529906C>T	ENST00000378016.2	+	0	15323							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGTCTAGACCCGGAGAGCCCT	0.642																																					p.P5113P												.	.	0			c.C15339T	7						.	C	LEU/PRO	0,4098		0,0,2049	40.0	47.0	45.0		15339	4.6	0.9	7		45	2,8422		0,2,4210	no	missense	SSPO	NM_198455.2	98	0,2,6259	TT,TC,CC		0.0237,0.0,0.016	probably-damaging	5107/5148	149529906	2,12520	2049	4212	6261	149160839			23145	exon102			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149529906C>T		Somatic		Capture	Illumina HiSeq	Phase_I	149160839	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																					0.642	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
EIF2AK1	27102	broad.mit.edu	37	7	6084196	6084196	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:6084196G>A	ENST00000199389.6	-	7	873	c.727C>T	c.(727-729)Cga>Tga	p.R243*	EIF2AK1_ENST00000495565.1_5'UTR|EIF2AK1_ENST00000536084.1_Nonsense_Mutation_p.R119*	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	243	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)	p.R243*(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		GGCTTACCTCGTGGCTGAATC	0.488																																					p.R243X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C727T	7						.						91.0	72.0	79.0					7																	6084196		2203	4300	6503	6050722	SO:0001587	stop_gained	27102	exon7			BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.727C>T	7.37:g.6084196G>A	ENSP00000199389:p.Arg243*	Somatic		Capture	Illumina HiSeq	Phase_I	6050722	NM_001134335	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Nonsense_Mutation	SNP	ENST00000199389.6	37	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	.	37	6.105792	0.97286	.	.	ENSG00000086232	ENST00000199389;ENST00000536084	.	.	.	5.41	2.55	0.30701	.	1.076460	0.07064	N	0.834207	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	3.0621	0.06203	0.1546:0.1216:0.5429:0.1808	.	.	.	.	X	243;119	.	ENSP00000199389:R243X	R	-	1	2	EIF2AK1	6050722	0.950000	0.32346	0.004000	0.12327	0.134000	0.20937	1.853000	0.39358	0.625000	0.30304	0.650000	0.86243	CGA		0.488	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
POM121C	100101267	broad.mit.edu	37	7	75052387	75052387	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:75052387A>G	ENST00000257665.5	-	11	1873	c.1874T>C	c.(1873-1875)cTc>cCc	p.L625P	POM121C_ENST00000453279.2_Missense_Mutation_p.L383P|POM121C_ENST00000473168.1_5'Flank			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	625	Pore side. {ECO:0000255}.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)		p.L383P(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GGGGCTGGGGAGCAGCCCTGG	0.622																																					p.L383P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1148C	7						.						4.0	5.0	5.0					7																	75052387		1953	3909	5862	74890323	SO:0001583	missense	100101267	exon13				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.1874T>C	7.37:g.75052387A>G	ENSP00000257665:p.Leu625Pro	Somatic		Capture	Illumina HiSeq	Phase_I	74890323	NM_001099415	O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000257665.5	37		.	.	.	.	.	.	.	.	.	.	A	12.07	1.826523	0.32329	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.21543	3.46;2.0	3.23	2.01	0.26516	.	0.452864	0.16468	N	0.213116	T	0.37679	0.1012	M	0.72894	2.215	0.09310	N	0.999996	D	0.71674	0.998	D	0.76071	0.987	T	0.07908	-1.0748	10	0.72032	D	0.01	.	3.9781	0.09483	0.6949:0.0:0.1185:0.1866	.	625	A8CG34	P121C_HUMAN	P	625;383	ENSP00000257665:L625P;ENSP00000414208:L383P	ENSP00000257665:L625P	L	-	2	0	POM121C	74890323	0.043000	0.20138	0.015000	0.15790	0.069000	0.16628	1.828000	0.39111	1.237000	0.43756	0.164000	0.16699	CTC		0.622	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415	
CHPF2	54480	broad.mit.edu	37	7	150932334	150932334	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr7:150932334G>A	ENST00000035307.2	+	2	1977	c.464G>A	c.(463-465)cGg>cAg	p.R155Q	CHPF2_ENST00000495645.1_Missense_Mutation_p.R147Q	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	155					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.R155Q(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						GGGGATGAGCGGCCCGCCTGG	0.612																																					p.R155Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G464A	7						.						66.0	67.0	67.0					7																	150932334		2203	4300	6503	150563267	SO:0001583	missense	54480	exon2			AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.464G>A	7.37:g.150932334G>A	ENSP00000035307:p.Arg155Gln	Somatic		Capture	Illumina HiSeq	Phase_I	150563267	NM_019015	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	G	35	5.448552	0.96205	.	.	ENSG00000033100	ENST00000482173;ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.27557	1.66;1.66	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.53722	0.1814	L	0.61036	1.89	0.80722	D	1	D;D	0.89917	0.977;1.0	P;D	0.81914	0.487;0.995	T	0.43956	-0.9359	10	0.33940	T	0.23	-27.3693	18.4623	0.90743	0.0:0.0:1.0:0.0	.	155;147	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	Q	84;147;155;155	ENSP00000418914:R147Q;ENSP00000035307:R155Q	ENSP00000035307:R155Q	R	+	2	0	CHPF2	150563267	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	9.827000	0.99397	2.595000	0.87683	0.655000	0.94253	CGG		0.612	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015	
RP1L1	94137	broad.mit.edu	37	8	10467080	10467080	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr8:10467080C>T	ENST00000382483.3	-	4	4751	c.4528G>A	c.(4528-4530)Gcg>Acg	p.A1510T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1590					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.A1510T(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCAGAGCCGCGCTGCAGGCC	0.652																																					p.A1510T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4528A	8						.						39.0	44.0	43.0					8																	10467080		2040	4181	6221	10504490	SO:0001583	missense	94137	exon4			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4528G>A	8.37:g.10467080C>T	ENSP00000371923:p.Ala1510Thr	Somatic		Capture	Illumina HiSeq	Phase_I	10504490	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507434	0.27036	.	.	ENSG00000183638	ENST00000382483	T	0.03982	3.74	5.32	0.236	0.15471	.	1.447910	0.05120	N	0.490516	T	0.03564	0.0102	N	0.19112	0.55	0.09310	N	1	B	0.26602	0.154	B	0.11329	0.006	T	0.43048	-0.9415	10	0.56958	D	0.05	0.2413	4.549	0.12103	0.0:0.4479:0.1617:0.3904	.	1510	A6NKC6	.	T	1510	ENSP00000371923:A1510T	ENSP00000371923:A1510T	A	-	1	0	RP1L1	10504490	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.673000	0.05239	0.218000	0.20820	0.491000	0.48974	GCG		0.652	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
FAM135B	51059	broad.mit.edu	37	8	139149480	139149480	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr8:139149480C>T	ENST00000395297.1	-	19	4095	c.3925G>A	c.(3925-3927)Gtg>Atg	p.V1309M		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1309								p.V1309M(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCAACCAGCACGACGTTTTTA	0.423										HNSCC(54;0.14)																											p.V1309M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3925A	8						.						136.0	133.0	134.0					8																	139149480		1870	4111	5981	139218662	SO:0001583	missense	51059	exon19			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3925G>A	8.37:g.139149480C>T	ENSP00000378710:p.Val1309Met	Somatic		Capture	Illumina HiSeq	Phase_I	139218662	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043704	0.93685	.	.	ENSG00000147724	ENST00000395297	T	0.46063	0.88	5.92	5.92	0.95590	Domain of unknown function DUF676, lipase-like (1);	0.000000	0.64402	D	0.000001	T	0.67392	0.2888	M	0.75264	2.295	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.68655	-0.5351	10	0.87932	D	0	-19.6773	19.3054	0.94161	0.0:1.0:0.0:0.0	.	1309	Q49AJ0	F135B_HUMAN	M	1309	ENSP00000378710:V1309M	ENSP00000378710:V1309M	V	-	1	0	FAM135B	139218662	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	7.755000	0.85180	2.801000	0.96364	0.650000	0.86243	GTG		0.423	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
COL22A1	169044	broad.mit.edu	37	8	139856365	139856365	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr8:139856365C>T	ENST00000303045.6	-	4	1141	c.695G>A	c.(694-696)cGc>cAc	p.R232H	COL22A1_ENST00000435777.1_Missense_Mutation_p.R232H	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	232					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R232H(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTGCTTAAAGCGATCTCCTTC	0.458										HNSCC(7;0.00092)																											p.R232H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G695A	8						.						343.0	299.0	314.0					8																	139856365		2203	4300	6503	139925547	SO:0001583	missense	169044	exon4			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.695G>A	8.37:g.139856365C>T	ENSP00000303153:p.Arg232His	Somatic		Capture	Illumina HiSeq	Phase_I	139925547	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671718	0.47781	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.89415	-2.51;-2.43	5.11	3.3	0.37823	.	0.294794	0.24294	U	0.039789	D	0.85013	0.5600	L	0.43152	1.355	0.42198	D	0.991753	D	0.61080	0.989	P	0.48488	0.579	T	0.81143	-0.1067	9	.	.	.	.	6.3007	0.21111	0.1822:0.7253:0.0:0.0926	.	232	Q8NFW1	COMA1_HUMAN	H	232	ENSP00000303153:R232H;ENSP00000387655:R232H	.	R	-	2	0	COL22A1	139925547	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	0.936000	0.28938	0.742000	0.32697	0.650000	0.86243	CGC		0.458	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
PREX2	80243	broad.mit.edu	37	8	68950460	68950460	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr8:68950460G>T	ENST00000288368.4	+	7	1049	c.772G>T	c.(772-774)Gga>Tga	p.G258*	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	258	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.G258*(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AATTTCTTCTGGAAATATTCA	0.388																																					p.G258X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G772T	8						.						113.0	107.0	109.0					8																	68950460		2203	4300	6503	69113014	SO:0001587	stop_gained	80243	exon7			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.772G>T	8.37:g.68950460G>T	ENSP00000288368:p.Gly258*	Somatic		Capture	Illumina HiSeq	Phase_I	69113014	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Nonsense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	41	8.925252	0.99004	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.6621	0.95877	0.0:0.0:1.0:0.0	.	.	.	.	X	258	.	ENSP00000288368:G258X	G	+	1	0	PREX2	69113014	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.599000	0.98280	2.650000	0.89964	0.655000	0.94253	GGA		0.388	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
TRAPPC9	83696	broad.mit.edu	37	8	140922408	140922408	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr8:140922408C>T	ENST00000438773.2	-	20	3080	c.2947G>A	c.(2947-2949)Ggc>Agc	p.G983S	RP11-284H18.1_ENST00000518354.1_RNA|TRAPPC9_ENST00000522504.1_5'Flank|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.G1081S|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.G974S	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	983					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)		p.G1081S(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CAGCAGATGCCCAGCTTGCTG	0.602																																					p.G983S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2947A	8						.						61.0	68.0	66.0					8																	140922408		2203	4300	6503	140991590	SO:0001583	missense	83696	exon20			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2947G>A	8.37:g.140922408C>T	ENSP00000405060:p.Gly983Ser	Somatic		Capture	Illumina HiSeq	Phase_I	140991590	NM_001160372	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.75|12.75	2.031205|2.031205	0.35797|0.35797	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000520857|ENST00000389328;ENST00000389327;ENST00000438773	.|.	.|.	.|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.245658|0.245658	0.41823|0.41823	D|D	0.000803|0.000803	T|T	0.36635|0.36635	0.0974|0.0974	N|N	0.11427|0.11427	0.14|0.14	0.39010|0.39010	D|D	0.959521|0.959521	.|P;B;B;B	.|0.34955	.|0.477;0.124;0.026;0.421	.|B;B;B;B	.|0.37888	.|0.26;0.19;0.029;0.254	T|T	0.25117|0.25117	-1.0141|-1.0141	6|9	.|0.09590	.|T	.|0.72	.|.	18.6492|18.6492	0.91423|0.91423	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1081;983;974;1081	.|A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2	.|.;TPPC9_HUMAN;.;.	E|S	826|1081;974;983	.|.	.|ENSP00000373978:G974S	G|G	-|-	2|1	0|0	TRAPPC9|TRAPPC9	140991590|140991590	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.169000|0.169000	0.22640|0.22640	6.853000|6.853000	0.75435|0.75435	2.659000|2.659000	0.90383|0.90383	0.655000|0.655000	0.94253|0.94253	GGG|GGC		0.602	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
TNC	3371	broad.mit.edu	37	9	117808892	117808892	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:117808892G>T	ENST00000350763.4	-	17	5333	c.4922C>A	c.(4921-4923)aCa>aAa	p.T1641K	TNC_ENST00000535648.1_Missense_Mutation_p.T1186K|TNC_ENST00000537320.1_Intron|TNC_ENST00000481475.1_5'Flank|TNC_ENST00000542877.1_Missense_Mutation_p.T1278K|TNC_ENST00000423613.2_Intron|TNC_ENST00000341037.4_Missense_Mutation_p.T1459K|TNC_ENST00000340094.3_Missense_Mutation_p.T1277K|TNC_ENST00000346706.3_Missense_Mutation_p.T1095K|TNC_ENST00000345230.3_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1641	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.T1641K(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TTCATCAGCTGTCCAGGACAG	0.502																																					p.T1641K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4922A	9						.						60.0	67.0	64.0					9																	117808892		2203	4300	6503	116848713	SO:0001583	missense	3371	exon17				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4922C>A	9.37:g.117808892G>T	ENSP00000265131:p.Thr1641Lys	Somatic		Capture	Illumina HiSeq	Phase_I	116848713	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.39|15.39	2.820426|2.820426	0.50633|0.50633	.|.	.|.	ENSG00000041982|ENSG00000041982	ENST00000544972|ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877	.|T;T;T;T;T;T	.|0.56941	.|0.43;0.43;0.43;0.43;0.43;0.43	5.94|5.94	5.94|5.94	0.96194|0.96194	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.056688	.|0.64402	.|D	.|0.000001	T|T	0.67192|0.67192	0.2867|0.2867	M|M	0.87381|0.87381	2.88|2.88	0.80722|0.80722	D|D	1|1	.|P	.|0.47910	.|0.902	.|P	.|0.49421	.|0.61	T|T	0.69847|0.69847	-0.5034|-0.5034	5|10	.|0.41790	.|T	.|0.15	.|.	15.1118|15.1118	0.72362|0.72362	0.0:0.0:0.8585:0.1415|0.0:0.0:0.8585:0.1415	.|.	.|1641	.|P24821	.|TENA_HUMAN	E|K	203|1277;1186;1095;1641;1459;1278	.|ENSP00000344400:T1277K;ENSP00000438152:T1186K;ENSP00000344555:T1095K;ENSP00000265131:T1641K;ENSP00000339553:T1459K;ENSP00000442242:T1278K	.|ENSP00000344400:T1277K	D|T	-|-	3|2	2|0	TNC|TNC	116848713|116848713	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.500000|7.500000	0.81588|0.81588	2.803000|2.803000	0.96430|0.96430	0.655000|0.655000	0.94253|0.94253	GAC|ACA		0.502	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
PSMD5	5711	broad.mit.edu	37	9	123595614	123595614	+	Silent	SNP	A	A	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:123595614A>T	ENST00000210313.3	-	2	368	c.294T>A	c.(292-294)tcT>tcA	p.S98S	PSMD5_ENST00000373904.5_Silent_p.S98S|PSMD5-AS1_ENST00000589026.1_RNA	NM_001270427.1|NM_005047.3	NP_001257356.1|NP_005038.1	Q16401	PSMD5_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 5	98					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein folding (GO:0006457)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)		p.S98S(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)	10						GGATTTTTACAGAATCATCAG	0.498																																					p.S98S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T294A	9						.						131.0	134.0	133.0					9																	123595614		2203	4300	6503	122635435	SO:0001819	synonymous_variant	5711	exon2			AK001065	CCDS6824.1, CCDS59143.1	9q34.11	2008-02-05			ENSG00000095261	ENSG00000095261		"""Proteasome (prosome, macropain) subunits"""	9563	protein-coding gene	gene with protein product		604452				7559544	Standard	NM_005047		Approved	S5B, KIAA0072	uc004bko.4	Q16401	OTTHUMG00000020573	ENST00000210313.3:c.294T>A	9.37:g.123595614A>T		Somatic		Capture	Illumina HiSeq	Phase_I	122635435	NM_005047	B4DZM8|Q15045|Q4VXG8	Silent	SNP	ENST00000210313.3	37	CCDS6824.1																																																																																				0.498	PSMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053825.2	NM_005047	
SLC25A25	114789	broad.mit.edu	37	9	130869645	130869645	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:130869645G>T	ENST00000373064.5	+	10	1595	c.1332G>T	c.(1330-1332)atG>atT	p.M444I	SLC25A25_ENST00000373068.2_Missense_Mutation_p.M478I|SLC25A25_ENST00000373066.5_Missense_Mutation_p.M476I|SLC25A25_ENST00000373069.5_Missense_Mutation_p.M490I|SLC25A25_ENST00000432073.2_Missense_Mutation_p.M464I|RP11-395P17.11_ENST00000602939.1_RNA|SLC25A25_ENST00000433501.1_Missense_Mutation_p.M341I	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	444					adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.M478I(1)|p.M444I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						CCAACTTCATGAAGGTCATCC	0.642																																					p.M341I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1023T	9						.						92.0	98.0	96.0					9																	130869645		2203	4300	6503	129909466	SO:0001583	missense	114789	exon10			AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.1332G>T	9.37:g.130869645G>T	ENSP00000362155:p.Met444Ile	Somatic		Capture	Illumina HiSeq	Phase_I	129909466	NM_001006643	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Missense_Mutation	SNP	ENST00000373064.5	37	CCDS6890.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832748	0.50845	.	.	ENSG00000148339	ENST00000373068;ENST00000373069;ENST00000432073;ENST00000373066;ENST00000373064;ENST00000433501	T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	5.41	5.41	0.78517	Mitochondrial carrier domain (2);	0.075174	0.85682	D	0.000000	T	0.71350	0.3329	L	0.31664	0.95	0.80722	D	1	B;B;B;B	0.32338	0.016;0.191;0.028;0.365	B;B;B;B	0.36186	0.06;0.09;0.053;0.219	T	0.68546	-0.5380	10	0.31617	T	0.26	-41.1811	18.1921	0.89810	0.0:0.0:1.0:0.0	.	444;476;464;478	Q6KCM7;Q6KCM7-5;Q6KCM7-4;Q6KCM7-2	SCMC2_HUMAN;.;.;.	I	478;490;464;476;444;341	ENSP00000362159:M478I;ENSP00000362160:M490I;ENSP00000410053:M464I;ENSP00000362157:M476I;ENSP00000362155:M444I;ENSP00000401672:M341I	ENSP00000362155:M444I	M	+	3	0	SLC25A25	129909466	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.589000	0.67523	2.523000	0.85059	0.655000	0.94253	ATG		0.642	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054407.1	NM_052901	
AK3	50808	broad.mit.edu	37	9	4718526	4718526	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:4718526G>C	ENST00000381809.3	-	4	686	c.456C>G	c.(454-456)gaC>gaG	p.D152E	AK3_ENST00000359883.2_Missense_Mutation_p.D82E|AK3_ENST00000447596.4_Missense_Mutation_p.D112E	NM_016282.3	NP_057366.2	P27144	KAD4_HUMAN	adenylate kinase 3	150	LID.				ADP biosynthetic process (GO:0006172)|AMP metabolic process (GO:0046033)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|GTP metabolic process (GO:0046039)|liver development (GO:0001889)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|response to drug (GO:0042493)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside triphosphate adenylate kinase activity (GO:0046899)	p.D152E(1)		large_intestine(2)|lung(1)|ovary(2)	5	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)	Adefovir Dipivoxil(DB00718)|Tenofovir(DB00300)	CCCCAGTCAGGTCATCAATGC	0.383																																					p.D152E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C456G	9						.						87.0	79.0	82.0					9																	4718526		2203	4300	6503	4708526	SO:0001583	missense	50808	exon4			BC013771	CCDS6455.1, CCDS56561.1, CCDS56562.1	9p24.1	2010-09-29	2004-06-11	2005-04-07	ENSG00000147853	ENSG00000147853			17376	protein-coding gene	gene with protein product		609290	"""adenylate kinase 6"", ""adenylate kinase 3 like 1"""	AK6, AK3L1		8288, 182062	Standard	NM_001199852		Approved	AKL3L1	uc003ziq.2	Q9UIJ7	OTTHUMG00000019472	ENST00000381809.3:c.456C>G	9.37:g.4718526G>C	ENSP00000371230:p.Asp152Glu	Somatic		Capture	Illumina HiSeq	Phase_I	4708526	NM_001199854	B2R927|D3DQ62|Q6IBH4|Q6NXQ5|Q8IUU9	Missense_Mutation	SNP	ENST00000381809.3	37	CCDS6455.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614029	0.66672	.	.	ENSG00000147853	ENST00000381809;ENST00000359883;ENST00000474822;ENST00000447596	D;D;D	0.86097	-2.07;-2.07;-2.07	5.36	-5.46	0.02608	Adenylate kinase, active site lid domain (2);	0.000000	0.85682	D	0.000000	D	0.93825	0.8025	H	0.97390	3.995	0.33881	D	0.636114	D;D	0.76494	0.999;0.998	D;D	0.74023	0.982;0.931	D	0.94239	0.7483	10	0.87932	D	0	-18.5529	17.0133	0.86412	0.3613:0.0:0.6387:0.0	.	112;152	E7ET30;Q9UIJ7	.;KAD3_HUMAN	E	152;82;82;112	ENSP00000371230:D152E;ENSP00000352948:D82E;ENSP00000413933:D112E	ENSP00000352948:D82E	D	-	3	2	AK3	4708526	0.106000	0.21978	0.370000	0.25965	0.941000	0.58515	0.311000	0.19380	-0.817000	0.04335	-0.290000	0.09829	GAC		0.383	AK3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051585.1	NM_016282	
GBA2	57704	broad.mit.edu	37	9	35738792	35738792	+	Missense_Mutation	SNP	G	G	A	rs144239565		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:35738792G>A	ENST00000378103.3	-	12	2427	c.1904C>T	c.(1903-1905)aCg>aTg	p.T635M	GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000378094.4_Missense_Mutation_p.T635M|GBA2_ENST00000545786.1_Missense_Mutation_p.T641M|GBA2_ENST00000467252.1_5'UTR	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	635					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)	p.T635M(1)		NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTGATCACCCGTGAGGTAATA	0.502																																					p.T635M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1904T	9						.	G	MET/THR	0,4406		0,0,2203	121.0	116.0	118.0		1904	6.1	1.0	9	dbSNP_134	118	1,8599	1.2+/-3.3	0,1,4299	no	missense	GBA2	NM_020944.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	635/928	35738792	1,13005	2203	4300	6503	35728792	SO:0001583	missense	57704	exon12			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1904C>T	9.37:g.35738792G>A	ENSP00000367343:p.Thr635Met	Somatic		Capture	Illumina HiSeq	Phase_I	35728792	NM_020944	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420552	0.83559	0.0	1.16E-4	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	6.08	6.08	0.98989	Six-hairpin glycosidase-like (1);Glucosylceramidase (1);	0.044001	0.85682	D	0.000000	D	0.84804	0.5553	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;P;D	0.97110	0.999;0.885;1.0	D	0.84981	0.0888	9	0.51188	T	0.08	-12.9804	18.844	0.92196	0.0:0.0:1.0:0.0	.	641;635;635	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	M	635;635;641	.	ENSP00000367334:T635M	T	-	2	0	GBA2	35728792	1.000000	0.71417	0.986000	0.45419	0.959000	0.62525	9.725000	0.98778	2.894000	0.99253	0.655000	0.94253	ACG		0.502	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
VPS13A	23230	broad.mit.edu	37	9	79843078	79843078	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:79843078C>A	ENST00000360280.3	+	17	1753	c.1493C>A	c.(1492-1494)tCt>tAt	p.S498Y	VPS13A_ENST00000376636.3_Missense_Mutation_p.S498Y|VPS13A_ENST00000376634.4_Missense_Mutation_p.S498Y|VPS13A_ENST00000357409.5_Missense_Mutation_p.S498Y	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	498					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.S498Y(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAAAGTATGTCTATTGTTCTA	0.294																																					p.S498Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1493A	9						.						37.0	38.0	37.0					9																	79843078		2200	4288	6488	79032898	SO:0001583	missense	23230	exon17			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.1493C>A	9.37:g.79843078C>A	ENSP00000353422:p.Ser498Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	79032898	NM_001018037	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065478	0.76187	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.56444	0.63;0.46;0.53;0.63	5.63	5.63	0.86233	.	0.131964	0.53938	D	0.000060	T	0.75649	0.3878	M	0.81497	2.545	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.72075	0.958;0.966;0.976;0.976	T	0.77765	-0.2465	10	0.87932	D	0	.	20.0396	0.97574	0.0:1.0:0.0:0.0	.	498;498;498;498	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	Y	498	ENSP00000365821:S498Y;ENSP00000365823:S498Y;ENSP00000353422:S498Y;ENSP00000349985:S498Y	ENSP00000349985:S498Y	S	+	2	0	VPS13A	79032898	0.998000	0.40836	0.999000	0.59377	0.986000	0.74619	3.938000	0.56583	2.814000	0.96858	0.563000	0.77884	TCT		0.294	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
FBP2	8789	broad.mit.edu	37	9	97329633	97329633	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:97329633C>A	ENST00000375337.3	-	5	690	c.624G>T	c.(622-624)aaG>aaT	p.K208N	PCAT7_ENST00000452148.2_RNA	NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	208					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)	p.K208N(1)		endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				GGCTGTAAATCTTTCCTTTCT	0.443																																					p.K208N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G624T	9						.						161.0	162.0	161.0					9																	97329633		2203	4300	6503	96369454	SO:0001583	missense	8789	exon5			Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.624G>T	9.37:g.97329633C>A	ENSP00000364486:p.Lys208Asn	Somatic		Capture	Illumina HiSeq	Phase_I	96369454	NM_003837	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.598538	0.28445	.	.	ENSG00000130957	ENST00000375337	T	0.72725	-0.68	5.15	3.26	0.37387	.	0.043066	0.85682	N	0.000000	T	0.52451	0.1735	N	0.25426	0.745	0.80722	D	1	B	0.17268	0.021	B	0.16722	0.016	T	0.35226	-0.9797	10	0.27082	T	0.32	0.0048	6.604	0.22716	0.1459:0.6971:0.0:0.157	.	208	O00757	F16P2_HUMAN	N	208	ENSP00000364486:K208N	ENSP00000364486:K208N	K	-	3	2	FBP2	96369454	0.992000	0.36948	1.000000	0.80357	0.996000	0.88848	0.405000	0.21015	0.518000	0.28383	0.557000	0.71058	AAG		0.443	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837	
NCBP1	4686	broad.mit.edu	37	9	100403156	100403156	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:100403156G>A	ENST00000375147.3	+	2	371	c.115G>A	c.(115-117)Gga>Aga	p.G39R		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	39	MIF4G.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)	p.G39R(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				ATGTAAAGTAGGAGAAAAGGT	0.373																																					p.G39R	Ovarian(36;879 898 2893 44212 50307)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G115A	9						.						72.0	75.0	74.0					9																	100403156		2203	4300	6503	99442977	SO:0001583	missense	4686	exon2			BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.115G>A	9.37:g.100403156G>A	ENSP00000364289:p.Gly39Arg	Somatic		Capture	Illumina HiSeq	Phase_I	99442977	NM_002486	B2R718|Q59G76|Q5T1V0|Q5T7X2	Missense_Mutation	SNP	ENST00000375147.3	37	CCDS6728.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932932	0.92458	.	.	ENSG00000136937	ENST00000375147	T	0.23552	1.9	5.13	5.13	0.70059	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69101	-0.5234	10	0.66056	D	0.02	-20.1445	18.5603	0.91097	0.0:0.0:1.0:0.0	.	39	Q09161	NCBP1_HUMAN	R	39	ENSP00000364289:G39R	ENSP00000364289:G39R	G	+	1	0	NCBP1	99442977	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.657000	0.91106	2.573000	0.86826	0.555000	0.69702	GGA		0.373	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1	NM_002486	
FNBP1	23048	broad.mit.edu	37	9	132662280	132662280	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chr9:132662280C>T	ENST00000446176.2	-	15	1837	c.1651G>A	c.(1651-1653)Gcc>Acc	p.A551T	FNBP1_ENST00000420781.1_Missense_Mutation_p.A542T|FNBP1_ENST00000478129.1_5'UTR|FNBP1_ENST00000443566.2_Missense_Mutation_p.A179T|FNBP1_ENST00000355681.3_Missense_Mutation_p.A522T	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	551	Interaction with ARHGAP17, DAAM1, DIAPH1 and DIAPH2.|Interaction with DNM1 and DNM3.|Interaction with PDE6G. {ECO:0000250}.|Interaction with RND2. {ECO:0000250}.|Required for interaction with TNKS.|Required for self-association and induction of membrane tubulation.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.A551T(1)					Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		GTCCCTATGGCAGGGAGGGGC	0.488			T	MLL	AML																																p.A551T			Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1651A	9						.						124.0	127.0	126.0					9																	132662280		1992	4176	6168	131702101	SO:0001583	missense	23048	exon15			AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.1651G>A	9.37:g.132662280C>T	ENSP00000413625:p.Ala551Thr	Somatic		Capture	Illumina HiSeq	Phase_I	131702101	NM_015033	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	ENST00000446176.2	37	CCDS48040.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972304	0.34754	.	.	ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000443566;ENST00000355681	T;T;T;T	0.56275	0.86;0.88;0.47;0.87	4.88	3.85	0.44370	Src homology-3 domain (2);	0.201110	0.51477	D	0.000099	T	0.28267	0.0698	N	0.12443	0.215	0.29809	N	0.831806	B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.12156	0.001;0.001;0.004;0.003;0.007;0.001;0.005;0.001	T	0.05451	-1.0884	10	0.36615	T	0.2	-15.102	3.532	0.07779	0.0:0.639:0.0:0.361	.	546;541;179;485;522;502;546;551	B7ZL12;B7ZL13;E7EPB7;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3	.;.;.;.;.;.;.;FNBP1_HUMAN	T	551;551;542;551;179;522	ENSP00000413625:A551T;ENSP00000407548:A542T;ENSP00000389117:A179T;ENSP00000347907:A522T	ENSP00000347907:A522T	A	-	1	0	FNBP1	131702101	1.000000	0.71417	0.816000	0.32577	0.987000	0.75469	3.891000	0.56227	2.238000	0.73509	0.456000	0.33151	GCC		0.488	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2		
ARMCX5	64860	broad.mit.edu	37	X	101858726	101858726	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:101858726C>T	ENST00000604957.1	+	1	4279	c.1657C>T	c.(1657-1659)Cga>Tga	p.R553*	RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000536530.1_Nonsense_Mutation_p.R553*|ARMCX5_ENST00000246174.2_Nonsense_Mutation_p.R553*|RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000537008.1_Nonsense_Mutation_p.R553*|ARMCX5_ENST00000372742.1_Nonsense_Mutation_p.R553*|ARMCX5_ENST00000541409.1_Nonsense_Mutation_p.R553*	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	553								p.R553*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						TAAAGTCATACGATTAATACT	0.353																																					p.R553X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1657T	X						.						72.0	74.0	73.0					X																	101858726		2201	4293	6494	101745382	SO:0001587	stop_gained	64860	exon5				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1657C>T	X.37:g.101858726C>T	ENSP00000474720:p.Arg553*	Somatic		Capture	Illumina HiSeq	Phase_I	101745382	NM_001168485	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Nonsense_Mutation	SNP	ENST00000604957.1	37	CCDS14500.1	.	.	.	.	.	.	.	.	.	.	C	41	8.576050	0.98870	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	.	.	.	4.0	-1.24	0.09435	.	0.270733	0.19751	N	0.106899	.	.	.	.	.	.	0.35119	D	0.766916	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-1.8361	6.3203	0.21215	0.4669:0.4336:0.0:0.0995	.	.	.	.	X	553	.	ENSP00000246174:R553X	R	+	1	2	ARMCX5	101745382	0.925000	0.31364	0.963000	0.40424	0.837000	0.47467	-0.462000	0.06704	-0.455000	0.07054	-1.073000	0.02249	CGA		0.353	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1	NM_022838	
NRK	203447	broad.mit.edu	37	X	105153514	105153514	+	Silent	SNP	A	A	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:105153514A>T	ENST00000243300.9	+	13	2184	c.1881A>T	c.(1879-1881)ctA>ctT	p.L627L	NRK_ENST00000428173.2_Silent_p.L628L	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	627					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.L627L(1)|p.L628L(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CTTGGACACTAGAACCCCCAC	0.493										HNSCC(51;0.14)																											p.L627L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1881T	X						.						63.0	59.0	60.0					X																	105153514		1961	4139	6100	105040170	SO:0001819	synonymous_variant	203447	exon13			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1881A>T	X.37:g.105153514A>T		Somatic		Capture	Illumina HiSeq	Phase_I	105040170	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	ENST00000243300.9	37																																																																																					0.493	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
FRMPD4	9758	broad.mit.edu	37	X	12735823	12735823	+	Missense_Mutation	SNP	G	G	A	rs138299368		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:12735823G>A	ENST00000380682.1	+	16	3384	c.2878G>A	c.(2878-2880)Gct>Act	p.A960T		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	960					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A950T(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CAAGACCCCCGCTGGGGGCTT	0.597													G|||	1	0.000264901	0.0008	0.0	3775	,	,		13008	0.0		0.0	False		,,,				2504	0.0				p.A960T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2878A	X						.	G	THR/ALA	0,3835		0,0,0,1632,571	67.0	73.0	71.0		2878	-8.6	0.0	X	dbSNP_134	71	7,6721		0,5,2,2423,1870	yes	missense	FRMPD4	NM_014728.3	58	0,5,2,4055,2441	AA,AG,A,GG,G		0.104,0.0,0.0663	benign	960/1323	12735823	7,10556	2203	4300	6503	12645744	SO:0001583	missense	9758	exon16			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2878G>A	X.37:g.12735823G>A	ENSP00000370057:p.Ala960Thr	Somatic		Capture	Illumina HiSeq	Phase_I	12645744	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	G	0.359	-0.940611	0.02322	0.0	0.00104	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.06768	3.26	5.65	-8.56	0.00904	.	0.947979	0.08940	N	0.871689	T	0.03739	0.0106	L	0.31294	0.92	0.09310	N	1	B;B	0.20368	0.044;0.044	B;B	0.08055	0.003;0.003	T	0.37430	-0.9706	10	0.27785	T	0.31	-22.51	0.8832	0.01239	0.207:0.2133:0.2951:0.2846	.	952;960	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	T	960;951;949	ENSP00000370057:A960T	ENSP00000304583:A949T	A	+	1	0	FRMPD4	12645744	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.822000	0.04448	-2.163000	0.00783	-2.215000	0.00298	GCT		0.597	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
GRIA3	2892	broad.mit.edu	37	X	122319797	122319797	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:122319797G>A	ENST00000371251.1	+	2	275	c.223G>A	c.(223-225)Gta>Ata	p.V75I	GRIA3_ENST00000371256.5_Missense_Mutation_p.V75I|GRIA3_ENST00000371264.3_Missense_Mutation_p.V75I|GRIA3_ENST00000542149.1_Missense_Mutation_p.V75I|GRIA3_ENST00000371266.1_Missense_Mutation_p.V75I|GRIA3_ENST00000479118.1_3'UTR|GRIA3_ENST00000264357.5_Missense_Mutation_p.V75I|GRIA3_ENST00000541091.1_Missense_Mutation_p.V59I			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	75					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.V75I(2)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GAATTACCACGTAGATCACTT	0.473																																					p.V75I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G223A	X						.						177.0	137.0	150.0					X																	122319797		2203	4300	6503	122147478	SO:0001583	missense	2892	exon2			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.223G>A	X.37:g.122319797G>A	ENSP00000360297:p.Val75Ile	Somatic		Capture	Illumina HiSeq	Phase_I	122147478	NM_007325	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650124	0.47362	.	.	ENSG00000125675	ENST00000371266;ENST00000264357;ENST00000371264;ENST00000542149;ENST00000335161;ENST00000371256;ENST00000371251;ENST00000541091	T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48	5.67	5.67	0.87782	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	N	0.11064	0.09	0.80722	D	1	B;D;P;P	0.89917	0.231;1.0;0.892;0.869	B;D;P;P	0.81914	0.037;0.995;0.816;0.72	T	0.72367	-0.4315	10	0.02654	T	1	.	17.5992	0.88021	0.0:0.0:1.0:0.0	.	59;75;75;75	B7Z4C0;Q4TT43;P42263;P42263-2	.;.;GRIA3_HUMAN;.	I	75;75;75;75;75;75;75;59	ENSP00000264357:V75I;ENSP00000446146:V75I;ENSP00000360302:V75I;ENSP00000360297:V75I;ENSP00000446440:V59I	ENSP00000264357:V75I	V	+	1	0	GRIA3	122147478	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.452000	0.97615	2.372000	0.80975	0.600000	0.82982	GTA		0.473	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
SLC9A6	10479	broad.mit.edu	37	X	135092707	135092707	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:135092707G>C	ENST00000370698.3	+	7	945	c.910G>C	c.(910-912)Gca>Cca	p.A304P	SLC9A6_ENST00000370695.4_Missense_Mutation_p.A336P|SLC9A6_ENST00000370701.1_Missense_Mutation_p.A284P	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	304					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)	p.A304P(1)|p.A304S(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TGGATCTTTTGCAATGGGTGC	0.403																																					p.A284P												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G850C	X						.						236.0	183.0	201.0					X																	135092707		2203	4300	6503	134920373	SO:0001583	missense	10479	exon8			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.910G>C	X.37:g.135092707G>C	ENSP00000359732:p.Ala304Pro	Somatic		Capture	Illumina HiSeq	Phase_I	134920373	NM_001177651	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632310	0.87660	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.18174	2.23;2.23;2.23	5.49	5.49	0.81192	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.49847	0.1581	M	0.91561	3.22	0.80722	D	1	P;D;P	0.55800	0.953;0.973;0.907	P;P;P	0.62649	0.905;0.847;0.905	T	0.60969	-0.7157	10	0.62326	D	0.03	.	17.2696	0.87097	0.0:0.0:1.0:0.0	.	284;336;304	B4DU30;Q92581-2;Q92581	.;.;SL9A6_HUMAN	P	284;304;336	ENSP00000359735:A284P;ENSP00000359732:A304P;ENSP00000359729:A336P	ENSP00000359729:A336P	A	+	1	0	SLC9A6	134920373	1.000000	0.71417	0.941000	0.38009	0.902000	0.53008	6.251000	0.72441	2.290000	0.77057	0.513000	0.50165	GCA		0.403	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
SLC9A6	10479	broad.mit.edu	37	X	135122338	135122338	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:135122338G>A	ENST00000370698.3	+	15	1770	c.1735G>A	c.(1735-1737)Gaa>Aaa	p.E579K	SLC9A6_ENST00000370695.4_Missense_Mutation_p.E611K|SLC9A6_ENST00000370701.1_Missense_Mutation_p.E559K	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	579					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)	p.E579K(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CCAGGCTTACGAAGTAAGTTG	0.463																																					p.E559K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1675A	X						.						30.0	26.0	27.0					X																	135122338		2203	4300	6503	134950004	SO:0001583	missense	10479	exon16			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1735G>A	X.37:g.135122338G>A	ENSP00000359732:p.Glu579Lys	Somatic		Capture	Illumina HiSeq	Phase_I	134950004	NM_001177651	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771870	0.90108	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.39787	1.06;1.06;1.06	5.61	5.61	0.85477	.	0.388619	0.33161	N	0.005203	T	0.52964	0.1767	M	0.69823	2.125	0.80722	D	1	P;P	0.50819	0.939;0.755	P;B	0.50860	0.652;0.145	T	0.49351	-0.8949	10	0.17369	T	0.5	.	17.4825	0.87677	0.0:0.0:1.0:0.0	.	611;579	Q92581-2;Q92581	.;SL9A6_HUMAN	K	559;579;611	ENSP00000359735:E559K;ENSP00000359732:E579K;ENSP00000359729:E611K	ENSP00000359729:E611K	E	+	1	0	SLC9A6	134950004	1.000000	0.71417	0.959000	0.39883	0.915000	0.54546	7.512000	0.81728	2.343000	0.79666	0.513000	0.50165	GAA		0.463	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
BRS3	680	broad.mit.edu	37	X	135572636	135572636	+	Missense_Mutation	SNP	G	G	A	rs376207740		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:135572636G>A	ENST00000370648.3	+	2	1007	c.779G>A	c.(778-780)cGt>cAt	p.R260H		NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	260					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)	p.R260H(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					AGCCATGCCCGTAAGCAGGTA	0.383													G|||	1	0.000264901	0.0	0.0	3775	,	,		15428	0.001		0.0	False		,,,				2504	0.0				p.R260H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G779A	X						.	G	HIS/ARG	0,3833		0,0,1632,569	51.0	47.0	49.0		779	4.6	1.0	X		49	1,6715		0,1,2423,1868	no	missense	BRS3	NM_001727.1	29	0,1,4055,2437	AA,AG,GG,G		0.0149,0.0,0.0095	benign	260/400	135572636	1,10548	2201	4292	6493	135400302	SO:0001583	missense	680	exon2				CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.779G>A	X.37:g.135572636G>A	ENSP00000359682:p.Arg260His	Somatic		Capture	Illumina HiSeq	Phase_I	135400302	NM_001727		Missense_Mutation	SNP	ENST00000370648.3	37	CCDS14656.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.492506	0.44352	0.0	1.49E-4	ENSG00000102239	ENST00000370648	T	0.37915	1.17	5.45	4.58	0.56647	GPCR, rhodopsin-like superfamily (1);	0.084343	0.52532	D	0.000076	T	0.40067	0.1102	M	0.78916	2.43	0.44402	D	0.997317	B	0.32573	0.376	B	0.33690	0.168	T	0.22138	-1.0225	10	0.34782	T	0.22	-3.2137	11.2828	0.49206	0.156:0.0:0.844:0.0	.	260	P32247	BRS3_HUMAN	H	260	ENSP00000359682:R260H	ENSP00000359682:R260H	R	+	2	0	BRS3	135400302	0.914000	0.31030	0.999000	0.59377	0.695000	0.40330	2.965000	0.49200	1.051000	0.40369	0.600000	0.82982	CGT		0.383	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059005.1	NM_001727	
MAGEA4	4103	broad.mit.edu	37	X	151092827	151092827	+	Missense_Mutation	SNP	G	G	C	rs150785634	byFrequency	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:151092827G>C	ENST00000360243.2	+	3	958	c.691G>C	c.(691-693)Gtg>Ctg	p.V231L	MAGEA4_ENST00000276344.2_Missense_Mutation_p.V231L|MAGEA4_ENST00000370340.3_Missense_Mutation_p.V231L|MAGEA4_ENST00000393921.1_Missense_Mutation_p.V231L|MAGEA4_ENST00000393920.1_Missense_Mutation_p.V231L|MAGEA4_ENST00000370335.1_Missense_Mutation_p.V231L|MAGEA4_ENST00000370337.4_Missense_Mutation_p.V231L	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	231	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.V231L(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					TGTGATGGGGGTGTATGATGG	0.577													G||||G|||	9|9	0.00238411|0.00238411	0.003|0.003	0.0014|0.0014	3775|3775	,|,	,|,		14306|14306	0.003|0.003		0.001|0.001	False|False		,,,|,,,				2504|2504	0.0|0.0				p.V231L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G691C	X						.	G	LEU/VAL,LEU/VAL,LEU/VAL,LEU/VAL	22,3813		0,19,3,1613,568	110.0	112.0	111.0		691,691,691,691	-1.8	0.0	X	dbSNP_134	111	0,6728		0,0,0,2428,1872	no	missense,missense,missense,missense	MAGEA4	NM_001011548.1,NM_001011549.1,NM_001011550.1,NM_002362.4	32,32,32,32	0,19,3,4041,2440	CC,CG,C,GG,G		0.0,0.5737,0.2083	benign,benign,benign,benign	231/318,231/318,231/318,231/318	151092827	22,10541	2203	4300	6503	150843483	SO:0001583	missense	4103	exon3				CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.691G>C	X.37:g.151092827G>C	ENSP00000353379:p.Val231Leu	Somatic		Capture	Illumina HiSeq	Phase_I	150843483	NM_002362	Q14798	Missense_Mutation	SNP	ENST00000360243.2	37	CCDS14702.1	3	0.0018083182640144665	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	6.556	0.470811	0.12461	0.005737	0.0	ENSG00000147381	ENST00000276344;ENST00000393921;ENST00000430273;ENST00000370337;ENST00000441865;ENST00000393920;ENST00000370340;ENST00000457310;ENST00000370335;ENST00000360243;ENST00000431971	T;T;T;T;T;T;T;T;T;T;T	0.03663	3.85;3.85;3.85;3.85;3.85;3.85;3.85;3.85;3.85;3.85;3.85	2.37	-1.83	0.07833	.	0.272380	0.35838	N	0.002954	T	0.01558	0.0050	L	0.35854	1.095	0.09310	N	1	B	0.24721	0.11	B	0.25291	0.059	T	0.42481	-0.9449	9	.	.	.	.	0.589	0.00725	0.1628:0.1998:0.2973:0.3401	.	231	P43358	MAGA4_HUMAN	L	231	ENSP00000276344:V231L;ENSP00000377498:V231L;ENSP00000394149:V231L;ENSP00000359362:V231L;ENSP00000402624:V231L;ENSP00000377497:V231L;ENSP00000359365:V231L;ENSP00000402186:V231L;ENSP00000359360:V231L;ENSP00000353379:V231L;ENSP00000390096:V231L	.	V	+	1	0	MAGEA4	150843483	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.285000	0.08410	-0.595000	0.05828	0.292000	0.19580	GTG		0.577	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362	
TBL1X	6907	broad.mit.edu	37	X	9659688	9659688	+	Missense_Mutation	SNP	G	G	A	rs370618515		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:9659688G>A	ENST00000217964.7	+	8	1326	c.686G>A	c.(685-687)cGg>cAg	p.R229Q	TBL1X_ENST00000407597.2_Missense_Mutation_p.R229Q|TBL1X_ENST00000424279.1_Missense_Mutation_p.R178Q|TBL1X_ENST00000380961.1_Missense_Mutation_p.R178Q|TBL1X_ENST00000536365.1_Missense_Mutation_p.R178Q	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	229					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R229Q(2)		breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				ACAGTCCTTCGGGGCCATGAG	0.527																																					p.R178Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G533A	X						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,3835		0,0,0,1632,571	177.0	138.0	151.0		686,533,533,686	4.5	1.0	X		151	1,6727		0,0,1,2428,1871	no	missense,missense,missense,missense	TBL1X	NM_001139466.1,NM_001139467.1,NM_001139468.1,NM_005647.3	43,43,43,43	0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095	probably-damaging,probably-damaging,probably-damaging,probably-damaging	229/578,178/527,178/527,229/578	9659688	1,10562	2203	4300	6503	9619688	SO:0001583	missense	6907	exon8			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.686G>A	X.37:g.9659688G>A	ENSP00000217964:p.Arg229Gln	Somatic		Capture	Illumina HiSeq	Phase_I	9619688	NM_001139468	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	g	21.2	4.120106	0.77323	0.0	1.49E-4	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.57107	0.42;3.56;3.56;3.56;0.42	4.48	4.48	0.54585	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.44850	0.1313	L	0.31926	0.97	0.80722	D	1	B;B	0.32731	0.334;0.382	B;B	0.35607	0.206;0.094	T	0.35201	-0.9798	10	0.23891	T	0.37	.	16.8161	0.85734	0.0:0.0:1.0:0.0	.	192;229	Q59F53;O60907	.;TBL1X_HUMAN	Q	229;178;178;178;229	ENSP00000385988:R229Q;ENSP00000394097:R178Q;ENSP00000445317:R178Q;ENSP00000370348:R178Q;ENSP00000217964:R229Q	ENSP00000217964:R229Q	R	+	2	0	TBL1X	9619688	1.000000	0.71417	0.985000	0.45067	0.998000	0.95712	9.056000	0.93881	1.974000	0.57490	0.597000	0.82753	CGG		0.527	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
TBL1X	6907	broad.mit.edu	37	X	9684278	9684278	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:9684278C>T	ENST00000217964.7	+	18	2366	c.1726C>T	c.(1726-1728)Cgg>Tgg	p.R576W	TBL1X_ENST00000407597.2_Missense_Mutation_p.R576W|TBL1X_ENST00000424279.1_Missense_Mutation_p.R525W|TBL1X_ENST00000380961.1_Missense_Mutation_p.R525W|TBL1X_ENST00000536365.1_Missense_Mutation_p.R525W	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	576					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R576W(2)		breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				TTTGGATCTGCGGAAGTAACC	0.418																																					p.R525W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1573T	X						.						140.0	106.0	117.0					X																	9684278		2203	4299	6502	9644278	SO:0001583	missense	6907	exon18			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1726C>T	X.37:g.9684278C>T	ENSP00000217964:p.Arg576Trp	Somatic		Capture	Illumina HiSeq	Phase_I	9644278	NM_001139468	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507651	0.64410	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.66460	-0.21;0.01;0.01;0.01;-0.21	4.82	4.82	0.62117	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.184661	0.36066	U	0.002820	D	0.82604	0.5073	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	D	0.85911	0.1440	10	0.87932	D	0	.	15.4309	0.75099	0.0:1.0:0.0:0.0	.	539;576	Q59F53;O60907	.;TBL1X_HUMAN	W	576;525;525;525;576	ENSP00000385988:R576W;ENSP00000394097:R525W;ENSP00000445317:R525W;ENSP00000370348:R525W;ENSP00000217964:R576W	ENSP00000217964:R576W	R	+	1	2	TBL1X	9644278	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	6.344000	0.72991	1.998000	0.58463	0.589000	0.80489	CGG		0.418	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
FAM47A	158724	broad.mit.edu	37	X	34150179	34150179	+	Missense_Mutation	SNP	G	G	A	rs201264239		TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:34150179G>A	ENST00000346193.3	-	1	268	c.217C>T	c.(217-219)Cgt>Tgt	p.R73C		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	73								p.R73C(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AACTCGTCACGGCGACAAACG	0.532																																					p.R73C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C217T	X						.	G	CYS/ARG	0,3833		0,0,0,1631,571	89.0	85.0	86.0		217	0.2	0.0	X		86	2,6726		0,1,1,2427,1871	yes	missense	FAM47A	NM_203408.3	180	0,1,1,4058,2442	AA,AG,A,GG,G		0.0297,0.0,0.0189	benign	73/792	34150179	2,10559	2202	4300	6502	34060100	SO:0001583	missense	158724	exon1			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.217C>T	X.37:g.34150179G>A	ENSP00000345029:p.Arg73Cys	Somatic		Capture	Illumina HiSeq	Phase_I	34060100	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	G	5.604	0.296225	0.10622	0.0	2.97E-4	ENSG00000185448	ENST00000346193	T	0.21543	2.0	1.17	0.248	0.15526	.	.	.	.	.	T	0.10465	0.0256	L	0.32530	0.975	0.09310	N	1	P	0.36789	0.57	B	0.24269	0.052	T	0.20571	-1.0271	9	0.37606	T	0.19	.	3.3597	0.07182	0.3018:0.0:0.6982:0.0	.	73	Q5JRC9	FA47A_HUMAN	C	73	ENSP00000345029:R73C	ENSP00000345029:R73C	R	-	1	0	FAM47A	34060100	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.307000	0.19296	0.020000	0.15106	0.544000	0.68410	CGT		0.532	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
PJA1	64219	broad.mit.edu	37	X	68381407	68381407	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:68381407C>T	ENST00000361478.1	-	2	2052	c.1675G>A	c.(1675-1677)Gca>Aca	p.A559T	PJA1_ENST00000477231.1_5'Flank|PJA1_ENST00000374584.3_Missense_Mutation_p.A371T|PJA1_ENST00000374571.4_Missense_Mutation_p.A504T|PJA1_ENST00000374583.1_Missense_Mutation_p.A559T	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	559					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A371T(1)|p.A559T(1)		endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						ACATCCACTGCGAGAGACTCC	0.552																																					p.A504T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1510A	X						.						102.0	77.0	86.0					X																	68381407		2203	4300	6503	68298132	SO:0001583	missense	64219	exon2			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.1675G>A	X.37:g.68381407C>T	ENSP00000355014:p.Ala559Thr	Somatic		Capture	Illumina HiSeq	Phase_I	68298132	NM_001032396	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727504	0.30593	.	.	ENSG00000181191	ENST00000396010;ENST00000374584;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T;T	0.15372	2.43;2.65;2.65;2.64	3.53	2.64	0.31445	.	0.000000	0.50627	U	0.000108	T	0.25680	0.0625	L	0.29908	0.895	0.20196	N	0.999924	D;D	0.76494	0.999;0.999	D;D	0.76575	0.985;0.988	T	0.02639	-1.1130	10	0.48119	T	0.1	-8.0732	10.0654	0.42299	0.0:0.797:0.203:0.0	.	559;371	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	T	474;371;559;559;504	ENSP00000363712:A371T;ENSP00000363711:A559T;ENSP00000355014:A559T;ENSP00000363699:A504T	ENSP00000355014:A559T	A	-	1	0	PJA1	68298132	0.996000	0.38824	0.015000	0.15790	0.085000	0.17905	4.077000	0.57598	0.856000	0.35383	0.544000	0.68410	GCA		0.552	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
MAGEE1	57692	broad.mit.edu	37	X	75649322	75649322	+	Silent	SNP	G	G	A			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:75649322G>A	ENST00000361470.2	+	1	1277	c.999G>A	c.(997-999)ccG>ccA	p.P333P		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	333	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.P333P(2)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CCTCCGTGCCGCCCACCGCCA	0.692																																					p.P333P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G999A	X						.						22.0	22.0	22.0					X																	75649322		2200	4295	6495	75565726	SO:0001819	synonymous_variant	57692	exon1			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.999G>A	X.37:g.75649322G>A		Somatic		Capture	Illumina HiSeq	Phase_I	75565726	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	ENST00000361470.2	37	CCDS14433.1																																																																																				0.692	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
PGK1	5230	broad.mit.edu	37	X	77378799	77378799	+	Silent	SNP	T	T	C			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:77378799T>C	ENST00000373316.4	+	8	1031	c.864T>C	c.(862-864)acT>acC	p.T288T	PGK1_ENST00000442431.1_Silent_p.T152T|PGK1_ENST00000537456.1_Silent_p.T260T	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	288					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.T288T(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	ACTTTGTCACTGCTGACAAGT	0.478																																					p.T288T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T864C	X						.						103.0	76.0	86.0					X																	77378799		2203	4300	6503	77265455	SO:0001819	synonymous_variant	5230	exon8			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.864T>C	X.37:g.77378799T>C		Somatic		Capture	Illumina HiSeq	Phase_I	77265455	NM_000291	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Silent	SNP	ENST00000373316.4	37	CCDS14438.1																																																																																				0.478	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1		
KLHL4	56062	broad.mit.edu	37	X	86873008	86873008	+	Silent	SNP	C	C	G			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:86873008C>G	ENST00000373119.4	+	4	946	c.801C>G	c.(799-801)gtC>gtG	p.V267V	KLHL4_ENST00000373114.4_Silent_p.V267V	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	267						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.V267V(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TGACTCAGGTCATTGATGTTT	0.428																																					p.V267V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801G	X						.						99.0	82.0	88.0					X																	86873008		2203	4300	6503	86759664	SO:0001819	synonymous_variant	56062	exon4			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.801C>G	X.37:g.86873008C>G		Somatic		Capture	Illumina HiSeq	Phase_I	86759664	NM_057162	B2RTW2|Q9Y3J5	Silent	SNP	ENST00000373119.4	37	CCDS14457.1																																																																																				0.428	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
IL9R	3581	broad.mit.edu	37	X	155232668	155232668	+	Silent	SNP	C	C	G			TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3695-01A-01W-0900-09	TCGA-AA-3695-10A-01W-0900-09	g.chrX:155232668C>G	ENST00000244174.5	+	2	305	c.126C>G	c.(124-126)gtC>gtG	p.V42V	IL9R_ENST00000540897.1_Silent_p.V79V|IL9R_ENST00000424344.3_Silent_p.V21V|IL9R_ENST00000369423.2_Silent_p.V89V	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	42					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)	p.V42V(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAGTCTCTGTCACAGGGGAAG	0.592																																					p.V42V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C126G	X						.						180.0	175.0	177.0					X																	155232668		2203	4296	6499	154885862	SO:0001819	synonymous_variant	3581	exon2			M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.126C>G	X.37:g.155232668C>G		Somatic		Capture	Illumina HiSeq	Phase_I	154885862	NM_002186	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Silent	SNP	ENST00000244174.5	37	CCDS14771.4																																																																																				0.592	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
