#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PSD	5662	broad.mit.edu	37	10	104175854	104175855	+	Frame_Shift_Ins	INS	-	-	G	rs201151774		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr10:104175854_104175855insG	ENST00000020673.5	-	3	1202_1203	c.676_677insC	c.(676-678)cggfs	p.R226fs	PSD_ENST00000406432.1_Frame_Shift_Ins_p.R226fs|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	226					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)	p.R11fs*12(1)|p.R226fs*12(1)		breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GGAGACTTCCCGGGGGGAGGAC	0.559																																					p.R226fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.677_678insC	10						.																																			104165845	SO:0001589	frameshift_variant	5662	exon3			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.677dupC	10.37:g.104175860_104175860dupG	ENSP00000020673:p.Arg226fs	Somatic		Capture	Illumina HiSeq	Phase_I	104165844	NM_002779	B1AKX7|D3DR87|Q15673|Q8IVG0	Frame_Shift_Ins	INS	ENST00000020673.5	37	CCDS31272.1																																																																																				0.559	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
SVIL	6840	broad.mit.edu	37	10	29822166	29822166	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr10:29822166G>A	ENST00000355867.4	-	8	1882	c.1130C>T	c.(1129-1131)gCc>gTc	p.A377V	SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Missense_Mutation_p.A377V	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	377					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.A377V(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CACTAGCTTGGCGGTGTGACC	0.562																																					p.A377V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1130T	10						.						87.0	73.0	78.0					10																	29822166		2203	4300	6503	29862172	SO:0001583	missense	6840	exon8			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1130C>T	10.37:g.29822166G>A	ENSP00000348128:p.Ala377Val	Somatic		Capture	Illumina HiSeq	Phase_I	29862172	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363490	0.41902	.	.	ENSG00000197321	ENST00000375398;ENST00000355867	T;T	0.48836	0.8;0.8	5.66	1.23	0.21249	.	0.709976	0.13707	N	0.368396	T	0.35770	0.0943	L	0.46157	1.445	0.09310	N	0.999999	B	0.27229	0.172	B	0.23716	0.048	T	0.18871	-1.0323	9	.	.	.	-1.9111	7.304	0.26436	0.1936:0.1285:0.6779:0.0	.	377	O95425	SVIL_HUMAN	V	377	ENSP00000364547:A377V;ENSP00000348128:A377V	.	A	-	2	0	SVIL	29862172	0.986000	0.35501	0.018000	0.16275	0.045000	0.14185	2.127000	0.42035	-0.044000	0.13491	0.655000	0.94253	GCC		0.562	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
ARHGAP12	94134	broad.mit.edu	37	10	32096742	32096742	+	Silent	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr10:32096742C>T	ENST00000344936.2	-	20	2619	c.2385G>A	c.(2383-2385)gaG>gaA	p.E795E	ARHGAP12_ENST00000311380.4_Silent_p.E743E|ARHGAP12_ENST00000375250.5_Silent_p.E765E|ARHGAP12_ENST00000396144.4_Silent_p.E790E|ARHGAP12_ENST00000375245.4_Silent_p.E743E|ARHGAP12_ENST00000492028.1_5'UTR	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	795	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.E795E(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				TTCGATTTTTCTCTCCATTTT	0.323																																					p.E795E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2385A	10						.						53.0	58.0	56.0					10																	32096742		2203	4300	6503	32136748	SO:0001819	synonymous_variant	94134	exon20			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.2385G>A	10.37:g.32096742C>T		Somatic		Capture	Illumina HiSeq	Phase_I	32136748	NM_018287	B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Silent	SNP	ENST00000344936.2	37	CCDS7170.1																																																																																				0.323	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1		
PCDH15	65217	broad.mit.edu	37	10	56077129	56077129	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr10:56077129C>A	ENST00000320301.6	-	8	1172	c.778G>T	c.(778-780)Gac>Tac	p.D260Y	PCDH15_ENST00000395445.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000395432.2_Missense_Mutation_p.D223Y|PCDH15_ENST00000395438.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000395430.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000395433.1_Missense_Mutation_p.D238Y|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395440.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000373957.3_Missense_Mutation_p.D238Y|PCDH15_ENST00000373955.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000373965.2_Missense_Mutation_p.D260Y|PCDH15_ENST00000395446.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000414778.1_Missense_Mutation_p.D265Y|PCDH15_ENST00000395442.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000437009.1_Missense_Mutation_p.D260Y|PCDH15_ENST00000361849.3_Missense_Mutation_p.D260Y	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	260	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.D265Y(2)|p.D260Y(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GGACCCAAGTCATCTCCATCC	0.493										HNSCC(58;0.16)																											p.D223Y												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G667T	10						.						194.0	147.0	163.0					10																	56077129		2203	4300	6503	55747135	SO:0001583	missense	65217	exon7			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.778G>T	10.37:g.56077129C>A	ENSP00000322604:p.Asp260Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	55747135	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572971	0.86542	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.73152	-0.06;-0.01;-0.21;-0.09;-0.26;-0.72;-0.48;-0.05;-0.6;-0.47;-0.45;-0.61;-0.63;-0.67;-0.03	4.77	4.77	0.60923	Cadherin (3);	.	.	.	.	D	0.90607	0.7055	H	0.98426	4.23	0.58432	D	0.999997	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;0.999;1.0;0.999;0.999;0.999;1.0;1.0;0.999;1.0;0.999;1.0	D	0.94486	0.7697	9	0.87932	D	0	.	17.7447	0.88416	0.0:1.0:0.0:0.0	.	238;260;260;265;260;223;260;260;260;260;260;265;260;238;260	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	Y	260;265;260;260;260;260;260;260;223;260;238;238;260;260;265;260;260	ENSP00000363076:D260Y;ENSP00000410304:D265Y;ENSP00000378826:D260Y;ENSP00000378832:D260Y;ENSP00000378833:D260Y;ENSP00000378829:D260Y;ENSP00000378827:D260Y;ENSP00000378820:D223Y;ENSP00000354950:D260Y;ENSP00000378821:D238Y;ENSP00000363068:D238Y;ENSP00000322604:D260Y;ENSP00000378818:D260Y;ENSP00000412628:D260Y;ENSP00000363066:D260Y	ENSP00000322604:D260Y	D	-	1	0	PCDH15	55747135	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.664000	0.83830	2.346000	0.79739	0.557000	0.71058	GAC		0.493	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
TET1	80312	broad.mit.edu	37	10	70432785	70432785	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr10:70432785C>T	ENST00000373644.4	+	8	5016	c.4807C>T	c.(4807-4809)Cca>Tca	p.P1603S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1603					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.P1603S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TAGAATTGATCCAAGCTCTCC	0.343																																					p.P1603S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4807T	10						.						127.0	118.0	121.0					10																	70432785		2203	4300	6503	70102791	SO:0001583	missense	80312	exon8			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4807C>T	10.37:g.70432785C>T	ENSP00000362748:p.Pro1603Ser	Somatic		Capture	Illumina HiSeq	Phase_I	70102791	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	C	9.724	1.160475	0.21454	.	.	ENSG00000138336	ENST00000373644;ENST00000545846	T	0.11385	2.78	5.34	3.38	0.38709	TET cysteine-rich domain (1);	0.239772	0.38164	N	0.001793	T	0.10294	0.0252	L	0.50333	1.59	0.33117	D	0.541358	B	0.32862	0.387	B	0.37550	0.253	T	0.04053	-1.0981	10	0.16896	T	0.51	.	7.4735	0.27363	0.2769:0.4861:0.237:0.0	.	1603	Q8NFU7	TET1_HUMAN	S	1603;75	ENSP00000362748:P1603S	ENSP00000362748:P1603S	P	+	1	0	TET1	70102791	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.018000	0.40991	2.673000	0.90976	0.591000	0.81541	CCA		0.343	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
NRBF2	29982	broad.mit.edu	37	10	64913530	64913531	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	AC	AC	AC	-	AC	AC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr10:64913530_64913531delAC	ENST00000277746.6	+	4	597_598	c.416_417delAC	c.(415-417)gacfs	p.D139fs	NRBF2_ENST00000435510.2_Frame_Shift_Del_p.D129fs	NM_030759.3	NP_110386.2	Q96F24	NRBF2_HUMAN	nuclear receptor binding factor 2	139					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)		p.L141fs*9(1)		large_intestine(2)|lung(3)|skin(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					AGGGATCCAGACACACTACTTT	0.475																																					p.139_139del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.416_417del	10						.																																			64583537	SO:0001589	frameshift_variant	29982	exon4			D82519	CCDS7268.1, CCDS60537.1	10q22.1	2012-11-01			ENSG00000148572	ENSG00000148572			19692	protein-coding gene	gene with protein product	"""comodulator of PPAR and RXR 1"", ""comodulator of PPAR and RXR 2"""					10786636	Standard	NM_001282405		Approved	DKFZp564C1664, FLJ30395, COPR1, COPR2	uc001jmj.4	Q96F24	OTTHUMG00000018309	ENST00000277746.6:c.416_417delAC	10.37:g.64913534_64913535delAC	ENSP00000277746:p.Asp139fs	Somatic		Capture	Illumina HiSeq	Phase_I	64583536	NM_030759	A6PW36|B4DWS0|Q86UR2|Q96NP6|Q9H0S9|Q9H2I2	Frame_Shift_Del	DEL	ENST00000277746.6	37	CCDS7268.1																																																																																				0.475	NRBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048247.1	NM_030759	
USP54	159195	broad.mit.edu	37	10	75301494	75301494	+	Missense_Mutation	SNP	T	T	C	rs527912423		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr10:75301494T>C	ENST00000339859.4	-	7	675	c.575A>G	c.(574-576)aAt>aGt	p.N192S	USP54_ENST00000428547.1_Intron|USP54_ENST00000408019.1_Missense_Mutation_p.N192S|USP54_ENST00000319786.7_Missense_Mutation_p.N192S|USP54_ENST00000394811.2_5'UTR|USP54_ENST00000497106.1_5'UTR			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	192	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)	p.N192S(1)		breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					AATAGCCTGATTGCTTCAAGA	0.428													T|||	1	0.000199681	0.0	0.0	5008	,	,		21855	0.0		0.0	False		,,,				2504	0.001				p.N192S	Colon(195;880 2046 8854 25025 38456)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A575G	10						.						74.0	70.0	71.0					10																	75301494		1885	4116	6001	74971500	SO:0001583	missense	159195	exon6			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.575A>G	10.37:g.75301494T>C	ENSP00000345216:p.Asn192Ser	Somatic		Capture	Illumina HiSeq	Phase_I	74971500	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	37	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	T	15.38	2.816259	0.50527	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000319786	T;T	0.26223	1.75;1.75	5.55	5.55	0.83447	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	U	0.000000	T	0.37999	0.1024	L	0.31752	0.955	0.44136	D	0.996923	D;P;D	0.71674	0.998;0.885;0.998	D;B;D	0.69654	0.949;0.392;0.965	T	0.07214	-1.0784	9	.	.	.	-12.2488	15.9896	0.80193	0.0:0.0:0.0:1.0	.	192;192;192	B7Z7X1;Q70EL1-6;Q70EL1	.;.;UBP54_HUMAN	S	192	ENSP00000345216:N192S;ENSP00000386080:N192S	.	N	-	2	0	USP54	74971500	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.694000	0.61760	2.238000	0.73509	0.533000	0.62120	AAT		0.428	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
ARAP1	116985	broad.mit.edu	37	11	72425237	72425238	+	Frame_Shift_Ins	INS	-	-	G	rs377222092		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr11:72425237_72425238insG	ENST00000393609.3	-	4	840_841	c.638_639insC	c.(637-639)ccgfs	p.P213fs	ARAP1_ENST00000359373.5_Frame_Shift_Ins_p.P213fs|ARAP1_ENST00000455638.2_Frame_Shift_Ins_p.P213fs|ARAP1_ENST00000426523.1_5'UTR|ARAP1_ENST00000393605.3_5'Flank|ARAP1_ENST00000334211.8_5'UTR|ARAP1_ENST00000429686.1_5'UTR	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	213					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GAGGTATCTCCGGGGGGCAGGG	0.653																																					p.P213fs	Ovarian(102;1198 1520 13195 17913 37529)											.	.	0			c.639_640insC	11						.																																			72102886	SO:0001589	frameshift_variant	116985	exon4			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.639dupC	11.37:g.72425243_72425243dupG	ENSP00000377233:p.Pro213fs	None		Capture	Illumina HiSeq	Phase_I	72102885	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Frame_Shift_Ins	INS	ENST00000393609.3	37	CCDS41687.1																																																																																				0.653	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
KMT2A	4297	broad.mit.edu	37	11	118371787	118371787	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr11:118371787G>A	ENST00000389506.5	+	25	6235	c.6235G>A	c.(6235-6237)Gta>Ata	p.V2079I	KMT2A_ENST00000534358.1_Missense_Mutation_p.V2082I|KMT2A_ENST00000354520.4_Missense_Mutation_p.V2041I			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2079					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.V2079I(1)									TCCTCCAGTCGTAGAGCCGGA	0.468																																					p.V2079I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6235A	11						.						164.0	128.0	140.0					11																	118371787		2200	4296	6496	117876997	SO:0001583	missense	4297	exon25			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.6235G>A	11.37:g.118371787G>A	ENSP00000374157:p.Val2079Ile	Somatic		Capture	Illumina HiSeq	Phase_I	117876997	NM_005933	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.385260	0.25031	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.81739	-1.53;-1.53;-1.5	5.72	3.81	0.43845	.	0.519709	0.20224	N	0.096625	T	0.71324	0.3326	L	0.47716	1.5	0.09310	N	0.999998	D;B	0.53151	0.958;0.003	B;B	0.41332	0.354;0.001	T	0.59804	-0.7385	10	0.17369	T	0.5	.	10.4131	0.44305	0.0688:0.2533:0.6779:0.0	.	2082;2079	E9PQG7;Q03164	.;MLL1_HUMAN	I	2082;2079;2041;989	ENSP00000436786:V2082I;ENSP00000374157:V2079I;ENSP00000346516:V2041I	ENSP00000346516:V2041I	V	+	1	0	MLL	117876997	0.000000	0.05858	0.489000	0.27452	0.936000	0.57629	0.417000	0.21214	0.717000	0.32145	-0.218000	0.12543	GTA		0.468	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
NUP160	23279	broad.mit.edu	37	11	47829977	47829977	+	Silent	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr11:47829977G>A	ENST00000378460.2	-	18	2392	c.2346C>T	c.(2344-2346)tgC>tgT	p.C782C	NUP160_ENST00000530326.1_Silent_p.C668C|NUP160_ENST00000528071.1_Silent_p.C668C	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	782					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.C782C(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CAGTTGCCAAGCACTCACTTC	0.388																																					p.C782C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2346T	11						.						112.0	99.0	104.0					11																	47829977		2201	4298	6499	47786553	SO:0001819	synonymous_variant	23279	exon18			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2346C>T	11.37:g.47829977G>A		Somatic		Capture	Illumina HiSeq	Phase_I	47786553	NM_015231	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Silent	SNP	ENST00000378460.2	37	CCDS31484.1																																																																																				0.388	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231	
FRMD8	83786	broad.mit.edu	37	11	65156932	65156932	+	Silent	SNP	C	C	T	rs146504901		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr11:65156932C>T	ENST00000317568.5	+	3	349	c.186C>T	c.(184-186)cgC>cgT	p.R62R	FRMD8_ENST00000355991.5_Intron|FRMD8_ENST00000416776.2_Silent_p.R62R	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	62	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)		p.R62R(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						GCGCTGTCCGCGAGGTCCTGC	0.652																																					p.R62R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C186T	11						.	C		4,4398	8.1+/-20.4	0,4,2197	70.0	50.0	57.0		186	-10.2	0.6	11	dbSNP_134	57	0,8594		0,0,4297	no	coding-synonymous	FRMD8	NM_031904.3		0,4,6494	TT,TC,CC		0.0,0.0909,0.0308		62/465	65156932	4,12992	2201	4297	6498	64913508	SO:0001819	synonymous_variant	83786	exon3			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.186C>T	11.37:g.65156932C>T		Somatic		Capture	Illumina HiSeq	Phase_I	64913508	NM_031904	B4E2P1|Q86V56|Q8NCB5	Silent	SNP	ENST00000317568.5	37	CCDS8102.1																																																																																				0.652	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
PHLDB1	23187	broad.mit.edu	37	11	118485287	118485287	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr11:118485287A>G	ENST00000361417.2	+	4	485	c.74A>G	c.(73-75)gAc>gGc	p.D25G	PHLDB1_ENST00000356063.5_Missense_Mutation_p.D25G	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	25								p.D25G(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GGACCCTTGGACCTGATCGAG	0.572																																					p.D25G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A74G	11						.						106.0	82.0	90.0					11																	118485287		2200	4295	6495	117990497	SO:0001583	missense	23187	exon3				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.74A>G	11.37:g.118485287A>G	ENSP00000354498:p.Asp25Gly	Somatic		Capture	Illumina HiSeq	Phase_I	117990497	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.845212	0.91197	.	.	ENSG00000019144	ENST00000361417;ENST00000543207;ENST00000545313;ENST00000356063	T;T	0.60299	0.2;0.2	5.7	5.7	0.88788	.	0.111526	0.64402	D	0.000014	T	0.68467	0.3004	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	0.994;0.998;1.0	D;D;D	0.80764	0.93;0.99;0.994	T	0.65631	-0.6121	10	0.31617	T	0.26	-34.3828	15.6366	0.76961	1.0:0.0:0.0:0.0	.	25;25;25	B4DIX4;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	G	25	ENSP00000354498:D25G;ENSP00000348359:D25G	ENSP00000348359:D25G	D	+	2	0	PHLDB1	117990497	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.774000	0.91767	2.168000	0.68352	0.459000	0.35465	GAC		0.572	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
LRTM2	654429	broad.mit.edu	37	12	1943841	1943841	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:1943841C>T	ENST00000543818.1	+	5	1909	c.1067C>T	c.(1066-1068)cCc>cTc	p.P356L	LRTM2_ENST00000535041.1_Missense_Mutation_p.P356L|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585708.1_Intron|LRTM2_ENST00000299194.1_Missense_Mutation_p.P356L|CACNA2D4_ENST00000588077.1_Intron|CACNA2D4_ENST00000586184.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	356						integral component of membrane (GO:0016021)		p.P356L(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			ATGGGGGACCCCGAGGGCGAG	0.647																																					p.P356L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1067T	12						.						40.0	42.0	42.0					12																	1943841		2202	4296	6498	1814102	SO:0001583	missense	654429	exon5			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.1067C>T	12.37:g.1943841C>T	ENSP00000446278:p.Pro356Leu	Somatic		Capture	Illumina HiSeq	Phase_I	1814102	NM_001039029	A7E2U6	Missense_Mutation	SNP	ENST00000543818.1	37	CCDS31726.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819469	0.50633	.	.	ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041	T;T;T	0.54866	0.55;0.55;0.55	5.3	5.3	0.74995	.	0.156832	0.56097	D	0.000022	T	0.42630	0.1211	N	0.22421	0.69	0.45172	D	0.998188	B	0.24882	0.113	B	0.17979	0.02	T	0.29640	-1.0005	10	0.49607	T	0.09	.	18.9667	0.92700	0.0:1.0:0.0:0.0	.	356	Q8N967	LRTM2_HUMAN	L	356	ENSP00000446278:P356L;ENSP00000299194:P356L;ENSP00000444737:P356L	ENSP00000299194:P356L	P	+	2	0	LRTM2	1814102	0.545000	0.26449	0.924000	0.36721	0.830000	0.47004	1.428000	0.34892	2.480000	0.83734	0.561000	0.74099	CCC		0.647	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398055.1		
RERG	85004	broad.mit.edu	37	12	15370410	15370410	+	Missense_Mutation	SNP	G	G	A	rs376776458		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:15370410G>A	ENST00000256953.2	-	2	350	c.14C>T	c.(13-15)gCg>gTg	p.A5V	RERG_ENST00000536465.1_Missense_Mutation_p.A5V|RERG_ENST00000538313.1_Missense_Mutation_p.A5V|RERG_ENST00000546331.1_Missense_Mutation_p.A5V|RERG_ENST00000537647.1_Missense_Mutation_p.A5V	NM_032918.2	NP_116307.1	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	5					negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to hormone (GO:0009725)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	estrogen receptor binding (GO:0030331)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A5V(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16						TTTGACCTCCGCACTTTTAGC	0.423													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18460	0.0		0.0	False		,,,				2504	0.0				p.A5V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C14T	12						.	G	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	263.0	221.0	236.0		14,14	4.9	1.0	12		236	0,8600		0,0,4300	no	missense,missense	RERG	NM_032918.2,NM_001190726.1	64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	5/200,5/181	15370410	1,13005	2203	4300	6503	15261677	SO:0001583	missense	85004	exon2			AF339750	CCDS8673.1, CCDS53753.1	12p13.1	2014-05-09			ENSG00000134533	ENSG00000134533			15980	protein-coding gene	gene with protein product		612664				11533059	Standard	NM_032918		Approved	MGC15754	uc001rct.3	Q96A58	OTTHUMG00000168745	ENST00000256953.2:c.14C>T	12.37:g.15370410G>A	ENSP00000256953:p.Ala5Val	Somatic		Capture	Illumina HiSeq	Phase_I	15261677	NM_032918	B2R9R0|B4DI02	Missense_Mutation	SNP	ENST00000256953.2	37	CCDS8673.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307532	0.40795	2.27E-4	0.0	ENSG00000134533	ENST00000256953;ENST00000538313;ENST00000536465;ENST00000546331;ENST00000537647;ENST00000393736	T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	4.92	4.92	0.64577	Small GTP-binding protein domain (1);	0.128942	0.52532	D	0.000076	T	0.61937	0.2387	N	0.17564	0.495	0.39770	D	0.972158	B;B	0.29909	0.14;0.261	B;B	0.16289	0.014;0.015	T	0.66775	-0.5838	10	0.72032	D	0.01	.	13.496	0.61426	0.0:0.0:1.0:0.0	.	5;5	B4DI02;Q96A58	.;RERG_HUMAN	V	5	ENSP00000256953:A5V;ENSP00000441505:A5V;ENSP00000438280:A5V;ENSP00000444485:A5V;ENSP00000441860:A5V;ENSP00000440887:A5V	ENSP00000256953:A5V	A	-	2	0	RERG	15261677	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	6.170000	0.71920	2.550000	0.86006	0.655000	0.94253	GCG		0.423	RERG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400882.1	NM_032918	
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12C	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1 	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34T	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	Somatic		Capture	Illumina HiSeq	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
BICD1	636	broad.mit.edu	37	12	32481287	32481287	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:32481287G>A	ENST00000281474.5	+	5	2001	c.1898G>A	c.(1897-1899)cGg>cAg	p.R633Q	BICD1_ENST00000548411.1_Missense_Mutation_p.R633Q	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	633					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)	p.R633Q(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GCCATAATCCGGGACCAAATC	0.488																																					p.R633Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1898A	12						.						135.0	138.0	137.0					12																	32481287		2203	4300	6503	32372554	SO:0001583	missense	636	exon5			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.1898G>A	12.37:g.32481287G>A	ENSP00000281474:p.Arg633Gln	Somatic		Capture	Illumina HiSeq	Phase_I	32372554	NM_001003398	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681634	0.88542	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.52057	0.68;0.68	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	M	0.80028	2.48	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.66351	0.845;0.943	T	0.69143	-0.5223	10	0.33940	T	0.23	.	18.7402	0.91770	0.0:0.0:1.0:0.0	.	633;633	F8W113;Q96G01	.;BICD1_HUMAN	Q	633	ENSP00000446793:R633Q;ENSP00000281474:R633Q	ENSP00000281474:R633Q	R	+	2	0	BICD1	32372554	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.611000	0.98342	2.415000	0.81967	0.655000	0.94253	CGG		0.488	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
KMT2D	8085	broad.mit.edu	37	12	49434221	49434221	+	Silent	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:49434221G>A	ENST00000301067.7	-	31	7331	c.7332C>T	c.(7330-7332)ttC>ttT	p.F2444F		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2444	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.F2444F(1)|p.F2174F(1)									CAGGGGACTGGAAGCGAGGGG	0.622																																					p.F2444F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C7332T	12						.						42.0	48.0	46.0					12																	49434221		2066	4208	6274	47720488	SO:0001819	synonymous_variant	8085	exon31			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7332C>T	12.37:g.49434221G>A		Somatic		Capture	Illumina HiSeq	Phase_I	47720488	NM_003482	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																				0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KRT72	140807	broad.mit.edu	37	12	52981584	52981584	+	Missense_Mutation	SNP	C	C	T	rs368767777		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:52981584C>T	ENST00000537672.2	-	7	1151	c.1141G>A	c.(1141-1143)Gcc>Acc	p.A381T	KRT72_ENST00000293745.2_Missense_Mutation_p.A381T|KRT72_ENST00000398066.3_Missense_Mutation_p.A193T|KRT72_ENST00000354310.4_Missense_Mutation_p.A339T	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	381	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.A381T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		TCTTTCAGGGCGCAGTCCCCC	0.637																																					p.A339T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1015A	12						.						55.0	53.0	54.0					12																	52981584		2203	4300	6503	51267851	SO:0001583	missense	140807	exon6			AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1141G>A	12.37:g.52981584C>T	ENSP00000441160:p.Ala381Thr	Somatic		Capture	Illumina HiSeq	Phase_I	51267851	NM_001146226	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375592	0.61735	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	D;D;T;D	0.88741	-2.42;-2.42;2.51;-2.42	4.92	4.92	0.64577	Filament (1);	0.000000	0.51477	D	0.000087	D	0.91805	0.7407	M	0.87900	2.915	0.52501	D	0.999954	P;P	0.40970	0.734;0.598	B;B	0.42188	0.379;0.26	D	0.93143	0.6543	10	0.62326	D	0.03	.	19.0272	0.92937	0.0:1.0:0.0:0.0	.	339;381	B4DEI8;Q14CN4	.;K2C72_HUMAN	T	381;381;339;193	ENSP00000441160:A381T;ENSP00000293745:A381T;ENSP00000346269:A339T;ENSP00000446151:A193T	ENSP00000293745:A381T	A	-	1	0	KRT72	51267851	0.982000	0.34865	0.959000	0.39883	0.092000	0.18411	2.626000	0.46460	2.652000	0.90054	0.650000	0.86243	GCC		0.637	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
DNAJC14	85406	broad.mit.edu	37	12	56222377	56222377	+	Silent	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:56222377G>A	ENST00000357606.3	-	3	355	c.66C>T	c.(64-66)ctC>ctT	p.L22L	TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317269.3_Silent_p.L22L|RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317287.5_Silent_p.L22L			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	22					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.L22L(1)		breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						CTAAAGTCCTGAGGGAGGCAC	0.597																																					p.L22L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C66T	12						.						90.0	86.0	87.0					12																	56222377		2203	4300	6503	54508644	SO:0001819	synonymous_variant	85406	exon2			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.66C>T	12.37:g.56222377G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54508644	NM_032364	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Silent	SNP	ENST00000357606.3	37	CCDS8894.1																																																																																				0.597	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364	
NAV3	89795	broad.mit.edu	37	12	78542694	78542694	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:78542694G>T	ENST00000397909.2	+	22	4953	c.4780G>T	c.(4780-4782)Gca>Tca	p.A1594S	NAV3_ENST00000266692.7_Missense_Mutation_p.A1417S|NAV3_ENST00000228327.6_Missense_Mutation_p.A1594S|NAV3_ENST00000536525.2_Missense_Mutation_p.A1594S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1594						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.A1594S(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCAGCTTTCAGCAAATGTAAG	0.313										HNSCC(70;0.22)																											p.A1594S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4780T	12						.						74.0	68.0	70.0					12																	78542694		1814	4083	5897	77066825	SO:0001583	missense	89795	exon22			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4780G>T	12.37:g.78542694G>T	ENSP00000381007:p.Ala1594Ser	Somatic		Capture	Illumina HiSeq	Phase_I	77066825	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.655158|4.655158	0.88056|0.88056	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|D	0.94092|0.93547	-3.35;-3.35;-3.35;-3.35;-3.35|-3.24	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.39834|.	U|.	0.001252|.	D|D	0.96131|0.96131	0.8739|0.8739	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.67145|.	0.995;0.99;0.966;0.996|.	D;D;P;D|.	0.77557|.	0.913;0.971;0.472;0.99|.	D|D	0.96434|0.96434	0.9321|0.9321	10|7	0.56958|0.87932	D|D	0.05|0	-17.3605|-17.3605	18.84|18.84	0.92180|0.92180	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1594;1417;1594;1594|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	S|I	1594;1594;1594;1417;215;223|488	ENSP00000446132:A1594S;ENSP00000381007:A1594S;ENSP00000228327:A1594S;ENSP00000266692:A1417S;ENSP00000448303:A223S|ENSP00000446644:S488I	ENSP00000228327:A1594S|ENSP00000446644:S488I	A|S	+|+	1|2	0|0	NAV3|NAV3	77066825|77066825	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.070000|8.070000	0.89493|0.89493	2.559000|2.559000	0.86315|0.86315	0.650000|0.650000	0.86243|0.86243	GCA|AGC		0.313	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
KSR2	283455	broad.mit.edu	37	12	118199154	118199154	+	Silent	SNP	G	G	A	rs374977823		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr12:118199154G>A	ENST00000339824.5	-	4	1375	c.648C>T	c.(646-648)ccC>ccT	p.P216P	KSR2_ENST00000425217.1_Silent_p.P187P			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	216	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.P248P(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGGGGCCCCGGGAGTGGGGC	0.711																																					p.P187P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C561T	12						.	G		0,3750		0,0,1875	20.0	24.0	23.0		561	-9.3	0.0	12		23	1,8185		0,1,4092	no	coding-synonymous	KSR2	NM_173598.4		0,1,5967	AA,AG,GG		0.0122,0.0,0.0084		187/922	118199154	1,11935	1875	4093	5968	116683537	SO:0001819	synonymous_variant	283455	exon4			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.648C>T	12.37:g.118199154G>A		Somatic		Capture	Illumina HiSeq	Phase_I	116683537	NM_173598	A0PJT2|Q3B828|Q8N775	Silent	SNP	ENST00000339824.5	37																																																																																					0.711	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
OTX2	5015	broad.mit.edu	37	14	57271048	57271049	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr14:57271048_57271049insG	ENST00000555006.1	-	3	514_515	c.106_107insC	c.(106-108)cggfs	p.R36fs	OTX2_ENST00000339475.5_Frame_Shift_Ins_p.R44fs|OTX2_ENST00000408990.3_Frame_Shift_Ins_p.R36fs|OTX2_ENST00000554788.1_Intron|OTX2_ENST00000554559.1_Intron			P32243	OTX2_HUMAN	orthodenticle homeobox 2	36					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R44fs*52(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					GCGCTGTTTCCGGGGGGTGGCT	0.634																																					p.R44fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.131_132insC	14	GRCh37	CI086234	OTX2	I		.																																			56340802	SO:0001589	frameshift_variant	5015	exon4			AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.107dupC	14.37:g.57271054_57271054dupG	ENSP00000452336:p.Arg36fs	Somatic		Capture	Illumina HiSeq	Phase_I	56340801	NM_021728	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Frame_Shift_Ins	INS	ENST00000555006.1	37	CCDS41960.1																																																																																				0.634	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
OR4K14	122740	broad.mit.edu	37	14	20483081	20483081	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr14:20483081T>C	ENST00000305045.2	-	1	271	c.272A>G	c.(271-273)aAa>aGa	p.K91R		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K91R(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GGAGATGAGTTTTTGATCACT	0.483																																					p.K91R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A272G	14						.						99.0	92.0	94.0					14																	20483081		2203	4300	6503	19552921	SO:0001583	missense	122740	exon1				CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.272A>G	14.37:g.20483081T>C	ENSP00000305011:p.Lys91Arg	Somatic		Capture	Illumina HiSeq	Phase_I	19552921	NM_001004712	Q6IEU1|Q96R71	Missense_Mutation	SNP	ENST00000305045.2	37	CCDS32027.1	.	.	.	.	.	.	.	.	.	.	.	13.84	2.357451	0.41801	.	.	ENSG00000169484	ENST00000305045	T	0.37584	1.19	4.04	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000248	T	0.36276	0.0961	L	0.49350	1.555	0.09310	N	1	P	0.37423	0.594	B	0.40285	0.325	T	0.34453	-0.9828	10	0.66056	D	0.02	.	12.097	0.53761	0.0:0.0:0.0:1.0	.	91	Q8NGD5	OR4KE_HUMAN	R	91	ENSP00000305011:K91R	ENSP00000305011:K91R	K	-	2	0	OR4K14	19552921	0.010000	0.17322	0.450000	0.26969	0.759000	0.43091	1.413000	0.34725	1.695000	0.51148	0.413000	0.27773	AAA		0.483	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410343.1		
LRFN5	145581	broad.mit.edu	37	14	42361074	42361074	+	Silent	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr14:42361074C>T	ENST00000298119.4	+	4	3196	c.2007C>T	c.(2005-2007)aaC>aaT	p.N669N	LRFN5_ENST00000554120.1_Intron|LRFN5_ENST00000554171.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	669						integral component of membrane (GO:0016021)		p.N669N(1)|p.N669K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		AAAACACTAACAGGAACAACT	0.458										HNSCC(30;0.082)																											p.N669N												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C2007T	14						.						101.0	84.0	90.0					14																	42361074		2203	4300	6503	41430824	SO:0001819	synonymous_variant	145581	exon4			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.2007C>T	14.37:g.42361074C>T		Somatic		Capture	Illumina HiSeq	Phase_I	41430824	NM_152447	B3KU78|Q86XL2	Silent	SNP	ENST00000298119.4	37	CCDS9678.1																																																																																				0.458	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
ESR2	2100	broad.mit.edu	37	14	64727460	64727460	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr14:64727460C>T	ENST00000341099.4	-	5	1076	c.659G>A	c.(658-660)cGg>cAg	p.R220Q	ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000358599.5_Missense_Mutation_p.R220Q|ESR2_ENST00000553796.1_Missense_Mutation_p.R220Q|ESR2_ENST00000542956.1_Missense_Mutation_p.R220Q|ESR2_ENST00000353772.3_Missense_Mutation_p.R220Q|ESR2_ENST00000554572.1_Missense_Mutation_p.R220Q|ESR2_ENST00000555278.1_Missense_Mutation_p.R220Q|ESR2_ENST00000557772.1_Missense_Mutation_p.R220Q|ESR2_ENST00000267525.6_Missense_Mutation_p.R220Q|ESR2_ENST00000357782.2_Missense_Mutation_p.R220Q	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	220	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R220Q(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	TCTCTCTCTCCGGGAGCCTGA	0.577																																					p.R220Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G659A	14						.						29.0	30.0	29.0					14																	64727460		2197	4287	6484	63797213	SO:0001583	missense	2100	exon5			X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.659G>A	14.37:g.64727460C>T	ENSP00000343925:p.Arg220Gln	Somatic		Capture	Illumina HiSeq	Phase_I	63797213	NM_001437	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	37	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995366	0.93167	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;D	0.95980	-3.87;-3.87;-3.87;-3.87;-3.87;-3.87;-3.87;-3.87;-3.87;-3.87;-3.87	5.53	5.53	0.82687	Zinc finger, NHR/GATA-type (1);Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (1);	0.000000	0.85682	D	0.000000	D	0.97558	0.9200	M	0.92738	3.34	0.80722	D	1	D;P;B;P;B	0.58620	0.983;0.82;0.28;0.819;0.184	P;B;B;B;B	0.51135	0.66;0.135;0.072;0.343;0.021	D	0.98302	1.0519	10	0.87932	D	0	.	19.8407	0.96681	0.0:1.0:0.0:0.0	.	220;220;220;220;220	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	Q	220	ENSP00000452485:R220Q;ENSP00000441792:R220Q;ENSP00000450699:R220Q;ENSP00000335551:R220Q;ENSP00000351412:R220Q;ENSP00000450488:R220Q;ENSP00000452426:R220Q;ENSP00000350427:R220Q;ENSP00000451582:R220Q;ENSP00000343925:R220Q;ENSP00000267525:R220Q	ENSP00000267525:R220Q	R	-	2	0	ESR2	63797213	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	5.078000	0.64425	2.763000	0.94921	0.563000	0.77884	CGG		0.577	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
AHNAK2	113146	broad.mit.edu	37	14	105410172	105410173	+	Missense_Mutation	DNP	CA	CA	TG	rs560224708		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr14:105410172_105410173CA>TG	ENST00000333244.5	-	7	11734_11735	c.11615_11616TG>CA	c.(11614-11616)cTG>cCA	p.L3872P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3872						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L3872>?(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGTGGCCCTCCAGGAGTTTCAT	0.609																																					.												.	.	1	Complex(1)	large_intestine(1)	c.11615_11616CA	14						.																																			104481218	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11615_11616delinsTG	14.37:g.105410172_105410173delinsTG	ENSP00000353114:p.Leu3872Pro	Somatic		Capture	Illumina HiSeq	Phase_I	104481217	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	DNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.609	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
HERC2	8924	broad.mit.edu	37	15	28478824	28478824	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr15:28478824T>C	ENST00000261609.7	-	28	4445	c.4337A>G	c.(4336-4338)aAa>aGa	p.K1446R		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.K1446R(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ATCTTCATGTTTTAAGAGGCA	0.468																																					p.K1446R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4337G	15						.						68.0	61.0	64.0					15																	28478824		2203	4300	6503	26152419	SO:0001583	missense	8924	exon28			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.4337A>G	15.37:g.28478824T>C	ENSP00000261609:p.Lys1446Arg	Somatic		Capture	Illumina HiSeq	Phase_I	26152419	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	t	14.03	2.413651	0.42817	.	.	ENSG00000128731	ENST00000261609	T	0.44482	0.92	4.22	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	L	0.31526	0.94	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.28870	-1.0030	10	0.20046	T	0.44	.	13.7978	0.63182	0.0:0.0:0.0:1.0	.	1446	O95714	HERC2_HUMAN	R	1446	ENSP00000261609:K1446R	ENSP00000261609:K1446R	K	-	2	0	HERC2	26152419	1.000000	0.71417	0.915000	0.36163	0.541000	0.35023	7.523000	0.81856	1.907000	0.55213	0.524000	0.50904	AAA		0.468	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TP53BP1	7158	broad.mit.edu	37	15	43705410	43705410	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr15:43705410C>T	ENST00000263801.3	-	24	5449	c.5197G>A	c.(5197-5199)Gca>Aca	p.A1733T	TP53BP1_ENST00000450115.2_Missense_Mutation_p.A1736T|TP53BP1_ENST00000382039.3_Missense_Mutation_p.A1688T|TP53BP1_ENST00000382044.4_Missense_Mutation_p.A1738T	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1733	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.A1733T(1)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AGGAGAAATGCGTAGCCCAGA	0.557								Other conserved DNA damage response genes																													p.A1733T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5197A	15						.						117.0	96.0	103.0					15																	43705410		2201	4298	6499	41492702	SO:0001583	missense	7158	exon24			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5197G>A	15.37:g.43705410C>T	ENSP00000263801:p.Ala1733Thr	Somatic		Capture	Illumina HiSeq	Phase_I	41492702	NM_005657	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	C	34	5.355292	0.95854	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	6.03	6.03	0.97812	BRCT (3);	0.000000	0.85682	D	0.000000	D	0.92815	0.7715	L	0.60455	1.87	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	D	0.92229	0.5791	10	0.62326	D	0.03	-11.6389	20.5568	0.99304	0.0:1.0:0.0:0.0	.	1733;1738;1736	Q12888;Q12888-2;F8VY86	TP53B_HUMAN;.;.	T	1733;1738;1688;1736	ENSP00000263801:A1733T;ENSP00000371475:A1738T;ENSP00000371470:A1688T;ENSP00000393497:A1736T	ENSP00000263801:A1733T	A	-	1	0	TP53BP1	41492702	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.999000	0.70665	2.861000	0.98227	0.655000	0.94253	GCA		0.557	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
HERC2	8924	broad.mit.edu	37	15	28443624	28443626	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	AGA	AGA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr15:28443624_28443626delAGA	ENST00000261609.7	-	50	8017_8019	c.7909_7911delTCT	c.(7909-7911)tctdel	p.S2637del		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.S2637delS(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCTTGATGTGAGAAGAAGAACTT	0.389																																					p.2637_2637del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.7909_7911del	15						.																																			26117221	SO:0001651	inframe_deletion	8924	exon50			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.7909_7911delTCT	15.37:g.28443630_28443632delAGA	ENSP00000261609:p.Ser2637del	Somatic		Capture	Illumina HiSeq	Phase_I	26117219	NM_004667		In_Frame_Del	DEL	ENST00000261609.7	37	CCDS10021.1																																																																																				0.389	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TLN2	83660	broad.mit.edu	37	15	63097799	63097799	+	Splice_Site	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr15:63097799G>A	ENST00000561311.1	+	50	6708	c.6478G>A	c.(6478-6480)Gtg>Atg	p.V2160M	TLN2_ENST00000306829.6_Splice_Site_p.V2160M			Q9Y4G6	TLN2_HUMAN	talin 2	2160					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.V2160M(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TGACTTCCAGGTGTTCCAGTC	0.418																																					p.V2160M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6478A	15						.						41.0	39.0	40.0					15																	63097799		2203	4300	6503	60884852	SO:0001630	splice_region_variant	83660	exon48			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6478-1G>A	15.37:g.63097799G>A		Somatic		Capture	Illumina HiSeq	Phase_I	60884852	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	G	7.252	0.603461	0.14002	.	.	ENSG00000171914	ENST00000306829	T	0.69926	-0.44	5.93	4.06	0.47325	.	0.247991	0.39407	N	0.001365	T	0.61286	0.2335	L	0.59436	1.845	0.36710	D	0.880604	B	0.22746	0.074	B	0.15484	0.013	T	0.58470	-0.7631	9	.	.	.	-14.2398	13.9793	0.64295	0.0611:0.0:0.8266:0.1123	.	2160	Q9Y4G6	TLN2_HUMAN	M	2160	ENSP00000303476:V2160M	.	V	+	1	0	TLN2	60884852	1.000000	0.71417	0.947000	0.38551	0.092000	0.18411	4.805000	0.62561	0.427000	0.26145	-0.808000	0.03180	GTG		0.418	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		Missense_Mutation
TSC2	7249	broad.mit.edu	37	16	2106717	2106717	+	Missense_Mutation	SNP	G	G	A	rs200943828|rs397514893		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr16:2106717G>A	ENST00000219476.3	+	8	1351	c.721G>A	c.(721-723)Gtt>Att	p.V241I	TSC2_ENST00000350773.4_Missense_Mutation_p.V241I|TSC2_ENST00000439673.2_Missense_Mutation_p.V204I|TSC2_ENST00000401874.2_Missense_Mutation_p.V241I|TSC2_ENST00000568454.1_Missense_Mutation_p.V252I|TSC2_ENST00000382538.6_Missense_Mutation_p.V192I|TSC2_ENST00000353929.4_Missense_Mutation_p.V241I	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	241	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)	p.V241I(2)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GCTGTTCATCGTTACCCTCTG	0.607			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				.|||	1	0.000199681	0.0	0.0	5008	,	,		20930	0.0		0.0	False		,,,				2504	0.001				p.V241I		yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G721A	16						.	G	ILE/VAL,ILE/VAL,ILE/VAL	0,4396		0,0,2198	114.0	102.0	106.0		721,721,721	1.5	0.9	16		106	1,8599		0,1,4299	yes	missense,missense,missense	TSC2	NM_000548.3,NM_001077183.1,NM_001114382.1	29,29,29	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	241/1808,241/1741,241/1785	2106717	1,12995	2198	4300	6498	2046718	SO:0001583	missense	7249	exon8	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.721G>A	16.37:g.2106717G>A	ENSP00000219476:p.Val241Ile	Somatic		Capture	Illumina HiSeq	Phase_I	2046718	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	.	0.062	-1.220621	0.01530	0.0	1.16E-4	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	5.05	1.47	0.22746	Armadillo-type fold (1);Tuberin, N-terminal (1);	0.310145	0.33572	N	0.004764	T	0.54013	0.1832	N	0.02357	-0.585	0.26061	N	0.981347	B;B;B;B;B;B	0.09022	0.0;0.002;0.0;0.001;0.001;0.001	B;B;B;B;B;B	0.08055	0.002;0.002;0.001;0.003;0.003;0.003	T	0.48958	-0.8988	10	0.36615	T	0.2	-19.7054	8.6987	0.34312	0.4368:0.0:0.5632:0.0	.	192;204;241;241;241;241	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	I	241;241;241;204;192;241	ENSP00000219476:V241I;ENSP00000384468:V241I;ENSP00000248099:V241I;ENSP00000399232:V204I;ENSP00000371978:V192I;ENSP00000344383:V241I	ENSP00000219476:V241I	V	+	1	0	TSC2	2046718	0.746000	0.28272	0.947000	0.38551	0.097000	0.18754	1.486000	0.35530	0.525000	0.28522	-0.140000	0.14226	GTT		0.607	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
DHX58	79132	broad.mit.edu	37	17	40255719	40255719	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr17:40255719A>G	ENST00000251642.3	-	12	1883	c.1661T>C	c.(1660-1662)cTa>cCa	p.L554P		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	554	Repressor domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GATGCAGAGTAGCTGCACGTG	0.637																																					p.L554P												.	.	0			c.T1661C	17						.						72.0	59.0	63.0					17																	40255719		2203	4300	6503	37509245	SO:0001583	missense	79132	exon12			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.1661T>C	17.37:g.40255719A>G	ENSP00000251642:p.Leu554Pro	None		Capture	Illumina HiSeq	Phase_I	37509245	NM_024119	Q9HAM6	Missense_Mutation	SNP	ENST00000251642.3	37	CCDS11416.1	.	.	.	.	.	.	.	.	.	.	A	34	5.367298	0.95900	.	.	ENSG00000108771	ENST00000251642	T	0.63096	-0.02	5.72	5.72	0.89469	C-terminal domain of RIG-I (1);	0.073969	0.52532	D	0.000069	T	0.79639	0.4480	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.82368	-0.0492	10	0.72032	D	0.01	.	13.7509	0.62906	1.0:0.0:0.0:0.0	.	547;554	B7Z455;Q96C10	.;DHX58_HUMAN	P	554	ENSP00000251642:L554P	ENSP00000251642:L554P	L	-	2	0	DHX58	37509245	0.996000	0.38824	0.254000	0.24359	0.852000	0.48524	8.625000	0.90965	2.185000	0.69588	0.454000	0.30748	CTA		0.637	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	NM_024119	
CDC27	996	broad.mit.edu	37	17	45234725	45234725	+	Silent	SNP	T	T	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr17:45234725T>C	ENST00000066544.3	-	6	594	c.501A>G	c.(499-501)acA>acG	p.T167T	CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000446365.2_Silent_p.T106T|CDC27_ENST00000531206.1_Silent_p.T167T|CDC27_ENST00000527547.1_Silent_p.T167T	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.T167T(7)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGAATTTAAATGTTTGGTCAG	0.368																																					p.T167T												.	.	7	Substitution - coding silent(7)	large_intestine(4)|prostate(3)	c.A501G	17						.						74.0	74.0	74.0					17																	45234725		2203	4300	6503	42589724	SO:0001819	synonymous_variant	996	exon6			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.501A>G	17.37:g.45234725T>C		Somatic		Capture	Illumina HiSeq	Phase_I	42589724	NM_001114091	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																				0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
GUCY2D	3000	broad.mit.edu	37	17	7915820	7915820	+	Missense_Mutation	SNP	G	G	A	rs369222553		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr17:7915820G>A	ENST00000254854.4	+	10	2159	c.2009G>A	c.(2008-2010)cGg>cAg	p.R670Q		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	670	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.R670Q(1)		skin(1)	1		Prostate(122;0.157)				CTGAAGTCACGGAACTGCATA	0.577																																					p.R670Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2009A	17						.	G	GLN/ARG	0,4406		0,0,2203	116.0	106.0	109.0		2009	5.3	1.0	17		109	1,8599	1.2+/-3.3	0,1,4299	no	missense	GUCY2D	NM_000180.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	670/1104	7915820	1,13005	2203	4300	6503	7856545	SO:0001583	missense	3000	exon10			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.2009G>A	17.37:g.7915820G>A	ENSP00000254854:p.Arg670Gln	Somatic		Capture	Illumina HiSeq	Phase_I	7856545	NM_000180	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749834	0.89753	0.0	1.16E-4	ENSG00000132518	ENST00000254854	D	0.87334	-2.24	5.35	5.35	0.76521	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45126	D	0.000400	D	0.91143	0.7211	M	0.74467	2.265	0.34033	D	0.654094	D	0.58620	0.983	P	0.54100	0.742	D	0.93500	0.6843	10	0.45353	T	0.12	.	17.983	0.89147	0.0:0.0:1.0:0.0	.	670	Q02846	GUC2D_HUMAN	Q	670	ENSP00000254854:R670Q	ENSP00000254854:R670Q	R	+	2	0	GUCY2D	7856545	0.949000	0.32298	0.999000	0.59377	0.955000	0.61496	4.556000	0.60775	2.781000	0.95711	0.655000	0.94253	CGG		0.577	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
RNF213	57674	broad.mit.edu	37	17	78314014	78314014	+	Silent	SNP	C	C	T	rs149232232		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr17:78314014C>T	ENST00000582970.1	+	26	5990	c.5847C>T	c.(5845-5847)ttC>ttT	p.F1949F	RNF213_ENST00000336301.6_Silent_p.F22F|RNF213_ENST00000508628.2_Silent_p.F1998F	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1949					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F22F(1)|p.F1998F(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACAAGGTCTTCGTCACCCCCC	0.637																																					p.F1998F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C5994T	17						.	C		0,4406		0,0,2203	98.0	71.0	80.0		5994	-2.0	0.0	17	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RNF213	NM_020914.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1998/5257	78314014	1,13005	2203	4300	6503	75928609	SO:0001819	synonymous_variant	57674	exon27			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.5847C>T	17.37:g.78314014C>T		Somatic		Capture	Illumina HiSeq	Phase_I	75928609	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																				0.637	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
SMCHD1	23347	broad.mit.edu	37	18	2674059	2674059	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr18:2674059A>C	ENST00000320876.6	+	5	891	c.553A>C	c.(553-555)Aat>Cat	p.N185H	SMCHD1_ENST00000261598.8_Missense_Mutation_p.N185H	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	185					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)	p.N185H(3)		NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AGTGATAGATAATGGAAGAGG	0.358																																					p.N185H												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A553C	18						.						76.0	68.0	71.0					18																	2674059		1844	4088	5932	2664059	SO:0001583	missense	23347	exon5			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.553A>C	18.37:g.2674059A>C	ENSP00000326603:p.Asn185His	Somatic		Capture	Illumina HiSeq	Phase_I	2664059	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.438151	0.83885	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	D;D	0.96554	-4.05;-4.05	5.42	5.42	0.78866	ATPase-like, ATP-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.98308	0.9439	M	0.88979	2.995	0.40254	D	0.978101	D	0.89917	1.0	D	0.91635	0.999	D	0.99901	1.1163	10	0.87932	D	0	.	15.4738	0.75461	1.0:0.0:0.0:0.0	.	185	A6NHR9	SMHD1_HUMAN	H	185	ENSP00000326603:N185H;ENSP00000261598:N185H	ENSP00000261598:N185H	N	+	1	0	SMCHD1	2664059	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.548000	0.90669	2.062000	0.61559	0.460000	0.39030	AAT		0.358	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
SMAD2	4087	broad.mit.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr18:45368211G>C	ENST00000402690.2	-	11	1785	c.1391C>G	c.(1390-1392)tCa>tGa	p.S464*	SMAD2_ENST00000262160.6_Nonsense_Mutation_p.S464*|SMAD2_ENST00000356825.4_Nonsense_Mutation_p.S434*|SMAD2_ENST00000586040.1_Nonsense_Mutation_p.S434*	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	464	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.S464*(4)|p.R462fs*>4(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						TGACATGCTTGAGCAACGCAC	0.423																																					p.S434X												.	.	5	Substitution - Nonsense(4)|Deletion - Frameshift(1)	large_intestine(4)|kidney(1)	c.C1301G	18						.						162.0	130.0	141.0					18																	45368211		2203	4300	6503	43622209	SO:0001587	stop_gained	4087	exon10			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1391C>G	18.37:g.45368211G>C	ENSP00000384449:p.Ser464*	Somatic		Capture	Illumina HiSeq	Phase_I	43622209	NM_001135937		Nonsense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	G	41	8.723736	0.98929	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	.	.	.	X	464;434;464	.	ENSP00000262160:S464X	S	-	2	0	SMAD2	43622209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.781000	0.99029	2.824000	0.97209	0.655000	0.94253	TCA		0.423	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
RIT2	6014	broad.mit.edu	37	18	40323520	40323524	+	Frame_Shift_Del	DEL	TTCTC	TTCTC	-	rs77976328		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	TTCTC	TTCTC	TTCTC	-	TTCTC	TTCTC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr18:40323520_40323524delTTCTC	ENST00000326695.5	-	5	759_763	c.588_592delGAGAA	c.(586-594)aagagaaaafs	p.KRK196fs	RIT2_ENST00000589109.1_3'UTR|RIT2_ENST00000590910.1_3'UTR	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	196					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R197T(1)|p.K198fs*>19(1)		endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGGCTGTCTTTTCTCTTCAGTTTCT	0.41																																					p.196_198del												.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	urinary_tract(1)|large_intestine(1)	c.588_592del	18						.																																			38577522	SO:0001589	frameshift_variant	6014	exon5			BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.588_592delGAGAA	18.37:g.40323520_40323524delTTCTC	ENSP00000321805:p.Lys196fs	Somatic		Capture	Illumina HiSeq	Phase_I	38577518	NM_002930	B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Frame_Shift_Del	DEL	ENST00000326695.5	37	CCDS11921.1																																																																																				0.410	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930	
DSEL	92126	broad.mit.edu	37	18	65180959	65180959	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr18:65180959C>T	ENST00000310045.7	-	2	2390	c.917G>A	c.(916-918)cGc>cAc	p.R306H	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	296					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.R306H(2)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				ATTAAAATGGCGCTGGGCCAG	0.393																																					p.R306H												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G917A	18						.						71.0	77.0	75.0					18																	65180959		2203	4300	6503	63331939	SO:0001583	missense	92126	exon2			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.917G>A	18.37:g.65180959C>T	ENSP00000310565:p.Arg306His	Somatic		Capture	Illumina HiSeq	Phase_I	63331939	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229500	0.79688	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.27402	1.67	4.62	4.62	0.57501	.	0.000000	0.85682	U	0.000000	T	0.44932	0.1317	M	0.78049	2.395	0.58432	D	0.999997	D	0.56746	0.977	P	0.47206	0.541	T	0.57300	-0.7835	10	0.87932	D	0	.	17.8479	0.88736	0.0:1.0:0.0:0.0	.	296	Q8IZU8	DSEL_HUMAN	H	306;296	ENSP00000310565:R306H	ENSP00000310565:R306H	R	-	2	0	DSEL	63331939	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.633000	0.83260	2.302000	0.77476	0.462000	0.41574	CGC		0.393	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
WDR88	126248	broad.mit.edu	37	19	33666317	33666317	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr19:33666317A>G	ENST00000355868.3	+	11	1334	c.1258A>G	c.(1258-1260)Agg>Ggg	p.R420G	AC008738.2_ENST00000577275.1_RNA|WDR88_ENST00000361680.2_3'UTR|CTD-2540B15.10_ENST00000590117.1_RNA	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	420								p.R420G(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					AAGATGTGACAGGCCTTTCTC	0.478																																					p.R420G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1258G	19						.						167.0	162.0	164.0					19																	33666317		2203	4300	6503	38358157	SO:0001583	missense	126248	exon11			BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.1258A>G	19.37:g.33666317A>G	ENSP00000348129:p.Arg420Gly	Somatic		Capture	Illumina HiSeq	Phase_I	38358157	NM_173479	Q8NEF8	Missense_Mutation	SNP	ENST00000355868.3	37	CCDS12429.1	.	.	.	.	.	.	.	.	.	.	A	11.03	1.520225	0.27211	.	.	ENSG00000166359	ENST00000355868	T	0.57595	0.39	4.92	3.88	0.44766	.	0.949995	0.08743	N	0.900167	T	0.39600	0.1084	L	0.40543	1.245	0.25453	N	0.987983	P	0.38922	0.651	B	0.27887	0.084	T	0.22661	-1.0210	10	0.52906	T	0.07	.	8.3637	0.32374	0.7902:0.2098:0.0:0.0	.	420	Q6ZMY6	WDR88_HUMAN	G	420	ENSP00000348129:R420G	ENSP00000348129:R420G	R	+	1	2	WDR88	38358157	0.984000	0.35163	0.845000	0.33349	0.388000	0.30384	1.410000	0.34691	0.878000	0.35920	0.459000	0.35465	AGG		0.478	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450840.1	NM_173479	
SIGLEC7	27036	broad.mit.edu	37	19	51647931	51647931	+	Silent	SNP	C	C	G			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr19:51647931C>G	ENST00000317643.6	+	2	771	c.702C>G	c.(700-702)ctC>ctG	p.L234L	SIGLEC7_ENST00000305628.7_Intron|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	234					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.L234L(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		CCATCCAACTCAATGTGTCCT	0.652																																					p.L234L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C702G	19						.						48.0	44.0	45.0					19																	51647931		2203	4300	6503	56339743	SO:0001819	synonymous_variant	27036	exon2			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.702C>G	19.37:g.51647931C>G		Somatic		Capture	Illumina HiSeq	Phase_I	56339743	NM_014385	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	ENST00000317643.6	37	CCDS12826.1																																																																																				0.652	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543	
COL11A1	1301	broad.mit.edu	37	1	103480147	103480147	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:103480147G>A	ENST00000370096.3	-	13	1804	c.1492C>T	c.(1492-1494)Cgt>Tgt	p.R498C	COL11A1_ENST00000512756.1_Missense_Mutation_p.R382C|COL11A1_ENST00000358392.2_Missense_Mutation_p.R510C|COL11A1_ENST00000353414.4_Missense_Mutation_p.R459C	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	498	Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.R510C(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCACCATAACGGAACTTGGAA	0.393																																					p.R498C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1492T	1						.						75.0	67.0	70.0					1																	103480147		2203	4299	6502	103252735	SO:0001583	missense	1301	exon13			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1492C>T	1.37:g.103480147G>A	ENSP00000359114:p.Arg498Cys	Somatic		Capture	Illumina HiSeq	Phase_I	103252735	NM_001854	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371528	0.61624	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.88818	-2.42;-2.43;-2.41;-1.74;-1.74	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.93644	0.7970	M	0.80028	2.48	0.80722	D	1	D;D;D;D	0.89917	0.997;0.999;1.0;0.999	P;P;P;P	0.62014	0.649;0.855;0.897;0.719	D	0.93843	0.7138	10	0.72032	D	0.01	.	19.5815	0.95469	0.0:0.0:1.0:0.0	.	382;459;510;498	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	C	498;510;459;382;510	ENSP00000359114:R498C;ENSP00000351163:R510C;ENSP00000302551:R459C;ENSP00000426533:R382C;ENSP00000408640:R510C	ENSP00000302551:R459C	R	-	1	0	COL11A1	103252735	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	4.081000	0.57627	2.620000	0.88729	0.655000	0.94253	CGT		0.393	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
BRINP2	57795	broad.mit.edu	37	1	177249695	177249695	+	Silent	SNP	C	C	T	rs199990562	byFrequency	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:177249695C>T	ENST00000361539.4	+	8	1695	c.1383C>T	c.(1381-1383)ggC>ggT	p.G461G	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	461					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.G461G(1)									GTGCCTTGGGCGAAGGGCCCG	0.642													C|||	4	0.000798722	0.0	0.0	5008	,	,		17664	0.003		0.0	False		,,,				2504	0.001				p.G461G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1383T	1						.						38.0	36.0	37.0					1																	177249695		2203	4300	6503	175516318	SO:0001819	synonymous_variant	57795	exon8				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1383C>T	1.37:g.177249695C>T		Somatic		Capture	Illumina HiSeq	Phase_I	175516318	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	37	CCDS1320.1																																																																																				0.642	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
RYR2	6262	broad.mit.edu	37	1	237670041	237670041	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:237670041G>T	ENST00000366574.2	+	23	2962	c.2645G>T	c.(2644-2646)aGa>aTa	p.R882I	RYR2_ENST00000542537.1_Missense_Mutation_p.R866I|RYR2_ENST00000360064.6_Missense_Mutation_p.R880I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	882	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R880I(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAAGAATAAGAGAAAAACTG	0.353																																					p.R882I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2645T	1						.						95.0	94.0	95.0					1																	237670041		1817	4080	5897	235736664	SO:0001583	missense	6262	exon23			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2645G>T	1.37:g.237670041G>T	ENSP00000355533:p.Arg882Ile	Somatic		Capture	Illumina HiSeq	Phase_I	235736664	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.009894	0.93346	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91180	-2.8;-2.8;-2.8	5.49	5.49	0.81192	Ryanodine receptor Ryr (1);	0.000000	0.64402	D	0.000002	D	0.93403	0.7896	L	0.41632	1.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93244	0.6629	10	0.49607	T	0.09	.	19.3546	0.94407	0.0:0.0:1.0:0.0	.	882	Q92736	RYR2_HUMAN	I	882;880;866	ENSP00000355533:R882I;ENSP00000353174:R880I;ENSP00000443798:R866I	ENSP00000353174:R880I	R	+	2	0	RYR2	235736664	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.568000	0.86640	0.585000	0.79938	AGA		0.353	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
ZMYM6	9204	broad.mit.edu	37	1	35474490	35474490	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:35474490G>A	ENST00000357182.4	-	11	1755	c.1528C>T	c.(1528-1530)Cga>Tga	p.R510*	ZMYM6_ENST00000373340.2_Nonsense_Mutation_p.R510*|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000487874.1_Nonsense_Mutation_p.R510*	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	510					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R510*(2)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTTCCCCATCGTTCTCCAAAG	0.403																																					p.R510X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|endometrium(1)	c.C1528T	1						.						100.0	99.0	100.0					1																	35474490		2203	4300	6503	35247077	SO:0001587	stop_gained	9204	exon11			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.1528C>T	1.37:g.35474490G>A	ENSP00000349708:p.Arg510*	Somatic		Capture	Illumina HiSeq	Phase_I	35247077	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Nonsense_Mutation	SNP	ENST00000357182.4	37	CCDS387.2	.	.	.	.	.	.	.	.	.	.	G	40	8.404019	0.98796	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	.	.	.	4.94	1.94	0.25998	.	0.251140	0.31381	N	0.007744	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.1303	7.8142	0.29249	0.0732:0.0:0.4979:0.4289	.	.	.	.	X	510	.	ENSP00000349708:R510X	R	-	1	2	ZMYM6	35247077	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	3.359000	0.52292	0.324000	0.23333	-0.175000	0.13238	CGA		0.403	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
ZMYM6	9204	broad.mit.edu	37	1	35476176	35476176	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:35476176C>T	ENST00000357182.4	-	10	1591	c.1364G>A	c.(1363-1365)gGc>gAc	p.G455D	ZMYM6_ENST00000373340.2_Missense_Mutation_p.G455D|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000487874.1_Missense_Mutation_p.G455D	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	455					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G455D(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				GCAATTCTTGCCACAAAACAG	0.358																																					p.G455D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1364A	1						.						115.0	112.0	113.0					1																	35476176		2203	4300	6503	35248763	SO:0001583	missense	9204	exon10			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.1364G>A	1.37:g.35476176C>T	ENSP00000349708:p.Gly455Asp	Somatic		Capture	Illumina HiSeq	Phase_I	35248763	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	37	CCDS387.2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636625	0.87760	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	T;T	0.25085	1.82;2.96	5.13	5.13	0.70059	TRASH (1);Zinc finger, MYM-type (1);	0.106801	0.64402	D	0.000005	T	0.49253	0.1546	M	0.72118	2.19	0.41455	D	0.988008	P;D;D	0.53885	0.942;0.963;0.959	P;D;P	0.64410	0.76;0.925;0.84	T	0.29671	-1.0004	10	0.32370	T	0.25	-1.3209	18.1025	0.89510	0.0:1.0:0.0:0.0	.	358;455;455	B4DWC0;O95789;O95789-1	.;ZMYM6_HUMAN;.	D	455	ENSP00000362437:G455D;ENSP00000349708:G455D	ENSP00000349708:G455D	G	-	2	0	ZMYM6	35248763	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.066000	0.57520	2.819000	0.97034	0.650000	0.86243	GGC		0.358	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
RSPO1	284654	broad.mit.edu	37	1	38079564	38079564	+	Splice_Site	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:38079564G>A	ENST00000401069.1	-	6	1149	c.437C>T	c.(436-438)gCg>gTg	p.A146V	RSPO1_ENST00000373059.1_Splice_Site_p.A119V|RSPO1_ENST00000401068.1_Splice_Site_p.A146V|RSPO1_ENST00000356545.2_Splice_Site_p.A146V|RSPO1_ENST00000401070.1_Intron|RSPO1_ENST00000401071.2_Intron	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	146					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.A146E(1)|p.A146V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTCACATTGCGCTGGCAGGAA	0.612																																					p.A146V	GBM(122;680 2230 27822 42821)											.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C437T	1						.						45.0	48.0	47.0					1																	38079564		1958	4145	6103	37852151	SO:0001630	splice_region_variant	284654	exon7			AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.437-1C>T	1.37:g.38079564G>A		Somatic		Capture	Illumina HiSeq	Phase_I	37852151	NM_001038633	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Missense_Mutation	SNP	ENST00000401069.1	37	CCDS41304.1	.	.	.	.	.	.	.	.	.	.	G	3.924	-0.017458	0.07681	.	.	ENSG00000169218	ENST00000373059;ENST00000356545;ENST00000401069;ENST00000401068	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.43	3.49	0.39957	Growth factor, receptor (1);	0.115294	0.64402	D	0.000018	T	0.23926	0.0579	N	0.01009	-1.055	0.80722	D	1	B;B	0.21147	0.052;0.018	B;B	0.15870	0.014;0.006	T	0.31668	-0.9935	10	0.02654	T	1	.	7.636	0.28267	0.143:0.1349:0.7221:0.0	.	119;146	Q2MKA7-2;Q2MKA7	.;RSPO1_HUMAN	V	119;146;146;146	ENSP00000362150:A119V;ENSP00000348944:A146V;ENSP00000383847:A146V;ENSP00000383846:A146V	ENSP00000348944:A146V	A	-	2	0	RSPO1	37852151	1.000000	0.71417	0.998000	0.56505	0.800000	0.45204	2.574000	0.46016	1.291000	0.44653	-0.137000	0.14449	GCG		0.612	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640	Missense_Mutation
MED8	112950	broad.mit.edu	37	1	43852552	43852552	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:43852552G>A	ENST00000372457.4	-	4	431	c.388C>T	c.(388-390)Cgc>Tgc	p.R130C	MED8_ENST00000372455.4_Missense_Mutation_p.R41C|RP1-92O14.6_ENST00000436713.1_RNA|MED8_ENST00000290663.6_Missense_Mutation_p.R130C	NM_001001653.2|NM_201542.3	NP_001001653.1|NP_963836.2	Q96G25	MED8_HUMAN	mediator complex subunit 8	130					gene expression (GO:0010467)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.R41C(1)|p.R130C(1)		endometrium(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	9	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCACCAATGCGGGCAGCATCT	0.542																																					p.R130C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C388T	1						.						154.0	131.0	139.0					1																	43852552		2203	4300	6503	43625139	SO:0001583	missense	112950	exon4			AF521562, BC010543	CCDS486.2, CCDS487.2, CCDS60108.1	1p34.1	2008-02-05	2007-07-30		ENSG00000159479	ENSG00000159479			19971	protein-coding gene	gene with protein product		607956	"""mediator of RNA polymerase II transcription, subunit 8 homolog (S. cerevisiae)"""			12149480, 9671713	Standard	NM_052877		Approved	MGC17544, MGC19641, ARC32	uc001cje.2	Q96G25	OTTHUMG00000007421	ENST00000372457.4:c.388C>T	1.37:g.43852552G>A	ENSP00000361535:p.Arg130Cys	Somatic		Capture	Illumina HiSeq	Phase_I	43625139	NM_052877	A9IZ91|A9IZ92|Q5JUY8|Q96FQ4	Missense_Mutation	SNP	ENST00000372457.4	37	CCDS487.2	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735015	0.48939	.	.	ENSG00000159479	ENST00000290663;ENST00000372457;ENST00000372455	.	.	.	5.67	4.69	0.59074	.	0.048489	0.85682	N	0.000000	T	0.75019	0.3793	M	0.72118	2.19	0.80722	D	1	B;D	0.76494	0.081;0.999	B;P	0.60173	0.019;0.87	T	0.77973	-0.2386	9	0.62326	D	0.03	-0.2749	14.9364	0.70960	0.0:0.0:0.816:0.184	.	130;130	Q96G25;Q96G25-2	MED8_HUMAN;.	C	130;130;41	.	ENSP00000290663:R130C	R	-	1	0	MED8	43625139	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.434000	0.66526	1.193000	0.43086	0.655000	0.94253	CGC		0.542	MED8-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318959.1	NM_052877	
TNNI3K	51086	broad.mit.edu	37	1	75009634	75009634	+	Nonsense_Mutation	SNP	C	C	T	rs201614312		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:75009634C>T	ENST00000326637.3	+	25	2527	c.2476C>T	c.(2476-2478)Cga>Tga	p.R826*	TNNI3K_ENST00000370891.2_Nonsense_Mutation_p.R927*|TNNI3K_ENST00000465473.1_3'UTR|FPGT-TNNI3K_ENST00000557284.2_Nonsense_Mutation_p.R940*	NM_015978.2	NP_057062.1			TNNI3 interacting kinase									p.R826*(1)		cervix(1)|endometrium(3)|kidney(5)|large_intestine(21)|lung(31)|ovary(4)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	76						TCATTCTTGCCGAAATAGTAG	0.453																																					p.R826X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2476T	1						.						135.0	114.0	121.0					1																	75009634		2203	4300	6503	74782222	SO:0001587	stop_gained	51086	exon25			AF116826	CCDS664.1, CCDS44161.1	1p31.1	2014-09-17				ENSG00000116783			19661	protein-coding gene	gene with protein product		613932				12721663	Standard	NM_015978		Approved	CARK		Q59H18	OTTHUMG00000171318	ENST00000326637.3:c.2476C>T	1.37:g.75009634C>T	ENSP00000322251:p.Arg826*	Somatic		Capture	Illumina HiSeq	Phase_I	74782222	NM_015978		Nonsense_Mutation	SNP	ENST00000326637.3	37	CCDS664.1	.	.	.	.	.	.	.	.	.	.	C	34	5.319052	0.95682	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	.	.	.	5.32	3.16	0.36331	.	0.330749	0.31347	N	0.007818	.	.	.	.	.	.	0.49051	D	0.999741	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6801	0.17771	0.2814:0.6195:0.0:0.0991	.	.	.	.	X	927;927;826	.	ENSP00000322251:R826X	R	+	1	2	RP11-653A5.2;AC093158.1	74782222	0.998000	0.40836	0.964000	0.40570	0.282000	0.26991	1.995000	0.40767	1.377000	0.46286	0.561000	0.74099	CGA		0.453	TNNI3K-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026432.1	NM_015978	
PGBD2	267002	broad.mit.edu	37	1	249210979	249210979	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr1:249210979C>T	ENST00000329291.5	+	3	343	c.196C>T	c.(196-198)Cga>Tga	p.R66*	PGBD2_ENST00000355360.4_Intron|PGBD2_ENST00000539153.1_Nonsense_Mutation_p.R63*|PGBD2_ENST00000462488.1_Intron	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	66								p.R66*(1)		NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGACAGCCAGCGAGGTGCTCA	0.562																																					p.R66X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C196T	1						.						75.0	68.0	70.0					1																	249210979		2203	4300	6503	247177602	SO:0001587	stop_gained	267002	exon3			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.196C>T	1.37:g.249210979C>T	ENSP00000331643:p.Arg66*	Somatic		Capture	Illumina HiSeq	Phase_I	247177602	NM_170725	B3KVR8|Q6MZF8	Nonsense_Mutation	SNP	ENST00000329291.5	37	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005404	0.74932	.	.	ENSG00000185220	ENST00000329291;ENST00000539153	.	.	.	3.84	0.508	0.16972	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	4.0402	0.09748	0.4139:0.4685:0.0:0.1175	.	.	.	.	X	66;63	.	ENSP00000331643:R66X	R	+	1	2	PGBD2	247177602	0.001000	0.12720	0.001000	0.08648	0.025000	0.11179	0.944000	0.29043	0.374000	0.24650	0.655000	0.94253	CGA		0.562	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
MACROD2	140733	broad.mit.edu	37	20	15210668	15210668	+	Silent	SNP	A	A	G	rs368006162		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr20:15210668A>G	ENST00000310348.4	+	6	501	c.501A>G	c.(499-501)tcA>tcG	p.S167S	MACROD2_ENST00000402914.1_5'UTR|MACROD2_ENST00000217246.4_Silent_p.S167S			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	167	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.S167S(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GCTATAAATCATCTCTGAAGC	0.353																																					p.S167S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A501G	20						.	A	,	0,3630		0,0,1815	104.0	96.0	99.0		,501	1.8	1.0	20		99	1,8133		0,1,4066	no	utr-5,coding-synonymous	MACROD2	NM_001033087.1,NM_080676.5	,	0,1,5881	GG,GA,AA		0.0123,0.0,0.0085	,	,167/426	15210668	1,11763	1815	4067	5882	15158668	SO:0001819	synonymous_variant	140733	exon6			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.501A>G	20.37:g.15210668A>G		Somatic		Capture	Illumina HiSeq	Phase_I	15158668	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Silent	SNP	ENST00000310348.4	37	CCDS13120.2																																																																																				0.353	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
CHD6	84181	broad.mit.edu	37	20	40116325	40116325	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr20:40116325C>T	ENST00000373233.3	-	14	2158	c.1981G>A	c.(1981-1983)Gat>Aat	p.D661N	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	661	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.D661N(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GTTTTCAGATCTCCAAATTCC	0.453																																					p.D661N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1981A	20						.						103.0	105.0	104.0					20																	40116325		2203	4300	6503	39549739	SO:0001583	missense	84181	exon14			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.1981G>A	20.37:g.40116325C>T	ENSP00000362330:p.Asp661Asn	Somatic		Capture	Illumina HiSeq	Phase_I	39549739	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	35	5.500834	0.96371	.	.	ENSG00000124177	ENST00000373233	D	0.93189	-3.18	5.48	5.48	0.80851	SNF2-related (1);	0.000000	0.56097	D	0.000028	D	0.94928	0.8360	L	0.41356	1.27	0.80722	D	1	P	0.37500	0.597	P	0.55615	0.78	D	0.94413	0.7633	10	0.56958	D	0.05	-17.7117	19.7157	0.96119	0.0:1.0:0.0:0.0	.	661	Q8TD26	CHD6_HUMAN	N	661	ENSP00000362330:D661N	ENSP00000362330:D661N	D	-	1	0	CHD6	39549739	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.867000	0.69597	2.749000	0.94314	0.655000	0.94253	GAT		0.453	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
CSTF1	1477	broad.mit.edu	37	20	54974209	54974209	+	Missense_Mutation	SNP	G	G	A	rs140246355		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr20:54974209G>A	ENST00000217109.4	+	5	1184	c.832G>A	c.(832-834)Gta>Ata	p.V278I	CSTF1_ENST00000493039.1_3'UTR	NM_001033521.1|NM_001324.2	NP_001028693.1|NP_001315.1	Q05048	CSTF1_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	278					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V278I(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	15			Colorectal(105;0.202)			CAATATGTACGTAACTGGAAG	0.398													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20948	0.0		0.0	False		,,,				2504	0.0				p.V278I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G832A	20						.	G	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	191.0	169.0	176.0		832,832,832	5.6	0.9	20	dbSNP_134	176	1,8599		0,1,4299	no	missense,missense,missense	CSTF1	NM_001033521.1,NM_001033522.1,NM_001324.2	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	278/432,278/432,278/432	54974209	1,13005	2203	4300	6503	54407616	SO:0001583	missense	1477	exon5				CCDS13452.1	20q13.31	2013-01-10	2002-08-29		ENSG00000101138	ENSG00000101138		"""WD repeat domain containing"""	2483	protein-coding gene	gene with protein product		600369	"""cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kD"""			1358884, 11257228	Standard	NM_001033521		Approved		uc002xxl.1	Q05048	OTTHUMG00000032791	ENST00000217109.4:c.832G>A	20.37:g.54974209G>A	ENSP00000217109:p.Val278Ile	Somatic		Capture	Illumina HiSeq	Phase_I	54407616	NM_001033521	Q5QPD8	Missense_Mutation	SNP	ENST00000217109.4	37	CCDS13452.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771783	0.90108	0.0	1.16E-4	ENSG00000101138	ENST00000415828;ENST00000217109;ENST00000425890;ENST00000452950	T;T;T	0.61158	0.13;0.13;0.13	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54062	0.1835	L	0.42632	1.34	0.80722	D	1	P	0.46912	0.886	B	0.40038	0.317	T	0.58803	-0.7572	10	0.56958	D	0.05	3.6282	20.0572	0.97657	0.0:0.0:1.0:0.0	.	278	Q05048	CSTF1_HUMAN	I	278;278;265;278	ENSP00000387968:V278I;ENSP00000217109:V278I;ENSP00000409035:V278I	ENSP00000217109:V278I	V	+	1	0	CSTF1	54407616	1.000000	0.71417	0.854000	0.33618	0.988000	0.76386	9.604000	0.98317	2.826000	0.97356	0.655000	0.94253	GTA		0.398	CSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079794.2	NM_001033521	
KRTAP6-2	337967	broad.mit.edu	37	21	31971050	31971050	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr21:31971050G>T	ENST00000334897.3	-	1	169	c.144C>A	c.(142-144)ttC>ttA	p.F48L	KRTAP22-1_ENST00000334680.2_5'Flank	NM_181604.1	NP_853635.1	Q3LI66	KRA62_HUMAN	keratin associated protein 6-2	48						intermediate filament (GO:0005882)		p.F48L(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11						AGCCACAGAAGAAGCGGGAGC	0.552																																					p.F48L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C144A	21						.						78.0	70.0	73.0					21																	31971050		2203	4300	6503	30892921	SO:0001583	missense	337967	exon1			AP001708	CCDS13600.1	21q22.1	2011-02-10			ENSG00000186930	ENSG00000186930		"""Keratin associated proteins"""	18932	protein-coding gene	gene with protein product						12359730	Standard	NM_181604		Approved	KAP6.2	uc011adc.2	Q3LI66	OTTHUMG00000057794	ENST00000334897.3:c.144C>A	21.37:g.31971050G>T	ENSP00000334560:p.Phe48Leu	Somatic		Capture	Illumina HiSeq	Phase_I	30892921	NM_181604		Missense_Mutation	SNP	ENST00000334897.3	37	CCDS13600.1	.	.	.	.	.	.	.	.	.	.	G	1.840	-0.467583	0.04476	.	.	ENSG00000186930	ENST00000334897	T	0.10668	2.85	3.56	-3.4	0.04853	.	1.236910	0.06829	N	0.793671	T	0.07098	0.0180	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.42799	-0.9430	9	0.87932	D	0	.	3.0169	0.06063	0.3146:0.0:0.3401:0.3453	.	48	Q3LI66	KRA62_HUMAN	L	48	ENSP00000334560:F48L	ENSP00000334560:F48L	F	-	3	2	KRTAP6-2	30892921	0.000000	0.05858	0.002000	0.10522	0.037000	0.13140	-0.505000	0.06367	-0.694000	0.05113	-0.334000	0.08254	TTC		0.552	KRTAP6-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128246.3		
CRYBB3	1417	broad.mit.edu	37	22	25598691	25598691	+	Silent	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr22:25598691G>A	ENST00000215855.2	+	3	206	c.126G>A	c.(124-126)tcG>tcA	p.S42S	CRYBB3_ENST00000404334.1_Silent_p.S42S	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	42	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.S42S(1)		large_intestine(2)|lung(2)|prostate(1)	5						GCGAGCTCTCGGCCGAGTGCC	0.602											OREG0026423	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S42S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G126A	22						.						68.0	65.0	66.0					22																	25598691		2203	4300	6503	23928691	SO:0001819	synonymous_variant	1417	exon3				CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.126G>A	22.37:g.25598691G>A		Somatic	780	Capture	Illumina HiSeq	Phase_I	23928691	NM_004076	Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Silent	SNP	ENST00000215855.2	37	CCDS13830.1																																																																																				0.602	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1	NM_004076	
PKDREJ	10343	broad.mit.edu	37	22	46658494	46658494	+	Silent	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr22:46658494G>A	ENST00000253255.5	-	1	725	c.726C>T	c.(724-726)aaC>aaT	p.N242N		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	242	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.N242N(1)		NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GCACCGAGGCGTTGATGGTGG	0.697																																					p.N242N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C726T	22						.						24.0	26.0	26.0					22																	46658494		2203	4299	6502	45037158	SO:0001819	synonymous_variant	10343	exon1			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.726C>T	22.37:g.46658494G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45037158	NM_006071	B1AJY3|O95850	Silent	SNP	ENST00000253255.5	37	CCDS14073.1																																																																																				0.697	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
ATRAID	51374	broad.mit.edu	37	2	27438211	27438211	+	Silent	SNP	C	C	T	rs142014101		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr2:27438211C>T	ENST00000606999.1	+	3	302	c.244C>T	c.(244-246)Ctg>Ttg	p.L82L	CAD_ENST00000264705.4_5'Flank|ATRAID_ENST00000405489.3_Silent_p.L24L|CAD_ENST00000403525.1_5'Flank|ATRAID_ENST00000380171.3_Silent_p.L137L	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor	82					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.L137L(1)									GAACTGTTCTCTGGAGGACCC	0.423																																					p.L137L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C409T	2						.	C	,,	0,4406		0,0,2203	95.0	87.0	89.0		244,70,409	4.8	1.0	2	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	C2orf28	NM_001170795.1,NM_016085.4,NM_080592.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	82/230,24/172,137/285	27438211	1,13005	2203	4300	6503	27291715	SO:0001819	synonymous_variant	51374	exon3			BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405	ENST00000606999.1:c.244C>T	2.37:g.27438211C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27291715	NM_080592	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Silent	SNP	ENST00000606999.1	37																																																																																					0.423	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470709.1	NM_016085	
PCYOX1	51449	broad.mit.edu	37	2	70486539	70486539	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr2:70486539C>T	ENST00000433351.2	+	2	188	c.160C>T	c.(160-162)Cgg>Tgg	p.R54W	PCYOX1_ENST00000545138.1_5'UTR|PCYOX1_ENST00000264441.5_Missense_Mutation_p.R54W|PCYOX1_ENST00000505044.2_5'UTR	NM_016297.3	NP_057381.3	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1	54					prenylated protein catabolic process (GO:0030327)|prenylcysteine catabolic process (GO:0030328)|prenylcysteine metabolic process (GO:0030329)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	chloride-transporting ATPase activity (GO:0008555)|prenylcysteine oxidase activity (GO:0001735)	p.R54W(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)	15						CTATTACCTGCGGCAGAAATT	0.483																																					p.R54W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C160T	2						.						163.0	186.0	178.0					2																	70486539		2203	4300	6503	70340043	SO:0001583	missense	51449	exon2			AB020715	CCDS1902.1	2p13.3	2008-02-05			ENSG00000116005	ENSG00000116005	1.8.3.5		20588	protein-coding gene	gene with protein product		610995				10585463, 12186880	Standard	NM_016297		Approved	KIAA0908, PCL1	uc002sgn.4	Q9UHG3	OTTHUMG00000129671	ENST00000433351.2:c.160C>T	2.37:g.70486539C>T	ENSP00000387654:p.Arg54Trp	Somatic		Capture	Illumina HiSeq	Phase_I	70340043	NM_016297	B2RB14|B7Z9P8|O94982|Q8N4N5|Q96QM8	Missense_Mutation	SNP	ENST00000433351.2	37	CCDS1902.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124939	0.77436	.	.	ENSG00000116005	ENST00000433351;ENST00000264441	D;D	0.82711	-1.64;-1.64	5.39	4.51	0.55191	FAD dependent oxidoreductase (1);	0.048531	0.85682	D	0.000000	D	0.93022	0.7779	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94702	0.7884	10	0.87932	D	0	-17.5946	14.5541	0.68089	0.1468:0.8532:0.0:0.0	.	54;54	B7Z8A2;Q9UHG3	.;PCYOX_HUMAN	W	54	ENSP00000387654:R54W;ENSP00000264441:R54W	ENSP00000264441:R54W	R	+	1	2	PCYOX1	70340043	1.000000	0.71417	0.998000	0.56505	0.888000	0.51559	3.621000	0.54210	1.475000	0.48197	0.655000	0.94253	CGG		0.483	PCYOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251872.3	NM_016297	
ABCB6	10058	broad.mit.edu	37	2	220078019	220078020	+	Missense_Mutation	DNP	AA	AA	GG			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	AA	AA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr2:220078019_220078020AA>GG	ENST00000265316.3	-	12	2064_2065	c.1748_1749TT>CC	c.(1747-1749)cTT>cCC	p.L583P	ABCB6_ENST00000439002.2_Missense_Mutation_p.L537P	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	583					brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)	p.L583>?(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTGAAAGCGAAGGGGCCCTGC	0.525																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1748_1749CC	2						.																																			219786264	SO:0001583	missense	10058	exon12			AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.1748_1749delinsGG	2.37:g.220078019_220078020delinsGG	ENSP00000265316:p.Leu583Pro	Somatic		Capture	Illumina HiSeq	Phase_I	219786263	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	DNP	ENST00000265316.3	37	CCDS2436.1																																																																																				0.525	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047R	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,breast,NS,Substitution - Missense,0 	.	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140G	3						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	180434779	SO:0001583	missense	5290	exon21				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		Capture	Illumina HiSeq	Phase_I	180434779	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
TPRG1	285386	broad.mit.edu	37	3	188956657	188956657	+	Silent	SNP	C	C	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:188956657C>A	ENST00000345063.3	+	4	605	c.438C>A	c.(436-438)atC>atA	p.I146I	TPRG1-AS2_ENST00000425454.1_RNA|TPRG1_ENST00000433971.1_Silent_p.I146I	NM_198485.3	NP_940887.1	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	146						cytoplasm (GO:0005737)		p.I146I(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|skin(2)|urinary_tract(1)	16	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		TCTATCGCATCTGCCTGGGCA	0.498																																					p.I146I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C438A	3						.						128.0	118.0	121.0					3																	188956657		2203	4300	6503	190439351	SO:0001819	synonymous_variant	285386	exon4			AK125682	CCDS3292.1	3q28	2008-02-04	2008-01-16	2008-01-16	ENSG00000188001	ENSG00000188001			24759	protein-coding gene	gene with protein product			"""family with sequence similarity 79, member B"""	FAM79B			Standard	NM_198485		Approved	FLJ41238, FLJ43694	uc003frw.2	Q6ZUI0	OTTHUMG00000156321	ENST00000345063.3:c.438C>A	3.37:g.188956657C>A		Somatic		Capture	Illumina HiSeq	Phase_I	190439351	NM_198485		Silent	SNP	ENST00000345063.3	37	CCDS3292.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.685112	0.47991	.	.	ENSG00000188001	ENST00000425670	.	.	.	5.74	4.86	0.63082	.	.	.	.	.	T	0.57227	0.2039	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53620	-0.8413	4	.	.	.	-9.7864	7.0044	0.24828	0.1737:0.7409:0.0:0.0854	.	.	.	.	M	74	.	.	L	+	1	2	TPRG1	190439351	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.745000	0.38278	2.873000	0.98535	0.563000	0.77884	CTG		0.498	TPRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343931.1	NM_198485	
TP63	8626	broad.mit.edu	37	3	189586404	189586404	+	Missense_Mutation	SNP	G	G	A	rs121908841		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:189586404G>A	ENST00000264731.3	+	8	1117	c.1028G>A	c.(1027-1029)cGg>cAg	p.R343Q	TP63_ENST00000440651.2_Missense_Mutation_p.R343Q|TP63_ENST00000449992.1_Missense_Mutation_p.R164Q|TP63_ENST00000392463.2_Missense_Mutation_p.R249Q|TP63_ENST00000456148.1_Missense_Mutation_p.R249Q|TP63_ENST00000392461.3_Missense_Mutation_p.R249Q|TP63_ENST00000382063.4_Missense_Mutation_p.R258Q|TP63_ENST00000392460.3_Missense_Mutation_p.R343Q|TP63_ENST00000418709.2_Missense_Mutation_p.R343Q|TP63_ENST00000320472.5_Missense_Mutation_p.R343Q|TP63_ENST00000354600.5_Missense_Mutation_p.R249Q|TP63_ENST00000437221.1_Missense_Mutation_p.R249Q	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	343			R -> Q (in EEC3). {ECO:0000269|PubMed:10839977, ECO:0000269|PubMed:11462173}.|R -> W (in EEC3). {ECO:0000269|PubMed:11462173}.		apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)	p.R343Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TTTGAGGCCCGGATCTGTGCT	0.488										HNSCC(45;0.13)																											p.R249Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G746A	3	GRCh37	CM001823|CM030108	TP63	M	rs121908841	.						72.0	71.0	71.0					3																	189586404		2203	4300	6503	191069098	SO:0001583	missense	8626	exon6			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1028G>A	3.37:g.189586404G>A	ENSP00000264731:p.Arg343Gln	Somatic		Capture	Illumina HiSeq	Phase_I	191069098	NM_001114980	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	G	33	5.216117	0.95104	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	5.83	5.83	0.93111	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.89904	3.07	0.80722	A	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;0.999;1.0;0.999;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D;D	0.75484	0.977;0.927;0.977;0.957;0.977;0.957;0.975;0.982;0.986;0.957	D	0.96931	0.9681	8	.	.	.	-15.0836	19.1141	0.93331	0.0:0.0:1.0:0.0	.	164;343;343;249;249;249;249;343;343;343	Q9H3D4-10;Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;.;P63_HUMAN;.	Q	343;343;343;343;343;258;249;249;249;249;164;249	ENSP00000264731:R343Q;ENSP00000407144:R343Q;ENSP00000317510:R343Q;ENSP00000376253:R343Q;ENSP00000394337:R343Q;ENSP00000371495:R258Q;ENSP00000346614:R249Q;ENSP00000392488:R249Q;ENSP00000376256:R249Q;ENSP00000376254:R249Q;ENSP00000387839:R164Q;ENSP00000389485:R249Q	.	R	+	2	0	TP63	191069098	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.700000	0.98707	2.749000	0.94314	0.655000	0.94253	CGG		0.488	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
CTNNB1	1499	broad.mit.edu	37	3	41266689	41266689	+	Missense_Mutation	SNP	C	C	A	rs5743392	byFrequency	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:41266689C>A	ENST00000349496.5	+	4	766	c.486C>A	c.(484-486)gaC>gaA	p.D162E	CTNNB1_ENST00000396183.3_Missense_Mutation_p.D162E|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D162E|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D155E|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D162E	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	162	Interaction with BCL9.				adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.M1_V173del(1)|p.D162E(1)|p.I35_K170del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGCTAAATGACGAGGACCAGG	0.413		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D162E	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	.	3	Deletion - In frame(2)|Substitution - Missense(1)	large_intestine(1)|liver(1)|skin(1)	c.C486A	3						.						116.0	109.0	112.0					3																	41266689		2203	4300	6503	41241693	SO:0001583	missense	1499	exon4	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.486C>A	3.37:g.41266689C>A	ENSP00000344456:p.Asp162Glu	Somatic		Capture	Illumina HiSeq	Phase_I	41241693	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037970	0.35989	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34	5.7	-9.57	0.00562	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59689	0.2212	M	0.70595	2.14	0.80722	D	1	B;B	0.24483	0.07;0.104	B;B	0.24269	0.052;0.033	T	0.41502	-0.9505	10	0.54805	T	0.06	-11.5956	17.8144	0.88627	0.0:0.5637:0.0:0.4363	.	90;162	B4DSW9;P35222	.;CTNB1_HUMAN	E	162;162;162;155;162	ENSP00000385604:D162E;ENSP00000379486:D162E;ENSP00000344456:D162E;ENSP00000411226:D155E;ENSP00000379488:D162E	ENSP00000344456:D162E	D	+	3	2	CTNNB1	41241693	0.573000	0.26676	0.165000	0.22776	0.828000	0.46876	-0.237000	0.08990	-2.191000	0.00756	-1.728000	0.00702	GAC		0.413	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
ZKSCAN7	55888	broad.mit.edu	37	3	44612304	44612304	+	Nonsense_Mutation	SNP	C	C	T	rs200003223		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:44612304C>T	ENST00000273320.3	+	6	2131	c.1702C>T	c.(1702-1704)Cga>Tga	p.R568*	ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000426540.1_Nonsense_Mutation_p.R568*|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	568					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R568*(1)									ATGTCTTATTCGACATCAGAG	0.433																																					p.R568X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1702T	3						.	C	stop/ARG,	0,4406		0,0,2203	90.0	91.0	90.0		1702,	3.3	1.0	3		90	1,8599		0,1,4299	no	stop-gained,intron	ZNF167	NM_018651.2,NM_025169.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	568/755,	44612304	1,13005	2203	4300	6503	44587308	SO:0001587	stop_gained	55888	exon6			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1702C>T	3.37:g.44612304C>T	ENSP00000273320:p.Arg568*	Somatic		Capture	Illumina HiSeq	Phase_I	44587308	NM_018651	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Nonsense_Mutation	SNP	ENST00000273320.3	37	CCDS2715.1	.	.	.	.	.	.	.	.	.	.	.	38	7.137541	0.98088	0.0	1.16E-4	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000315777	.	.	.	4.21	3.29	0.37713	.	0.348037	0.16505	N	0.211495	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-4.0189	10.3669	0.44030	0.3844:0.6156:0.0:0.0	.	.	.	.	X	568;568;6	.	ENSP00000273320:R568X	R	+	1	2	ZNF167	44587308	0.000000	0.05858	1.000000	0.80357	0.895000	0.52256	-0.426000	0.07008	2.189000	0.69895	0.655000	0.94253	CGA		0.433	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
FOXP1	27086	broad.mit.edu	37	3	71021817	71021817	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:71021817C>T	ENST00000318789.4	-	18	2066	c.1541G>A	c.(1540-1542)cGt>cAt	p.R514H	FOXP1_ENST00000484350.1_Missense_Mutation_p.R438H|FOXP1_ENST00000468577.1_Intron|FOXP1_ENST00000475937.1_Missense_Mutation_p.R514H|FOXP1_ENST00000498215.1_Missense_Mutation_p.R514H|FOXP1_ENST00000491238.1_Missense_Mutation_p.R516H|FOXP1_ENST00000493089.1_Missense_Mutation_p.R513H	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	514					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R514H(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		AAGATTATGACGCACTGCATT	0.378			T	PAX5	ALL																																p.R514H			Dom	yes		3	3p14.1	27086	forkhead box P1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1541A	3						.						451.0	366.0	395.0					3																	71021817		2203	4300	6503	71104507	SO:0001583	missense	27086	exon18			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1541G>A	3.37:g.71021817C>T	ENSP00000318902:p.Arg514His	Somatic		Capture	Illumina HiSeq	Phase_I	71104507	NM_032682	A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Missense_Mutation	SNP	ENST00000318789.4	37	CCDS2914.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413640	0.83449	.	.	ENSG00000114861	ENST00000318789;ENST00000358280;ENST00000475937;ENST00000497355;ENST00000491238;ENST00000493089;ENST00000498215;ENST00000484350	D;D;D;D;D;D;D	0.98075	-4.7;-4.7;-4.7;-4.7;-4.7;-4.7;-4.7	5.81	5.81	0.92471	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99474	0.9813	H	0.99634	4.67	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.994;0.999;0.999	D	0.97889	1.0296	10	0.87932	D	0	.	20.4375	0.99097	0.0:1.0:0.0:0.0	.	513;513;438;514	B3KV70;G5E9V8;Q8NAN6;Q9H334	.;.;.;FOXP1_HUMAN	H	514;326;514;410;516;513;514;438	ENSP00000318902:R514H;ENSP00000419393:R514H;ENSP00000418225:R410H;ENSP00000420736:R516H;ENSP00000418524:R513H;ENSP00000418102:R514H;ENSP00000417857:R438H	ENSP00000318902:R514H	R	-	2	0	FOXP1	71104507	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.906000	0.99361	0.655000	0.94253	CGT		0.378	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352250.1	NM_032682	
OR5AC2	81050	broad.mit.edu	37	3	97806608	97806608	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:97806608G>A	ENST00000358642.2	+	1	592	c.592G>A	c.(592-594)Gca>Aca	p.A198T		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	198					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A198T(2)		endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						ATCTATTAACGCACTAATGAT	0.289																																					p.A198T												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G592A	3						.						47.0	49.0	48.0					3																	97806608		2203	4299	6502	99289298	SO:0001583	missense	81050	exon1			AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.592G>A	3.37:g.97806608G>A	ENSP00000351466:p.Ala198Thr	Somatic		Capture	Illumina HiSeq	Phase_I	99289298	NM_054106		Missense_Mutation	SNP	ENST00000358642.2	37	CCDS33796.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.825980	0.32237	.	.	ENSG00000196578	ENST00000358642	T	0.00099	8.73	5.03	-5.16	0.02857	GPCR, rhodopsin-like superfamily (1);	3.367050	0.01838	U	0.035147	T	0.00073	0.0002	N	0.11064	0.09	0.09310	N	1	B	0.20550	0.046	B	0.21708	0.036	T	0.32214	-0.9915	10	0.66056	D	0.02	-0.0146	4.1855	0.10395	0.3439:0.0:0.3282:0.3279	.	198	Q9NZP5	O5AC2_HUMAN	T	198	ENSP00000351466:A198T	ENSP00000351466:A198T	A	+	1	0	OR5AC2	99289298	0.000000	0.05858	0.000000	0.03702	0.192000	0.23643	-2.317000	0.01122	-1.060000	0.03189	0.590000	0.80494	GCA		0.289	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359116.1		
GP5	2814	broad.mit.edu	37	3	194118919	194118919	+	Silent	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr3:194118919G>A	ENST00000401815.1	-	1	164	c.93C>T	c.(91-93)gaC>gaT	p.D31D	GP5_ENST00000323007.3_Silent_p.D31D			P40197	GPV_HUMAN	glycoprotein V (platelet)	31	LRRNT.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.D31D(2)		breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		ACTGCGCGGCGTCCCGGAAGA	0.687																																					p.D31D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C93T	3						.						17.0	19.0	18.0					3																	194118919		2184	4262	6446	195600208	SO:0001819	synonymous_variant	2814	exon2			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.93C>T	3.37:g.194118919G>A		Somatic		Capture	Illumina HiSeq	Phase_I	195600208	NM_004488	D1MER9	Silent	SNP	ENST00000401815.1	37	CCDS3307.1																																																																																				0.687	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317710.1	NM_004488	
SCD5	79966	broad.mit.edu	37	4	83601984	83601984	+	Missense_Mutation	SNP	G	G	A	rs200922750		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr4:83601984G>A	ENST00000319540.4	-	3	764	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	SCD5_ENST00000273908.4_Missense_Mutation_p.R149W	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	149					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.R149W(2)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				AAGAAGCCCCGGCGGGCATTG	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		17629	0.001		0.0	False		,,,				2504	0.0				p.R149W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C445T	4						.						97.0	105.0	102.0					4																	83601984		2203	4300	6503	83821008	SO:0001583	missense	79966	exon3			AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.445C>T	4.37:g.83601984G>A	ENSP00000316329:p.Arg149Trp	Somatic		Capture	Illumina HiSeq	Phase_I	83821008	NM_001037582	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	ENST00000319540.4	37	CCDS34024.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	21.0	4.088430	0.76756	.	.	ENSG00000145284	ENST00000319540;ENST00000273908	T;T	0.15603	2.41;2.41	5.27	1.2	0.21068	Fatty acid desaturase, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.60457	0.2270	H	0.99404	4.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79070	-0.1954	10	0.87932	D	0	-3.3149	15.0068	0.71519	0.0:0.0:0.382:0.618	.	149;149	Q86SK9-2;Q86SK9	.;SCD5_HUMAN	W	149	ENSP00000316329:R149W;ENSP00000273908:R149W	ENSP00000273908:R149W	R	-	1	2	SCD5	83821008	0.992000	0.36948	0.970000	0.41538	0.967000	0.64934	2.109000	0.41863	0.307000	0.22880	0.467000	0.42956	CGG		0.542	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906	
PCDHA3	56145	broad.mit.edu	37	5	140182077	140182077	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr5:140182077C>T	ENST00000522353.2	+	1	1295	c.1295C>T	c.(1294-1296)tCg>tTg	p.S432L	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.S432L	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	432	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S432L(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGGGGGCTCGCCTTCACTG	0.622																																					p.S432L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1295T	5						.						103.0	102.0	103.0					5																	140182077		2203	4300	6503	140162261	SO:0001583	missense	56145	exon1			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1295C>T	5.37:g.140182077C>T	ENSP00000429808:p.Ser432Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140162261	NM_031497	O75286	Missense_Mutation	SNP	ENST00000522353.2	37	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	c	12.77	2.036449	0.35893	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.54675	0.56;0.56	4.75	2.81	0.32909	Cadherin (5);Cadherin-like (1);	0.515394	0.14373	U	0.323685	T	0.50205	0.1602	L	0.56280	1.765	0.09310	N	1	B;B	0.33549	0.148;0.417	B;B	0.39503	0.088;0.301	T	0.49542	-0.8929	10	0.62326	D	0.03	.	9.6284	0.39765	0.1437:0.7771:0.0:0.0793	.	432;432	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	L	432	ENSP00000429808:S432L;ENSP00000434086:S432L	ENSP00000429808:S432L	S	+	2	0	PCDHA3	140162261	0.000000	0.05858	0.990000	0.47175	0.949000	0.60115	0.204000	0.17335	2.374000	0.81015	0.461000	0.40582	TCG		0.622	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PCDHA13	56136	broad.mit.edu	37	5	140262629	140262629	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr5:140262629C>T	ENST00000289272.2	+	1	776	c.776C>T	c.(775-777)aCa>aTa	p.T259I	PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.T259I|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	259	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T259I(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAATGGAACATTAGTGATC	0.433																																					p.T259I	Melanoma(147;1739 1852 5500 27947 37288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C776T	5						.						101.0	97.0	98.0					5																	140262629		2203	4300	6503	140242813	SO:0001583	missense	56136	exon1			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.776C>T	5.37:g.140262629C>T	ENSP00000289272:p.Thr259Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140242813	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.280805	0.59758	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.58210	0.35;0.35	5.58	5.58	0.84498	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.77631	0.4159	M	0.91920	3.255	0.30615	N	0.759075	D;D;D	0.54207	0.965;0.965;0.964	D;P;P	0.66196	0.942;0.819;0.905	T	0.80039	-0.1549	9	0.87932	D	0	.	15.1155	0.72397	0.1421:0.8579:0.0:0.0	.	259;259;259	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	I	259	ENSP00000386821:T259I;ENSP00000289272:T259I	ENSP00000289272:T259I	T	+	2	0	PCDHA13	140242813	0.723000	0.28027	0.457000	0.27056	0.721000	0.41392	4.768000	0.62293	2.621000	0.88768	0.561000	0.74099	ACA		0.433	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
CDC20B	166979	broad.mit.edu	37	5	54423154	54423154	+	Missense_Mutation	SNP	C	C	T	rs200952851	byFrequency	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr5:54423154C>T	ENST00000381375.2	-	8	1065	c.920G>A	c.(919-921)cGg>cAg	p.R307Q	CDC20B_ENST00000334206.5_Missense_Mutation_p.R307Q|CDC20B_ENST00000296733.1_Missense_Mutation_p.R307Q|CDC20B_ENST00000322374.6_Missense_Mutation_p.R307Q			Q86Y33	CD20B_HUMAN	cell division cycle 20B	307								p.R307Q(1)		kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			ATTTCTCAGCCGCTTTTTAGT	0.438													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19603	0.0		0.0	False		,,,				2504	0.001				p.R307Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G920A	5						.	C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	99.0	101.0	100.0		920,920,920	-0.0	1.0	5		100	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	CDC20B	NM_001145734.2,NM_001170402.1,NM_152623.2	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	307/478,307/520,307/516	54423154	1,13005	2203	4300	6503	54458911	SO:0001583	missense	166979	exon8			AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.920G>A	5.37:g.54423154C>T	ENSP00000370781:p.Arg307Gln	Somatic		Capture	Illumina HiSeq	Phase_I	54458911	NM_001170402	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Missense_Mutation	SNP	ENST00000381375.2	37	CCDS54852.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956611	0.34565	0.0	1.16E-4	ENSG00000164287	ENST00000334206;ENST00000296733;ENST00000381375;ENST00000322374	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	4.56	-0.0407	0.13871	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.395622	0.18070	N	0.152668	T	0.15652	0.0377	N	0.17312	0.475	0.80722	D	1	B;B;B;B	0.26363	0.147;0.014;0.008;0.014	B;B;B;B	0.16722	0.014;0.016;0.007;0.012	T	0.07908	-1.0748	10	0.33141	T	0.24	-29.7981	9.1538	0.36980	0.0:0.528:0.0:0.472	.	307;307;307;307	Q86Y33-4;Q86Y33-3;Q86Y33;Q86Y33-2	.;.;CD20B_HUMAN;.	Q	307	ENSP00000335664:R307Q;ENSP00000296733:R307Q;ENSP00000370781:R307Q;ENSP00000315720:R307Q	ENSP00000296733:R307Q	R	-	2	0	CDC20B	54458911	0.041000	0.20044	0.958000	0.39756	0.882000	0.50991	0.217000	0.17603	-0.138000	0.11434	-0.736000	0.03550	CGG		0.438	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1	NM_152623	
ZNF366	167465	broad.mit.edu	37	5	71757114	71757114	+	Silent	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr5:71757114G>A	ENST00000318442.5	-	2	700	c.210C>T	c.(208-210)gtC>gtT	p.V70V		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	70					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.V70V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		CTCCTTCGAAGACCCCGGGGA	0.582																																					p.V70V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C210T	5						.						112.0	120.0	117.0					5																	71757114		2203	4300	6503	71792870	SO:0001819	synonymous_variant	167465	exon2			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.210C>T	5.37:g.71757114G>A		Somatic		Capture	Illumina HiSeq	Phase_I	71792870	NM_152625	Q5HYI9|Q7RTV4	Silent	SNP	ENST00000318442.5	37	CCDS4015.1																																																																																				0.582	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
RANBP17	64901	broad.mit.edu	37	5	170351429	170351429	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr5:170351429T>G	ENST00000523189.1	+	12	1507	c.1343T>G	c.(1342-1344)gTc>gGc	p.V448G		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	448					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.V448G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTGTGCACGGTCAGCAGATGT	0.413			T	TRD@	ALL																																p.V448G			Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1343G	5						.						153.0	135.0	141.0					5																	170351429		2203	4300	6503	170284034	SO:0001583	missense	64901	exon12			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1343T>G	5.37:g.170351429T>G	ENSP00000427975:p.Val448Gly	Somatic		Capture	Illumina HiSeq	Phase_I	170284034	NM_022897	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	t	31	5.077745	0.94000	.	.	ENSG00000204764	ENST00000523189;ENST00000545246	T	0.68903	-0.36	6.16	6.16	0.99307	Armadillo-type fold (1);	0.000000	0.56097	D	0.000021	T	0.69142	0.3078	L	0.36672	1.1	0.80722	D	1	D	0.54397	0.966	P	0.52598	0.703	T	0.72475	-0.4282	10	0.87932	D	0	-15.6623	16.4675	0.84087	0.0:0.0:0.0:1.0	.	448	Q9H2T7	RBP17_HUMAN	G	448;344	ENSP00000427975:V448G	ENSP00000373770:V448G	V	+	2	0	RANBP17	170284034	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.850000	0.86915	2.367000	0.80283	0.528000	0.53228	GTC		0.413	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
LPA	4018	broad.mit.edu	37	6	160968909	160968909	+	Missense_Mutation	SNP	G	G	A	rs201624944		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr6:160968909G>A	ENST00000316300.5	-	32	5260	c.5216C>T	c.(5215-5217)aCg>aTg	p.T1739M	LPA_ENST00000447678.1_Missense_Mutation_p.T1739M			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4247	Kringle 16. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.T1739M(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CTGGCATGGCGTCCCAGTAAC	0.453																																					p.T1739M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5216T	6						.	G	MET/THR	0,4404		0,0,2202	99.0	107.0	104.0		5216	0.6	0.0	6		104	2,8598	811.6+/-407.1	0,2,4298	no	missense	LPA	NM_005577.2	81	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	1739/2041	160968909	2,13002	2202	4300	6502	160888899	SO:0001583	missense	4018	exon33			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5216C>T	6.37:g.160968909G>A	ENSP00000321334:p.Thr1739Met	Somatic		Capture	Illumina HiSeq	Phase_I	160888899	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	a	0.039	-1.294328	0.01375	0.0	2.33E-4	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62639	0.01;0.01	2.49	0.589	0.17452	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.26629	0.0651	L	0.45470	1.425	0.09310	N	1	P	0.43788	0.817	B	0.37047	0.24	T	0.12142	-1.0559	9	0.49607	T	0.09	.	2.4601	0.04539	0.2899:0.0:0.4779:0.2322	.	4247	P08519	APOA_HUMAN	M	1739	ENSP00000321334:T1739M;ENSP00000395608:T1739M	ENSP00000321334:T1739M	T	-	2	0	LPA	160888899	0.000000	0.05858	0.000000	0.03702	0.158000	0.22134	-0.053000	0.11846	0.001000	0.14605	0.184000	0.17185	ACG		0.453	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
MLLT4	4301	broad.mit.edu	37	6	168352589	168352589	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr6:168352589T>C	ENST00000447894.2	+	29	4534	c.4534T>C	c.(4534-4536)Tcc>Ccc	p.S1512P	MLLT4_ENST00000400822.3_Missense_Mutation_p.S1511P|MLLT4_ENST00000392108.3_Missense_Mutation_p.S1512P|MLLT4_ENST00000392112.1_Missense_Mutation_p.S1495P|MLLT4_ENST00000351017.4_Missense_Mutation_p.S1519P|MLLT4_ENST00000366806.2_Missense_Mutation_p.S1512P|MLLT4_ENST00000344191.4_Missense_Mutation_p.S1512P			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1512					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GGACAGTCTGTCCCCCGACCC	0.607			T	MLL	AL																																p.S1512P			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	.	0			c.T4534C	6						.						33.0	41.0	38.0					6																	168352589		2202	4300	6502	168095438	SO:0001583	missense	4301	exon29			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.4534T>C	6.37:g.168352589T>C	ENSP00000404595:p.Ser1512Pro	None		Capture	Illumina HiSeq	Phase_I	168095438	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.	.	.	.	.	.	.	.	.	.	T	16.91	3.252480	0.59212	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.09255	3.19;3.18;3.2;3.27;3.0;3.18;3.17	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.24122	0.0584	M	0.75447	2.3	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.91635	0.993;0.999;0.996;0.996	T	0.01617	-1.1311	10	0.52906	T	0.07	0.0623	15.0845	0.72142	0.0:0.0:0.0:1.0	.	1512;1511;1512;1496	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	P	1512;1519;1512;1512;1495;1512;1511;1512	ENSP00000341118:S1512P;ENSP00000252692:S1519P;ENSP00000375956:S1512P;ENSP00000355771:S1512P;ENSP00000375960:S1495P;ENSP00000383623:S1511P;ENSP00000404595:S1512P	ENSP00000345834:S1512P	S	+	1	0	MLLT4	168095438	1.000000	0.71417	0.965000	0.40720	0.083000	0.17756	7.301000	0.78850	1.954000	0.56735	0.533000	0.62120	TCC		0.607	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
MUC17	140453	broad.mit.edu	37	7	100677953	100677953	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:100677953G>T	ENST00000306151.4	+	3	3320	c.3256G>T	c.(3256-3258)Gct>Tct	p.A1086S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1086	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.A1086S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCTACAACTGCTGACGGTAC	0.502																																					p.A1086S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3256T	7						.						467.0	382.0	411.0					7																	100677953		2203	4300	6503	100464673	SO:0001583	missense	140453	exon3			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3256G>T	7.37:g.100677953G>T	ENSP00000302716:p.Ala1086Ser	Somatic		Capture	Illumina HiSeq	Phase_I	100464673	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	g	1.469	-0.560413	0.03939	.	.	ENSG00000169876	ENST00000306151	T	0.02579	4.24	0.74	-1.48	0.08745	.	.	.	.	.	T	0.00845	0.0028	N	0.03608	-0.345	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.39961	-0.9588	9	0.07030	T	0.85	.	2.8403	0.05527	0.2541:0.342:0.4039:0.0	.	1086	Q685J3	MUC17_HUMAN	S	1086	ENSP00000302716:A1086S	ENSP00000302716:A1086S	A	+	1	0	MUC17	100464673	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.682000	0.05185	-0.419000	0.07439	0.134000	0.15878	GCT		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
DOCK4	9732	broad.mit.edu	37	7	111462434	111462434	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:111462434G>A	ENST00000437633.1	-	27	3170	c.2914C>T	c.(2914-2916)Cgc>Tgc	p.R972C	DOCK4-AS1_ENST00000452714.1_RNA|DOCK4_ENST00000428084.1_Missense_Mutation_p.R972C	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	972					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.R960C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GCAACCAAGCGCATAACAGTC	0.373																																					p.R972C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2914T	7						.						83.0	76.0	79.0					7																	111462434		1861	4096	5957	111249670	SO:0001583	missense	9732	exon27				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.2914C>T	7.37:g.111462434G>A	ENSP00000404179:p.Arg972Cys	Somatic		Capture	Illumina HiSeq	Phase_I	111249670	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385246	0.82792	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	T;T	0.55760	0.5;0.5	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.72277	0.3440	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.68943	0.953;0.886;0.961	T	0.74219	-0.3736	10	0.72032	D	0.01	.	18.5689	0.91128	0.0:0.0:1.0:0.0	.	1008;972;972	Q149N5;Q8N1I0;Q8N1I0-2	.;DOCK4_HUMAN;.	C	960;972;972;960;971	ENSP00000410746:R972C;ENSP00000404179:R972C	ENSP00000345432:R960C	R	-	1	0	DOCK4	111249670	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.432000	0.66514	2.673000	0.90976	0.650000	0.86243	CGC		0.373	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
DGKB	1607	broad.mit.edu	37	7	14378223	14378223	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:14378223C>T	ENST00000403951.2	-	23	2461	c.2042G>A	c.(2041-2043)cGa>cAa	p.R681Q	DGKB_ENST00000407950.1_Missense_Mutation_p.R673Q|DGKB_ENST00000444700.2_Missense_Mutation_p.R662Q|DGKB_ENST00000399322.3_Missense_Mutation_p.R681Q|DGKB_ENST00000258767.5_Missense_Mutation_p.R681Q|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000402815.1_Missense_Mutation_p.R680Q|DGKB_ENST00000406247.3_Missense_Mutation_p.R681Q			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	681					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.R681Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TCGATGGCTTCGTCTTTTCTT	0.398																																					p.R681Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2042A	7						.						178.0	162.0	167.0					7																	14378223		1861	4099	5960	14344748	SO:0001583	missense	1607	exon22			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2042G>A	7.37:g.14378223C>T	ENSP00000385780:p.Arg681Gln	Somatic		Capture	Illumina HiSeq	Phase_I	14344748	NM_145695	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	C	34	5.413003	0.96072	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6	5.5	5.5	0.81552	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.47173	0.1431	L	0.46741	1.465	0.48696	D	0.999692	D;P;P;D	0.69078	0.997;0.912;0.912;0.988	P;B;B;P	0.59703	0.862;0.297;0.392;0.571	T	0.29212	-1.0019	10	0.45353	T	0.12	.	19.3986	0.94619	0.0:1.0:0.0:0.0	.	680;662;681;681	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	Q	681;681;681;680;673;662;681	ENSP00000385780:R681Q;ENSP00000382260:R681Q;ENSP00000258767:R681Q;ENSP00000384909:R680Q;ENSP00000385031:R673Q;ENSP00000388451:R662Q;ENSP00000386066:R681Q	ENSP00000258767:R681Q	R	-	2	0	DGKB	14344748	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.070000	0.71220	2.570000	0.86706	0.650000	0.86243	CGA		0.398	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
RAMP3	10268	broad.mit.edu	37	7	45222982	45222982	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:45222982C>T	ENST00000242249.4	+	3	456	c.418C>T	c.(418-420)Cgc>Tgc	p.R140C	RAMP3_ENST00000481345.1_Missense_Mutation_p.R140C|RAMP3_ENST00000496212.1_Missense_Mutation_p.R140C	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	140					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.R140C(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	GGTGGTGTGGCGCAGCAAACG	0.627																																					p.R140C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C418T	7						.						108.0	100.0	103.0					7																	45222982		2203	4300	6503	45189507	SO:0001583	missense	10268	exon3			AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.418C>T	7.37:g.45222982C>T	ENSP00000242249:p.Arg140Cys	Somatic		Capture	Illumina HiSeq	Phase_I	45189507	NM_005856	Q7Z2Y1	Missense_Mutation	SNP	ENST00000242249.4	37	CCDS5503.1	.	.	.	.	.	.	.	.	.	.	C	4.587	0.109075	0.08780	.	.	ENSG00000122679	ENST00000242249;ENST00000481345;ENST00000496212	T;T;T	0.53206	0.63;0.63;0.63	4.37	2.24	0.28232	.	0.174478	0.53938	N	0.000055	T	0.28167	0.0695	L	0.31526	0.94	0.46113	D	0.99887	B	0.15141	0.012	B	0.06405	0.002	T	0.05971	-1.0853	10	0.22109	T	0.4	-19.451	4.0764	0.09906	0.0:0.5296:0.2246:0.2458	.	140	O60896	RAMP3_HUMAN	C	140	ENSP00000242249:R140C;ENSP00000419012:R140C;ENSP00000418460:R140C	ENSP00000242249:R140C	R	+	1	0	RAMP3	45189507	1.000000	0.71417	0.999000	0.59377	0.249000	0.25844	3.270000	0.51600	0.146000	0.19002	-0.165000	0.13383	CGC		0.627	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
ADCY1	107	broad.mit.edu	37	7	45632443	45632443	+	Missense_Mutation	SNP	C	C	T	rs75000917	byFrequency	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:45632443C>T	ENST00000297323.7	+	2	747	c.725C>T	c.(724-726)gCg>gTg	p.A242V	ADCY1_ENST00000432715.1_Missense_Mutation_p.A17V	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	242					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.A242V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAGAGGAAGGCGTTCCTGCAG	0.587																																					p.A242V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C725T	7						.	C	VAL/ALA	0,4406		0,0,2203	168.0	148.0	155.0		725	5.1	1.0	7	dbSNP_131	155	10,8590	7.7+/-29.5	0,10,4290	yes	missense	ADCY1	NM_021116.2	64	0,10,6493	TT,TC,CC		0.1163,0.0,0.0769	benign	242/1120	45632443	10,12996	2203	4300	6503	45598968	SO:0001583	missense	107	exon2			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.725C>T	7.37:g.45632443C>T	ENSP00000297323:p.Ala242Val	Somatic		Capture	Illumina HiSeq	Phase_I	45598968	NM_021116	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572924	0.65765	0.0	0.001163	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.82526	-1.62;-1.55	5.06	5.06	0.68205	.	0.127228	0.52532	D	0.000077	D	0.82582	0.5068	M	0.78049	2.395	0.51233	D	0.999911	B;B	0.31581	0.154;0.329	B;B	0.24701	0.007;0.055	D	0.83619	0.0138	10	0.59425	D	0.04	.	15.9068	0.79436	0.0:1.0:0.0:0.0	.	242;17	Q08828;C9J1J0	ADCY1_HUMAN;.	V	17;242;242	ENSP00000392721:A17V;ENSP00000297323:A242V	ENSP00000297323:A242V	A	+	2	0	ADCY1	45598968	1.000000	0.71417	0.999000	0.59377	0.939000	0.58152	3.676000	0.54612	2.329000	0.79093	0.484000	0.47621	GCG		0.587	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
ABCA13	154664	broad.mit.edu	37	7	48312591	48312591	+	Missense_Mutation	SNP	G	G	A	rs201667847		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:48312591G>A	ENST00000435803.1	+	17	3352	c.3328G>A	c.(3328-3330)Gta>Ata	p.V1110I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1110					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.V1110I(1)|p.V1055I(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CATTTCTTCCGTAAATTATTC	0.318																																					p.P1055P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3165A	7						.	G	ILE/VAL	4,3630		0,4,1813	50.0	50.0	50.0		3328	-5.4	0.0	7		50	1,8143		0,1,4071	yes	missense	ABCA13	NM_152701.3	29	0,5,5884	AA,AG,GG		0.0123,0.1101,0.0425	possibly-damaging	1110/5059	48312591	5,11773	1817	4072	5889	48283137	SO:0001583	missense	154664	exon15			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.3328G>A	7.37:g.48312591G>A	ENSP00000411096:p.Val1110Ile	Somatic		Capture	Illumina HiSeq	Phase_I	48283137	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	6.734	0.504229	0.12822	0.001101	1.23E-4	ENSG00000179869	ENST00000435803	D	0.86562	-2.14	5.28	-5.45	0.02616	.	1.055820	0.07553	N	0.915687	T	0.80336	0.4604	L	0.59436	1.845	0.09310	N	1	B	0.14012	0.009	B	0.04013	0.001	T	0.64960	-0.6284	10	0.72032	D	0.01	.	3.4538	0.07507	0.4568:0.1116:0.3321:0.0994	.	1110	Q86UQ4	ABCAD_HUMAN	I	1110	ENSP00000411096:V1110I	ENSP00000411096:V1110I	V	+	1	0	ABCA13	48283137	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.875000	0.04205	-1.347000	0.02208	-0.732000	0.03574	GTA		0.318	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
SAMD9L	219285	broad.mit.edu	37	7	92761449	92761449	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:92761449T>A	ENST00000318238.4	-	5	5052	c.3836A>T	c.(3835-3837)aAa>aTa	p.K1279I	SAMD9L_ENST00000411955.1_Missense_Mutation_p.K1279I|SAMD9L_ENST00000437805.1_Missense_Mutation_p.K1279I	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1279					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.K1279I(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			ATACCTCATTTTCAGAAGAAC	0.333																																					p.K1279I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3836T	7						.						70.0	73.0	72.0					7																	92761449		2197	4297	6494	92599385	SO:0001583	missense	219285	exon5			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3836A>T	7.37:g.92761449T>A	ENSP00000326247:p.Lys1279Ile	Somatic		Capture	Illumina HiSeq	Phase_I	92599385	NM_152703	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.052382	0.55218	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.28454	1.61;1.61;1.61	4.92	4.92	0.64577	.	0.231178	0.36703	N	0.002442	T	0.41511	0.1162	L	0.55990	1.75	0.40701	D	0.982487	P	0.49185	0.92	P	0.51135	0.66	T	0.42999	-0.9418	10	0.87932	D	0	-14.6319	14.6677	0.68921	0.0:0.0:0.0:1.0	.	1279	Q8IVG5	SAM9L_HUMAN	I	1279	ENSP00000326247:K1279I;ENSP00000405760:K1279I;ENSP00000408796:K1279I	ENSP00000326247:K1279I	K	-	2	0	SAMD9L	92599385	1.000000	0.71417	0.996000	0.52242	0.781000	0.44180	5.595000	0.67563	2.193000	0.70182	0.383000	0.25322	AAA		0.333	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
TFPI2	7980	broad.mit.edu	37	7	93519485	93519485	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:93519485A>G	ENST00000222543.5	-	2	547	c.235T>C	c.(235-237)Tgg>Cgg	p.W79R	TFPI2_ENST00000545378.1_Missense_Mutation_p.W79R|GNGT1_ENST00000455502.1_Intron|AC002076.10_ENST00000435257.1_RNA	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	79	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.W79R(1)		endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CAAGCCTCCCAGGTGTAGAAA	0.622																																					p.W79R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T235C	7						.						36.0	38.0	37.0					7																	93519485		2203	4300	6503	93357421	SO:0001583	missense	7980	exon2			L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.235T>C	7.37:g.93519485A>G	ENSP00000222543:p.Trp79Arg	Somatic		Capture	Illumina HiSeq	Phase_I	93357421	NM_006528	Q66ME8|Q8NAK6|Q9UC86	Missense_Mutation	SNP	ENST00000222543.5	37	CCDS5632.1	.	.	.	.	.	.	.	.	.	.	A	7.811	0.715758	0.15306	.	.	ENSG00000105825	ENST00000222543;ENST00000545378	T;T	0.55413	0.52;0.52	4.95	-5.13	0.02884	Proteinase inhibitor I2, Kunitz metazoa (5);Proteinase inhibitor I2, Kunitz, conserved site (1);	2.136030	0.01365	N	0.012373	T	0.17109	0.0411	N	0.00315	-1.66	0.09310	N	1	B;B;B;B	0.15473	0.003;0.001;0.013;0.001	B;B;B;B	0.12837	0.006;0.001;0.008;0.001	T	0.18555	-1.0333	10	0.23891	T	0.37	.	6.6258	0.22828	0.307:0.0:0.4657:0.2273	.	50;68;79;79	A4ZVU7;Q8NAK6;F5H3J8;P48307	.;.;.;TFPI2_HUMAN	R	79	ENSP00000222543:W79R;ENSP00000438861:W79R	ENSP00000222543:W79R	W	-	1	0	TFPI2	93357421	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.260000	0.02858	-0.957000	0.03627	-0.736000	0.03550	TGG		0.622	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254720.2	NM_006528	
EPHA1	2041	broad.mit.edu	37	7	143095839	143095839	+	Silent	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr7:143095839C>T	ENST00000275815.3	-	6	1277	c.1191G>A	c.(1189-1191)cgG>cgA	p.R397R		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	397	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.R397R(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TGGTGAGCCCCCGGGCCCCCG	0.612																																					p.R397R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1191A	7						.						62.0	57.0	59.0					7																	143095839		2203	4300	6503	142805961	SO:0001819	synonymous_variant	2041	exon6			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1191G>A	7.37:g.143095839C>T		Somatic		Capture	Illumina HiSeq	Phase_I	142805961	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Silent	SNP	ENST00000275815.3	37	CCDS5884.1																																																																																				0.612	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
MYOM2	9172	broad.mit.edu	37	8	2005570	2005570	+	Missense_Mutation	SNP	G	G	A	rs147661043		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr8:2005570G>A	ENST00000262113.4	+	4	509	c.368G>A	c.(367-369)cGc>cAc	p.R123H	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	123					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.R123H(2)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCCCAGGCCCGCGACAAGCTG	0.617																																					p.R123H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G368A	8						.						29.0	30.0	30.0					8																	2005570		2203	4300	6503	1992977	SO:0001583	missense	9172	exon4				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.368G>A	8.37:g.2005570G>A	ENSP00000262113:p.Arg123His	Somatic		Capture	Illumina HiSeq	Phase_I	1992977	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.641288	0.29157	.	.	ENSG00000036448	ENST00000262113	T	0.56611	0.45	4.71	-0.21	0.13176	.	0.326897	0.26792	N	0.022472	T	0.47544	0.1451	M	0.63843	1.955	0.09310	N	1	P	0.43662	0.814	B	0.41374	0.355	T	0.46992	-0.9151	10	0.72032	D	0.01	.	10.4822	0.44700	0.1944:0.0:0.8056:0.0	.	123	P54296	MYOM2_HUMAN	H	123	ENSP00000262113:R123H	ENSP00000262113:R123H	R	+	2	0	MYOM2	1992977	0.034000	0.19679	0.000000	0.03702	0.015000	0.08874	0.763000	0.26517	-0.346000	0.08312	-0.258000	0.10820	CGC		0.617	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
WRN	7486	broad.mit.edu	37	8	30977784	30977784	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr8:30977784G>C	ENST00000298139.5	+	21	2723	c.2474G>C	c.(2473-2475)gGa>gCa	p.G825A		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	825	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.G825A(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		ATAGCTTTTGGAATGGGCATT	0.373			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												p.G825A	Ovarian(18;161 598 2706 14834 27543)	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2474C	8						.						197.0	187.0	191.0					8																	30977784		2203	4300	6503	31097326	SO:0001583	missense	7486	exon21	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.2474G>C	8.37:g.30977784G>C	ENSP00000298139:p.Gly825Ala	Somatic		Capture	Illumina HiSeq	Phase_I	31097326	NM_000553	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670274	0.88348	.	.	ENSG00000165392	ENST00000298139	T	0.04758	3.56	5.76	5.76	0.90799	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.20820	0.0501	L	0.60067	1.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00008	-1.2487	10	0.87932	D	0	-28.653	19.9192	0.97079	0.0:0.0:1.0:0.0	.	235;825	Q59F09;Q14191	.;WRN_HUMAN	A	825	ENSP00000298139:G825A	ENSP00000298139:G825A	G	+	2	0	WRN	31097326	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.146000	0.89626	2.882000	0.98803	0.655000	0.94253	GGA		0.373	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1		
NRG1	3084	broad.mit.edu	37	8	32585589	32585589	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr8:32585589T>A	ENST00000405005.3	+	6	625	c.625T>A	c.(625-627)Ttg>Atg	p.L209M	NRG1_ENST00000338921.4_Missense_Mutation_p.L209M|NRG1_ENST00000341377.5_Missense_Mutation_p.L209M|NRG1_ENST00000356819.4_Missense_Mutation_p.L209M|NRG1_ENST00000287842.3_Missense_Mutation_p.L209M|NRG1_ENST00000521670.1_Missense_Mutation_p.L209M|NRG1_ENST00000523079.1_Missense_Mutation_p.L209M|NRG1_ENST00000539990.1_Missense_Mutation_p.L55M|NRG1_ENST00000287845.5_Missense_Mutation_p.L175M|NRG1_ENST00000519301.1_Missense_Mutation_p.L154M|NRG1_ENST00000520502.2_Missense_Mutation_p.L264M|NRG1_ENST00000520407.1_Missense_Mutation_p.L390M			Q02297	NRG1_HUMAN	neuregulin 1	209	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.L209M(2)|p.L390M(1)|p.L264M(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTCGAGATACTTGTGCAAGTA	0.398																																					p.L209M												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.T625A	8						.						134.0	126.0	128.0					8																	32585589		2203	4300	6503	32705131	SO:0001583	missense	3084	exon6			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.625T>A	8.37:g.32585589T>A	ENSP00000384620:p.Leu209Met	Somatic		Capture	Illumina HiSeq	Phase_I	32705131	NM_013957	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	De_novo_Start_OutOfFrame	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	T	18.10	3.547865	0.65311	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000520407;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670;ENST00000520502;ENST00000518084;ENST00000522402;ENST00000519240;ENST00000539990	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.92348	-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-3.02;-2.99;-2.99	5.92	2.08	0.27032	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.216074	0.38326	N	0.001726	D	0.89312	0.6679	N	0.13327	0.33	0.36732	D	0.881781	B;B;P;P;P;B;D;B;D;D;D;P;B;P;B;D;P	0.76494	0.042;0.368;0.558;0.55;0.558;0.365;0.995;0.072;0.999;0.996;0.96;0.685;0.4;0.685;0.317;0.998;0.7	B;B;B;B;B;B;P;B;D;D;D;B;B;B;B;D;P	0.80764	0.031;0.271;0.213;0.382;0.213;0.216;0.883;0.041;0.994;0.919;0.959;0.382;0.304;0.382;0.193;0.961;0.534	D	0.86481	0.1791	10	0.48119	T	0.1	.	4.5685	0.12198	0.1339:0.2321:0.0:0.634	.	55;55;209;175;209;208;174;209;209;264;209;209;209;209;209;209;390	B7Z1E3;B7Z1D7;E9PHH4;F8W9E3;Q7RTW4;B0FYA9;B0FWZ3;B7Z4Z3;Q02297-2;Q02297-10;Q02297-4;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8;Q02297-9	.;.;.;.;.;.;.;.;.;.;.;.;NRG1_HUMAN;.;.;.;.	M	171;154;390;277;209;209;209;209;175;209;209;209;209;264;55;55;55;55	ENSP00000430053:L171M;ENSP00000429582:L154M;ENSP00000434640:L390M;ENSP00000429067:L277M;ENSP00000430120:L209M;ENSP00000343395:L209M;ENSP00000349275:L209M;ENSP00000287840:L209M;ENSP00000287845:L175M;ENSP00000340497:L209M;ENSP00000287842:L209M;ENSP00000384620:L209M;ENSP00000428828:L209M;ENSP00000433289:L264M;ENSP00000428546:L55M;ENSP00000430862:L55M;ENSP00000428411:L55M;ENSP00000439276:L55M	ENSP00000287840:L209M	L	+	1	2	NRG1	32705131	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.037000	0.30241	0.112000	0.17975	0.477000	0.44152	TTG		0.398	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
ADAM32	203102	broad.mit.edu	37	8	39007371	39007371	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr8:39007371C>T	ENST00000379907.4	+	5	465	c.338C>T	c.(337-339)aCg>aTg	p.T113M	ADAM32_ENST00000519315.1_Missense_Mutation_p.T113M|ADAM32_ENST00000437682.2_Missense_Mutation_p.T120M	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	113						integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T113M(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			ACACTCAGCACGTGCTCTGGA	0.373																																					p.T113M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C338T	8						.						134.0	126.0	129.0					8																	39007371		1905	4125	6030	39126528	SO:0001583	missense	203102	exon5			BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.338C>T	8.37:g.39007371C>T	ENSP00000369238:p.Thr113Met	Somatic		Capture	Illumina HiSeq	Phase_I	39126528	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	37	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.867258	0.32977	.	.	ENSG00000197140	ENST00000523400;ENST00000399831;ENST00000437682;ENST00000519315;ENST00000379907;ENST00000522506;ENST00000521741;ENST00000399826	T;T;T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1;3.1;3.1	5.16	4.29	0.51040	Peptidase M12B, propeptide (1);	0.233794	0.21983	N	0.066265	T	0.33030	0.0849	M	0.90542	3.125	0.29174	N	0.876922	B;B;D	0.89917	0.262;0.173;1.0	B;B;D	0.85130	0.289;0.116;0.997	T	0.32188	-0.9916	10	0.66056	D	0.02	.	10.2366	0.43286	0.0:0.9072:0.0:0.0928	.	120;113;113	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	M	144;113;120;113;113;113;39;114	ENSP00000427735:T144M;ENSP00000382727:T113M;ENSP00000405978:T120M;ENSP00000429422:T113M;ENSP00000369238:T113M;ENSP00000429066:T113M;ENSP00000431050:T39M	ENSP00000369238:T113M	T	+	2	0	ADAM32	39126528	0.738000	0.28186	0.918000	0.36340	0.050000	0.14768	1.527000	0.35975	1.329000	0.45376	-0.126000	0.14955	ACG		0.373	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
RP1	6101	broad.mit.edu	37	8	55540787	55540788	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr8:55540787_55540788GG>TT	ENST00000220676.1	+	4	4493_4494	c.4345_4346GG>TT	c.(4345-4347)GGc>TTc	p.G1449F		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1449					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.G1449>?(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGAAGAACCAGGCTCAATAACC	0.342																																					.	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Complex(1)	large_intestine(1)	c.4345_4346TT	8						.																																			55703341	SO:0001583	missense	6101	exon4			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		Exception_encountered	8.37:g.55540787_55540788delinsTT	ENSP00000220676:p.Gly1449Phe	Somatic		Capture	Illumina HiSeq	Phase_I	55703340	NM_006269		Missense_Mutation	DNP	ENST00000220676.1	37	CCDS6160.1																																																																																				0.342	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
CERCAM	51148	broad.mit.edu	37	9	131197991	131197991	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chr9:131197991T>C	ENST00000372838.4	+	12	1993	c.1595T>C	c.(1594-1596)cTg>cCg	p.L532P	CERCAM_ENST00000372842.1_Missense_Mutation_p.L454P	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	532					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)		p.L454P(1)		endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						GCCCAGCCCCTGCTCGCTGCC	0.647																																					p.L532P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1595C	9						.						34.0	29.0	31.0					9																	131197991		2203	4299	6502	130237812	SO:0001583	missense	51148	exon12			AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.1595T>C	9.37:g.131197991T>C	ENSP00000361929:p.Leu532Pro	Somatic		Capture	Illumina HiSeq	Phase_I	130237812	NM_016174	A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	37	CCDS6901.2	.	.	.	.	.	.	.	.	.	.	T	17.23	3.335938	0.60853	.	.	ENSG00000167123	ENST00000372842;ENST00000372838;ENST00000413863	D;D	0.82433	-1.57;-1.61	5.18	3.96	0.45880	.	0.159823	0.42420	D	0.000715	D	0.90304	0.6967	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91156	0.4957	10	0.87932	D	0	-9.7553	10.7057	0.45954	0.0:0.0:0.1598:0.8402	.	532	Q5T4B2	GT253_HUMAN	P	454;532;485	ENSP00000361933:L454P;ENSP00000361929:L532P	ENSP00000361929:L532P	L	+	2	0	CERCAM	130237812	1.000000	0.71417	0.993000	0.49108	0.099000	0.18886	6.090000	0.71397	1.954000	0.56735	0.459000	0.35465	CTG		0.647	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2	NM_016174	
BEX4	56271	broad.mit.edu	37	X	102471120	102471120	+	Silent	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:102471120C>T	ENST00000372695.5	+	3	274	c.39C>T	c.(37-39)aaC>aaT	p.N13N	BEX4_ENST00000372691.3_Silent_p.N13N	NM_001080425.3	NP_001073894.1	Q9NWD9	BEX4_HUMAN	brain expressed, X-linked 4	13						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.N339N(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	9						ACAATCTCAACGGGGAAAATG	0.517																																					p.N13N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C39T	X						.						33.0	36.0	35.0					X																	102471120		2194	4272	6466	102357776	SO:0001819	synonymous_variant	56271	exon3			AL035494	CCDS35355.1	Xq22.1-q22.3	2014-03-21	2008-11-04	2007-08-24	ENSG00000102409	ENSG00000102409			25475	protein-coding gene	gene with protein product		300692	"""brain expressed X-linked-like 1"", ""BEX family member 4"""	BEXL1		15958283, 16221301	Standard	NM_001080425		Approved	FLJ10097	uc004ejw.4	Q9NWD9	OTTHUMG00000022091	ENST00000372695.5:c.39C>T	X.37:g.102471120C>T		Somatic		Capture	Illumina HiSeq	Phase_I	102357776	NM_001080425		Silent	SNP	ENST00000372695.5	37	CCDS35355.1																																																																																				0.517	BEX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057694.1	XM_043653	
NRK	203447	broad.mit.edu	37	X	105161622	105161622	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:105161622C>A	ENST00000243300.9	+	16	2773	c.2470C>A	c.(2470-2472)Caa>Aaa	p.Q824K	NRK_ENST00000428173.2_Missense_Mutation_p.Q825K	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	824					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.Q824K(1)|p.Q825K(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TGACATCAGACAAAGGAGTTC	0.408										HNSCC(51;0.14)																											p.Q824K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2470A	X						.						83.0	66.0	72.0					X																	105161622		1882	4091	5973	105048278	SO:0001583	missense	203447	exon16			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2470C>A	X.37:g.105161622C>A	ENSP00000434830:p.Gln824Lys	Somatic		Capture	Illumina HiSeq	Phase_I	105048278	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37		.	.	.	.	.	.	.	.	.	.	C	13.60	2.284195	0.40394	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.76578	-1.03;-1.02	5.3	3.45	0.39498	.	0.645957	0.13777	N	0.363494	T	0.64382	0.2593	L	0.27053	0.805	0.80722	D	1	B;B	0.28291	0.206;0.043	B;B	0.31101	0.124;0.027	T	0.49021	-0.8982	10	0.10902	T	0.67	.	11.2926	0.49258	0.0:0.6536:0.3464:0.0	.	492;824	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	K	824;825	ENSP00000434830:Q824K;ENSP00000438378:Q825K	ENSP00000434830:Q824K	Q	+	1	0	NRK	105048278	1.000000	0.71417	0.987000	0.45799	0.941000	0.58515	1.322000	0.33689	0.506000	0.28125	0.600000	0.82982	CAA		0.408	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
COL4A5	1287	broad.mit.edu	37	X	107898597	107898597	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:107898597G>T	ENST00000361603.2	+	37	3527	c.3283G>T	c.(3283-3285)Ggt>Tgt	p.G1095C	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1095C	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1095	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G1095C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AGGGAACCCTGGTATCAAAGG	0.468									Alport syndrome with Diffuse Leiomyomatosis																												p.G1095C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3283T	X						.						78.0	75.0	76.0					X																	107898597		2203	4300	6503	107785253	SO:0001583	missense	1287	exon37	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3283G>T	X.37:g.107898597G>T	ENSP00000354505:p.Gly1095Cys	Somatic		Capture	Illumina HiSeq	Phase_I	107785253	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478662	0.63849	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99369	-5.78;-5.78	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.99711	0.9889	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97192	0.9858	10	0.87932	D	0	.	18.3471	0.90326	0.0:0.0:1.0:0.0	.	1095;1095	E7EVY4;P29400	.;CO4A5_HUMAN	C	1095	ENSP00000331902:G1095C;ENSP00000354505:G1095C	ENSP00000331902:G1095C	G	+	1	0	COL4A5	107785253	1.000000	0.71417	0.992000	0.48379	0.925000	0.55904	6.937000	0.75898	2.459000	0.83118	0.594000	0.82650	GGT		0.468	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
MOSPD2	158747	broad.mit.edu	37	X	14891816	14891816	+	Silent	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:14891816C>T	ENST00000380492.3	+	2	103	c.15C>T	c.(13-15)caC>caT	p.H5H	FANCB_ENST00000324138.3_5'Flank|MOSPD2_ENST00000497603.2_Silent_p.H5H|MOSPD2_ENST00000482354.1_Silent_p.H5H|FANCB_ENST00000398334.1_5'Flank	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	5						integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.H5H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					TCCAGAATCACGCCCAGAATA	0.557																																					p.H5H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C15T	X						.						201.0	189.0	193.0					X																	14891816		2203	4300	6503	14801737	SO:0001819	synonymous_variant	158747	exon2			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.15C>T	X.37:g.14891816C>T		Somatic		Capture	Illumina HiSeq	Phase_I	14801737	NM_152581	Q8N3H2|Q8NA83	Silent	SNP	ENST00000380492.3	37	CCDS14162.1																																																																																				0.557	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581	
CXorf23	256643	broad.mit.edu	37	X	19953995	19953995	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:19953995C>A	ENST00000379682.4	-	9	1915	c.1882G>T	c.(1882-1884)Gac>Tac	p.D628Y	CXorf23_ENST00000356980.3_Intron|CXorf23_ENST00000379687.3_Missense_Mutation_p.D599Y			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	628						mitochondrion (GO:0005739)		p.D599Y(1)|p.D193Y(1)		endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						GTAATTATGTCTTTTCTCTGC	0.343																																					p.D599Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1795T	X						.						283.0	249.0	260.0					X																	19953995		2203	4300	6503	19863916	SO:0001583	missense	256643	exon9			AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.1882G>T	X.37:g.19953995C>A	ENSP00000369004:p.Asp628Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	19863916	NM_198279	A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Missense_Mutation	SNP	ENST00000379682.4	37		.	.	.	.	.	.	.	.	.	.	C	11.75	1.730538	0.30684	.	.	ENSG00000173681	ENST00000379687;ENST00000379682	T;T	0.16073	2.55;2.37	4.98	4.12	0.48240	.	.	.	.	.	T	0.25082	0.0609	L	0.29908	0.895	0.25848	N	0.98398	D;D	0.89917	0.999;1.0	P;D	0.65874	0.875;0.939	T	0.06625	-1.0816	8	.	.	.	.	8.5451	0.33417	0.0:0.8895:0.0:0.1105	.	599;628	A2AJT9-2;A2AJT9	.;CX023_HUMAN	Y	599;628	ENSP00000369009:D599Y;ENSP00000369004:D628Y	.	D	-	1	0	CXorf23	19863916	0.367000	0.25023	0.008000	0.14137	0.225000	0.24961	0.766000	0.26560	0.886000	0.36113	0.538000	0.68166	GAC		0.343	CXorf23-006	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000055991.2	NM_198279	
NR0B1	190	broad.mit.edu	37	X	30327157	30327157	+	Silent	SNP	C	C	T	rs147442403	byFrequency	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:30327157C>T	ENST00000378970.4	-	1	558	c.324G>A	c.(322-324)tcG>tcA	p.S108S	NR0B1_ENST00000378963.1_5'Flank|NR0B1_ENST00000453287.1_Silent_p.S108S	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	108	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.S108S(1)		central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	CAGAGCCGCACGAACAGCCCC	0.692											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S108S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G324A	X						.	C		2,3825		0,1,1,1629,566	23.0	25.0	24.0		324	-8.8	0.0	X	dbSNP_134	24	0,6712		0,0,0,2425,1862	no	coding-synonymous	NR0B1	NM_000475.4		0,1,1,4054,2428	TT,TC,T,CC,C		0.0,0.0523,0.019		108/471	30327157	2,10537	2197	4287	6484	30237078	SO:0001819	synonymous_variant	190	exon1			S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.324G>A	X.37:g.30327157C>T		Somatic	816	Capture	Illumina HiSeq	Phase_I	30237078	NM_000475	Q96F69	Silent	SNP	ENST00000378970.4	37	CCDS14223.1																																																																																				0.692	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475	
FAM47C	442444	broad.mit.edu	37	X	37027867	37027867	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:37027867C>A	ENST00000358047.3	+	1	1436	c.1384C>A	c.(1384-1386)Ctc>Atc	p.L462I		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	462								p.L462I(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GGTGTCCAGTCTCCACCTGGA	0.632																																					p.L462I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1384A	X						.						62.0	60.0	60.0					X																	37027867		2202	4300	6502	36937788	SO:0001583	missense	442444	exon1			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1384C>A	X.37:g.37027867C>A	ENSP00000367913:p.Leu462Ile	Somatic		Capture	Illumina HiSeq	Phase_I	36937788	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	c	1.740	-0.492038	0.04322	.	.	ENSG00000198173	ENST00000358047	T	0.20881	2.04	1.44	-1.71	0.08133	.	.	.	.	.	T	0.35682	0.0940	M	0.72894	2.215	0.09310	N	0.999994	D	0.67145	0.996	D	0.65987	0.94	T	0.17531	-1.0366	9	0.37606	T	0.19	.	6.3543	0.21393	0.0:0.6717:0.0:0.3283	.	462	Q5HY64	FA47C_HUMAN	I	462	ENSP00000367913:L462I	ENSP00000367913:L462I	L	+	1	0	FAM47C	36937788	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-0.486000	0.06513	-0.883000	0.03982	-0.492000	0.04666	CTC		0.632	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
SSX6	280657	broad.mit.edu	37	X	47970673	47970673	+	IGR	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:47970673C>T								snoU13 (29434 upstream) : SSX6 (5792 downstream)														p.R72C(1)									ACTTTTCATGCGTAATAAACG	0.478																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	X						.						105.0	80.0	88.0					X																	47970673		2192	4286	6478	47855617	SO:0001628	intergenic_variant	280657	.																															X.37:g.47970673C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47855617	.		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	.	2.710	-0.268963	0.05716	.	.	ENSG00000171483	ENST00000376932	T	0.08282	3.11	2.19	-4.39	0.03611	Krueppel-associated box (2);Krueppel-associated box-related (1);	2.438670	0.01255	N	0.008990	T	0.05823	0.0152	.	.	.	0.21184	N	0.999767	B;B	0.14438	0.01;0.001	B;B	0.09377	0.004;0.002	T	0.27262	-1.0079	9	0.45353	T	0.12	.	1.6084	0.02689	0.1369:0.3009:0.1363:0.4259	.	72;72	B7Z813;Q7RTT6	.;SSX6_HUMAN	C	72	ENSP00000366131:R72C	ENSP00000366131:R72C	R	+	1	0	SSX6	47855617	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-4.983000	0.00163	-2.943000	0.00296	-1.030000	0.02411	CGT	0	0.478								
PHF8	23133	broad.mit.edu	37	X	54013588	54013588	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:54013588G>A	ENST00000357988.5	-	16	2384	c.2026C>T	c.(2026-2028)Cgg>Tgg	p.R676W	PHF8_ENST00000338154.6_Missense_Mutation_p.R640W|PHF8_ENST00000322659.8_Missense_Mutation_p.R640W|PHF8_ENST00000338946.6_Missense_Mutation_p.R539W	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	676					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.R640W(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						GGCAATTTCCGGGGAAATTCT	0.423																																					p.R640W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1918T	X						.						70.0	61.0	64.0					X																	54013588		2203	4300	6503	54030313	SO:0001583	missense	23133	exon16			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2026C>T	X.37:g.54013588G>A	ENSP00000350676:p.Arg676Trp	Somatic		Capture	Illumina HiSeq	Phase_I	54030313	NM_001184898	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.15|15.15	2.748215|2.748215	0.49257|0.49257	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000443302|ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000375189;ENST00000322659	T|T;T;T;T	0.44482|0.26373	0.92|2.41;2.16;2.12;1.74	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|0.496370	.|0.22031	.|N	.|0.065587	T|T	0.28101|0.28101	0.0693|0.0693	N|N	0.19112|0.19112	0.55|0.55	0.30310|0.30310	N|N	0.788606|0.788606	.|B;D;D;D;D	.|0.69078	.|0.03;0.997;0.997;0.997;0.997	.|B;P;P;P;P	.|0.53401	.|0.011;0.616;0.635;0.725;0.635	T|T	0.12344|0.12344	-1.0551|-1.0551	7|10	0.56958|0.66056	D|D	0.05|0.02	-3.4258|-3.4258	14.4778|14.4778	0.67559|0.67559	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|162;640;539;575;676	.|B3KMV4;Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1	.|.;.;.;.;PHF8_HUMAN	L|W	403|676;640;539;569;116;640	ENSP00000397129:P403L|ENSP00000350676:R676W;ENSP00000338868:R640W;ENSP00000340051:R539W;ENSP00000319473:R640W	ENSP00000397129:P403L|ENSP00000319473:R640W	P|R	-|-	2|1	0|2	PHF8|PHF8	54030313|54030313	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.988000|0.988000	0.76386|0.76386	3.758000|3.758000	0.55220|0.55220	2.112000|2.112000	0.64535|0.64535	0.523000|0.523000	0.50628|0.50628	CCG|CGG		0.423	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
NAP1L3	4675	broad.mit.edu	37	X	92926912	92926912	+	Silent	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:92926912C>T	ENST00000373079.3	-	1	1655	c.1392G>A	c.(1390-1392)gaG>gaA	p.E464E	FAM133A_ENST00000332647.4_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000538690.1_5'Flank|NAP1L3_ENST00000475430.2_Silent_p.E457E|FAM133A_ENST00000355813.5_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	464					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.E464E(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TTTCAAAGTCCTCATCCAGGA	0.393																																					p.E464E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1392A	X						.						72.0	60.0	64.0					X																	92926912		2203	4300	6503	92813568	SO:0001819	synonymous_variant	4675	exon1				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.1392G>A	X.37:g.92926912C>T		Somatic		Capture	Illumina HiSeq	Phase_I	92813568	NM_004538	B2RCM0|O60788	Silent	SNP	ENST00000373079.3	37	CCDS14465.1																																																																																				0.393	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
PCDH19	57526	broad.mit.edu	37	X	99662741	99662741	+	Silent	SNP	C	C	T			TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:99662741C>T	ENST00000373034.4	-	1	2530	c.855G>A	c.(853-855)acG>acA	p.T285T	PCDH19_ENST00000420881.2_Silent_p.T285T|PCDH19_ENST00000255531.7_Silent_p.T285T	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	285	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T285T(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						AGAGCTCGCGCGTGCGGTCGT	0.607																																					p.T285T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G855A	X						.						103.0	108.0	106.0					X																	99662741		2165	4249	6414	99549397	SO:0001819	synonymous_variant	57526	exon1			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.855G>A	X.37:g.99662741C>T		Somatic		Capture	Illumina HiSeq	Phase_I	99549397	NM_001105243	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	ENST00000373034.4	37	CCDS55462.1																																																																																				0.607	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
IRS4	8471	broad.mit.edu	37	X	107978401	107978401	+	Missense_Mutation	SNP	C	C	T	rs143812272		TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3696-01A-01W-0900-09	TCGA-AA-3696-10A-01W-0900-09	g.chrX:107978401C>T	ENST00000372129.2	-	1	1250	c.1174G>A	c.(1174-1176)Gag>Aag	p.E392K	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	392					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.E392K(2)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AAAAGCATCTCGTCTTCCCCG	0.652																																					p.E392K												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.G1174A	X						.						60.0	56.0	57.0					X																	107978401		2203	4300	6503	107865057	SO:0001583	missense	8471	exon1			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1174G>A	X.37:g.107978401C>T	ENSP00000361202:p.Glu392Lys	Somatic		Capture	Illumina HiSeq	Phase_I	107865057	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	4.925	0.171841	0.09391	.	.	ENSG00000133124	ENST00000372129	T	0.36520	1.25	3.56	2.7	0.31948	.	1.397060	0.04406	N	0.365199	T	0.25269	0.0614	L	0.29908	0.895	0.09310	N	1	B	0.29612	0.251	B	0.12837	0.008	T	0.18366	-1.0339	10	0.38643	T	0.18	-5.6278	5.0808	0.14655	0.0:0.7273:0.0:0.2727	.	392	O14654	IRS4_HUMAN	K	392	ENSP00000361202:E392K	ENSP00000361202:E392K	E	-	1	0	IRS4	107865057	0.178000	0.23122	0.005000	0.12908	0.164000	0.22412	1.328000	0.33758	0.897000	0.36392	0.529000	0.55759	GAG		0.652	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
