#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC18A2	6571	broad.mit.edu	37	10	119015014	119015014	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr10:119015014C>A	ENST00000298472.5	+	8	958	c.815C>A	c.(814-816)cCg>cAg	p.P272Q	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	272					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)	p.P272Q(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GTGCTCCAGCCGTCCCGGGTG	0.547																																					p.P272Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C815A	10						.						36.0	45.0	42.0					10																	119015014		2203	4300	6503	119005004	SO:0001583	missense	6571	exon8			L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.815C>A	10.37:g.119015014C>A	ENSP00000298472:p.Pro272Gln	Somatic		Capture	Illumina HiSeq	Phase_I	119005004	NM_003054	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	ENST00000298472.5	37	CCDS7599.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533385	0.85812	.	.	ENSG00000165646	ENST00000298472	T	0.80909	-1.43	5.07	5.07	0.68467	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.056468	0.64402	D	0.000001	D	0.92041	0.7478	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93388	0.6749	10	0.62326	D	0.03	-12.3547	18.8216	0.92099	0.0:1.0:0.0:0.0	.	272	Q05940	VMAT2_HUMAN	Q	272	ENSP00000298472:P272Q	ENSP00000298472:P272Q	P	+	2	0	SLC18A2	119005004	1.000000	0.71417	0.965000	0.40720	0.895000	0.52256	7.770000	0.85390	2.505000	0.84491	0.563000	0.77884	CCG		0.547	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
UPF2	26019	broad.mit.edu	37	10	12039699	12039699	+	Missense_Mutation	SNP	G	G	A	rs180827437		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr10:12039699G>A	ENST00000356352.2	-	7	2289	c.1816C>T	c.(1816-1818)Cgg>Tgg	p.R606W	UPF2_ENST00000357604.5_Missense_Mutation_p.R606W|UPF2_ENST00000397053.2_Missense_Mutation_p.R606W			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	606	MIF4G 2.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.R606W(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				AAGAGTGCCCGTACCAACTTC	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		16459	0.0		0.001	False		,,,				2504	0.0				p.R606W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1816T	10						.						190.0	179.0	183.0					10																	12039699		2203	4300	6503	12079705	SO:0001583	missense	26019	exon8			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.1816C>T	10.37:g.12039699G>A	ENSP00000348708:p.Arg606Trp	Somatic		Capture	Illumina HiSeq	Phase_I	12079705	NM_080599	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	CCDS7086.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	26.6	4.753049	0.89753	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.24151	1.87;1.87;1.87	5.7	5.7	0.88788	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.64402	D	0.000001	T	0.49133	0.1539	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.45991	-0.9223	10	0.66056	D	0.02	.	14.2888	0.66263	0.0:0.0:0.8511:0.1489	.	606	Q9HAU5	RENT2_HUMAN	W	606	ENSP00000348708:R606W;ENSP00000350221:R606W;ENSP00000380244:R606W	ENSP00000348708:R606W	R	-	1	2	UPF2	12079705	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	5.759000	0.68785	2.667000	0.90743	0.655000	0.94253	CGG		0.338	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
PRLHR	2834	broad.mit.edu	37	10	120353839	120353839	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr10:120353839G>A	ENST00000369169.1	-	1	917	c.918C>T	c.(916-918)caC>caT	p.H306H	PRLHR_ENST00000239032.2_Silent_p.H306H			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	306					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)	p.H306H(1)		large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		GGTCGATGGCGTGGGGGTCGA	0.652																																					p.H306H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C918T	10						.						45.0	45.0	45.0					10																	120353839		2203	4300	6503	120343829	SO:0001819	synonymous_variant	2834	exon2			AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.918C>T	10.37:g.120353839G>A		Somatic		Capture	Illumina HiSeq	Phase_I	120343829	NM_004248	O75194|Q502U8|Q5VXR9	Silent	SNP	ENST00000369169.1	37	CCDS7606.1																																																																																				0.652	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050610.1	NM_004248	
BEND7	222389	broad.mit.edu	37	10	13481241	13481241	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr10:13481241C>T	ENST00000396900.2	-	9	1490	c.1491G>A	c.(1489-1491)ggG>ggA	p.G497G	BEND7_ENST00000341083.3_Silent_p.G446G|BEND7_ENST00000486542.1_5'UTR			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	497						extracellular vesicular exosome (GO:0070062)		p.G446G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						agttgcgaatccctctctgat	0.458																																					p.G446G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1338A	10						.						260.0	238.0	245.0					10																	13481241		2203	4300	6503	13521247	SO:0001819	synonymous_variant	222389	exon9			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.1491G>A	10.37:g.13481241C>T		Somatic		Capture	Illumina HiSeq	Phase_I	13521247	NM_152751	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Silent	SNP	ENST00000396900.2	37																																																																																					0.458	BEND7-202	KNOWN	basic	protein_coding	protein_coding		NM_152751	
SVIL	6840	broad.mit.edu	37	10	29818642	29818642	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr10:29818642G>A	ENST00000355867.4	-	12	2990	c.2238C>T	c.(2236-2238)atC>atT	p.I746I	SVIL_ENST00000375398.2_Silent_p.I746I|SVIL_ENST00000375400.3_Silent_p.I352I	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	746					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.I746I(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				ACGTGGCTGCGATGACCACCT	0.488																																					p.I352I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1056T	10						.						115.0	99.0	105.0					10																	29818642		2203	4300	6503	29858648	SO:0001819	synonymous_variant	6840	exon11			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2238C>T	10.37:g.29818642G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29858648	NM_003174	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																				0.488	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
DMBT1	1755	broad.mit.edu	37	10	124402773	124402773	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr10:124402773G>A	ENST00000338354.3	+	53	7207	c.7101G>A	c.(7099-7101)gcG>gcA	p.A2367A	DMBT1_ENST00000359586.6_Silent_p.A1087A|DMBT1_ENST00000368909.3_Silent_p.A2367A|DMBT1_ENST00000368955.3_Silent_p.A2357A|DMBT1_ENST00000344338.3_Silent_p.A2357A|DMBT1_ENST00000330163.4_Silent_p.A1739A|DMBT1_ENST00000368956.2_Silent_p.A1739A			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2367	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.A2367A(1)|p.A2496A(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGTGCAGAGCGTATGACCCCT	0.597																																					p.A2367A	Ovarian(182;93 2026 18125 22222 38972)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G7101A	10						.						138.0	141.0	140.0					10																	124402773		2099	4229	6328	124392763	SO:0001819	synonymous_variant	1755	exon53				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.7101G>A	10.37:g.124402773G>A		Somatic		Capture	Illumina HiSeq	Phase_I	124392763	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37																																																																																					0.597	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
MUC6	4588	broad.mit.edu	37	11	1016171	1016171	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr11:1016171G>A	ENST00000421673.2	-	31	6680	c.6630C>T	c.(6628-6630)gcC>gcT	p.A2210A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2210	Ser-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.A2210A(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGGGAGAGTGGCCCTAATGG	0.552																																					p.A2210A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C6630T	11						.						39.0	46.0	44.0					11																	1016171		2133	4230	6363	1006171	SO:0001819	synonymous_variant	4588	exon31			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6630C>T	11.37:g.1016171G>A		Somatic		Capture	Illumina HiSeq	Phase_I	1006171	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
COPB1	1315	broad.mit.edu	37	11	14480188	14480188	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr11:14480188G>A	ENST00000249923.3	-	21	2992	c.2692C>T	c.(2692-2694)Cgt>Tgt	p.R898C	COPB1_ENST00000439561.2_Missense_Mutation_p.R898C	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	898					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.R898C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						AATATGGAACGAGCATAAAGG	0.428																																					p.R898C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2692T	11						.						78.0	82.0	81.0					11																	14480188		2200	4294	6494	14436764	SO:0001583	missense	1315	exon21			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2692C>T	11.37:g.14480188G>A	ENSP00000249923:p.Arg898Cys	Somatic		Capture	Illumina HiSeq	Phase_I	14436764	NM_016451	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	G	33	5.214267	0.95104	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.51325	0.71;0.71	5.63	5.63	0.86233	Coatomer, beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70649	0.3248	M	0.78285	2.405	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.73717	-0.3895	10	0.87932	D	0	.	19.6846	0.95976	0.0:0.0:1.0:0.0	.	898	P53618	COPB_HUMAN	C	898	ENSP00000249923:R898C;ENSP00000397873:R898C	ENSP00000249923:R898C	R	-	1	0	COPB1	14436764	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.498000	0.97972	2.644000	0.89710	0.655000	0.94253	CGT		0.428	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
KIAA1549L	25758	broad.mit.edu	37	11	33640191	33640191	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr11:33640191C>T	ENST00000321505.4	+	15	4681	c.4501C>T	c.(4501-4503)Cgc>Tgc	p.R1501C	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.R1507C			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1501						integral component of membrane (GO:0016021)		p.R1501C(1)									GCGTGGAATCCGCAACAGCGG	0.572																																					p.R1501C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4501T	11						.						18.0	20.0	20.0					11																	33640191		1874	4100	5974	33596767	SO:0001583	missense	25758	exon15			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4501C>T	11.37:g.33640191C>T	ENSP00000315295:p.Arg1501Cys	Somatic		Capture	Illumina HiSeq	Phase_I	33596767	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368575	0.82463	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000536568	.	.	.	5.09	4.15	0.48705	.	0.000000	0.64402	D	0.000002	T	0.75532	0.3862	L	0.57536	1.79	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.78362	-0.2233	9	0.72032	D	0.01	-9.5539	15.0323	0.71717	0.1433:0.8567:0.0:0.0	.	1507	E9PAT2	.	C	1501;1507;1340	.	ENSP00000315295:R1501C	R	+	1	0	C11orf41	33596767	1.000000	0.71417	0.962000	0.40283	0.979000	0.70002	5.692000	0.68256	1.212000	0.43366	0.561000	0.74099	CGC		0.572	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
OR8J1	219477	broad.mit.edu	37	11	56128087	56128087	+	Missense_Mutation	SNP	G	G	A	rs150618551		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr11:56128087G>A	ENST00000303039.3	+	1	397	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122H(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					GCCTATGACCGCTATGTGGCT	0.488																																					p.R122H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G365A	11						.						151.0	138.0	142.0					11																	56128087		2201	4296	6497	55884663	SO:0001583	missense	219477	exon1			AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.365G>A	11.37:g.56128087G>A	ENSP00000304060:p.Arg122His	Somatic		Capture	Illumina HiSeq	Phase_I	55884663	NM_001005205	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	37	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.815679	0.70912	.	.	ENSG00000172487	ENST00000303039	T	0.77489	-1.1	4.76	4.76	0.60689	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	T	0.78691	0.4323	M	0.81239	2.535	0.36780	D	0.884284	P	0.37914	0.611	B	0.34138	0.176	D	0.85921	0.1446	10	0.72032	D	0.01	.	16.6811	0.85291	0.0:0.0:1.0:0.0	.	122	Q8NGP2	OR8J1_HUMAN	H	122	ENSP00000304060:R122H	ENSP00000304060:R122H	R	+	2	0	OR8J1	55884663	0.991000	0.36638	1.000000	0.80357	0.901000	0.52897	5.972000	0.70448	2.358000	0.79984	0.643000	0.83706	CGC		0.488	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205	
SLCO2B1	11309	broad.mit.edu	37	11	74915494	74915494	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr11:74915494G>A	ENST00000289575.5	+	14	2394	c.1999G>A	c.(1999-2001)Gcc>Acc	p.A667T	SLCO2B1_ENST00000525650.1_Missense_Mutation_p.A523T|SLCO2B1_ENST00000341411.4_Missense_Mutation_p.A440T|SLCO2B1_ENST00000454962.2_Missense_Mutation_p.A440T|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.A645T|SLCO2B1_ENST00000532236.1_Missense_Mutation_p.A551T	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	667					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.A667T(1)		breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	GATCTGCTTCGCCTTAGTTTT	0.552																																					p.A523T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1567A	11						.						136.0	117.0	123.0					11																	74915494		2200	4293	6493	74593142	SO:0001583	missense	11309	exon11			AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1999G>A	11.37:g.74915494G>A	ENSP00000289575:p.Ala667Thr	Somatic		Capture	Illumina HiSeq	Phase_I	74593142	NM_001145212	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	G	7.632	0.679025	0.14841	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000525650;ENST00000454962;ENST00000428359	T;D;D;D;D;T	0.81659	0.19;-1.52;-1.52;-1.52;-1.52;0.19	5.6	-4.38	0.03622	Major facilitator superfamily domain, general substrate transporter (1);	0.713864	0.14091	N	0.341981	T	0.47078	0.1426	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.25955	0.085;0.138;0.085	B;B;B	0.19148	0.011;0.024;0.011	T	0.43360	-0.9396	10	0.21540	T	0.41	.	2.3005	0.04161	0.4841:0.126:0.2619:0.128	.	523;440;667	E9PPU8;O94956-2;O94956	.;.;SO2B1_HUMAN	T	667;440;551;523;440;645	ENSP00000289575:A667T;ENSP00000341286:A440T;ENSP00000434112:A551T;ENSP00000436324:A523T;ENSP00000389653:A440T;ENSP00000388912:A645T	ENSP00000289575:A667T	A	+	1	0	SLCO2B1	74593142	0.000000	0.05858	0.064000	0.19789	0.353000	0.29299	-0.427000	0.06999	-0.491000	0.06697	0.563000	0.77884	GCC		0.552	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
TMEM119	338773	broad.mit.edu	37	12	108985995	108985995	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:108985995C>T	ENST00000392806.3	-	2	333	c.165G>A	c.(163-165)ccG>ccA	p.P55P		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	55					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.P55P(1)		large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						TCCAGGGTGGCGGGAGGCTCG	0.706																																					p.P55P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G165A	12						.						18.0	23.0	22.0					12																	108985995		2201	4293	6494	107510124	SO:0001819	synonymous_variant	338773	exon2			AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.165G>A	12.37:g.108985995C>T		Somatic		Capture	Illumina HiSeq	Phase_I	107510124	NM_181724	Q6UXE5|Q8N2F5	Silent	SNP	ENST00000392806.3	37	CCDS9119.1																																																																																				0.706	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403900.1	NM_181724	
DYRK4	8798	broad.mit.edu	37	12	4705409	4705409	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:4705409A>T	ENST00000540757.2	+	5	537	c.377A>T	c.(376-378)aAc>aTc	p.N126I	DYRK4_ENST00000010132.5_Missense_Mutation_p.N126I|DYRK4_ENST00000543431.1_Missense_Mutation_p.N126I	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	126	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.N528I(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			GATCACAAAAACAATGAGCTG	0.542																																					p.N126I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A377T	12						.						128.0	127.0	128.0					12																	4705409		2203	4300	6503	4575670	SO:0001583	missense	8798	exon5			Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.377A>T	12.37:g.4705409A>T	ENSP00000441755:p.Asn126Ile	Somatic		Capture	Illumina HiSeq	Phase_I	4575670	NM_003845	A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	ENST00000540757.2	37	CCDS8530.1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.423839	0.43020	.	.	ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.240785	0.41097	D	0.000959	T	0.21186	0.0510	L	0.53561	1.675	0.80722	D	1	P;B;B	0.45474	0.859;0.321;0.068	B;B;B	0.43274	0.414;0.086;0.091	T	0.02567	-1.1140	10	0.37606	T	0.19	.	6.9773	0.24683	0.6734:0.1958:0.0:0.1308	.	241;126;126	F5H6L9;Q9NR20-2;Q9NR20	.;.;DYRK4_HUMAN	I	241;126;126;126	ENSP00000437534:N241I;ENSP00000441755:N126I;ENSP00000010132:N126I;ENSP00000439697:N126I	ENSP00000010132:N126I	N	+	2	0	DYRK4	4575670	0.996000	0.38824	1.000000	0.80357	0.989000	0.77384	1.820000	0.39032	2.124000	0.65301	0.533000	0.62120	AAC		0.542	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398780.2		
MFAP5	8076	broad.mit.edu	37	12	8808388	8808388	+	Missense_Mutation	SNP	C	C	A	rs375116825		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:8808388C>A	ENST00000359478.2	-	4	320	c.133G>T	c.(133-135)Gat>Tat	p.D45Y	MFAP5_ENST00000535336.1_Missense_Mutation_p.D45Y|MFAP5_ENST00000433590.2_Missense_Mutation_p.D45Y|MFAP5_ENST00000540087.1_Missense_Mutation_p.D45Y|MFAP5_ENST00000538107.1_5'UTR|MFAP5_ENST00000543369.1_Missense_Mutation_p.D33Y|MFAP5_ENST00000396549.2_Missense_Mutation_p.D45Y	NM_003480.2	NP_003471.1	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5	45					extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	extracellular matrix structural constituent (GO:0005201)	p.D45Y(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(5)|skin(1)	13	Lung SC(5;0.184)					TTACTAGGATCTTCTGTGAAT	0.368																																					p.D45Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G133T	12						.						115.0	122.0	119.0					12																	8808388		2203	4300	6503	8699655	SO:0001583	missense	8076	exon4			AK124368	CCDS8595.1, CCDS73437.1	12p13.1-p12.3	2004-04-05				ENSG00000197614			29673	protein-coding gene	gene with protein product		601103				9792630, 8557636	Standard	XM_005253485		Approved	MAGP2, MP25	uc001qut.1	Q13361		ENST00000359478.2:c.133G>T	12.37:g.8808388C>A	ENSP00000352455:p.Asp45Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	8699655	NM_003480	B0AZL6|D3DUV1|Q7Z490	Missense_Mutation	SNP	ENST00000359478.2	37	CCDS8595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.40|18.40	3.615817|3.615817	0.66672|0.66672	.|.	.|.	ENSG00000197614|ENSG00000197614	ENST00000359478;ENST00000433590;ENST00000396549;ENST00000543369;ENST00000535336;ENST00000540087;ENST00000544889|ENST00000535411	.|.	.|.	.|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	0.000000|.	0.56097|.	D|.	0.000027|.	T|T	0.66257|0.66257	0.2771|0.2771	M|M	0.63428|0.63428	1.95|1.95	0.39109|0.39109	D|D	0.96143|0.96143	D;D;D|.	0.89917|.	0.999;1.0;0.999|.	D;D;D|.	0.72338|.	0.964;0.977;0.964|.	T|T	0.66674|0.66674	-0.5864|-0.5864	9|5	0.21540|.	T|.	0.41|.	-23.2345|-23.2345	13.6148|13.6148	0.62101|0.62101	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	45;45;45|.	B3KW70;Q13361;Q7Z490|.	.;MFAP5_HUMAN;.|.	Y|N	45;45;45;33;45;45;45|34	.|.	ENSP00000352455:D45Y|.	D|K	-|-	1|3	0|2	MFAP5|MFAP5	8699655|8699655	0.989000|0.989000	0.36119|0.36119	0.998000|0.998000	0.56505|0.56505	0.829000|0.829000	0.46940|0.46940	3.340000|3.340000	0.52143|0.52143	2.657000|2.657000	0.90304|0.90304	0.591000|0.591000	0.81541|0.81541	GAT|AAG		0.368	MFAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400656.2	NM_003480	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TMTC1	83857	broad.mit.edu	37	12	29904772	29904772	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:29904772C>G	ENST00000539277.1	-	5	823	c.765G>C	c.(763-765)caG>caC	p.Q255H	TMTC1_ENST00000552618.1_Missense_Mutation_p.Q255H|TMTC1_ENST00000381224.2_Missense_Mutation_p.Q147H|TMTC1_ENST00000551659.1_Missense_Mutation_p.Q255H|TMTC1_ENST00000256062.5_Missense_Mutation_p.Q147H	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	255						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.Q147H(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TCCCGGGCTGCTGTGGGCTGC	0.597																																					p.Q255H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G765C	12						.						27.0	25.0	25.0					12																	29904772		2202	4299	6501	29796039	SO:0001583	missense	83857	exon5				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.765G>C	12.37:g.29904772C>G	ENSP00000442046:p.Gln255His	Somatic		Capture	Illumina HiSeq	Phase_I	29796039	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141176	0.37825	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.68765	-0.32;-0.11;-0.35;-0.2;1.48	4.55	4.55	0.56014	.	0.962934	0.08569	N	0.926287	T	0.57740	0.2074	N	0.22421	0.69	0.26018	N	0.981907	B;P	0.42941	0.001;0.794	B;B	0.41619	0.001;0.361	T	0.50466	-0.8825	9	.	.	.	-0.2949	14.9144	0.70785	0.0:1.0:0.0:0.0	.	147;255	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	H	147;255;255;255;147	ENSP00000256062:Q147H;ENSP00000448112:Q255H;ENSP00000449043:Q255H;ENSP00000442046:Q255H;ENSP00000370622:Q147H	.	Q	-	3	2	TMTC1	29796039	0.727000	0.28069	0.259000	0.24435	0.165000	0.22458	2.614000	0.46359	2.468000	0.83385	0.555000	0.69702	CAG		0.597	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
NELL2	4753	broad.mit.edu	37	12	44915941	44915941	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:44915941G>A	ENST00000429094.2	-	18	2521	c.2017C>T	c.(2017-2019)Cga>Tga	p.R673*	NELL2_ENST00000551601.1_Nonsense_Mutation_p.R625*|NELL2_ENST00000452445.2_Nonsense_Mutation_p.R673*|NELL2_ENST00000549027.1_Nonsense_Mutation_p.R672*|NELL2_ENST00000437801.2_Nonsense_Mutation_p.R723*|NELL2_ENST00000333837.4_Nonsense_Mutation_p.R696*|NELL2_ENST00000395487.2_Nonsense_Mutation_p.R672*	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	673	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R673*(1)|p.R723*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ACCATCCGTCGACACATAACG	0.438																																					p.R673X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2017T	12						.						92.0	85.0	88.0					12																	44915941		2203	4300	6503	43202208	SO:0001587	stop_gained	4753	exon18			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.2017C>T	12.37:g.44915941G>A	ENSP00000390680:p.Arg673*	Somatic		Capture	Illumina HiSeq	Phase_I	43202208	NM_001145108	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Nonsense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	G	40	8.465419	0.98822	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7144	19.8383	0.96670	0.0:0.0:1.0:0.0	.	.	.	.	X	672;673;625;673;672;696;723	.	ENSP00000327988:R696X	R	-	1	2	NELL2	43202208	1.000000	0.71417	0.977000	0.42913	0.926000	0.56050	4.502000	0.60400	2.683000	0.91414	0.650000	0.86243	CGA		0.438	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
AVIL	10677	broad.mit.edu	37	12	58191764	58191764	+	Silent	SNP	T	T	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:58191764T>C	ENST00000257861.3	-	19	2791	c.2361A>G	c.(2359-2361)gaA>gaG	p.E787E	TSFM_ENST00000550559.1_Intron|TSFM_ENST00000548851.1_Intron|TSFM_ENST00000543727.1_Intron|AVIL_ENST00000537081.1_Silent_p.E780E	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	787	HP. {ECO:0000255|PROSITE- ProRule:PRU00595}.|Headpiece. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)	p.E787E(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					CAAAGTCCTGTTCAGAGAGGT	0.428																																					p.E787E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2361G	12						.						79.0	78.0	79.0					12																	58191764		2203	4300	6503	56478031	SO:0001819	synonymous_variant	10677	exon19			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.2361A>G	12.37:g.58191764T>C		Somatic		Capture	Illumina HiSeq	Phase_I	56478031	NM_006576	B2RAU7|Q2NKM9	Silent	SNP	ENST00000257861.3	37	CCDS8959.1																																																																																				0.428	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1	NM_006576	
KNTC1	9735	broad.mit.edu	37	12	123098273	123098273	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr12:123098273A>G	ENST00000333479.7	+	55	6019	c.5842A>G	c.(5842-5844)Aag>Gag	p.K1948E	KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000450485.2_Missense_Mutation_p.K873E|KNTC1_ENST00000537348.1_Missense_Mutation_p.K373E	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1948					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.K1948E(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AGGAATGATTAAGGGTCTGTG	0.418																																					p.K1948E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5842G	12						.						84.0	76.0	78.0					12																	123098273		1850	4110	5960	121664226	SO:0001583	missense	9735	exon55				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.5842A>G	12.37:g.123098273A>G	ENSP00000328236:p.Lys1948Glu	Somatic		Capture	Illumina HiSeq	Phase_I	121664226	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.890234	0.91889	.	.	ENSG00000184445	ENST00000450485;ENST00000333479;ENST00000537348;ENST00000546125	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.81	5.81	0.92471	RZZ complex, subunit KNTC1/ROD, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71484	0.3345	M	0.67953	2.075	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.994;0.999	T	0.74293	-0.3712	10	0.72032	D	0.01	-25.1367	16.1738	0.81836	1.0:0.0:0.0:0.0	.	873;1948	E7ES84;P50748	.;KNTC1_HUMAN	E	873;1948;373;109	ENSP00000397992:K873E;ENSP00000328236:K1948E;ENSP00000443622:K373E;ENSP00000439119:K109E	ENSP00000328236:K1948E	K	+	1	0	KNTC1	121664226	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	8.811000	0.91954	2.221000	0.72209	0.455000	0.32223	AAG		0.418	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
LNX2	222484	broad.mit.edu	37	13	28136720	28136720	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr13:28136720C>A	ENST00000316334.3	-	5	1183	c.1054G>T	c.(1054-1056)Ggc>Tgc	p.G352C		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	352	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)	p.G352C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		AATTTAATGCCAAGCTGTTCA	0.507																																					p.G352C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1054T	13						.						112.0	112.0	112.0					13																	28136720		2203	4300	6503	27034720	SO:0001583	missense	222484	exon5			AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1054G>T	13.37:g.28136720C>A	ENSP00000325929:p.Gly352Cys	Somatic		Capture	Illumina HiSeq	Phase_I	27034720	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	ENST00000316334.3	37	CCDS9323.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892297	0.91889	.	.	ENSG00000139517	ENST00000316334	D	0.90324	-2.65	5.88	5.88	0.94601	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	D	0.97898	0.9309	H	0.99425	4.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98931	1.0787	10	0.87932	D	0	.	20.2422	0.98381	0.0:1.0:0.0:0.0	.	352	Q8N448	LNX2_HUMAN	C	352	ENSP00000325929:G352C	ENSP00000325929:G352C	G	-	1	0	LNX2	27034720	1.000000	0.71417	0.969000	0.41365	0.987000	0.75469	7.283000	0.78640	2.782000	0.95742	0.655000	0.94253	GGC		0.507	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
FREM2	341640	broad.mit.edu	37	13	39265590	39265590	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr13:39265590T>G	ENST00000280481.7	+	1	4325	c.4109T>G	c.(4108-4110)tTt>tGt	p.F1370C		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1370					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F1370C(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGCATGAATTTTACCCAGGAT	0.383																																					p.F1370C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4109G	13						.						68.0	66.0	66.0					13																	39265590		2203	4300	6503	38163590	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4109T>G	13.37:g.39265590T>G	ENSP00000280481:p.Phe1370Cys	Somatic		Capture	Illumina HiSeq	Phase_I	38163590	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.452075	0.63290	.	.	ENSG00000150893	ENST00000280481	T	0.66099	-0.19	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.81375	0.4809	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83326	-0.0015	10	0.51188	T	0.08	.	16.1699	0.81801	0.0:0.0:0.0:1.0	.	1370	Q5SZK8	FREM2_HUMAN	C	1370	ENSP00000280481:F1370C	ENSP00000280481:F1370C	F	+	2	0	FREM2	38163590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.036000	0.88901	2.217000	0.71921	0.533000	0.62120	TTT		0.383	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PCDH9	5101	broad.mit.edu	37	13	67799981	67799981	+	Missense_Mutation	SNP	C	C	A	rs376104811		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr13:67799981C>A	ENST00000377865.2	-	1	2726	c.2592G>T	c.(2590-2592)aaG>aaT	p.K864N	PCDH9_ENST00000328454.5_Missense_Mutation_p.K864N|PCDH9_ENST00000456367.1_Missense_Mutation_p.K864N|PCDH9_ENST00000544246.1_Missense_Mutation_p.K864N|PCDH9_ENST00000377861.3_Missense_Mutation_p.K864N			Q9HC56	PCDH9_HUMAN	protocadherin 9	864					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K864N(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TCTTGTTTTGCTTGTTCTCCT	0.463																																					p.K864N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2592T	13						.						88.0	91.0	90.0					13																	67799981		2203	4300	6503	66697982	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.2592G>T	13.37:g.67799981C>A	ENSP00000367096:p.Lys864Asn	Somatic		Capture	Illumina HiSeq	Phase_I	66697982	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292833	0.40594	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	5.87	-4.97	0.03029	Protocadherin (1);	0.000000	0.85682	D	0.000000	T	0.43433	0.1247	L	0.49778	1.585	0.53005	D	0.999963	P;P;P;P	0.51240	0.943;0.772;0.93;0.943	P;P;P;P	0.55508	0.777;0.602;0.669;0.777	T	0.53899	-0.8373	10	0.62326	D	0.03	.	17.525	0.87798	0.0:0.6116:0.0:0.3884	.	864;864;864;864	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	N	864	ENSP00000442186:K864N;ENSP00000367096:K864N;ENSP00000401699:K864N;ENSP00000332060:K864N;ENSP00000367092:K864N	ENSP00000332060:K864N	K	-	3	2	PCDH9	66697982	0.331000	0.24713	0.975000	0.42487	0.978000	0.69477	-0.298000	0.08265	-0.616000	0.05671	-0.238000	0.12139	AAG		0.463	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
SLC10A2	6555	broad.mit.edu	37	13	103710674	103710674	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr13:103710674G>T	ENST00000245312.3	-	2	1032	c.436C>A	c.(436-438)Ctt>Att	p.L146I		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	146					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.L146I(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GTATAGATAAGGAGGCACAGC	0.483																																					p.L146I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C436A	13						.						135.0	113.0	120.0					13																	103710674		2203	4300	6503	102508675	SO:0001583	missense	6555	exon2			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.436C>A	13.37:g.103710674G>T	ENSP00000245312:p.Leu146Ile	Somatic		Capture	Illumina HiSeq	Phase_I	102508675	NM_000452	A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598617	0.46318	.	.	ENSG00000125255	ENST00000245312	T	0.11604	2.76	5.74	0.419	0.16438	.	0.747635	0.14045	N	0.345160	T	0.18718	0.0449	M	0.77616	2.38	0.09310	N	1	B	0.27229	0.172	B	0.38755	0.281	T	0.26849	-1.0091	10	0.48119	T	0.1	-6.6458	9.4832	0.38913	0.5564:0.0:0.4436:0.0	.	146	Q12908	NTCP2_HUMAN	I	146	ENSP00000245312:L146I	ENSP00000245312:L146I	L	-	1	0	SLC10A2	102508675	0.722000	0.28017	0.014000	0.15608	0.967000	0.64934	0.972000	0.29409	-0.064000	0.13043	0.563000	0.77884	CTT		0.483	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
YLPM1	56252	broad.mit.edu	37	14	75283781	75283781	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr14:75283781T>C	ENST00000552421.1	+	13	3839	c.3715T>C	c.(3715-3717)Tgg>Cgg	p.W1239R	YLPM1_ENST00000238571.3_Missense_Mutation_p.W1710R|YLPM1_ENST00000325680.7_Missense_Mutation_p.W1945R			P49750	YLPM1_HUMAN	YLP motif containing 1	1750					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.W1945R(1)|p.W1710R(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TGACCAGTTTTGGAGTGCAGC	0.358																																					p.W1945R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T5833C	14						.						67.0	60.0	63.0					14																	75283781		1857	4096	5953	74353534	SO:0001583	missense	56252	exon14			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.3715T>C	14.37:g.75283781T>C	ENSP00000447921:p.Trp1239Arg	Somatic		Capture	Illumina HiSeq	Phase_I	74353534	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	37		.	.	.	.	.	.	.	.	.	.	T	22.3	4.277590	0.80580	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680;ENST00000547879	T;T;T	0.38560	1.13;1.13;1.13	6.02	6.02	0.97574	.	0.000000	0.64402	D	0.000012	T	0.66187	0.2764	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	0.978;1.0	D;D	0.87578	0.986;0.998	T	0.69573	-0.5109	10	0.87932	D	0	-4.2554	16.5446	0.84426	0.0:0.0:0.0:1.0	.	1750;1945	P49750-3;P49750-4	.;.	R	1239;1945;1710;1658;354	ENSP00000447921:W1239R;ENSP00000324463:W1945R;ENSP00000448367:W354R	ENSP00000238571:W1710R	W	+	1	0	YLPM1	74353534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.311000	0.77944	0.533000	0.62120	TGG		0.358	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
TDP1	55775	broad.mit.edu	37	14	90429605	90429605	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr14:90429605C>T	ENST00000335725.4	+	3	397	c.147C>T	c.(145-147)tcC>tcT	p.S49S	TDP1_ENST00000393454.2_Silent_p.S49S|TDP1_ENST00000555880.1_Silent_p.S49S|TDP1_ENST00000393452.3_Silent_p.S49S|TDP1_ENST00000555565.1_Intron|TDP1_ENST00000357382.3_5'UTR	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	49					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)	p.S49S(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		ACACCTGTTCCGAGGCCCAGA	0.478								Repair of DNA-protein crosslinks																													p.S49S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C147T	14						.						114.0	107.0	109.0					14																	90429605		2203	4300	6503	89499358	SO:0001819	synonymous_variant	55775	exon2			AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.147C>T	14.37:g.90429605C>T		Somatic		Capture	Illumina HiSeq	Phase_I	89499358	NM_001008744	Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Silent	SNP	ENST00000335725.4	37	CCDS9888.1																																																																																				0.478	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319	
LTK	4058	broad.mit.edu	37	15	41796575	41796575	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr15:41796575C>T	ENST00000263800.6	-	19	2407	c.2311G>A	c.(2311-2313)Gcc>Acc	p.A771T	LTK_ENST00000355166.5_Missense_Mutation_p.A710T|LTK_ENST00000561619.1_Missense_Mutation_p.A469T|LTK_ENST00000453182.2_Missense_Mutation_p.A641T	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	771	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A710T(1)|p.A771T(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		AAGATGCTGGCAAAGCTAGGG	0.582										TSP Lung(18;0.14)																											p.A771T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2311A	15						.						75.0	67.0	70.0					15																	41796575		2203	4300	6503	39583867	SO:0001583	missense	4058	exon19			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.2311G>A	15.37:g.41796575C>T	ENSP00000263800:p.Ala771Thr	Somatic		Capture	Illumina HiSeq	Phase_I	39583867	NM_002344	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	ENST00000263800.6	37	CCDS10077.1	.	.	.	.	.	.	.	.	.	.	C	14.37	2.514423	0.44763	.	.	ENSG00000062524	ENST00000355166;ENST00000263800;ENST00000453182	D;D;D	0.82803	-1.65;-1.65;-1.65	5.04	3.16	0.36331	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.263067	0.19717	U	0.107678	T	0.66416	0.2787	L	0.31578	0.945	0.24952	N	0.991785	B;B;P;P	0.37141	0.222;0.267;0.529;0.584	B;B;B;B	0.32465	0.119;0.057;0.082;0.146	T	0.53592	-0.8417	10	0.19590	T	0.45	.	4.6061	0.12378	0.2615:0.5685:0.0:0.1699	.	641;641;710;771	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	T	710;771;641	ENSP00000347293:A710T;ENSP00000263800:A771T;ENSP00000392196:A641T	ENSP00000263800:A771T	A	-	1	0	LTK	39583867	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	1.255000	0.32909	0.724000	0.32296	0.655000	0.94253	GCC		0.582	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
DTWD1	56986	broad.mit.edu	37	15	49935670	49935670	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr15:49935670C>A	ENST00000251250.6	+	6	1017	c.810C>A	c.(808-810)taC>taA	p.Y270*	DTWD1_ENST00000403028.3_Nonsense_Mutation_p.Y270*|DTWD1_ENST00000415425.1_Nonsense_Mutation_p.Y183*|DTWD1_ENST00000558653.1_Nonsense_Mutation_p.Y270*	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	270								p.Y270*(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		AAGAGAAATACAGAGGGCAAT	0.343																																					p.Y270X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C810A	15						.						66.0	72.0	70.0					15																	49935670		2195	4289	6484	47722962	SO:0001587	stop_gained	56986	exon5			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.810C>A	15.37:g.49935670C>A	ENSP00000251250:p.Tyr270*	Somatic		Capture	Illumina HiSeq	Phase_I	47722962	NM_001144955	Q567Q3|Q8WVG9|Q9NRU6	Nonsense_Mutation	SNP	ENST00000251250.6	37	CCDS10132.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967132	0.92855	.	.	ENSG00000104047	ENST00000403028;ENST00000251250;ENST00000415425	.	.	.	5.51	2.59	0.31030	.	0.173527	0.52532	D	0.000067	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.317	9.3768	0.38288	0.0:0.7233:0.0:0.2767	.	.	.	.	X	270;270;183	.	.	Y	+	3	2	DTWD1	47722962	0.997000	0.39634	0.998000	0.56505	0.995000	0.86356	2.086000	0.41643	0.707000	0.31934	0.650000	0.86243	TAC		0.343	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254431.2	NM_020234	
MYO5A	4644	broad.mit.edu	37	15	52720718	52720718	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr15:52720718G>A	ENST00000399231.3	-	3	430	c.187C>T	c.(187-189)Cga>Tga	p.R63*	MYO5A_ENST00000399233.2_Nonsense_Mutation_p.R63*|MYO5A_ENST00000553916.1_Nonsense_Mutation_p.R63*|MYO5A_ENST00000356338.6_Nonsense_Mutation_p.R63*|MYO5A_ENST00000358212.6_Nonsense_Mutation_p.R63*	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	63					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.R63*(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TCAGGATTTCGTAAGTGAGGC	0.448																																					p.R63X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C187T	15						.						179.0	164.0	169.0					15																	52720718		1979	4164	6143	50508010	SO:0001587	stop_gained	4644	exon3				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.187C>T	15.37:g.52720718G>A	ENSP00000382177:p.Arg63*	Somatic		Capture	Illumina HiSeq	Phase_I	50508010	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Nonsense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	G	34	5.353266	0.95830	.	.	ENSG00000197535	ENST00000399231;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000553916	.	.	.	5.76	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7549	0.57328	0.0:0.0:0.621:0.379	.	.	.	.	X	63	.	ENSP00000348693:R63X	R	-	1	2	MYO5A	50508010	0.376000	0.25098	0.993000	0.49108	0.951000	0.60555	0.627000	0.24506	1.295000	0.44724	0.655000	0.94253	CGA		0.448	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
ONECUT1	3175	broad.mit.edu	37	15	53081039	53081039	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr15:53081039C>T	ENST00000305901.5	-	1	1170	c.1043G>A	c.(1042-1044)cGg>cAg	p.R348Q	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	348					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R348Q(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		CCACATCCTCCGGAAGGTCTC	0.667																																					p.R348Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1043A	15						.						46.0	48.0	47.0					15																	53081039		2194	4293	6487	50868331	SO:0001583	missense	3175	exon1			U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.1043G>A	15.37:g.53081039C>T	ENSP00000302630:p.Arg348Gln	Somatic		Capture	Illumina HiSeq	Phase_I	50868331	NM_004498	B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	ENST00000305901.5	37	CCDS10150.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169143	0.78339	.	.	ENSG00000169856	ENST00000305901	T	0.51817	0.69	4.6	3.69	0.42338	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.068936	0.64402	D	0.000016	T	0.64148	0.2572	M	0.73372	2.23	0.80722	D	1	D	0.64830	0.994	D	0.69307	0.963	T	0.66716	-0.5853	10	0.62326	D	0.03	-15.1015	11.4578	0.50191	0.0:0.9113:0.0:0.0887	.	348	Q9UBC0	HNF6_HUMAN	Q	348	ENSP00000302630:R348Q	ENSP00000302630:R348Q	R	-	2	0	ONECUT1	50868331	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.598000	0.82745	1.148000	0.42385	0.514000	0.50259	CGG		0.667	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254849.2		
RFX7	64864	broad.mit.edu	37	15	56386996	56386996	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr15:56386996C>T	ENST00000559447.2	-	9	2910	c.2639G>A	c.(2638-2640)cGg>cAg	p.R880Q	RFX7_ENST00000422057.1_Missense_Mutation_p.R880Q|RFX7_ENST00000423270.1_Missense_Mutation_p.R977Q|RFX7_ENST00000317318.6_Missense_Mutation_p.R977Q			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	880					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R880Q(1)|p.R977Q(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGGGCTCTCCCGTGACAGACT	0.547																																					p.R977Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2930A	15						.						64.0	64.0	64.0					15																	56386996		2016	4169	6185	54174288	SO:0001583	missense	64864	exon9					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.2639G>A	15.37:g.56386996C>T	ENSP00000453281:p.Arg880Gln	Somatic		Capture	Illumina HiSeq	Phase_I	54174288	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	37		.	.	.	.	.	.	.	.	.	.	C	17.15	3.316316	0.60524	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.58210	0.36;0.35;0.36	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000001	T	0.57359	0.2048	L	0.27053	0.805	0.39524	D	0.968567	D;D	0.76494	0.999;0.998	P;P	0.56751	0.805;0.662	T	0.56559	-0.7959	10	0.41790	T	0.15	-15.7083	19.2409	0.93883	0.0:1.0:0.0:0.0	.	880;880	Q2KHR2;C9JU50	RFX7_HUMAN;.	Q	880;977;977	ENSP00000387504:R880Q;ENSP00000313299:R977Q;ENSP00000397644:R977Q	ENSP00000313299:R977Q	R	-	2	0	RFX7	54174288	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.548000	0.67255	2.788000	0.95919	0.557000	0.71058	CGG		0.547	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
PRC1	9055	broad.mit.edu	37	15	91513739	91513739	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr15:91513739G>A	ENST00000361188.5	-	12	2678	c.1467C>T	c.(1465-1467)aaC>aaT	p.N489N	PRC1_ENST00000442656.2_Silent_p.N448N|PRC1_ENST00000361919.3_Silent_p.N489N|PRC1_ENST00000394249.3_Silent_p.N489N|PRC1-AS1_ENST00000556200.1_RNA|PRC1-AS1_ENST00000554388.1_RNA					protein regulator of cytokinesis 1									p.N489N(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					TGGTGGTAGTGTTCAGCTAGG	0.512																																					p.N489N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1467T	15						.						203.0	148.0	167.0					15																	91513739		2198	4298	6496	89314743	SO:0001819	synonymous_variant	9055	exon12			AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1467C>T	15.37:g.91513739G>A		Somatic		Capture	Illumina HiSeq	Phase_I	89314743	NM_003981		Silent	SNP	ENST00000361188.5	37	CCDS45352.1																																																																																				0.512	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981	
IGF1R	3480	broad.mit.edu	37	15	99456415	99456415	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr15:99456415G>A	ENST00000268035.6	+	8	2343	c.1732G>A	c.(1732-1734)Gcc>Acc	p.A578T	IGF1R_ENST00000558762.1_Missense_Mutation_p.A578T	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	578	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)	p.A578T(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GACTCAGTACGCCGTTTACGT	0.567																																					p.A578T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1732A	15						.						142.0	99.0	113.0					15																	99456415		2197	4297	6494	97273938	SO:0001583	missense	3480	exon8			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.1732G>A	15.37:g.99456415G>A	ENSP00000268035:p.Ala578Thr	Somatic		Capture	Illumina HiSeq	Phase_I	97273938	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	35	5.568978	0.96540	.	.	ENSG00000140443	ENST00000268035	T	0.70045	-0.45	4.73	4.73	0.59995	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000023	D	0.85344	0.5675	M	0.90759	3.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.88536	0.3106	10	0.87932	D	0	.	18.2545	0.90015	0.0:0.0:1.0:0.0	.	578;578	C9J5X1;P08069	.;IGF1R_HUMAN	T	578	ENSP00000268035:A578T	ENSP00000268035:A578T	A	+	1	0	IGF1R	97273938	1.000000	0.71417	0.196000	0.23383	0.967000	0.64934	9.580000	0.98207	2.614000	0.88457	0.563000	0.77884	GCC		0.567	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
CREBBP	1387	broad.mit.edu	37	16	3779624	3779624	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr16:3779624G>T	ENST00000262367.5	-	31	6233	c.5424C>A	c.(5422-5424)tgC>tgA	p.C1808*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.C1770*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1808	Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.C1808*(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCTTGCGTTTGCAGCCCTTGG	0.632			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.C1808X			Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C5424A	16						.						99.0	84.0	89.0					16																	3779624		2197	4300	6497	3719625	SO:0001587	stop_gained	1387	exon31			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5424C>A	16.37:g.3779624G>T	ENSP00000262367:p.Cys1808*	Somatic		Capture	Illumina HiSeq	Phase_I	3719625	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	g	49	15.156902	0.99824	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	.	.	.	5.35	0.0163	0.14107	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.303	10.2406	0.43310	0.3264:0.0:0.6736:0.0	.	.	.	.	X	1808;1838;1770;343	.	ENSP00000262367:C1808X	C	-	3	2	CREBBP	3719625	1.000000	0.71417	0.994000	0.49952	0.894000	0.52154	2.352000	0.44080	-0.202000	0.10268	-0.948000	0.02665	TGC		0.632	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
RNF40	9810	broad.mit.edu	37	16	30783432	30783432	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr16:30783432G>A	ENST00000324685.6	+	19	3185	c.2750G>A	c.(2749-2751)cGc>cAc	p.R917H	RNF40_ENST00000357890.5_Missense_Mutation_p.R817H|RNF40_ENST00000402121.3_Missense_Mutation_p.R609H|RNF40_ENST00000563683.1_Missense_Mutation_p.R877H|RNF40_ENST00000567365.1_3'UTR	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	917					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R917H(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			CGGCTGCGGCGCAAGCTGGAA	0.612																																					p.R917H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2750A	16						.						44.0	30.0	34.0					16																	30783432		2164	4257	6421	30690933	SO:0001583	missense	9810	exon19			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.2750G>A	16.37:g.30783432G>A	ENSP00000325677:p.Arg917His	Somatic		Capture	Illumina HiSeq	Phase_I	30690933	NM_014771	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	37	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	g	28.2	4.903444	0.92035	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121;ENST00000538323	T;T;T	0.35421	1.31;1.32;1.33	5.57	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.58509	0.2127	M	0.75777	2.31	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;0.996;0.999;1.0;1.0	D;D;D;D;D	0.70487	0.969;0.91;0.956;0.964;0.964	T	0.63633	-0.6593	10	0.87932	D	0	-17.2365	13.1236	0.59340	0.0783:0.0:0.9217:0.0	.	249;609;817;916;917	F6SYU7;F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;.;BRE1B_HUMAN	H	917;817;609;249	ENSP00000325677:R917H;ENSP00000350563:R817H;ENSP00000384942:R609H	ENSP00000325677:R917H	R	+	2	0	RNF40	30690933	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.462000	0.97649	1.361000	0.45981	0.651000	0.88453	CGC		0.612	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	NM_014771	
TERF2	7014	broad.mit.edu	37	16	69390900	69390900	+	Silent	SNP	T	T	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr16:69390900T>C	ENST00000254942.3	-	10	1546	c.1530A>G	c.(1528-1530)ggA>ggG	p.G510G	TERF2_ENST00000603068.1_Silent_p.G468G|RP11-343C2.9_ENST00000563634.1_5'Flank	NM_005652.3	NP_005643.2	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2	510	HTH myb-type. {ECO:0000255|PROSITE- ProRule:PRU00625}.				age-dependent telomere shortening (GO:0001309)|cell cycle (GO:0007049)|cellular senescence (GO:0090398)|in utero embryonic development (GO:0001701)|negative regulation of telomere maintenance (GO:0032205)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|positive regulation of telomere maintenance (GO:0032206)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)|telomeric loop formation (GO:0031627)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded telomeric DNA binding (GO:0003691)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)	p.G468G(1)		NS(2)|breast(1)|large_intestine(3)|lung(1)	7		Ovarian(137;0.101)				CAGCCCAGTTTCCTTCCCCAT	0.433																																					p.G468G	Ovarian(13;63 524 30420 31710 34037)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1404G	16						.						118.0	120.0	119.0					16																	69390900		2198	4300	6498	67948401	SO:0001819	synonymous_variant	7014	exon10				CCDS10879.1, CCDS10879.2	16q22.1	2008-02-05			ENSG00000132604	ENSG00000132604			11729	protein-coding gene	gene with protein product		602027		TRBF2		9326950, 10226653	Standard	NM_005652		Approved	TRF2	uc002exd.4	Q15554	OTTHUMG00000137566	ENST00000254942.3:c.1530A>G	16.37:g.69390900T>C		Somatic		Capture	Illumina HiSeq	Phase_I	67948401	NM_005652		Silent	SNP	ENST00000254942.3	37																																																																																					0.433	TERF2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000268944.2		
WFDC1	58189	broad.mit.edu	37	16	84351894	84351894	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr16:84351894G>A	ENST00000219454.5	+	3	680	c.354G>A	c.(352-354)gtG>gtA	p.V118V	WFDC1_ENST00000568638.1_Silent_p.V118V	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	118					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V118V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						ACTGGCTGGTGCAGCCGAAAC	0.602																																					p.V118V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G354A	16						.						101.0	82.0	88.0					16																	84351894		2200	4300	6500	82909395	SO:0001819	synonymous_variant	58189	exon3			AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.354G>A	16.37:g.84351894G>A		Somatic		Capture	Illumina HiSeq	Phase_I	82909395	NM_021197	D3DUL7|Q8NC27|Q9HAU1	Silent	SNP	ENST00000219454.5	37	CCDS10946.1																																																																																				0.602	WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269083.2		
TUBB3	10381	broad.mit.edu	37	16	90001161	90001161	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr16:90001161G>T	ENST00000315491.7	+	4	425	c.302G>T	c.(301-303)tGg>tTg	p.W101L	TUBB3_ENST00000556922.1_Missense_Mutation_p.W448L|TUBB3_ENST00000555576.1_Intron|TUBB3_ENST00000304984.5_Missense_Mutation_p.W29L|TUBB3_ENST00000554444.1_Missense_Mutation_p.W29L	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	101					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.W101L(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	GGCAACAACTGGGCCAAGGGT	0.622																																					p.W101L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G302T	16						.						51.0	49.0	50.0					16																	90001161		2198	4300	6498	88528662	SO:0001583	missense	10381	exon4			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.302G>T	16.37:g.90001161G>T	ENSP00000320295:p.Trp101Leu	Somatic		Capture	Illumina HiSeq	Phase_I	88528662	NM_006086	A8K854|Q9BTZ0|Q9BW10	Missense_Mutation	SNP	ENST00000315491.7	37	CCDS10988.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286188	0.59867	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000198211;ENSG00000198211;ENSG00000198211;ENSG00000198211	ENST00000556922;ENST00000555399;ENST00000304984;ENST00000555810;ENST00000554444;ENST00000556565;ENST00000315491	T;T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72;-0.72	4.72	4.72	0.59763	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.47852	D	0.000220	D	0.91019	0.7175	H	0.99273	4.495	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.97110	0.989;1.0	D	0.94936	0.8087	9	.	.	.	.	16.8149	0.85732	0.0:0.0:1.0:0.0	.	101;101	Q13509;B2RBD5	TBB3_HUMAN;.	L	448;101;29;29;29;29;101	ENSP00000451560:W448L;ENSP00000302777:W29L;ENSP00000450538:W29L;ENSP00000451617:W29L;ENSP00000452166:W29L;ENSP00000320295:W101L	.	W	+	2	0	RP11-566K11.2;TUBB3	88528662	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.640000	0.98453	2.332000	0.79248	0.561000	0.74099	TGG		0.622	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272874.1	NM_006086	
MYH1	4619	broad.mit.edu	37	17	10419516	10419516	+	Splice_Site	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr17:10419516G>A	ENST00000226207.5	-	4	442	c.348C>T	c.(346-348)taC>taT	p.Y116Y	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	116	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Y116Y(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						AAGAACTCACGTAGATCATCC	0.438																																					p.Y116Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C348T	17						.						207.0	182.0	190.0					17																	10419516		2203	4300	6503	10360241	SO:0001630	splice_region_variant	4619	exon4				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.348+1C>T	17.37:g.10419516G>A		Somatic		Capture	Illumina HiSeq	Phase_I	10360241	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																				0.438	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	Silent
COL1A1	1277	broad.mit.edu	37	17	48267388	48267388	+	Missense_Mutation	SNP	C	C	T	rs72653136		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr17:48267388C>T	ENST00000225964.5	-	36	2651	c.2533G>A	c.(2533-2535)Gga>Aga	p.G845R		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	845	Triple-helical region.		G -> R (in OI2). {ECO:0000269|PubMed:18996919}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G845R(1)	COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	CCAGCGGGTCCGGCAGGGCCA	0.677			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.G845R			Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2533A	17	GRCh37	CM090258|CM880015	COL1A1	M	rs72653136	.						42.0	49.0	46.0					17																	48267388		2201	4299	6500	45622387	SO:0001583	missense	1277	exon36			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2533G>A	17.37:g.48267388C>T	ENSP00000225964:p.Gly845Arg	Somatic		Capture	Illumina HiSeq	Phase_I	45622387	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	37	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383611	0.82792	.	.	ENSG00000108821	ENST00000225964	D	0.99353	-5.77	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.99732	0.9895	H	0.99312	4.51	0.80722	A	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96980	0.9714	9	0.87932	D	0	.	17.6284	0.88099	0.0:1.0:0.0:0.0	.	845	P02452	CO1A1_HUMAN	R	845	ENSP00000225964:G845R	ENSP00000225964:G845R	G	-	1	0	COL1A1	45622387	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	7.770000	0.85390	2.477000	0.83638	0.313000	0.20887	GGA		0.677	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
GATA6	2627	broad.mit.edu	37	18	19762738	19762738	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr18:19762738G>A	ENST00000269216.3	+	5	1726	c.1449G>A	c.(1447-1449)atG>atA	p.M483I	RNU6-702P_ENST00000364982.1_RNA|GATA6_ENST00000581694.1_Missense_Mutation_p.M483I	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	483					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.M483I(1)		NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			CACTTGCTATGAAAAAAGAGG	0.328																																					p.M483I	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1449A	18						.						52.0	54.0	53.0					18																	19762738		2203	4299	6502	18016736	SO:0001583	missense	2627	exon5			U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1449G>A	18.37:g.19762738G>A	ENSP00000269216:p.Met483Ile	Somatic		Capture	Illumina HiSeq	Phase_I	18016736	NM_005257	B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	37	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.734971	0.89482	.	.	ENSG00000141448	ENST00000269216	D	0.99660	-6.32	5.97	5.97	0.96955	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (2);	0.121190	0.85682	D	0.000000	D	0.99588	0.9851	M	0.89214	3.015	0.80722	D	1	P	0.41978	0.767	P	0.52627	0.704	D	0.98287	1.0511	10	0.87932	D	0	-5.8643	20.4251	0.99070	0.0:0.0:1.0:0.0	.	483	Q92908	GATA6_HUMAN	I	483	ENSP00000269216:M483I	ENSP00000269216:M483I	M	+	3	0	GATA6	18016736	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.476000	0.97823	2.829000	0.97493	0.650000	0.86243	ATG		0.328	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257	
PTPRM	5797	broad.mit.edu	37	18	7955226	7955226	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr18:7955226C>T	ENST00000332175.8	+	7	1983	c.946C>T	c.(946-948)Cga>Tga	p.R316*	PTPRM_ENST00000444013.1_Nonsense_Mutation_p.R103*|PTPRM_ENST00000400060.4_Nonsense_Mutation_p.R316*|PTPRM_ENST00000580170.1_Nonsense_Mutation_p.R316*|PTPRM_ENST00000400053.4_Nonsense_Mutation_p.R254*	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	316	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R316G(1)|p.R316*(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CATTGTGGCCCGAGAGGTGGA	0.562																																					p.R316X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|large_intestine(1)	c.C946T	18						.						51.0	49.0	50.0					18																	7955226		2203	4300	6503	7945226	SO:0001587	stop_gained	5797	exon7			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.946C>T	18.37:g.7955226C>T	ENSP00000331418:p.Arg316*	Somatic		Capture	Illumina HiSeq	Phase_I	7945226	NM_002845	A7MBN1|D3DUH8|J3QL11	Nonsense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	37	6.361225	0.97507	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	.	.	.	6.02	5.11	0.69529	.	0.053577	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	13.825	0.63346	0.4686:0.5314:0.0:0.0	.	.	.	.	X	316;316;254;103	.	ENSP00000331418:R316X	R	+	1	2	PTPRM	7945226	0.822000	0.29219	0.992000	0.48379	0.947000	0.59692	1.229000	0.32600	1.498000	0.48600	0.655000	0.94253	CGA		0.562	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
EPG5	57724	broad.mit.edu	37	18	43502542	43502542	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr18:43502542G>A	ENST00000282041.5	-	16	2897	c.2863C>T	c.(2863-2865)Cga>Tga	p.R955*		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	955					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.R955*(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TCTCCATATCGAACAATACTG	0.368																																					p.R955X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2863T	18						.						85.0	88.0	87.0					18																	43502542		1862	4103	5965	41756540	SO:0001587	stop_gained	57724	exon16			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.2863C>T	18.37:g.43502542G>A	ENSP00000282041:p.Arg955*	Somatic		Capture	Illumina HiSeq	Phase_I	41756540	NM_020964	A2BDF3|Q9H8C8	Nonsense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	43	9.921883	0.99297	.	.	ENSG00000152223	ENST00000282041	.	.	.	5.97	5.97	0.96955	.	0.561758	0.16988	N	0.191425	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6685	20.428	0.99075	0.0:0.0:1.0:0.0	.	.	.	.	X	955	.	ENSP00000282041:R955X	R	-	1	2	EPG5	41756540	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.858000	0.86971	2.837000	0.97791	0.655000	0.94253	CGA		0.368	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
SYDE1	85360	broad.mit.edu	37	19	15222191	15222191	+	Missense_Mutation	SNP	G	G	A	rs140575092		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:15222191G>A	ENST00000342784.2	+	5	1389	c.1358G>A	c.(1357-1359)cGg>cAg	p.R453Q	SYDE1_ENST00000600440.1_Missense_Mutation_p.R386Q|SYDE1_ENST00000600252.1_Missense_Mutation_p.R110Q	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	453	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)	p.R453Q(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						GCCTTTGAGCGGGACAGTGCA	0.572																																					p.R453Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1358A	19						.	G	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	168.0	133.0	145.0		1358	4.3	1.0	19	dbSNP_134	145	0,8600		0,0,4300	yes	missense	SYDE1	NM_033025.4	43	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	453/736	15222191	3,13003	2203	4300	6503	15083191	SO:0001583	missense	85360	exon5			BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1358G>A	19.37:g.15222191G>A	ENSP00000341489:p.Arg453Gln	Somatic		Capture	Illumina HiSeq	Phase_I	15083191	NM_033025	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	ENST00000342784.2	37	CCDS12324.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	19.29	3.799220	0.70567	6.81E-4	0.0	ENSG00000105137	ENST00000342784	T	0.19105	2.17	5.3	4.26	0.50523	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.073805	0.49305	N	0.000146	T	0.22513	0.0543	L	0.47016	1.485	0.44500	D	0.997444	P;B;P	0.37985	0.613;0.392;0.613	B;B;B	0.42282	0.382;0.049;0.273	T	0.02093	-1.1215	10	0.34782	T	0.22	.	10.8865	0.46971	0.0941:0.0:0.9058:0.0	.	386;386;453	B2RD93;Q6ZW31-2;Q6ZW31	.;.;SYDE1_HUMAN	Q	453	ENSP00000341489:R453Q	ENSP00000341489:R453Q	R	+	2	0	SYDE1	15083191	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	3.155000	0.50700	1.212000	0.43366	0.561000	0.74099	CGG		0.572	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465666.1	NM_033025	
TSHZ3	57616	broad.mit.edu	37	19	31769276	31769276	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:31769276C>T	ENST00000240587.4	-	2	1750	c.1423G>A	c.(1423-1425)Gac>Aac	p.D475N		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	475					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D292N(1)|p.D475N(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TTCTCCTTGTCGACTTCCTTC	0.522																																					p.D475N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1423A	19						.						171.0	172.0	172.0					19																	31769276		2203	4300	6503	36461116	SO:0001583	missense	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1423G>A	19.37:g.31769276C>T	ENSP00000240587:p.Asp475Asn	Somatic		Capture	Illumina HiSeq	Phase_I	36461116	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957045	0.53293	.	.	ENSG00000121297	ENST00000240587	T	0.33438	1.41	5.55	5.55	0.83447	.	0.167960	0.52532	D	0.000064	T	0.24661	0.0598	N	0.22421	0.69	0.80722	D	1	B	0.28783	0.222	B	0.25759	0.063	T	0.02797	-1.1109	10	0.33141	T	0.24	-38.5971	19.5283	0.95215	0.0:1.0:0.0:0.0	.	475	Q63HK5	TSH3_HUMAN	N	475	ENSP00000240587:D475N	ENSP00000240587:D475N	D	-	1	0	TSHZ3	36461116	1.000000	0.71417	0.955000	0.39395	0.807000	0.45602	7.461000	0.80834	2.596000	0.87737	0.655000	0.94253	GAC		0.522	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
RYR1	6261	broad.mit.edu	37	19	39075622	39075622	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:39075622G>A	ENST00000359596.3	+	102	14686	c.14686G>A	c.(14686-14688)Gga>Aga	p.G4896R	RYR1_ENST00000360985.3_Missense_Mutation_p.G4891R|RYR1_ENST00000355481.4_Missense_Mutation_p.G4891R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4896					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.G4896R(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCGGGCTGGCGGAGGCATTGG	0.557																																					p.G4891R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14671A	19						.						203.0	168.0	180.0					19																	39075622		2203	4300	6503	43767462	SO:0001583	missense	6261	exon101			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14686G>A	19.37:g.39075622G>A	ENSP00000352608:p.Gly4896Arg	Somatic		Capture	Illumina HiSeq	Phase_I	43767462	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400688	0.62177	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98437	-4.93;-4.93;-4.93	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.64402	U	0.000003	D	0.99275	0.9747	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98951	1.0794	10	0.87932	D	0	.	18.3248	0.90250	0.0:0.0:1.0:0.0	.	4891;4896	P21817-2;P21817	.;RYR1_HUMAN	R	4896;4891;4891	ENSP00000352608:G4896R;ENSP00000347667:G4891R;ENSP00000354254:G4891R	ENSP00000347667:G4891R	G	+	1	0	RYR1	43767462	1.000000	0.71417	0.970000	0.41538	0.961000	0.63080	9.656000	0.98514	2.658000	0.90341	0.449000	0.29647	GGA		0.557	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
IFNL3	282617	broad.mit.edu	37	19	39734290	39734290	+	Silent	SNP	G	G	A	rs200180353		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:39734290G>A	ENST00000413851.2	-	5	611	c.573C>T	c.(571-573)agC>agT	p.S191S		NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	191					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)		p.S191S(1)									ACAGGTCCCCGCTGGCAACAC	0.527																																					p.S191S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C573T	19						.						46.0	44.0	45.0					19																	39734290		2203	4300	6503	44426130	SO:0001819	synonymous_variant	282617	exon5			AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.573C>T	19.37:g.39734290G>A		Somatic		Capture	Illumina HiSeq	Phase_I	44426130	NM_172139	A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Silent	SNP	ENST00000413851.2	37	CCDS12530.1																																																																																				0.527	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463832.1	NM_172139	
ARHGEF1	9138	broad.mit.edu	37	19	42409945	42409945	+	Silent	SNP	C	C	T	rs376174015		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:42409945C>T	ENST00000354532.3	+	25	2518	c.2370C>T	c.(2368-2370)aaC>aaT	p.N790N	ARHGEF1_ENST00000599846.1_Silent_p.N846N|ARHGEF1_ENST00000337665.4_Silent_p.N805N|CTD-2575K13.6_ENST00000597630.1_RNA|ARHGEF1_ENST00000378152.4_Silent_p.N772N|ARHGEF1_ENST00000347545.4_Silent_p.N757N	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	790					cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N805N(1)		breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GCTCTGAGAACGGCAATGGTG	0.667																																					p.N757N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2271T	19						.		,,	0,4406		0,0,2203	63.0	57.0	59.0		2370,2271,2415	0.9	0.7	19		59	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ARHGEF1	NM_004706.3,NM_198977.1,NM_199002.1	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	790/913,757/880,805/928	42409945	1,13005	2203	4300	6503	47101785	SO:0001819	synonymous_variant	9138	exon24			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2370C>T	19.37:g.42409945C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47101785	NM_198977	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Silent	SNP	ENST00000354532.3	37	CCDS12591.1																																																																																				0.667	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000463360.1	NM_199002	
PSG1	5669	broad.mit.edu	37	19	43382321	43382321	+	Missense_Mutation	SNP	C	C	A	rs536318538		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:43382321C>A	ENST00000436291.2	-	2	290	c.174G>T	c.(172-174)ttG>ttT	p.L58F	PSG1_ENST00000595356.1_Missense_Mutation_p.L58F|PSG1_ENST00000312439.6_Missense_Mutation_p.L58F|PSG1_ENST00000244296.2_Missense_Mutation_p.L58F|PSG1_ENST00000403380.3_Missense_Mutation_p.L58F|PSG1_ENST00000595124.1_Missense_Mutation_p.L58F|PSG1_ENST00000601073.1_5'UTR	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	58	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.L58F(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GATTCTGGGGCAAATTGTGGA	0.448													.|||	1	0.000199681	0.0	0.0	5008	,	,		20213	0.001		0.0	False		,,,				2504	0.0				p.L58F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G174T	19						.						171.0	179.0	176.0					19																	43382321		2202	4298	6500	48074161	SO:0001583	missense	5669	exon2				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.174G>T	19.37:g.43382321C>A	ENSP00000413041:p.Leu58Phe	Somatic		Capture	Illumina HiSeq	Phase_I	48074161	NM_006905	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	ENST00000436291.2	37	CCDS54275.1	.	.	.	.	.	.	.	.	.	.	N	12.18	1.860475	0.32884	.	.	ENSG00000231924	ENST00000270059;ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	1.64	0.572	0.17357	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84174	0.5414	H	0.96861	3.895	0.09310	N	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.988;0.996;1.0;0.998;0.998;0.989;0.998;0.973	D;D;D;D;D;D;D;D;P	0.85130	0.997;0.954;0.969;0.994;0.989;0.988;0.988;0.988;0.892	T	0.69964	-0.5002	9	0.87932	D	0	.	3.9899	0.09532	0.0:0.7694:0.0:0.2306	.	58;58;58;58;58;58;58;58;58	O75238;P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;Q9UPK8;O75237;P11464-2	.;.;.;PSG1_HUMAN;.;.;.;.;.	F	58	ENSP00000413041:L58F;ENSP00000385386:L58F;ENSP00000308970:L58F;ENSP00000244296:L58F	ENSP00000244296:L58F	L	-	3	2	PSG1	48074161	0.000000	0.05858	0.002000	0.10522	0.085000	0.17905	-0.024000	0.12435	0.272000	0.22027	0.184000	0.17185	TTG		0.448	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
ZNF233	353355	broad.mit.edu	37	19	44778580	44778580	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:44778580G>A	ENST00000391958.2	+	5	1894	c.1767G>A	c.(1765-1767)gaG>gaA	p.E589E	ZNF233_ENST00000592581.1_3'UTR|ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Silent_p.E571E	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E589E(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				ACACAGGAGAGAAACCATACA	0.438																																					p.E589E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1767A	19						.						92.0	92.0	92.0					19																	44778580		2203	4300	6503	49470420	SO:0001819	synonymous_variant	353355	exon5			AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1767G>A	19.37:g.44778580G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49470420	NM_181756	B2RN78|B2RN79|Q86WL8	Silent	SNP	ENST00000391958.2	37	CCDS33047.1																																																																																				0.438	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
PTOV1	53635	broad.mit.edu	37	19	50363375	50363375	+	Missense_Mutation	SNP	C	C	T	rs377067186		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:50363375C>T	ENST00000601675.1	+	11	1278	c.1174C>T	c.(1174-1176)Cgt>Tgt	p.R392C	PTOV1_ENST00000598325.1_3'UTR|PTOV1_ENST00000221557.9_Silent_p.G336G|AC018766.5_ENST00000593654.1_RNA|PTOV1_ENST00000391842.1_Missense_Mutation_p.R392C|AC018766.4_ENST00000596624.1_RNA|AC018766.5_ENST00000599259.1_RNA|PTOV1_ENST00000600603.1_Silent_p.G336G|PTOV1_ENST00000601638.1_Missense_Mutation_p.R360C|PTOV1_ENST00000599732.1_Missense_Mutation_p.R392C|AC018766.5_ENST00000601893.1_RNA			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	392	Interaction with FLOT1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R392C(1)		endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		CGGCATCCGGCGTGTCATTGC	0.587																																					p.R392C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1174T	19						.	C	CYS/ARG	0,4406		0,0,2203	67.0	54.0	58.0		1174	3.2	0.8	19		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	PTOV1	NM_017432.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	392/417	50363375	1,13005	2203	4300	6503	55055187	SO:0001583	missense	53635	exon11			AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.1174C>T	19.37:g.50363375C>T	ENSP00000472816:p.Arg392Cys	Somatic		Capture	Illumina HiSeq	Phase_I	55055187	NM_017432	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	Missense_Mutation	SNP	ENST00000601675.1	37	CCDS12782.1	.	.	.	.	.	.	.	.	.	.	c	23.7	4.453011	0.84209	0.0	1.16E-4	ENSG00000104960	ENST00000391842	.	.	.	4.27	3.22	0.36961	Mediator complex, subunit Med25, PTOV activation and synapsin 2 (1);	0.163047	0.43260	N	0.000599	T	0.53190	0.1781	N	0.14661	0.345	0.49582	D	0.999801	D	0.89917	1.0	D	0.81914	0.995	T	0.58640	-0.7601	9	0.72032	D	0.01	-9.3283	11.2545	0.49045	0.0:0.9067:0.0:0.0933	.	392	Q86YD1	PTOV1_HUMAN	C	392	.	ENSP00000375717:R392C	R	+	1	0	PTOV1	55055187	1.000000	0.71417	0.787000	0.31911	0.975000	0.68041	4.834000	0.62774	1.137000	0.42214	0.457000	0.33378	CGT		0.587	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465347.1	NM_017432	
KIR3DL3	115653	broad.mit.edu	37	19	55247473	55247473	+	Silent	SNP	C	C	T	rs181518279		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr19:55247473C>T	ENST00000291860.1	+	8	1161	c.1143C>T	c.(1141-1143)taC>taT	p.Y381Y	KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_5'Flank|KIR3DL1_ENST00000538269.1_Intron|KIR2DL3_ENST00000342376.3_5'Flank	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	381						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y381Y(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		AGGTGACATACGCACAGTTGA	0.507													.|||	1	0.000199681	0.0	0.0	5008	,	,		13187	0.001		0.0	False		,,,				2504	0.0				p.Y381Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1143T	19						.						33.0	39.0	37.0					19																	55247473		1813	3822	5635	59939285	SO:0001819	synonymous_variant	115653	exon8			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.1143C>T	19.37:g.55247473C>T		Somatic		Capture	Illumina HiSeq	Phase_I	59939285	NM_153443	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Silent	SNP	ENST00000291860.1	37	CCDS12903.1																																																																																				0.507	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443	
PTGFRN	5738	broad.mit.edu	37	1	117504066	117504066	+	Missense_Mutation	SNP	C	C	T	rs371176280		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:117504066C>T	ENST00000393203.2	+	5	1562	c.1415C>T	c.(1414-1416)aCg>aTg	p.T472M	RNA5SP55_ENST00000516701.1_RNA	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	472	Ig-like C2-type 4.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.T472M(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		GGGGACTGGACGCTAAAATAT	0.517																																					p.T472M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1415T	1						.	C	MET/THR	0,4406		0,0,2203	91.0	80.0	84.0		1415	4.4	1.0	1		84	1,8599	1.2+/-3.3	0,1,4299	no	missense	PTGFRN	NM_020440.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	472/880	117504066	1,13005	2203	4300	6503	117305589	SO:0001583	missense	5738	exon5			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1415C>T	1.37:g.117504066C>T	ENSP00000376899:p.Thr472Met	Somatic		Capture	Illumina HiSeq	Phase_I	117305589	NM_020440	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637862	0.47049	0.0	1.16E-4	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.28069	1.63	5.35	4.43	0.53597	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.242826	0.41500	D	0.000864	T	0.39253	0.1071	L	0.60455	1.87	0.38946	D	0.958252	D	0.89917	1.0	D	0.71656	0.974	T	0.24584	-1.0156	10	0.66056	D	0.02	-19.4174	11.0553	0.47913	0.0:0.91:0.0:0.09	.	472	Q9P2B2	FPRP_HUMAN	M	472;331	ENSP00000376899:T472M	ENSP00000376899:T472M	T	+	2	0	PTGFRN	117305589	0.935000	0.31712	0.953000	0.39169	0.125000	0.20455	1.916000	0.39986	2.514000	0.84764	0.305000	0.20034	ACG		0.517	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
GJA8	2703	broad.mit.edu	37	1	147380558	147380558	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:147380558C>T	ENST00000369235.1	+	1	476	c.476C>T	c.(475-477)aCc>aTc	p.T159I	GJA8_ENST00000240986.4_Missense_Mutation_p.T159I			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	159					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)	p.T159I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					ATCTTCAAGACCCTCTTTGAA	0.597																																					p.T159I	Melanoma(76;1255 1795 8195 52096)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C476T	1						.						118.0	117.0	117.0					1																	147380558		2203	4300	6503	145847182	SO:0001583	missense	2703	exon2			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.476C>T	1.37:g.147380558C>T	ENSP00000358238:p.Thr159Ile	Somatic		Capture	Illumina HiSeq	Phase_I	145847182	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	c	16.95	3.262650	0.59431	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.97598	-4.45;-4.45	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.96131	0.8739	M	0.77486	2.375	0.80722	D	1	P	0.50617	0.937	B	0.43536	0.423	D	0.96806	0.9593	10	0.87932	D	0	.	18.0406	0.89318	0.0:1.0:0.0:0.0	.	159	P48165	CXA8_HUMAN	I	159	ENSP00000240986:T159I;ENSP00000358238:T159I	ENSP00000240986:T159I	T	+	2	0	GJA8	145847182	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.909000	0.63314	2.241000	0.73720	0.313000	0.20887	ACC		0.597	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
HRNR	388697	broad.mit.edu	37	1	152190972	152190972	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:152190972C>T	ENST00000368801.2	-	3	3208	c.3133G>A	c.(3133-3135)Ggt>Agt	p.G1045S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1045					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G1045S(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAGAGTGACCGGAGCCAGAC	0.577																																					p.G1045S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3133A	1						.						126.0	143.0	137.0					1																	152190972		2203	4298	6501	150457596	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.3133G>A	1.37:g.152190972C>T	ENSP00000357791:p.Gly1045Ser	Somatic		Capture	Illumina HiSeq	Phase_I	150457596	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	7.976	0.750186	0.15778	.	.	ENSG00000197915	ENST00000368801	T	0.01422	4.91	2.88	-1.91	0.07641	.	.	.	.	.	T	0.00178	0.0005	N	0.17082	0.46	0.09310	N	1	D	0.52996	0.957	B	0.33521	0.165	T	0.36890	-0.9729	9	0.02654	T	1	.	3.4985	0.07664	0.1769:0.4727:0.0:0.3504	.	1045	Q86YZ3	HORN_HUMAN	S	1045	ENSP00000357791:G1045S	ENSP00000357791:G1045S	G	-	1	0	HRNR	150457596	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.435000	0.02423	-0.586000	0.05898	0.461000	0.40582	GGT		0.577	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
ASH1L	55870	broad.mit.edu	37	1	155449183	155449183	+	Missense_Mutation	SNP	G	G	A	rs145739954		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:155449183G>A	ENST00000368346.3	-	3	4117	c.3478C>T	c.(3478-3480)Cgg>Tgg	p.R1160W	ASH1L_ENST00000392403.3_Missense_Mutation_p.R1160W			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1160					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.R1160W(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGAGATAACCGCCTCCTCCCC	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		21274	0.0		0.001	False		,,,				2504	0.0				p.R1160W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3478T	1						.						70.0	69.0	69.0					1																	155449183		2203	4300	6503	153715807	SO:0001583	missense	55870	exon3			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.3478C>T	1.37:g.155449183G>A	ENSP00000357330:p.Arg1160Trp	Somatic		Capture	Illumina HiSeq	Phase_I	153715807	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.56	2.571459	0.45798	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90844	-2.74;-2.74	5.2	5.2	0.72013	.	0.075337	0.52532	D	0.000062	D	0.86590	0.5969	N	0.08118	0	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.67548	0.897;0.952	D	0.90092	0.4178	10	0.87932	D	0	.	13.4275	0.61035	0.0:0.0:0.8056:0.1944	.	1160;1160	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	W	1160	ENSP00000357330:R1160W;ENSP00000376204:R1160W	ENSP00000357330:R1160W	R	-	1	2	ASH1L	153715807	1.000000	0.71417	0.986000	0.45419	0.988000	0.76386	3.237000	0.51344	2.705000	0.92388	0.591000	0.81541	CGG		0.453	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
PYHIN1	149628	broad.mit.edu	37	1	158943458	158943458	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:158943458G>T	ENST00000368140.1	+	8	1626	c.1381G>T	c.(1381-1383)Gca>Tca	p.A461S	PYHIN1_ENST00000392254.2_Intron|PYHIN1_ENST00000368138.3_Missense_Mutation_p.A452S|PYHIN1_ENST00000392252.3_Intron	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	461					cell cycle (GO:0007049)	nucleus (GO:0005634)		p.A461S(1)		breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					CCACCCAGGAGCACAGTCATC	0.428																																					p.A452S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1354T	1						.						145.0	131.0	136.0					1																	158943458		2203	4300	6503	157210082	SO:0001583	missense	149628	exon8			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1381G>T	1.37:g.158943458G>T	ENSP00000357122:p.Ala461Ser	Somatic		Capture	Illumina HiSeq	Phase_I	157210082	NM_198928	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410201	0.25465	.	.	ENSG00000163564	ENST00000368140;ENST00000368138	T;T	0.06068	3.36;3.35	1.98	-2.95	0.05564	.	.	.	.	.	T	0.00845	0.0028	N	0.14661	0.345	0.09310	N	0.999999	P;P	0.44006	0.824;0.731	B;B	0.34931	0.192;0.094	T	0.44682	-0.9312	9	0.48119	T	0.1	.	3.4105	0.07356	0.4675:0.2148:0.3177:0.0	.	452;461	Q6K0P9-2;Q6K0P9	.;IFIX_HUMAN	S	461;452	ENSP00000357122:A461S;ENSP00000357120:A452S	ENSP00000357120:A452S	A	+	1	0	PYHIN1	157210082	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.549000	0.06041	-0.874000	0.04027	-0.140000	0.14226	GCA		0.428	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
PRRC2C	23215	broad.mit.edu	37	1	171535427	171535427	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:171535427T>G	ENST00000338920.4	+	21	6404	c.6167T>G	c.(6166-6168)tTt>tGt	p.F2056C	PRRC2C_ENST00000367742.3_Missense_Mutation_p.F2058C|PRRC2C_ENST00000426496.2_Missense_Mutation_p.F2056C|PRRC2C_ENST00000392078.3_Missense_Mutation_p.F2058C	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2056					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.F2058C(1)									ACAATTCAGTTTGGTGCTCCA	0.393																																					p.F2056C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6167G	1						.						47.0	48.0	48.0					1																	171535427		2203	4300	6503	169802051	SO:0001583	missense	23215	exon21			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6167T>G	1.37:g.171535427T>G	ENSP00000343629:p.Phe2056Cys	Somatic		Capture	Illumina HiSeq	Phase_I	169802051	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.18|15.18	2.756003|2.756003	0.49362|0.49362	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	T;T;T;T|.	0.02525|.	4.26;4.26;4.28;4.28|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.000000|.	0.46442|.	D|.	0.000297|.	T|T	0.60222|0.60222	0.2252|0.2252	L|L	0.56769|0.56769	1.78|1.78	0.58432|0.58432	D|D	0.999998|0.999998	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.61197|0.61197	-0.7111|-0.7111	10|5	0.59425|.	D|.	0.04|.	.|.	14.6606|14.6606	0.68868|0.68868	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2056|.	Q9Y520-4|.	.|.	C|V	2058;2010;2056;2058;2056;1813|604	ENSP00000375928:F2058C;ENSP00000410219:F2056C;ENSP00000356716:F2058C;ENSP00000343629:F2056C|.	ENSP00000343629:F2056C|.	F|L	+|+	2|1	0|2	PRRC2C|PRRC2C	169802051|169802051	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	7.586000|7.586000	0.82596|0.82596	1.856000|1.856000	0.53863|0.53863	0.533000|0.533000	0.62120|0.62120	TTT|TTG		0.393	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
SERPINC1	462	broad.mit.edu	37	1	173878766	173878766	+	Silent	SNP	G	G	A	rs199469509		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:173878766G>A	ENST00000367698.3	-	5	1195	c.1077C>T	c.(1075-1077)gaC>gaT	p.D359D	SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	359					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.D359D(1)		NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	AACTGAAGCCGTCCTCAATGC	0.537																																					p.D359D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1077T	1						.						122.0	121.0	121.0					1																	173878766		2203	4300	6503	172145389	SO:0001819	synonymous_variant	462	exon5			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.1077C>T	1.37:g.173878766G>A		Somatic		Capture	Illumina HiSeq	Phase_I	172145389	NM_000488	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Silent	SNP	ENST00000367698.3	37	CCDS1313.1																																																																																				0.537	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090734.1	NM_000488	
BRINP3	339479	broad.mit.edu	37	1	190129945	190129945	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:190129945G>A	ENST00000367462.3	-	7	1268	c.1037C>T	c.(1036-1038)aCa>aTa	p.T346I	BRINP3_ENST00000534846.1_Missense_Mutation_p.T244I	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	346					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.T346I(1)									AGAATCCATTGTCCACAAATG	0.338																																					p.T346I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1037T	1						.						118.0	127.0	124.0					1																	190129945		2203	4300	6503	188396568	SO:0001583	missense	339479	exon7			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1037C>T	1.37:g.190129945G>A	ENSP00000356432:p.Thr346Ile	Somatic		Capture	Illumina HiSeq	Phase_I	188396568	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143867	0.77888	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.18016	2.5;2.24	5.75	5.75	0.90469	.	0.112431	0.64402	D	0.000015	T	0.17066	0.0410	L	0.38175	1.15	0.49915	D	0.999838	P;P	0.40476	0.718;0.596	B;B	0.37888	0.26;0.1	T	0.01021	-1.1478	10	0.48119	T	0.1	.	17.4294	0.87535	0.0:0.0:1.0:0.0	.	244;346	B7Z260;Q76B58	.;FAM5C_HUMAN	I	346;244	ENSP00000356432:T346I;ENSP00000438022:T244I	ENSP00000356432:T346I	T	-	2	0	FAM5C	188396568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.477000	0.81069	2.718000	0.92993	0.573000	0.79308	ACA		0.338	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
KDM5B	10765	broad.mit.edu	37	1	202715090	202715090	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:202715090T>A	ENST00000367265.3	-	16	3383	c.2219A>T	c.(2218-2220)gAt>gTt	p.D740V	KDM5B_ENST00000367264.2_Missense_Mutation_p.D776V	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	740					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.D740V(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						AGGGTAGAGATCATCCAGCGT	0.403																																					p.D740V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2219T	1						.						155.0	144.0	148.0					1																	202715090		2203	4300	6503	200981713	SO:0001583	missense	10765	exon16			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.2219A>T	1.37:g.202715090T>A	ENSP00000356234:p.Asp740Val	Somatic		Capture	Illumina HiSeq	Phase_I	200981713	NM_006618	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.996653	0.93167	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790;ENST00000543924	D;D;D	0.88586	-2.4;-2.4;-2.4	5.96	5.96	0.96718	Zinc finger, C5HC2-type (1);	0.136239	0.64402	D	0.000003	D	0.93035	0.7783	M	0.71581	2.175	0.80722	D	1	D;P	0.58970	0.984;0.599	P;P	0.59115	0.852;0.555	D	0.93676	0.6994	10	0.87932	D	0	-25.7748	16.4277	0.83824	0.0:0.0:0.0:1.0	.	776;740	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	V	740;582;776;582;109	ENSP00000356234:D740V;ENSP00000356233:D776V;ENSP00000235790:D582V	ENSP00000235790:D582V	D	-	2	0	KDM5B	200981713	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	GAT		0.403	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
BATF3	55509	broad.mit.edu	37	1	212870341	212870341	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:212870341G>A	ENST00000243440.1	-	2	379	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W	BATF3_ENST00000478275.1_5'UTR	NM_018664.2	NP_061134.1	Q9NR55	BATF3_HUMAN	basic leucine zipper transcription factor, ATF-like 3	53	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				dendritic cell differentiation (GO:0097028)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R53W(1)		endometrium(2)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0046)|all cancers(67;0.00785)|GBM - Glioblastoma multiforme(131;0.0731)|Epithelial(68;0.0781)		TGCTTCTTCCGACTTCTCTGA	0.562																																					p.R53W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C157T	1						.						212.0	175.0	187.0					1																	212870341		2203	4300	6503	210936964	SO:0001583	missense	55509	exon2			AF255346	CCDS1508.1	1q32.3	2013-01-10			ENSG00000123685	ENSG00000123685		"""basic leucine zipper proteins"""	28915	protein-coding gene	gene with protein product	"""Jun dimerization protein 1"""	612470				10878360, 12087103	Standard	NM_018664		Approved	JUNDM1, SNFT, JDP1	uc001hjl.2	Q9NR55	OTTHUMG00000036807	ENST00000243440.1:c.157C>T	1.37:g.212870341G>A	ENSP00000243440:p.Arg53Trp	Somatic		Capture	Illumina HiSeq	Phase_I	210936964	NM_018664		Missense_Mutation	SNP	ENST00000243440.1	37	CCDS1508.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.463534	0.84425	.	.	ENSG00000123685	ENST00000243440	D	0.94280	-3.39	5.09	4.16	0.48862	Basic-leucine zipper (bZIP) transcription factor (3);bZIP transcription factor, bZIP-1 (1);	0.000000	0.64402	D	0.000004	D	0.97798	0.9277	H	0.97315	3.98	0.58432	D	0.999991	D	0.89917	1.0	D	0.69824	0.966	D	0.98779	1.0731	10	0.87932	D	0	0.0	14.6338	0.68676	0.0:0.0:0.8533:0.1467	.	53	Q9NR55	BATF3_HUMAN	W	53	ENSP00000243440:R53W	ENSP00000243440:R53W	R	-	1	2	BATF3	210936964	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.681000	0.61663	1.112000	0.41740	0.555000	0.69702	CGG		0.562	BATF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089403.1	NM_018664	
PER3	8863	broad.mit.edu	37	1	7887408	7887408	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:7887408G>T	ENST00000361923.2	+	17	2570	c.2395G>T	c.(2395-2397)Gtc>Ttc	p.V799F	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.V807F	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	799	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.V799F(1)|p.V799I(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTTACCTCGTCCCAGCTTT	0.697																																					p.V799F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2395T	1						.						47.0	49.0	49.0					1																	7887408		2203	4300	6503	7809995	SO:0001583	missense	8863	exon17			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2395G>T	1.37:g.7887408G>T	ENSP00000355031:p.Val799Phe	Somatic		Capture	Illumina HiSeq	Phase_I	7809995	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297907	0.40694	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.10573	2.86;2.86	4.03	-6.07	0.02158	.	2.975620	0.01188	N	0.007247	T	0.09555	0.0235	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.23591	0.042;0.053;0.088;0.042	B;B;B;B	0.26094	0.015;0.03;0.066;0.015	T	0.24835	-1.0149	10	0.29301	T	0.29	.	10.9929	0.47559	0.2522:0.1266:0.6212:0.0	.	799;807;807;799	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	F	807;799;10	ENSP00000366755:V807F;ENSP00000355031:V799F	ENSP00000355031:V799F	V	+	1	0	PER3	7809995	0.000000	0.05858	0.000000	0.03702	0.243000	0.25628	-1.834000	0.01693	-1.223000	0.02584	-0.367000	0.07326	GTC		0.697	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
EPHA10	284656	broad.mit.edu	37	1	38227155	38227155	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:38227155C>T	ENST00000373048.4	-	3	771	c.772G>A	c.(772-774)Gcc>Acc	p.A258T	EPHA10_ENST00000427468.2_Missense_Mutation_p.A258T|EPHA10_ENST00000319637.6_Missense_Mutation_p.A258T	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	258					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)	p.A258T(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TCGCCGTCGGCGCCGCAGTGC	0.701																																					p.A258T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G772A	1						.						22.0	25.0	24.0					1																	38227155		2172	4229	6401	37999742	SO:0001583	missense	284656	exon3			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.772G>A	1.37:g.38227155C>T	ENSP00000362139:p.Ala258Thr	Somatic		Capture	Illumina HiSeq	Phase_I	37999742	NM_001099439	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311259	0.60414	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	T;T;T	0.76578	-1.03;-1.03;4.44	4.4	4.4	0.53042	Tyrosine-protein kinase, receptor class V, conserved site (1);	0.000000	0.41500	D	0.000874	T	0.80110	0.4563	L	0.48260	1.515	0.80722	D	1	P;D	0.71674	0.954;0.998	B;P	0.60541	0.166;0.876	T	0.78076	-0.2345	10	0.37606	T	0.19	.	10.1717	0.42913	0.0:0.9074:0.0:0.0926	.	258;258	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	T	258	ENSP00000397746:A258T;ENSP00000362139:A258T;ENSP00000316395:A258T	ENSP00000316395:A258T	A	-	1	0	EPHA10	37999742	1.000000	0.71417	0.958000	0.39756	0.970000	0.65996	3.750000	0.55157	2.411000	0.81874	0.551000	0.68910	GCC		0.701	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
KCNQ4	9132	broad.mit.edu	37	1	41304081	41304081	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:41304081G>A	ENST00000347132.5	+	14	2056	c.1974G>A	c.(1972-1974)ccG>ccA	p.P658P	KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Silent_p.P604P	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	658					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.P658P(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	TGCAAGTGCCGCTGTTCGACC	0.647																																					p.P658P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1974A	1						.						146.0	137.0	140.0					1																	41304081		2203	4300	6503	41076668	SO:0001819	synonymous_variant	9132	exon14			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1974G>A	1.37:g.41304081G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41076668	NM_004700	O96025	Silent	SNP	ENST00000347132.5	37	CCDS456.1	.	.	.	.	.	.	.	.	.	.	G	7.286	0.610150	0.14066	.	.	ENSG00000117013	ENST00000443478	.	.	.	4.91	2.87	0.33458	.	.	.	.	.	T	0.54351	0.1853	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49204	-0.8964	4	.	.	.	-26.702	6.0032	0.19531	0.1984:0.1749:0.6266:0.0	.	.	.	.	T	519	.	.	A	+	1	0	KCNQ4	41076668	0.962000	0.33011	1.000000	0.80357	0.704000	0.40688	0.027000	0.13621	1.069000	0.40788	0.455000	0.32223	GCT		0.647	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
DMRTB1	63948	broad.mit.edu	37	1	53925162	53925162	+	Silent	SNP	G	G	A	rs150523807	byFrequency	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:53925162G>A	ENST00000371445.3	+	1	91	c.36G>A	c.(34-36)tcG>tcA	p.S12S		NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	12					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S12S(1)		large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						CCAAGTGCTCGAGATGCAGGA	0.612																																					p.S12S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G36A	1						.						47.0	42.0	44.0					1																	53925162		2203	4300	6503	53697750	SO:0001819	synonymous_variant	63948	exon1			AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.36G>A	1.37:g.53925162G>A		Somatic		Capture	Illumina HiSeq	Phase_I	53697750	NM_033067	Q96SD2	Silent	SNP	ENST00000371445.3	37	CCDS581.1																																																																																				0.612	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022110.1		
ABCA4	24	broad.mit.edu	37	1	94487243	94487243	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:94487243C>A	ENST00000370225.3	-	34	4887	c.4801G>T	c.(4801-4803)Gaa>Taa	p.E1601*		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1601					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.E1601*(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCAGGTATTTCTTTAGAGGCC	0.358																																					p.E1601X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G4801T	1						.						50.0	51.0	51.0					1																	94487243		2203	4300	6503	94259831	SO:0001587	stop_gained	24	exon34			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4801G>T	1.37:g.94487243C>A	ENSP00000359245:p.Glu1601*	Somatic		Capture	Illumina HiSeq	Phase_I	94259831	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Nonsense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	45	11.555232	0.99575	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	.	.	.	5.65	5.65	0.86999	.	0.192579	0.44483	D	0.000442	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	20.1057	0.97893	0.0:1.0:0.0:0.0	.	.	.	.	X	393;1601	.	ENSP00000359245:E1601X	E	-	1	0	ABCA4	94259831	1.000000	0.71417	0.998000	0.56505	0.426000	0.31534	3.923000	0.56469	2.827000	0.97445	0.650000	0.86243	GAA		0.358	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
USH2A	7399	broad.mit.edu	37	1	215848632	215848632	+	Silent	SNP	G	G	A	rs369544099		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr1:215848632G>A	ENST00000307340.3	-	63	13007	c.12621C>T	c.(12619-12621)gcC>gcT	p.A4207A	USH2A_ENST00000366943.2_Silent_p.A4207A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4207	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.A4207A(2)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTTCTCGTCGGCCTGGATTG	0.398										HNSCC(13;0.011)																											p.A4207A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C12621T	1						.	G		1,4405	2.1+/-5.4	0,1,2202	118.0	118.0	118.0		12621	-9.8	0.0	1		118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	USH2A	NM_206933.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		4207/5203	215848632	2,13004	2203	4300	6503	213915255	SO:0001819	synonymous_variant	7399	exon63			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12621C>T	1.37:g.215848632G>A		Somatic		Capture	Illumina HiSeq	Phase_I	213915255	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																				0.398	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
TRIB3	57761	broad.mit.edu	37	20	372143	372143	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr20:372143C>T	ENST00000217233.3	+	3	1057	c.504C>T	c.(502-504)acC>acT	p.T168T	TRIB3_ENST00000422053.2_Silent_p.T195T	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	168	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)	p.T168T(1)		breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		AGATGGCCACCGCCCTGGCGC	0.622																																					p.T168T	Melanoma(101;421 2374 19538)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C504T	20						.						59.0	45.0	50.0					20																	372143		2203	4300	6503	320143	SO:0001819	synonymous_variant	57761	exon3			AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.504C>T	20.37:g.372143C>T		Somatic		Capture	Illumina HiSeq	Phase_I	320143	NM_021158	Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Silent	SNP	ENST00000217233.3	37	CCDS12997.1																																																																																				0.622	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077441.2	NM_021158	
DNMT3B	1789	broad.mit.edu	37	20	31372633	31372633	+	Missense_Mutation	SNP	C	C	T	rs149520896	byFrequency	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr20:31372633C>T	ENST00000328111.2	+	4	595	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	DNMT3B_ENST00000353855.2_Missense_Mutation_p.R92W|DNMT3B_ENST00000443239.3_Missense_Mutation_p.R92W|DNMT3B_ENST00000375623.4_Missense_Mutation_p.R92W|DNMT3B_ENST00000201963.3_Missense_Mutation_p.R104W|DNMT3B_ENST00000344505.4_Missense_Mutation_p.R92W|DNMT3B_ENST00000456297.2_Intron|DNMT3B_ENST00000348286.2_Missense_Mutation_p.R92W	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	92	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)	p.R92W(2)|p.R104W(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAAGCTCTTCCGGGAAACCAG	0.507													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17093	0.0		0.001	False		,,,				2504	0.0				p.R92W												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C274T	20						.	C	TRP/ARG,,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	80.0	67.0	72.0		274,,274,274,274,310	5.0	1.0	20	dbSNP_134	72	0,8600		0,0,4300	no	missense,intron,missense,missense,missense,missense	DNMT3B	NM_001207055.1,NM_001207056.1,NM_006892.3,NM_175848.1,NM_175849.1,NM_175850.2	101,,101,101,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,,probably-damaging,probably-damaging,probably-damaging,probably-damaging	92/729,,92/854,92/834,92/771,104/846	31372633	1,13005	2203	4300	6503	30836294	SO:0001583	missense	1789	exon4				CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.274C>T	20.37:g.31372633C>T	ENSP00000328547:p.Arg92Trp	Somatic		Capture	Illumina HiSeq	Phase_I	30836294	NM_175848	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	37	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409996	0.83340	2.27E-4	0.0	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000344505;ENST00000375623;ENST00000201963	D;D;D;D;D;T;D	0.97772	-4.39;-4.52;-4.45;-4.48;-4.36;-0.38;-4.53	4.98	4.98	0.66077	.	0.415723	0.25222	N	0.032240	D	0.97142	0.9066	L	0.27053	0.805	0.43000	D	0.994512	P;D;D;D;D	0.89917	0.765;1.0;1.0;1.0;1.0	B;D;D;D;D	0.67231	0.09;0.95;0.939;0.95;0.947	D	0.97331	0.9950	10	0.72032	D	0.01	-14.4438	13.9551	0.64142	0.0:1.0:0.0:0.0	.	92;104;92;92;92	E7EN63;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;DNM3B_HUMAN	W	92;178;92;92;92;92;92;104	ENSP00000328547:R92W;ENSP00000313397:R92W;ENSP00000337764:R92W;ENSP00000403169:R92W;ENSP00000345105:R92W;ENSP00000364774:R92W;ENSP00000201963:R104W	ENSP00000201963:R104W	R	+	1	2	DNMT3B	30836294	0.370000	0.25047	1.000000	0.80357	0.989000	0.77384	1.823000	0.39062	2.742000	0.94016	0.655000	0.94253	CGG		0.507	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
MMP9	4318	broad.mit.edu	37	20	44641948	44641948	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr20:44641948C>T	ENST00000372330.3	+	9	1404	c.1385C>T	c.(1384-1386)aCg>aTg	p.T462M	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	462					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T462M(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	CCGCAGCCCACGGCTCCCCCG	0.672											OREG0025990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T462M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1385T	20						.						52.0	69.0	63.0					20																	44641948		2187	4274	6461	44075355	SO:0001583	missense	4318	exon9				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1385C>T	20.37:g.44641948C>T	ENSP00000361405:p.Thr462Met	Somatic	925	Capture	Illumina HiSeq	Phase_I	44075355	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.134580	0.37630	.	.	ENSG00000100985	ENST00000372330;ENST00000545925	T	0.22743	1.94	5.0	3.07	0.35406	.	4.226240	0.00597	N	0.000375	T	0.12689	0.0308	N	0.08118	0	0.09310	N	0.999999	P	0.34587	0.458	B	0.25614	0.062	T	0.28396	-1.0045	10	0.87932	D	0	.	8.7932	0.34863	0.0:0.8244:0.0:0.1756	.	462	P14780	MMP9_HUMAN	M	462;107	ENSP00000361405:T462M	ENSP00000361405:T462M	T	+	2	0	MMP9	44075355	0.350000	0.24878	0.019000	0.16419	0.259000	0.26198	1.957000	0.40392	0.695000	0.31675	-0.136000	0.14681	ACG		0.672	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
SALL4	57167	broad.mit.edu	37	20	50407266	50407266	+	Missense_Mutation	SNP	G	G	A	rs148328518	byFrequency	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr20:50407266G>A	ENST00000217086.4	-	2	1867	c.1756C>T	c.(1756-1758)Cgc>Tgc	p.R586C	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron|SALL4_ENST00000395997.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	586					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R586C(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GTGTGGGTGCGATAATGCATC	0.522																																					p.R586C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1756T	20						.						106.0	92.0	97.0					20																	50407266		2203	4300	6503	49840673	SO:0001583	missense	57167	exon2			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1756C>T	20.37:g.50407266G>A	ENSP00000217086:p.Arg586Cys	Somatic		Capture	Illumina HiSeq	Phase_I	49840673	NM_020436	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504679	0.85176	.	.	ENSG00000101115	ENST00000217086	T	0.25749	1.78	5.59	5.59	0.84812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.152811	0.31257	N	0.007964	T	0.57755	0.2075	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62590	-0.6822	10	0.87932	D	0	-15.8162	19.5702	0.95409	0.0:0.0:1.0:0.0	.	586	Q9UJQ4	SALL4_HUMAN	C	586	ENSP00000217086:R586C	ENSP00000217086:R586C	R	-	1	0	SALL4	49840673	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.863000	0.99569	2.620000	0.88729	0.650000	0.86243	CGC		0.522	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
C20orf195	79025	broad.mit.edu	37	20	62187855	62187855	+	Missense_Mutation	SNP	A	A	T	rs372558520		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr20:62187855A>T	ENST00000370098.3	+	2	931	c.839A>T	c.(838-840)aAg>aTg	p.K280M	C20orf195_ENST00000370097.1_Missense_Mutation_p.K280M	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	280	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)		p.K280M(1)		large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CGATCCTATAAGTTCACCATC	0.667																																					p.K280M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A839T	20						.	A	MET/LYS	0,4406		0,0,2203	99.0	103.0	101.0		839	3.1	1.0	20		101	1,8597	1.2+/-3.3	0,1,4298	no	missense	C20orf195	NM_024059.2	95	0,1,6501	TT,TA,AA		0.0116,0.0,0.0077	probably-damaging	280/319	62187855	1,13003	2203	4299	6502	61658299	SO:0001583	missense	79025	exon2				CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.839A>T	20.37:g.62187855A>T	ENSP00000359116:p.Lys280Met	Somatic		Capture	Illumina HiSeq	Phase_I	61658299	NM_024059		Missense_Mutation	SNP	ENST00000370098.3	37	CCDS13526.1	.	.	.	.	.	.	.	.	.	.	A	17.95	3.513590	0.64522	0.0	1.16E-4	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.53	3.07	0.35406	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.221029	0.31199	N	0.008070	T	0.38401	0.1039	L	0.27053	0.805	0.30533	N	0.767275	D	0.61697	0.99	P	0.53313	0.723	T	0.39461	-0.9613	9	0.72032	D	0.01	-23.829	8.0786	0.30731	0.7301:0.0:0.2699:0.0	.	280	Q9BVV2	CT195_HUMAN	M	280	.	ENSP00000359115:K280M	K	+	2	0	C20orf195	61658299	0.966000	0.33281	0.998000	0.56505	0.946000	0.59487	0.452000	0.21795	0.317000	0.23160	0.533000	0.62120	AAG		0.667	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080155.1	NM_024059	
KRTAP24-1	643803	broad.mit.edu	37	21	31654987	31654987	+	Silent	SNP	C	C	T	rs372052619		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr21:31654987C>T	ENST00000340345.4	-	1	289	c.264G>A	c.(262-264)ccG>ccA	p.P88P		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	88						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.P88P(2)		breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						AGGAGTTTGACGGGTCACAAC	0.567																																					p.P88P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G264A	21						.						75.0	79.0	77.0					21																	31654987		2085	4220	6305	30576858	SO:0001819	synonymous_variant	643803	exon1			AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.264G>A	21.37:g.31654987C>T		Somatic		Capture	Illumina HiSeq	Phase_I	30576858	NM_001085455	Q1XDX0	Silent	SNP	ENST00000340345.4	37	CCDS42915.1																																																																																				0.567	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	NM_001085455	
IFNAR2	3455	broad.mit.edu	37	21	34635677	34635677	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr21:34635677G>A	ENST00000342136.4	+	9	1746	c.1420G>A	c.(1420-1422)Ggg>Agg	p.G474R	IL10RB_ENST00000290200.2_5'Flank|IL10RB-AS1_ENST00000411998.1_RNA|AP000295.9_ENST00000433395.2_Intron|IFNAR2_ENST00000382241.3_Missense_Mutation_p.G474R|IFNAR2_ENST00000342101.3_3'UTR|IFNAR2_ENST00000404220.3_3'UTR			P48551	INAR2_HUMAN	interferon (alpha, beta and omega) receptor 2	474					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|type I interferon binding (GO:0019962)|type I interferon receptor activity (GO:0004905)	p.G474R(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	11					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	GCTGGCCAGCGGGGAAGGGAC	0.517																																					p.G474R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1420A	21						.						137.0	137.0	137.0					21																	34635677		2203	4300	6503	33557547	SO:0001583	missense	3455	exon9				CCDS13621.1, CCDS13622.1, CCDS74782.1	21q22.1	2010-08-17			ENSG00000159110	ENSG00000159110		"""Interferons"""	5433	protein-coding gene	gene with protein product		602376		IFNABR		8181059	Standard	NM_207585		Approved		uc002yrd.3	P48551	OTTHUMG00000065127	ENST00000342136.4:c.1420G>A	21.37:g.34635677G>A	ENSP00000343957:p.Gly474Arg	Somatic		Capture	Illumina HiSeq	Phase_I	33557547	NM_207585	A8KAJ4|D3DSE8|D3DSE9|Q15467|Q6FHD7	Missense_Mutation	SNP	ENST00000342136.4	37	CCDS13621.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690364	0.48097	.	.	ENSG00000159110	ENST00000382241;ENST00000342136	T;T	0.23552	1.9;1.9	4.6	1.71	0.24356	.	3.982800	0.00550	N	0.000259	T	0.15955	0.0384	L	0.42245	1.32	0.09310	N	1	P	0.41710	0.76	B	0.28305	0.088	T	0.24012	-1.0172	10	0.07482	T	0.82	.	4.4876	0.11797	0.2035:0.1853:0.6112:0.0	.	474	P48551	INAR2_HUMAN	R	474	ENSP00000371676:G474R;ENSP00000343957:G474R	ENSP00000343957:G474R	G	+	1	0	IFNAR2	33557547	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	0.232000	0.17891	0.254000	0.21573	0.655000	0.94253	GGG		0.517	IFNAR2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139825.1		
RUNX1	861	broad.mit.edu	37	21	36206728	36206728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr21:36206728G>A	ENST00000344691.4	-	4	2280	c.703C>T	c.(703-705)Cag>Tag	p.Q235*	RUNX1_ENST00000399240.1_Intron|RUNX1_ENST00000358356.5_Nonsense_Mutation_p.Q235*|RUNX1_ENST00000300305.3_Nonsense_Mutation_p.Q262*|RUNX1_ENST00000437180.1_Nonsense_Mutation_p.Q262*|RUNX1_ENST00000325074.5_Nonsense_Mutation_p.Q250*	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	235	Pro/Ser/Thr-rich.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Q262*(1)|p.F259fs*219(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						CTCTGAGGCTGAGGGTTAAAG	0.652			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																p.Q262X			Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	.	.	2	Substitution - Nonsense(1)|Deletion - Frameshift(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.C784T	21						.						114.0	110.0	112.0					21																	36206728		2203	4300	6503	35128598	SO:0001587	stop_gained	861	exon7			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.703C>T	21.37:g.36206728G>A	ENSP00000340690:p.Gln235*	Somatic		Capture	Illumina HiSeq	Phase_I	35128598	NM_001754	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Nonsense_Mutation	SNP	ENST00000344691.4	37	CCDS42922.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.329255	0.81690	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399245;ENST00000358356;ENST00000399237	.	.	.	5.08	5.08	0.68730	.	0.118436	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-19.7417	18.4907	0.90846	0.0:0.0:1.0:0.0	.	.	.	.	X	235;262;262;250;238;235;250	.	ENSP00000300305:Q262X	Q	-	1	0	RUNX1	35128598	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.279000	0.65597	2.367000	0.80283	0.603000	0.83216	CAG		0.652	RUNX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194230.1		
ABCG1	9619	broad.mit.edu	37	21	43708421	43708421	+	Splice_Site	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr21:43708421C>T	ENST00000361802.2	+	10	1404	c.1259C>T	c.(1258-1260)tCg>tTg	p.S420L	ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000343687.3_Splice_Site_p.S419L|ABCG1_ENST00000340588.4_Splice_Site_p.S528L|ABCG1_ENST00000398437.1_Splice_Site_p.S566L|ABCG1_ENST00000347800.2_Splice_Site_p.S405L|ABCG1_ENST00000398449.3_Splice_Site_p.S408L|ABCG1_ENST00000398457.2_Splice_Site_p.S410L	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	420	ABC transmembrane type-2.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)	p.S420L(1)|p.S410L(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	ATGAGGGACTCGGTAAGGCTG	0.547																																					p.S405L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1214T	21						.						70.0	61.0	64.0					21																	43708421		2203	4300	6503	42581490	SO:0001630	splice_region_variant	9619	exon10			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.1260+1C>T	21.37:g.43708421C>T		Somatic		Capture	Illumina HiSeq	Phase_I	42581490	NM_207629	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	ENST00000361802.2	37	CCDS13682.1	.	.	.	.	.	.	.	.	.	.	C	9.913	1.210176	0.22289	.	.	ENSG00000160179	ENST00000398457;ENST00000347800;ENST00000398449;ENST00000361802;ENST00000343687;ENST00000398437;ENST00000340588	T;T;T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76	4.18	4.18	0.49190	ABC-2 type transporter (1);	0.421099	0.24024	N	0.042245	T	0.55924	0.1951	N	0.13168	0.305	0.49687	D	0.999813	B;B;B;B;B;B	0.33022	0.007;0.184;0.205;0.018;0.007;0.394	B;B;B;B;B;B	0.25614	0.015;0.04;0.042;0.025;0.005;0.062	T	0.56062	-0.8041	9	.	.	.	-1.5921	16.8551	0.86004	0.0:1.0:0.0:0.0	.	431;419;420;408;405;410	B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3	.;.;ABCG1_HUMAN;.;.;.	L	410;405;408;420;419;566;528	ENSP00000381475:S410L;ENSP00000291524:S405L;ENSP00000381467:S408L;ENSP00000354995:S420L;ENSP00000339744:S419L;ENSP00000381464:S566L;ENSP00000343820:S528L	.	S	+	2	0	ABCG1	42581490	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	2.959000	0.49153	2.046000	0.60703	0.460000	0.39030	TCG		0.547	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	NM_207174	Missense_Mutation
CLTCL1	8218	broad.mit.edu	37	22	19188971	19188971	+	Missense_Mutation	SNP	C	C	T	rs201292541		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr22:19188971C>T	ENST00000263200.10	-	23	3706	c.3634G>A	c.(3634-3636)Gag>Aag	p.E1212K	CLTCL1_ENST00000427926.1_Missense_Mutation_p.E1212K|CLTCL1_ENST00000353891.5_Missense_Mutation_p.E1212K|CLTCL1_ENST00000442042.2_5'UTR	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1212	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.E1212K(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					TTGGCAGCCTCGTACATTCCC	0.507			T	?	ALCL								C|||	1	0.000199681	0.0	0.0014	5008	,	,		20266	0.0		0.0	False		,,,				2504	0.0				p.E1212K			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3634A	22						.	C	LYS/GLU,LYS/GLU	6,3980		0,6,1987	81.0	88.0	86.0		3634,3634	1.2	0.2	22		86	0,8370		0,0,4185	yes	missense,missense	CLTCL1	NM_001835.3,NM_007098.3	56,56	0,6,6172	TT,TC,CC		0.0,0.1505,0.0486	,	1212/1584,1212/1641	19188971	6,12350	1993	4185	6178	17568971	SO:0001583	missense	8218	exon23				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.3634G>A	22.37:g.19188971C>T	ENSP00000445677:p.Glu1212Lys	Somatic		Capture	Illumina HiSeq	Phase_I	17568971	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	12.96	2.094558	0.36952	0.001505	0.0	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.26067	1.76;1.76;1.76	3.33	1.18	0.20946	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.258966	0.30293	N	0.009953	T	0.21921	0.0528	L	0.60455	1.87	0.47341	D	0.999392	B;B;B	0.31519	0.061;0.327;0.068	B;B;B	0.31812	0.049;0.136;0.027	T	0.04216	-1.0968	10	0.23302	T	0.38	-7.3006	8.9991	0.36069	0.0:0.8134:0.0:0.1866	.	1212;35;1212	P53675-2;B7Z1Z7;P53675	.;.;CLH2_HUMAN	K	1212	ENSP00000439662:E1212K;ENSP00000445677:E1212K;ENSP00000441158:E1212K	ENSP00000445677:E1212K	E	-	1	0	CLTCL1	17568971	1.000000	0.71417	0.227000	0.23927	0.873000	0.50193	3.339000	0.52135	0.132000	0.18615	0.491000	0.48974	GAG		0.507	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
GGA1	26088	broad.mit.edu	37	22	38026100	38026100	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr22:38026100C>T	ENST00000343632.4	+	13	1640	c.1254C>T	c.(1252-1254)agC>agT	p.S418S	GGA1_ENST00000406772.1_Silent_p.S345S|GGA1_ENST00000337437.4_Silent_p.S385S|GGA1_ENST00000381756.5_Silent_p.S435S|GGA1_ENST00000325180.8_Silent_p.S331S	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	418	Unstructured hinge.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S418S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					CAGCAAGCAGCGGTCTGGACG	0.677																																					p.S418S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1254T	22						.						55.0	58.0	57.0					22																	38026100		2203	4300	6503	36356046	SO:0001819	synonymous_variant	26088	exon13			AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.1254C>T	22.37:g.38026100C>T		Somatic		Capture	Illumina HiSeq	Phase_I	36356046	NM_001172687	A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Silent	SNP	ENST00000343632.4	37	CCDS13951.1																																																																																				0.677	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075873.3	NM_013365	
DESI1	27351	broad.mit.edu	37	22	42000127	42000127	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr22:42000127C>A	ENST00000263256.6	-	4	467	c.211G>T	c.(211-213)Gtg>Ttg	p.V71L	DESI1_ENST00000463886.1_5'UTR	NM_015704.2	NP_056519.1	Q6ICB0	DESI1_HUMAN	desumoylating isopeptidase 1	71	PPPDE peptidase.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)	p.V71L(1)									ACATCAACCACAGAGTCTGGA	0.512																																					p.V71L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G211T	22						.						90.0	87.0	88.0					22																	42000127		2203	4300	6503	40330073	SO:0001583	missense	27351	exon4			AF038183	CCDS33652.1	22q13.2	2012-05-16	2012-05-16	2012-05-16	ENSG00000100418	ENSG00000100418			24577	protein-coding gene	gene with protein product		614637	"""family with sequence similarity 152, member B"", ""PPPDE peptidase domain containing 2"""	FAM152B, PPPDE2		8619474, 9110174, 22370726	Standard	NM_015704		Approved	D15Wsu75e	uc003bam.2	Q6ICB0	OTTHUMG00000044632	ENST00000263256.6:c.211G>T	22.37:g.42000127C>A	ENSP00000263256:p.Val71Leu	Somatic		Capture	Illumina HiSeq	Phase_I	40330073	NM_015704		Missense_Mutation	SNP	ENST00000263256.6	37	CCDS33652.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395870	0.62177	.	.	ENSG00000100418	ENST00000263256	.	.	.	5.59	5.59	0.84812	Domain of unknown function DUF862, eukaryotic (1);	0.000000	0.85682	D	0.000000	T	0.68458	0.3003	M	0.79123	2.44	0.80722	D	1	B	0.17038	0.02	B	0.26310	0.068	T	0.63427	-0.6640	9	0.30078	T	0.28	-12.9289	14.2321	0.65901	0.0:0.9285:0.0:0.0715	.	71	Q6ICB0	PPDE2_HUMAN	L	71	.	ENSP00000263256:V71L	V	-	1	0	PPPDE2	40330073	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.803000	0.47924	2.810000	0.96702	0.650000	0.86243	GTG		0.512	DESI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000104124.3	NM_015704	
CNTNAP5	129684	broad.mit.edu	37	2	125547594	125547594	+	Silent	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:125547594C>A	ENST00000431078.1	+	18	3229	c.2865C>A	c.(2863-2865)ggC>ggA	p.G955G		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	955	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.G955G(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCAGGCCAGGCTGCCCCGGCC	0.547																																					p.G955G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2865A	2						.						52.0	59.0	57.0					2																	125547594		2130	4236	6366	125264064	SO:0001819	synonymous_variant	129684	exon18			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2865C>A	2.37:g.125547594C>A		Somatic		Capture	Illumina HiSeq	Phase_I	125264064	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	CCDS46401.1																																																																																				0.547	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
TUBA3E	112714	broad.mit.edu	37	2	130951730	130951730	+	Missense_Mutation	SNP	G	G	A	rs374679515		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:130951730G>A	ENST00000312988.7	-	4	785	c.685C>T	c.(685-687)Cgc>Tgc	p.R229C		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	229					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R229C(1)		endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					CCAATCAGGCGATTGAGGTTG	0.537																																					p.R229C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C685T	2						.	G	CYS/ARG	0,4406		0,0,2203	159.0	114.0	129.0		685	2.9	0.6	2		129	1,8593	1.2+/-3.3	0,1,4296	no	missense	TUBA3E	NM_207312.2	180	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	229/451	130951730	1,12999	2203	4297	6500	130668200	SO:0001583	missense	112714	exon4			BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.685C>T	2.37:g.130951730G>A	ENSP00000318197:p.Arg229Cys	Somatic		Capture	Illumina HiSeq	Phase_I	130668200	NM_207312		Missense_Mutation	SNP	ENST00000312988.7	37	CCDS2158.1	.	.	.	.	.	.	.	.	.	.	g	1.063	-0.672248	0.03403	0.0	1.16E-4	ENSG00000152086	ENST00000312988	T	0.69306	-0.39	2.92	2.92	0.33932	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.48286	U	0.000197	T	0.66674	0.2813	M	0.85542	2.76	0.51482	D	0.999927	B	0.25719	0.132	B	0.27170	0.077	T	0.70831	-0.4765	10	0.87932	D	0	.	7.3647	0.26766	0.0:0.0:0.7393:0.2607	.	229	Q6PEY2	TBA3E_HUMAN	C	229	ENSP00000318197:R229C	ENSP00000318197:R229C	R	-	1	0	TUBA3E	130668200	0.888000	0.30383	0.640000	0.29408	0.151000	0.21798	0.218000	0.17622	1.664000	0.50801	0.449000	0.29647	CGC		0.537	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312	
KYNU	8942	broad.mit.edu	37	2	143718335	143718335	+	Missense_Mutation	SNP	C	C	T	rs141632644	byFrequency	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:143718335C>T	ENST00000264170.4	+	8	983	c.725C>T	c.(724-726)gCg>gTg	p.A242V	KYNU_ENST00000375773.2_Missense_Mutation_p.A242V|KYNU_ENST00000409512.1_Missense_Mutation_p.A242V	NM_003937.2	NP_003928.1			kynureninase									p.A242V(1)		large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		GCTGGACAAGCGAAGGTATGC	0.428																																					p.A242V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C725T	2						.	C	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	138.0	131.0	134.0		725,725,725	4.5	1.0	2	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	KYNU	NM_001032998.1,NM_001199241.1,NM_003937.2	64,64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	242/308,242/466,242/466	143718335	1,13005	2203	4300	6503	143434805	SO:0001583	missense	8942	exon8			U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.725C>T	2.37:g.143718335C>T	ENSP00000264170:p.Ala242Val	Somatic		Capture	Illumina HiSeq	Phase_I	143434805	NM_001032998		Missense_Mutation	SNP	ENST00000264170.4	37	CCDS2183.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392286	0.42410	0.0	1.16E-4	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512	T;T;T	0.57907	0.37;0.37;0.37	5.35	4.46	0.54185	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.538276	0.21400	N	0.075169	T	0.50171	0.1600	M	0.78285	2.405	0.80722	D	1	P;P	0.36974	0.565;0.576	B;B	0.28232	0.087;0.067	T	0.53878	-0.8376	10	0.38643	T	0.18	.	13.2283	0.59927	0.3962:0.6037:0.0:0.0	.	242;242	Q16719;Q9BVW3	KYNU_HUMAN;.	V	242	ENSP00000264170:A242V;ENSP00000364928:A242V;ENSP00000386731:A242V	ENSP00000264170:A242V	A	+	2	0	KYNU	143434805	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	2.036000	0.41165	1.382000	0.46385	-0.182000	0.12963	GCG		0.428	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998	
NEB	4703	broad.mit.edu	37	2	152484190	152484190	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:152484190G>A	ENST00000172853.10	-	65	9408	c.9261C>T	c.(9259-9261)agC>agT	p.S3087S	NEB_ENST00000397345.3_Silent_p.S3330S|NEB_ENST00000604864.1_Silent_p.S3330S|NEB_ENST00000603639.1_Silent_p.S3330S|NEB_ENST00000427231.2_Silent_p.S3330S|NEB_ENST00000409198.1_Silent_p.S3087S			P20929	NEBU_HUMAN	nebulin	3087					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.S3330S(1)|p.S3087S(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CCACTGGGCTGCTGAACTTGG	0.517																																					p.S3330S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C9990T	2						.						393.0	385.0	387.0					2																	152484190		2071	4202	6273	152192436	SO:0001819	synonymous_variant	4703	exon69			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9261C>T	2.37:g.152484190G>A		Somatic		Capture	Illumina HiSeq	Phase_I	152192436	NM_001164507	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																					0.517	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
TTN	7273	broad.mit.edu	37	2	179431492	179431492	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:179431492T>C	ENST00000591111.1	-	276	74668	c.74444A>G	c.(74443-74445)gAg>gGg	p.E24815G	TTN_ENST00000342992.6_Missense_Mutation_p.E23888G|TTN_ENST00000589042.1_Missense_Mutation_p.E26456G|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E17583G|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E17391G|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E17516G|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24815	Fibronectin type-III 80. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E17391G(1)|p.E17583G(1)|p.E23886G(1)|p.E17516G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAATTCATACTCATGATCTTC	0.423																																					p.S17391G												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A52171G	2						.						91.0	94.0	93.0					2																	179431492		1857	4102	5959	179139738	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.74444A>G	2.37:g.179431492T>C	ENSP00000465570:p.Glu24815Gly	Somatic		Capture	Illumina HiSeq	Phase_I	179139738	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	13.86	2.363620	0.41902	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.75	5.75	0.90469	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75722	0.3888	M	0.83692	2.655	0.80722	D	1	D;D;D;D	0.61080	0.978;0.978;0.978;0.989	P;P;P;P	0.60117	0.715;0.715;0.715;0.869	T	0.80171	-0.1493	9	0.87932	D	0	.	16.0555	0.80801	0.0:0.0:0.0:1.0	.	17391;17516;17583;24815	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	23888;17391;17583;17516;17389	ENSP00000343764:E23888G;ENSP00000434586:E17391G;ENSP00000340554:E17583G;ENSP00000352154:E17516G	ENSP00000340554:E17583G	E	-	2	0	TTN	179139738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.185000	0.69588	0.459000	0.35465	GAG		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ITGA4	3676	broad.mit.edu	37	2	182387013	182387013	+	Missense_Mutation	SNP	C	C	T	rs199911081		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:182387013C>T	ENST00000397033.2	+	18	2448	c.2018C>T	c.(2017-2019)aCg>aTg	p.T673M		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	673					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)	p.T673M(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GCATATGAAACGACTCTACAT	0.358																																					p.T673M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2018T	2						.						188.0	174.0	178.0					2																	182387013		1868	4112	5980	182095258	SO:0001583	missense	3676	exon18				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2018C>T	2.37:g.182387013C>T	ENSP00000380227:p.Thr673Met	Somatic		Capture	Illumina HiSeq	Phase_I	182095258	NM_000885	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294625	0.60086	.	.	ENSG00000115232	ENST00000397033	T	0.59083	0.29	5.67	5.67	0.87782	Integrin alpha-2 (1);	0.047394	0.85682	D	0.000000	T	0.75708	0.3886	M	0.66939	2.045	0.45087	D	0.998107	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.77146	-0.2695	10	0.87932	D	0	.	19.7656	0.96337	0.0:1.0:0.0:0.0	.	495;673	Q59H74;P13612	.;ITA4_HUMAN	M	673	ENSP00000380227:T673M	ENSP00000380227:T673M	T	+	2	0	ITGA4	182095258	1.000000	0.71417	0.086000	0.20670	0.413000	0.31143	5.677000	0.68142	2.669000	0.90835	0.585000	0.79938	ACG		0.358	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
CALCRL	10203	broad.mit.edu	37	2	188225404	188225404	+	Silent	SNP	G	G	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:188225404G>C	ENST00000409998.1	-	11	1483	c.702C>G	c.(700-702)ggC>ggG	p.G234G	AC007319.1_ENST00000412276.1_RNA|CALCRL_ENST00000392370.3_Silent_p.G234G|AC007319.1_ENST00000453517.1_RNA|CALCRL_ENST00000410068.1_Silent_p.G234G			Q16602	CALRL_HUMAN	calcitonin receptor-like	234					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.G234G(1)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			GTAGGTAAATGCCTTCACAGA	0.393																																					p.G234G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C702G	2						.						91.0	80.0	84.0					2																	188225404		2203	4300	6503	187933649	SO:0001819	synonymous_variant	10203	exon10			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.702C>G	2.37:g.188225404G>C		Somatic		Capture	Illumina HiSeq	Phase_I	187933649	NM_005795	A8K6G5|A8KAD3|Q53S02|Q53TS5	Silent	SNP	ENST00000409998.1	37	CCDS2293.1																																																																																				0.393	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
CARF	79800	broad.mit.edu	37	2	203834723	203834723	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:203834723G>C	ENST00000402905.3	+	10	1356	c.1035G>C	c.(1033-1035)atG>atC	p.M345I	CARF_ENST00000320443.8_Missense_Mutation_p.M345I|WDR12_ENST00000477723.1_Intron|CARF_ENST00000545262.1_Missense_Mutation_p.M269I|CARF_ENST00000438828.2_Missense_Mutation_p.M345I|CARF_ENST00000428585.1_Missense_Mutation_p.M269I|CARF_ENST00000414439.1_Missense_Mutation_p.M243I|CARF_ENST00000456821.2_3'UTR|CARF_ENST00000545253.1_Missense_Mutation_p.M257I	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	345					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M345I(1)									TTATCAGAATGGAGCAGGAGA	0.308																																					p.M345I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1035C	2						.						96.0	91.0	93.0					2																	203834723		1815	4077	5892	203542968	SO:0001583	missense	79800	exon10			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.1035G>C	2.37:g.203834723G>C	ENSP00000384006:p.Met345Ile	Somatic		Capture	Illumina HiSeq	Phase_I	203542968	NM_001104586	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	ENST00000402905.3	37	CCDS42801.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.283656	0.59867	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	5.26	5.26	0.73747	.	0.178941	0.50627	D	0.000113	T	0.43033	0.1229	L	0.27053	0.805	0.34003	D	0.650487	P;P;P	0.39424	0.478;0.478;0.673	B;B;B	0.37144	0.173;0.122;0.242	T	0.58691	-0.7592	9	0.48119	T	0.1	-8.7782	17.8486	0.88738	0.0:0.0:1.0:0.0	.	257;269;345	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	I	345;243;269;257;269;345;345	.	ENSP00000316224:M345I	M	+	3	0	ALS2CR8	203542968	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.455000	0.66658	2.452000	0.82932	0.650000	0.86243	ATG		0.308	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
ZDBF2	57683	broad.mit.edu	37	2	207175566	207175566	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:207175566C>T	ENST00000374423.3	+	5	6700	c.6314C>T	c.(6313-6315)gCg>gTg	p.A2105V		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2105							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.A2105V(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TCTGCTTCAGCGCCTTTAATG	0.443																																					p.A2105V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6314T	2						.						67.0	66.0	66.0					2																	207175566		1891	4124	6015	206883811	SO:0001583	missense	57683	exon5			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6314C>T	2.37:g.207175566C>T	ENSP00000363545:p.Ala2105Val	Somatic		Capture	Illumina HiSeq	Phase_I	206883811	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	C	6.816	0.519637	0.13005	.	.	ENSG00000204186	ENST00000374423	T	0.45668	0.89	4.95	1.17	0.20885	.	.	.	.	.	T	0.14570	0.0352	N	0.00926	-1.1	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.29027	-1.0025	9	0.23302	T	0.38	.	8.8754	0.35343	0.0:0.7087:0.0:0.2913	.	2105	Q9HCK1	ZDBF2_HUMAN	V	2105	ENSP00000363545:A2105V	ENSP00000363545:A2105V	A	+	2	0	ZDBF2	206883811	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.498000	0.06420	-0.004000	0.14419	-1.008000	0.02478	GCG		0.443	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
MAP2	4133	broad.mit.edu	37	2	210518021	210518021	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:210518021C>T	ENST00000360351.4	+	4	633	c.127C>T	c.(127-129)Cga>Tga	p.R43*	MAP2_ENST00000199940.6_Nonsense_Mutation_p.R43*|MAP2_ENST00000447185.1_Nonsense_Mutation_p.R43*|MAP2_ENST00000361559.4_Nonsense_Mutation_p.R43*|MAP2_ENST00000392194.1_Nonsense_Mutation_p.R43*	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	43					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R43*(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AGGACTTGTCCGAAGCGCCAA	0.527																																					p.R43X	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C127T	2						.						115.0	89.0	97.0					2																	210518021		2203	4300	6503	210226266	SO:0001587	stop_gained	4133	exon4				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.127C>T	2.37:g.210518021C>T	ENSP00000353508:p.Arg43*	Somatic		Capture	Illumina HiSeq	Phase_I	210226266	NM_031847	Q17S04|Q8IUX2|Q99975|Q99976	Nonsense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	C	33	5.215536	0.95104	.	.	ENSG00000078018	ENST00000199940;ENST00000392193;ENST00000360351;ENST00000361559;ENST00000445941;ENST00000392194;ENST00000447185	.	.	.	5.29	2.12	0.27331	.	0.000000	0.47852	D	0.000207	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.8404	14.4615	0.67453	0.3791:0.6209:0.0:0.0	.	.	.	.	X	43	.	ENSP00000199940:R43X	R	+	1	2	MAP2	210226266	1.000000	0.71417	0.956000	0.39512	0.936000	0.57629	1.095000	0.30964	0.485000	0.27652	0.643000	0.83706	CGA		0.527	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
ALK	238	broad.mit.edu	37	2	29497989	29497989	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:29497989G>T	ENST00000389048.3	-	11	2923	c.2017C>A	c.(2017-2019)Cag>Aag	p.Q673K	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	673					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Q673K(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	ATGGGGGTCTGTCTTGGTGAA	0.463			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.Q673K		yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2017A	2						.						104.0	104.0	104.0					2																	29497989		2203	4300	6503	29351493	SO:0001583	missense	238	exon11	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2017C>A	2.37:g.29497989G>T	ENSP00000373700:p.Gln673Lys	Somatic		Capture	Illumina HiSeq	Phase_I	29351493	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	G	4.333	0.061221	0.08339	.	.	ENSG00000171094	ENST00000389048	T	0.76060	-0.99	4.8	2.96	0.34315	.	1.071810	0.07432	U	0.895786	T	0.65322	0.2680	L	0.34521	1.04	0.09310	N	0.999996	B	0.18968	0.032	B	0.15484	0.013	T	0.48352	-0.9043	9	.	.	.	.	12.0938	0.53742	0.0:0.753:0.247:0.0	.	673	Q9UM73	ALK_HUMAN	K	673	ENSP00000373700:Q673K	.	Q	-	1	0	ALK	29351493	0.050000	0.20438	0.011000	0.14972	0.115000	0.19883	1.511000	0.35801	0.427000	0.26145	0.561000	0.74099	CAG		0.463	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
WDPCP	51057	broad.mit.edu	37	2	63631605	63631605	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:63631605G>T	ENST00000272321.7	-	10	1540	c.1013C>A	c.(1012-1014)tCa>tAa	p.S338*	WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409562.3_Nonsense_Mutation_p.S338*|WDPCP_ENST00000409120.1_Nonsense_Mutation_p.S146*|WDPCP_ENST00000398544.3_Nonsense_Mutation_p.S179*|WDPCP_ENST00000409199.1_Nonsense_Mutation_p.S146*	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	338					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.S338*(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GATGGCCTTTGACTTTAGTGG	0.438																																					p.S338X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1013A	2						.						124.0	119.0	120.0					2																	63631605		1985	4172	6157	63485109	SO:0001587	stop_gained	51057	exon10				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1013C>A	2.37:g.63631605G>T	ENSP00000272321:p.Ser338*	Somatic		Capture	Illumina HiSeq	Phase_I	63485109	NM_015910	Q53RW4|Q7Z2Z3	Nonsense_Mutation	SNP	ENST00000272321.7	37	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022043	0.93462	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	.	.	.	5.54	4.65	0.58169	.	0.071645	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.2032	16.705	0.85369	0.0:0.1296:0.8704:0.0	.	.	.	.	X	338;146;146;179;338	.	ENSP00000272321:S338X	S	-	2	0	WDPCP	63485109	1.000000	0.71417	0.146000	0.22360	0.846000	0.48090	6.725000	0.74752	1.458000	0.47871	0.591000	0.81541	TCA		0.438	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910	
GKN1	56287	broad.mit.edu	37	2	69204790	69204790	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:69204790A>G	ENST00000377938.2	+	3	193	c.130A>G	c.(130-132)Aac>Gac	p.N44D		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	44					digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)		p.N44D(1)		breast(2)|large_intestine(4)|lung(5)	11						CAATGATGACAACAACAATGC	0.388																																					p.N44D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A130G	2						.						110.0	100.0	104.0					2																	69204790		2203	4300	6503	69058294	SO:0001583	missense	56287	exon3			AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.130A>G	2.37:g.69204790A>G	ENSP00000367172:p.Asn44Asp	Somatic		Capture	Illumina HiSeq	Phase_I	69058294	NM_019617	Q8IUA9	Missense_Mutation	SNP	ENST00000377938.2	37	CCDS1891.2	.	.	.	.	.	.	.	.	.	.	A	0.917	-0.717182	0.03182	.	.	ENSG00000169605	ENST00000377938	T	0.44083	0.93	5.12	-7.73	0.01245	.	1.380520	0.04145	N	0.320236	T	0.29882	0.0747	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.17806	-1.0357	10	0.31617	T	0.26	-0.0242	17.8736	0.88818	0.2923:0.0:0.7077:0.0	.	44	Q9NS71	GKN1_HUMAN	D	44	ENSP00000367172:N44D	ENSP00000367172:N44D	N	+	1	0	GKN1	69058294	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.369000	0.07533	-1.829000	0.01201	-0.993000	0.02533	AAC		0.388	GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617	
ERBB4	2066	broad.mit.edu	37	2	212288946	212288946	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr2:212288946C>T	ENST00000342788.4	-	23	3110	c.2800G>A	c.(2800-2802)Gag>Aag	p.E934K	ERBB4_ENST00000402597.1_Missense_Mutation_p.E924K|ERBB4_ENST00000436443.1_Missense_Mutation_p.E934K	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	934	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E934K(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TCTCCTTTCTCTAATAAATCA	0.393										TSP Lung(8;0.080)																											p.E934K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2800A	2						.						109.0	108.0	108.0					2																	212288946		2203	4300	6503	211997191	SO:0001583	missense	2066	exon23			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2800G>A	2.37:g.212288946C>T	ENSP00000342235:p.Glu934Lys	Somatic		Capture	Illumina HiSeq	Phase_I	211997191	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	35	5.548794	0.96488	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	D;D;D	0.82255	-1.59;-1.59;-1.59	6.16	6.16	0.99307	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87529	0.6200	L	0.37466	1.105	0.80722	D	1	P;P;P;P	0.51933	0.545;0.949;0.545;0.6	B;P;B;B	0.61533	0.177;0.89;0.177;0.271	D	0.87377	0.2354	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	924;924;934;934	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	K	934;934;924	ENSP00000342235:E934K;ENSP00000403204:E934K;ENSP00000385565:E924K	ENSP00000342235:E934K	E	-	1	0	ERBB4	211997191	1.000000	0.71417	0.998000	0.56505	0.871000	0.50021	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GAG		0.393	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
SENP7	57337	broad.mit.edu	37	3	101062576	101062576	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr3:101062576G>T	ENST00000394095.2	-	14	2113	c.2060C>A	c.(2059-2061)gCt>gAt	p.A687D	SENP7_ENST00000394094.2_Missense_Mutation_p.A622D|SENP7_ENST00000394091.1_Missense_Mutation_p.A523D|SENP7_ENST00000314261.7_Missense_Mutation_p.A621D|SENP7_ENST00000348610.3_Missense_Mutation_p.A654D|SENP7_ENST00000358203.3_Missense_Mutation_p.A523D	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	687						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.A621D(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AGCAACACCAGCAGGGAAAGA	0.378																																					p.A687D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2060A	3						.						86.0	87.0	87.0					3																	101062576		2203	4300	6503	102545266	SO:0001583	missense	57337	exon14				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2060C>A	3.37:g.101062576G>T	ENSP00000377655:p.Ala687Asp	Somatic		Capture	Illumina HiSeq	Phase_I	102545266	NM_020654	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	ENST00000394095.2	37	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	G	1.002	-0.690725	0.03303	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.18338	2.22;2.23;2.23;2.23;2.23;2.22	4.14	-0.0816	0.13701	.	1.361560	0.05580	U	0.572698	T	0.11367	0.0277	N	0.19112	0.55	0.09310	N	1	P;P;P;P	0.38922	0.589;0.646;0.478;0.651	B;B;B;B	0.38428	0.122;0.271;0.115;0.273	T	0.31420	-0.9944	10	0.36615	T	0.2	1.5762	6.1442	0.20276	0.5022:0.0:0.4978:0.0	.	523;621;654;687	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	D	687;622;621;523;523;654	ENSP00000377655:A687D;ENSP00000377654:A622D;ENSP00000313624:A621D;ENSP00000377651:A523D;ENSP00000350936:A523D;ENSP00000342159:A654D	ENSP00000313624:A621D	A	-	2	0	SENP7	102545266	0.006000	0.16342	0.008000	0.14137	0.045000	0.14185	0.721000	0.25911	0.075000	0.16796	0.585000	0.79938	GCT		0.378	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
BOC	91653	broad.mit.edu	37	3	112968705	112968705	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr3:112968705C>A	ENST00000495514.1	+	3	760	c.56C>A	c.(55-57)gCt>gAt	p.A19D	BOC_ENST00000485230.1_Missense_Mutation_p.A19D|BOC_ENST00000484034.1_Missense_Mutation_p.A19D|BOC_ENST00000355385.3_Missense_Mutation_p.A19D|BOC_ENST00000273395.4_Missense_Mutation_p.A19D			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	19					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.A19D(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GTCACACTGGCTTGCCTCCTC	0.552																																					p.A19D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C56A	3						.						158.0	103.0	122.0					3																	112968705		2203	4300	6503	114451395	SO:0001583	missense	91653	exon3			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.56C>A	3.37:g.112968705C>A	ENSP00000418663:p.Ala19Asp	Somatic		Capture	Illumina HiSeq	Phase_I	114451395	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	c	11.06	1.528470	0.27299	.	.	ENSG00000144857	ENST00000464546;ENST00000495514;ENST00000485230;ENST00000462425;ENST00000273395;ENST00000355385;ENST00000494687;ENST00000484034	D;T;T;T;T;T	0.82167	-1.58;0.23;0.5;0.24;0.23;0.5	5.29	2.53	0.30540	.	0.782162	0.12403	N	0.471976	T	0.75162	0.3812	N	0.19112	0.55	0.09310	N	1	D;P;B;P	0.53151	0.958;0.573;0.437;0.868	P;B;B;B	0.48704	0.587;0.219;0.109;0.296	T	0.62774	-0.6783	10	0.35671	T	0.21	.	8.7031	0.34338	0.0:0.6883:0.0:0.3117	.	19;19;19;19	C9J2L7;Q9BWV1-3;Q9BWV1;Q96DN7	.;.;BOC_HUMAN;.	D	19	ENSP00000417362:A19D;ENSP00000418663:A19D;ENSP00000420154:A19D;ENSP00000273395:A19D;ENSP00000347546:A19D;ENSP00000417337:A19D	ENSP00000273395:A19D	A	+	2	0	BOC	114451395	0.001000	0.12720	0.002000	0.10522	0.805000	0.45488	1.048000	0.30379	0.375000	0.24679	-0.142000	0.14014	GCT		0.552	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
TADA3	10474	broad.mit.edu	37	3	9831586	9831586	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr3:9831586T>C	ENST00000301964.2	-	3	827	c.269A>G	c.(268-270)cAt>cGt	p.H90R	TADA3_ENST00000343450.2_Missense_Mutation_p.H90R|TADA3_ENST00000440161.1_Missense_Mutation_p.H90R|ARPC4_ENST00000397261.3_5'Flank|ARPC4_ENST00000498623.2_5'Flank|TADA3_ENST00000492635.1_5'UTR|ARPC4_ENST00000287613.7_5'Flank	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	90					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.H90R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						TCCAAGTTCATGGTCTCGACC	0.562																																					p.H90R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A269G	3						.						69.0	66.0	67.0					3																	9831586		2203	4300	6503	9806586	SO:0001583	missense	10474	exon3			AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.269A>G	3.37:g.9831586T>C	ENSP00000307684:p.His90Arg	Somatic		Capture	Illumina HiSeq	Phase_I	9806586	NM_133480	Q6FI83|Q9UFS2	Missense_Mutation	SNP	ENST00000301964.2	37	CCDS2583.1	.	.	.	.	.	.	.	.	.	.	T	13.30	2.195593	0.38806	.	.	ENSG00000171148	ENST00000301964;ENST00000440161;ENST00000343450;ENST00000439043	.	.	.	5.53	5.53	0.82687	.	0.050608	0.85682	D	0.000000	T	0.42517	0.1206	N	0.22421	0.69	0.48452	D	0.999656	B	0.23128	0.08	B	0.17433	0.018	T	0.32241	-0.9914	9	0.12430	T	0.62	-2.7322	15.6519	0.77104	0.0:0.0:0.0:1.0	.	90	O75528	TADA3_HUMAN	R	90	.	ENSP00000307684:H90R	H	-	2	0	TADA3	9806586	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	5.948000	0.70249	2.095000	0.63458	0.533000	0.62120	CAT		0.562	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250236.1		
CCR8	1237	broad.mit.edu	37	3	39374455	39374455	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr3:39374455C>T	ENST00000326306.4	+	2	771	c.633C>T	c.(631-633)ttC>ttT	p.F211F	CCR8_ENST00000545843.1_Silent_p.F128F|CCR8_ENST00000414803.1_3'UTR	NM_005201.3	NP_005192.1	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	211					cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)	p.F211F(1)		NS(3)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		TGATCCCATTCACCATCTTTA	0.398																																					p.F211F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C633T	3						.						106.0	103.0	104.0					3																	39374455		2203	4300	6503	39349459	SO:0001819	synonymous_variant	1237	exon2			D49919	CCDS2684.1	3p22	2012-08-08			ENSG00000179934	ENSG00000179934		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1609	protein-coding gene	gene with protein product		601834		CMKBRL2, CMKBR8		8816377, 8886020	Standard	NM_005201		Approved	CY6, TER1, CKR-L1, GPR-CY6, CDw198	uc010hhr.2	P51685	OTTHUMG00000131290	ENST00000326306.4:c.633C>T	3.37:g.39374455C>T		Somatic		Capture	Illumina HiSeq	Phase_I	39349459	NM_005201	B2RC64|Q3KNQ8|Q3KNR3|Q9BYX5	Silent	SNP	ENST00000326306.4	37	CCDS2684.1																																																																																				0.398	CCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254058.2	NM_005201	
KLHDC8B	200942	broad.mit.edu	37	3	49213087	49213087	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr3:49213087G>A	ENST00000332780.2	+	6	1127	c.918G>A	c.(916-918)cgG>cgA	p.R306R	C3orf84_ENST00000443990.1_5'Flank	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	306						cytoplasm (GO:0005737)		p.R306R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCCTTGCACGGCGGCGCTGGG	0.627																																					p.R306R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G918A	3						.						72.0	73.0	73.0					3																	49213087		2203	4300	6503	49188091	SO:0001819	synonymous_variant	200942	exon6				CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.918G>A	3.37:g.49213087G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49188091	NM_173546		Silent	SNP	ENST00000332780.2	37	CCDS2791.1																																																																																				0.627	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345974.1	NM_173546	
DUSP7	1849	broad.mit.edu	37	3	52084933	52084933	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr3:52084933C>T	ENST00000495880.1	-	3	1341	c.1158G>A	c.(1156-1158)ggG>ggA	p.G386G	DUSP7_ENST00000296483.6_Silent_p.G335G			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	386					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.G335G(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCTGCTTAGCCCCAGCGTCC	0.562																																					p.G386G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1158A	3						.						162.0	131.0	141.0					3																	52084933		2203	4300	6503	52059973	SO:0001819	synonymous_variant	1849	exon3			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.1158G>A	3.37:g.52084933C>T		Somatic		Capture	Illumina HiSeq	Phase_I	52059973	NM_001947	Q2M3J7|Q8NFJ0	Silent	SNP	ENST00000495880.1	37	CCDS33766.2																																																																																				0.562	DUSP7-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349697.1	NM_001947	
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0 	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PCDH7	5099	broad.mit.edu	37	4	30725598	30725598	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr4:30725598C>A	ENST00000361762.2	+	1	3562	c.2554C>A	c.(2554-2556)Cag>Aag	p.Q852K	PCDH7_ENST00000543491.1_Missense_Mutation_p.Q852K	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	852	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q805K(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GATTGACTCCCAGATAGCTAG	0.483																																					p.Q852K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2554A	4						.						79.0	78.0	78.0					4																	30725598		2203	4300	6503	30334696	SO:0001583	missense	5099	exon1			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2554C>A	4.37:g.30725598C>A	ENSP00000355243:p.Gln852Lys	Somatic		Capture	Illumina HiSeq	Phase_I	30334696	NM_032456	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.7|20.7	4.026344|4.026344	0.75390|0.75390	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.32515	.|1.45;1.45	4.96|4.96	4.96|4.96	0.65561|0.65561	.|Protocadherin (1);Cadherin (1);	.|.	.|.	.|.	.|.	T|T	0.50871|0.50871	0.1641|0.1641	L|L	0.56769|0.56769	1.78|1.78	0.54753|0.54753	D|D	0.999989|0.999989	.|D;D;D	.|0.67145	.|0.995;0.987;0.996	.|P;P;P	.|0.62014	.|0.835;0.835;0.897	T|T	0.52852|0.52852	-0.8520|-0.8520	5|9	.|0.72032	.|D	.|0.01	.|.	18.3985|18.3985	0.90507|0.90507	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|852;805;852	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	Q|K	541|852;852;805	.|ENSP00000355243:Q852K;ENSP00000441802:Q852K	.|ENSP00000330302:Q805K	P|Q	+|+	2|1	0|0	PCDH7|PCDH7	30334696|30334696	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.981000|0.981000	0.71138|0.71138	7.651000|7.651000	0.83577|0.83577	2.577000|2.577000	0.86979|0.86979	0.655000|0.655000	0.94253|0.94253	CCA|CAG		0.483	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
PDGFRA	5156	broad.mit.edu	37	4	55156638	55156638	+	Silent	SNP	C	C	T	rs138150216	byFrequency	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr4:55156638C>T	ENST00000257290.5	+	22	3370	c.3039C>T	c.(3037-3039)agC>agT	p.S1013S	FIP1L1_ENST00000507166.1_Silent_p.S773S	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	1013					adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.S1013S(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	AGAGACTGAGCGCTGACAGTG	0.552			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)			C|||	6	0.00119808	0.0	0.0	5008	,	,		18821	0.006		0.0	False		,,,				2504	0.0				p.S1013S	Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3039T	4						.						194.0	160.0	172.0					4																	55156638		2203	4300	6503	54851395	SO:0001819	synonymous_variant	5156	exon22	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.3039C>T	4.37:g.55156638C>T		Somatic		Capture	Illumina HiSeq	Phase_I	54851395	NM_006206	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Silent	SNP	ENST00000257290.5	37	CCDS3495.1																																																																																				0.552	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
UGT2B28	54490	broad.mit.edu	37	4	70146727	70146727	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr4:70146727A>G	ENST00000335568.5	+	1	511	c.509A>G	c.(508-510)tAc>tGc	p.Y170C	UGT2B28_ENST00000511240.1_Missense_Mutation_p.Y170C	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	170					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.Y170C(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						CCGTTTGTGTACAGTCTCTGC	0.408																																					p.Y170C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A509G	4						.						118.0	125.0	123.0					4																	70146727		2032	4235	6267	70181316	SO:0001583	missense	54490	exon1			AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.509A>G	4.37:g.70146727A>G	ENSP00000334276:p.Tyr170Cys	Somatic		Capture	Illumina HiSeq	Phase_I	70181316	NM_053039	B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	-	12.80	2.046317	0.36085	.	.	ENSG00000135226	ENST00000335568;ENST00000511240	T;T	0.61980	0.06;0.06	2.18	2.18	0.27775	.	0.303615	0.26400	U	0.024588	T	0.78923	0.4360	M	0.90759	3.145	0.26418	N	0.976149	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.992	T	0.68239	-0.5461	10	0.87932	D	0	.	7.9497	0.30008	1.0:0.0:0.0:0.0	.	170;170	Q9BY64-2;Q9BY64	.;UDB28_HUMAN	C	170	ENSP00000334276:Y170C;ENSP00000427399:Y170C	ENSP00000334276:Y170C	Y	+	2	0	UGT2B28	70181316	0.964000	0.33143	0.146000	0.22360	0.006000	0.05464	2.564000	0.45931	1.012000	0.39366	0.155000	0.16302	TAC		0.408	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
GRID2	2895	broad.mit.edu	37	4	94145838	94145838	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr4:94145838A>T	ENST00000282020.4	+	7	1295	c.1037A>T	c.(1036-1038)aAg>aTg	p.K346M	GRID2_ENST00000510992.1_Missense_Mutation_p.K251M	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	346					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.K346M(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GAGGACCGAAAGTGGCACAGC	0.438																																					p.K346M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1037T	4						.						84.0	81.0	82.0					4																	94145838		2203	4300	6503	94364861	SO:0001583	missense	2895	exon7			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1037A>T	4.37:g.94145838A>T	ENSP00000282020:p.Lys346Met	Somatic		Capture	Illumina HiSeq	Phase_I	94364861	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.544595	0.86022	.	.	ENSG00000152208	ENST00000282020;ENST00000510992;ENST00000512631	D;D;D	0.83419	-1.72;-1.72;-1.72	5.53	5.53	0.82687	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88062	0.6336	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.997;0.998;0.999	D	0.89318	0.3638	10	0.87932	D	0	.	15.6884	0.77430	1.0:0.0:0.0:0.0	.	251;346;251	E9PH24;O43424;Q4KKU8	.;GRID2_HUMAN;.	M	346;251;27	ENSP00000282020:K346M;ENSP00000421257:K251M;ENSP00000423331:K27M	ENSP00000282020:K346M	K	+	2	0	GRID2	94364861	1.000000	0.71417	0.993000	0.49108	0.868000	0.49771	9.339000	0.96797	2.100000	0.63781	0.533000	0.62120	AAG		0.438	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
SNX25	83891	broad.mit.edu	37	4	186274742	186274742	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr4:186274742T>C	ENST00000504273.1	+	15	2372	c.2078T>C	c.(2077-2079)tTt>tCt	p.F693S	SNX25_ENST00000512853.1_3'UTR|SNX25_ENST00000264694.8_Missense_Mutation_p.F693S			Q9H3E2	SNX25_HUMAN	sorting nexin 25	693					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.F693S(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GGGGAGATTTTTGAACTTCGA	0.388																																					p.F693S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2078C	4						.						301.0	289.0	293.0					4																	186274742		2203	4300	6503	186511736	SO:0001583	missense	83891	exon15			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.2078T>C	4.37:g.186274742T>C	ENSP00000426255:p.Phe693Ser	Somatic		Capture	Illumina HiSeq	Phase_I	186511736	NM_031953	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.659248	0.88154	.	.	ENSG00000109762	ENST00000504273;ENST00000264694;ENST00000264693	T;T	0.34859	1.34;1.34	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.985	D;D;P	0.74023	0.982;0.919;0.711	T	0.63193	-0.6692	10	0.87932	D	0	-21.3005	14.7784	0.69746	0.0:0.0:0.0:1.0	.	409;226;693	Q8N6K3;Q9H5Q8;Q9H3E2	.;.;SNX25_HUMAN	S	693;693;226	ENSP00000426255:F693S;ENSP00000264694:F693S	ENSP00000264693:F226S	F	+	2	0	SNX25	186511736	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	2.238000	0.73509	0.528000	0.53228	TTT		0.388	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
APC	324	broad.mit.edu	37	5	112174170	112174171	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr5:112174170_112174171insAA	ENST00000457016.1	+	16	3259_3260	c.2879_2880insAA	c.(2878-2883)tcaaatfs	p.N961fs	APC_ENST00000257430.4_Frame_Shift_Ins_p.N961fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Ins_p.N961fs			P25054	APC_HUMAN	adenomatous polyposis coli	961	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.N961fs*5(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGAGATCTTCAAATGATAGTT	0.342		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S960fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|skin(1)	c.2879_2880insAA	5						.																																			112202070	SO:0001589	frameshift_variant	324	exon16	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2880_2881dupAA	5.37:g.112174171_112174172dupAA	ENSP00000413133:p.Asn961fs	Somatic		Capture	Illumina HiSeq	Phase_I	112202069	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				0.342	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DNAH5	1767	broad.mit.edu	37	5	13823419	13823419	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr5:13823419G>T	ENST00000265104.4	-	40	6744	c.6640C>A	c.(6640-6642)Ctg>Atg	p.L2214M		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2214					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L2214M(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCCTTGTCCAGAAGAATATTT	0.388									Kartagener syndrome																												p.L2214M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6640A	5						.						135.0	142.0	140.0					5																	13823419		2203	4300	6503	13876419	SO:0001583	missense	1767	exon40	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6640C>A	5.37:g.13823419G>T	ENSP00000265104:p.Leu2214Met	Somatic		Capture	Illumina HiSeq	Phase_I	13876419	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968169	0.74131	.	.	ENSG00000039139	ENST00000265104	T	0.44083	0.93	6.17	-1.13	0.09775	.	0.000000	0.85682	D	0.000000	T	0.64897	0.2640	H	0.95151	3.63	0.53688	D	0.999972	D	0.54964	0.969	P	0.56751	0.805	T	0.73360	-0.4007	10	0.72032	D	0.01	.	11.0925	0.48123	0.4555:0.0:0.5445:0.0	.	2214	Q8TE73	DYH5_HUMAN	M	2214	ENSP00000265104:L2214M	ENSP00000265104:L2214M	L	-	1	2	DNAH5	13876419	0.979000	0.34478	0.741000	0.31004	0.997000	0.91878	1.766000	0.38491	-0.057000	0.13199	0.655000	0.94253	CTG		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PCDHB5	26167	broad.mit.edu	37	5	140515444	140515444	+	Missense_Mutation	SNP	C	C	A	rs371263545		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr5:140515444C>A	ENST00000231134.5	+	1	645	c.428C>A	c.(427-429)cCa>cAa	p.P143Q		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	143	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P143Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTAAAAATCCCAGAGAGCACC	0.443																																					p.P143Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C428A	5						.						79.0	88.0	85.0					5																	140515444		2203	4300	6503	140495628	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.428C>A	5.37:g.140515444C>A	ENSP00000231134:p.Pro143Gln	Somatic		Capture	Illumina HiSeq	Phase_I	140495628	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	C	2.327	-0.354284	0.05173	.	.	ENSG00000113209	ENST00000231134	T	0.54866	0.55	5.18	4.29	0.51040	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.54159	0.1841	M	0.83223	2.63	0.09310	N	1	B	0.18461	0.028	B	0.24269	0.052	T	0.48163	-0.9059	9	0.25106	T	0.35	.	8.5518	0.33455	0.1586:0.7643:0.0:0.0771	.	143	Q9Y5E4	PCDB5_HUMAN	Q	143	ENSP00000231134:P143Q	ENSP00000231134:P143Q	P	+	2	0	PCDHB5	140495628	0.000000	0.05858	0.906000	0.35671	0.077000	0.17291	-0.575000	0.05861	1.256000	0.44068	0.555000	0.69702	CCA		0.443	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
OSMR	9180	broad.mit.edu	37	5	38881754	38881754	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr5:38881754G>T	ENST00000274276.3	+	4	708	c.306G>T	c.(304-306)gaG>gaT	p.E102D	OSMR_ENST00000502536.1_Missense_Mutation_p.E102D	NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	102					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.E102D(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					GGGAATCTGAGCTCCCTTTGG	0.468																																					p.E102D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G306T	5						.						117.0	111.0	113.0					5																	38881754		2203	4300	6503	38917511	SO:0001583	missense	9180	exon4			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.306G>T	5.37:g.38881754G>T	ENSP00000274276:p.Glu102Asp	Somatic		Capture	Illumina HiSeq	Phase_I	38917511	NM_001168355	Q6P4E8|Q96QJ6	Missense_Mutation	SNP	ENST00000274276.3	37	CCDS3928.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.033482	0.00406	.	.	ENSG00000145623	ENST00000502536;ENST00000274276	T;T	0.61742	0.08;0.08	5.81	0.583	0.17417	.	0.388896	0.29972	N	0.010738	T	0.31263	0.0791	N	0.16307	0.4	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.13407	0.003;0.009	T	0.27226	-1.0080	10	0.02654	T	1	.	8.6346	0.33939	0.0757:0.0:0.5447:0.3795	.	102;102	Q99650;Q99650-2	OSMR_HUMAN;.	D	102	ENSP00000422023:E102D;ENSP00000274276:E102D	ENSP00000274276:E102D	E	+	3	2	OSMR	38917511	0.593000	0.26840	0.068000	0.19968	0.064000	0.16182	-0.290000	0.08354	0.063000	0.16370	-2.029000	0.00425	GAG		0.468	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999	
PDE8B	8622	broad.mit.edu	37	5	76627248	76627248	+	Silent	SNP	G	G	A	rs138641918		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr5:76627248G>A	ENST00000264917.5	+	5	717	c.672G>A	c.(670-672)gcG>gcA	p.A224A	PDE8B_ENST00000342343.4_Silent_p.A204A|PDE8B_ENST00000346042.3_Silent_p.A224A|PDE8B_ENST00000333194.4_Silent_p.A224A|PDE8B_ENST00000340978.3_Silent_p.A224A	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	224					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.A224A(1)	GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	ATGAAGAGGCGTCAGTCCTTC	0.488													G|||	1	0.000199681	0.0	0.0	5008	,	,		21369	0.0		0.0	False		,,,				2504	0.001				p.A224A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G672A	5						.	G	,,,,	2,4404	4.2+/-10.8	0,2,2201	244.0	220.0	228.0		672,672,612,672,672	2.3	1.0	5	dbSNP_134	228	10,8590	7.7+/-29.5	0,10,4290	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PDE8B	NM_001029851.2,NM_001029852.2,NM_001029853.2,NM_001029854.2,NM_003719.3	,,,,	0,12,6491	AA,AG,GG		0.1163,0.0454,0.0923	,,,,	224/789,224/831,204/866,224/839,224/886	76627248	12,12994	2203	4300	6503	76663004	SO:0001819	synonymous_variant	8622	exon5			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.672G>A	5.37:g.76627248G>A		Somatic		Capture	Illumina HiSeq	Phase_I	76663004	NM_003719	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Silent	SNP	ENST00000264917.5	37	CCDS4037.1																																																																																				0.488	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
APC	324	broad.mit.edu	37	5	112175524	112175524	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr5:112175524delT	ENST00000457016.1	+	16	4613	c.4233delT	c.(4231-4233)agtfs	p.S1411fs	APC_ENST00000257430.4_Frame_Shift_Del_p.S1411fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.S1411fs			P25054	APC_HUMAN	adenomatous polyposis coli	1411	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1411fs*4(16)|p.Y1376fs*41(1)|p.?(1)|p.S1411fs*41(1)|p.K1192fs*3(1)|p.P1409fs*6(1)|p.S1411fs*2(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AACCATGCAGTGGAATGGTAA	0.478		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1393fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	22	Deletion - Frameshift(21)|Unknown(1)	large_intestine(20)|soft_tissue(1)|skin(1)	c.4179delT	5						.						116.0	107.0	110.0					5																	112175524		2202	4300	6502	112203423	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4233delT	5.37:g.112175524delT	ENSP00000413133:p.Ser1411fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203423	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHGA1	56114	broad.mit.edu	37	5	140712441	140712441	+	Silent	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr5:140712441C>T	ENST00000517417.1	+	1	2190	c.2190C>T	c.(2188-2190)ggC>ggT	p.G730G	PCDHGA1_ENST00000378105.3_Silent_p.G730G	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	730					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G730G(4)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCGGGAGGCGGCTTAGCGA	0.662																																					p.G730G												.	.	4	Substitution - coding silent(4)	large_intestine(2)|endometrium(2)	c.C2190T	5						.						65.0	70.0	68.0					5																	140712441		2203	4300	6503	140692625	SO:0001819	synonymous_variant	56114	exon1			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2190C>T	5.37:g.140712441C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140692625	NM_031993	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	37	CCDS54922.1																																																																																				0.662	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
LPA	4018	broad.mit.edu	37	6	161022000	161022000	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr6:161022000C>T	ENST00000316300.5	-	19	3120	c.3076G>A	c.(3076-3078)Gtc>Atc	p.V1026I	LPA_ENST00000447678.1_Missense_Mutation_p.V1026I			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3534	Kringle 9. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.V1026I(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TTCGGAGGGACGAAGGCAGTC	0.493																																					p.V1026I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3076A	6						.						80.0	83.0	82.0					6																	161022000		2182	4299	6481	160941990	SO:0001583	missense	4018	exon20			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3076G>A	6.37:g.161022000C>T	ENSP00000321334:p.Val1026Ile	Somatic		Capture	Illumina HiSeq	Phase_I	160941990	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	0.727	-0.781441	0.02929	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62788	-0.0;-0.0	1.94	-3.18	0.05186	Kringle (1);Kringle-like fold (1);	.	.	.	.	T	0.12561	0.0305	N	0.13003	0.285	0.09310	N	1	P	0.35401	0.499	B	0.20384	0.029	T	0.12578	-1.0542	9	0.17369	T	0.5	.	6.3793	0.21525	0.0:0.3282:0.0:0.6718	.	3534	P08519	APOA_HUMAN	I	1026	ENSP00000321334:V1026I;ENSP00000395608:V1026I	ENSP00000321334:V1026I	V	-	1	0	LPA	160941990	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.439000	0.01016	-0.729000	0.04875	-2.545000	0.00179	GTC		0.493	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
LRRC16A	55604	broad.mit.edu	37	6	25538206	25538206	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr6:25538206A>G	ENST00000329474.6	+	25	2559	c.2191A>G	c.(2191-2193)Aaa>Gaa	p.K731E		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	731					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)	p.K731E(1)		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						TAAGAACTCTAAAACGGTGAG	0.398																																					p.K731E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2191G	6						.						43.0	40.0	41.0					6																	25538206		1869	4112	5981	25646185	SO:0001583	missense	55604	exon25			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.2191A>G	6.37:g.25538206A>G	ENSP00000331983:p.Lys731Glu	Somatic		Capture	Illumina HiSeq	Phase_I	25646185	NM_017640	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	ENST00000329474.6	37	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.838170	0.91117	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.18502	2.21	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.27524	0.0676	L	0.58810	1.83	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.999;0.998	D;D;D;D	0.85130	0.993;0.96;0.997;0.993	T	0.01520	-1.1334	10	0.29301	T	0.29	-21.8748	15.7783	0.78242	1.0:0.0:0.0:0.0	.	731;731;731;731	Q5VZK9;B2RTQ5;Q5VZK9-2;B8X1J0	LR16A_HUMAN;.;.;.	E	731	ENSP00000331983:K731E	ENSP00000331983:K731E	K	+	1	0	LRRC16A	25646185	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.701000	0.91331	2.205000	0.71048	0.482000	0.46254	AAA		0.398	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	
BTN3A1	11119	broad.mit.edu	37	6	26413704	26413704	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr6:26413704G>A	ENST00000289361.6	+	10	1694	c.1326G>A	c.(1324-1326)cgG>cgA	p.R442R	BTN3A1_ENST00000414912.2_Silent_p.R390R	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	442	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R442R(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						ATAAGTATCGGACTCTAACTG	0.473																																					p.R390R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1170A	6						.						139.0	140.0	140.0					6																	26413704		2203	4300	6503	26521683	SO:0001819	synonymous_variant	11119	exon10			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1326G>A	6.37:g.26413704G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26521683	NM_001145008	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Silent	SNP	ENST00000289361.6	37	CCDS4608.1																																																																																				0.473	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
CLPS	1208	broad.mit.edu	37	6	35762985	35762985	+	Missense_Mutation	SNP	C	C	T	rs150755879	byFrequency	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr6:35762985C>T	ENST00000259938.2	-	3	299	c.277G>A	c.(277-279)Gtg>Atg	p.V93M		NM_001832.3	NP_001823.1	P04118	COL_HUMAN	colipase, pancreatic	93					lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme activator activity (GO:0008047)	p.V93M(1)		large_intestine(2)|lung(2)|prostate(1)	5						ATGGAGCCCACGATGGTCTTG	0.567													C|||	2	0.000399361	0.0015	0.0	5008	,	,		27997	0.0		0.0	False		,,,				2504	0.0				p.V93M	Melanoma(167;2962 3494 37796)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G277A	6						.	C	MET/VAL	10,4396	15.5+/-35.6	0,10,2193	276.0	182.0	214.0		277	0.3	0.0	6	dbSNP_134	214	0,8600		0,0,4300	yes	missense	CLPS	NM_001832.2	21	0,10,6493	TT,TC,CC		0.0,0.227,0.0769	possibly-damaging	93/113	35762985	10,12996	2203	4300	6503	35870963	SO:0001583	missense	1208	exon3				CCDS4811.1, CCDS75437.1, CCDS75438.1	6p21.31	2012-02-06			ENSG00000137392	ENSG00000137392			2085	protein-coding gene	gene with protein product		120105				2045105	Standard	NM_001832		Approved		uc003ole.2	P04118	OTTHUMG00000014578	ENST00000259938.2:c.277G>A	6.37:g.35762985C>T	ENSP00000259938:p.Val93Met	Somatic		Capture	Illumina HiSeq	Phase_I	35870963	NM_001832	Q5T9G7|Q5U809	Missense_Mutation	SNP	ENST00000259938.2	37	CCDS4811.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.531337	0.27387	0.00227	0.0	ENSG00000137392	ENST00000259938;ENST00000541088	T	0.35421	1.31	4.7	0.261	0.15592	Colipase, C-terminal (1);	0.209280	0.24316	N	0.039584	T	0.24198	0.0586	M	0.67953	2.075	0.20403	N	0.999901	P;D	0.56746	0.484;0.977	B;P	0.50270	0.053;0.636	T	0.10359	-1.0633	10	0.59425	D	0.04	-14.5363	7.2723	0.26264	0.0:0.5271:0.0:0.4729	.	52;93	G3V1M8;P04118	.;COL_HUMAN	M	93;52	ENSP00000259938:V93M	ENSP00000259938:V93M	V	-	1	0	CLPS	35870963	0.486000	0.25980	0.025000	0.17156	0.005000	0.04900	0.196000	0.17176	-0.040000	0.13580	-0.137000	0.14449	GTG		0.567	CLPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040312.1	NM_001832	
MRAP2	112609	broad.mit.edu	37	6	84765076	84765076	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr6:84765076G>T	ENST00000257776.4	+	2	174	c.39G>T	c.(37-39)caG>caT	p.Q13H		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	13					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)	p.Q13H(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						GAACCTCCCAGCAATCGGCAT	0.423																																					p.Q13H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G39T	6						.						86.0	87.0	87.0					6																	84765076		2203	4300	6503	84821795	SO:0001583	missense	112609	exon2			AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	ENST00000257776.4:c.39G>T	6.37:g.84765076G>T	ENSP00000257776:p.Gln13His	Somatic		Capture	Illumina HiSeq	Phase_I	84821795	NM_138409	A8K9M1|Q8IXM9|Q8N2D1	Missense_Mutation	SNP	ENST00000257776.4	37	CCDS5001.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317964	0.40996	.	.	ENSG00000135324	ENST00000257776	D	0.86432	-2.12	5.58	1.38	0.22167	.	0.198832	0.44483	D	0.000450	T	0.56746	0.2006	N	0.19112	0.55	0.33523	D	0.592629	B	0.02656	0.0	B	0.06405	0.002	T	0.25293	-1.0136	10	0.37606	T	0.19	-2.5215	4.342	0.11115	0.2234:0.0:0.4036:0.3729	.	13	Q96G30	MRAP2_HUMAN	H	13	ENSP00000257776:Q13H	ENSP00000257776:Q13H	Q	+	3	2	MRAP2	84821795	1.000000	0.71417	0.610000	0.28997	0.955000	0.61496	0.997000	0.29731	-0.042000	0.13535	0.655000	0.94253	CAG		0.423	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041367.1	NM_138409	
FRMD1	79981	broad.mit.edu	37	6	168461535	168461535	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr6:168461535G>A	ENST00000283309.6	-	9	1312	c.1248C>T	c.(1246-1248)gaC>gaT	p.D416D	FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_Silent_p.D187D|FRMD1_ENST00000440994.2_Silent_p.D348D	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	416						cytoskeleton (GO:0005856)		p.D416D(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CCAAGGGCACGTCCACAGACA	0.647																																					p.D348D	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1044T	6						.						56.0	48.0	51.0					6																	168461535		2203	4300	6503	168204384	SO:0001819	synonymous_variant	79981	exon9				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.1248C>T	6.37:g.168461535G>A		Somatic		Capture	Illumina HiSeq	Phase_I	168204384	NM_001122841	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Silent	SNP	ENST00000283309.6	37	CCDS5306.1																																																																																				0.647	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919	
CPVL	54504	broad.mit.edu	37	7	29105653	29105653	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr7:29105653A>C	ENST00000409850.1	-	14	1595	c.949T>G	c.(949-951)Ttt>Gtt	p.F317V	CPVL_ENST00000265394.5_Missense_Mutation_p.F317V|CPVL_ENST00000396276.3_Missense_Mutation_p.F317V			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	317						extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)	p.F317V(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						CACCGCAAAAAGTTATAGTAA	0.343																																					p.F317V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T949G	7						.						108.0	106.0	107.0					7																	29105653		2203	4300	6503	29072178	SO:0001583	missense	54504	exon10			AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.949T>G	7.37:g.29105653A>C	ENSP00000387164:p.Phe317Val	Somatic		Capture	Illumina HiSeq	Phase_I	29072178	NM_031311	A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Missense_Mutation	SNP	ENST00000409850.1	37	CCDS5419.1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.433779	0.25813	.	.	ENSG00000106066	ENST00000265394;ENST00000396276;ENST00000409850;ENST00000542995	D;D;D	0.84873	-1.91;-1.91;-1.91	5.42	-10.8	0.00216	.	0.379915	0.30244	N	0.010073	T	0.58409	0.2120	N	0.05078	-0.115	0.29705	N	0.839873	B	0.25169	0.119	B	0.29267	0.1	T	0.55761	-0.8090	10	0.15499	T	0.54	-21.8167	8.5909	0.33686	0.6727:0.0:0.2191:0.1082	.	317	Q9H3G5	CPVL_HUMAN	V	317;317;317;201	ENSP00000265394:F317V;ENSP00000379572:F317V;ENSP00000387164:F317V	ENSP00000265394:F317V	F	-	1	0	CPVL	29072178	0.454000	0.25728	0.414000	0.26521	0.069000	0.16628	-0.460000	0.06720	-2.768000	0.00366	-1.905000	0.00526	TTT		0.343	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328305.1	NM_019029	
ADCYAP1R1	117	broad.mit.edu	37	7	31142891	31142891	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr7:31142891G>A	ENST00000304166.4	+	14	1376	c.1087G>A	c.(1087-1089)Gga>Aga	p.G363R	ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.G419R|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.G342R|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.G391R	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	363					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)	p.G363R(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CCCACTATTCGGAATCCACTA	0.582																																					p.G390R	Ovarian(44;225 1186 2158 11092)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1168A	7						.						135.0	131.0	132.0					7																	31142891		2203	4300	6503	31109416	SO:0001583	missense	117	exon15				CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1087G>A	7.37:g.31142891G>A	ENSP00000306620:p.Gly363Arg	Somatic		Capture	Illumina HiSeq	Phase_I	31109416	NM_001199636	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	CCDS5433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.852026|4.852026	0.91355|0.91355	.|.	.|.	ENSG00000078549|ENSG00000078549	ENST00000304166;ENST00000381667;ENST00000409363;ENST00000396211;ENST00000409489|ENST00000436116	T;T;T;T|.	0.63417|.	-0.04;-0.04;-0.04;-0.04|.	5.58|5.58	5.58|5.58	0.84498|0.84498	GPCR, family 2-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88262|0.88262	0.6389|0.6389	H|H	0.96996|0.96996	3.92|3.92	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0|.	D|D	0.91630|0.91630	0.5318|0.5318	10|5	0.87932|.	D|.	0|.	.|.	17.4555|17.4555	0.87606|0.87606	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	390;391;419;342;363|.	B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586|.	.;.;.;.;PACR_HUMAN|.	R|Q	363;190;342;391;419|107	ENSP00000306620:G363R;ENSP00000387335:G342R;ENSP00000379514:G391R;ENSP00000386395:G419R|.	ENSP00000306620:G363R|.	G|R	+|+	1|2	0|0	ADCYAP1R1|ADCYAP1R1	31109416|31109416	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.863000|0.863000	0.49368|0.49368	9.869000|9.869000	0.99810|0.99810	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GGA|CGG		0.582	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
RELN	5649	broad.mit.edu	37	7	103180700	103180700	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr7:103180700G>A	ENST00000428762.1	-	44	7033	c.6874C>T	c.(6874-6876)Cgc>Tgc	p.R2292C	RELN_ENST00000424685.2_Missense_Mutation_p.R2292C|RELN_ENST00000343529.5_Missense_Mutation_p.R2292C	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2292					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R2292C(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGCCACCAGCGAAGGCGAGTA	0.498																																					p.R2292C	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6874T	7						.						90.0	85.0	87.0					7																	103180700		2203	4300	6503	102967936	SO:0001583	missense	5649	exon44				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6874C>T	7.37:g.103180700G>A	ENSP00000392423:p.Arg2292Cys	Somatic		Capture	Illumina HiSeq	Phase_I	102967936	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708678	0.89018	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.29917	1.99;1.99;1.55	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	M	0.82193	2.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.66372	-0.5940	10	0.87932	D	0	.	19.6264	0.95679	0.0:0.0:1.0:0.0	.	2292;2292	P78509-2;P78509	.;RELN_HUMAN	C	2292	ENSP00000392423:R2292C;ENSP00000345694:R2292C;ENSP00000388446:R2292C	ENSP00000345694:R2292C	R	-	1	0	RELN	102967936	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.173000	0.94815	2.717000	0.92951	0.655000	0.94253	CGC		0.498	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
CSMD1	64478	broad.mit.edu	37	8	2820801	2820801	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr8:2820801C>A	ENST00000520002.1	-	61	9955	c.9400G>T	c.(9400-9402)Gcc>Tcc	p.A3134S	CSMD1_ENST00000537824.1_Missense_Mutation_p.A3133S|CSMD1_ENST00000602723.1_Missense_Mutation_p.A2957S|CSMD1_ENST00000400186.3_Missense_Mutation_p.A2957S|CSMD1_ENST00000542608.1_Missense_Mutation_p.A2956S|CSMD1_ENST00000602557.1_Missense_Mutation_p.A3134S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3134	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.A3133S(1)|p.A2862S(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAGAGGATGGCGGAGTGAGAG	0.582																																					p.R3133L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9398T	8						.																																			2808208	SO:0001583	missense	64478	exon60					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9400G>T	8.37:g.2820801C>A	ENSP00000430733:p.Ala3134Ser	Somatic		Capture	Illumina HiSeq	Phase_I	2808208	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.139|5.139	0.211268|0.211268	0.09757|0.09757	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.63744|.	-0.06;-0.06;-0.06;-0.06|.	5.69|5.69	4.82|4.82	0.62117|0.62117	Complement control module (2);Sushi/SCR/CCP (3);|.	0.072136|.	0.53938|.	D|.	0.000044|.	T|T	0.52613|0.52613	0.1745|0.1745	L|L	0.35288|0.35288	1.05|1.05	0.80722|0.80722	D|D	1|1	D;D;P|.	0.76494|.	0.999;0.976;0.933|.	D;D;P|.	0.83275|.	0.996;0.945;0.658|.	T|T	0.48703|0.48703	-0.9012|-0.9012	10|5	0.12430|.	T|.	0.62|.	.|.	11.0295|11.0295	0.47763|0.47763	0.0:0.8583:0.0:0.1417|0.0:0.8583:0.0:0.1417	.|.	3134;3134;2956|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	S|L	2957;3134;2995;3133;2956|2550	ENSP00000383047:A2957S;ENSP00000430733:A3134S;ENSP00000441462:A3133S;ENSP00000446243:A2956S|.	ENSP00000320445:A2995S|.	A|R	-|-	1|2	0|0	CSMD1|CSMD1	2808208|2808208	0.981000|0.981000	0.34729|0.34729	0.885000|0.885000	0.34714|0.34714	0.079000|0.079000	0.17450|0.17450	2.561000|2.561000	0.45905|0.45905	1.418000|1.418000	0.47098|0.47098	-0.126000|-0.126000	0.14955|0.14955	GCC|CGC		0.582	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSMD1	64478	broad.mit.edu	37	8	3076960	3076960	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr8:3076960T>A	ENST00000520002.1	-	30	5047	c.4492A>T	c.(4492-4494)Aac>Tac	p.N1498Y	CSMD1_ENST00000539096.1_Missense_Mutation_p.N1497Y|CSMD1_ENST00000537824.1_Missense_Mutation_p.N1497Y|CSMD1_ENST00000602723.1_Missense_Mutation_p.N1498Y|CSMD1_ENST00000400186.3_Missense_Mutation_p.N1498Y|CSMD1_ENST00000542608.1_Missense_Mutation_p.N1497Y|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602557.1_Missense_Mutation_p.N1498Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1498	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.N1226Y(1)|p.N1497Y(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCTCCATGTTGAAACTAAAG	0.423																																					p.Q1497L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4490T	8						.						28.0	28.0	28.0					8																	3076960		1823	4086	5909	3064367	SO:0001583	missense	64478	exon29					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4492A>T	8.37:g.3076960T>A	ENSP00000430733:p.Asn1498Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	3064367	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.4|25.4	4.636936|4.636936	0.87760|0.87760	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.20069|.	2.1;2.1;2.1;2.1;2.1|.	5.39|5.39	5.39|5.39	0.77823|0.77823	CUB (5);|.	0.058200|.	0.64402|.	D|.	0.000003|.	T|T	0.52917|0.52917	0.1764|0.1764	N|N	0.25094|0.25094	0.71|0.71	0.54753|0.54753	D|D	0.999989|0.999989	P;P;P|.	0.51147|.	0.723;0.605;0.942|.	P;P;P|.	0.58873|.	0.541;0.832;0.847|.	T|T	0.50056|0.50056	-0.8872|-0.8872	10|5	0.56958|.	D|.	0.05|.	.|.	15.6858|15.6858	0.77409|0.77409	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1498;1498;1498|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	Y|L	1498;1498;1360;1497;1497;1497|977	ENSP00000383047:N1498Y;ENSP00000430733:N1498Y;ENSP00000441462:N1497Y;ENSP00000446243:N1497Y;ENSP00000441675:N1497Y|.	ENSP00000320445:N1360Y|.	N|Q	-|-	1|2	0|0	CSMD1|CSMD1	3064367|3064367	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	6.041000|6.041000	0.70988|0.70988	2.162000|2.162000	0.67917|0.67917	0.454000|0.454000	0.30748|0.30748	AAC|CAA		0.423	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ANK1	286	broad.mit.edu	37	8	41552228	41552228	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr8:41552228C>A	ENST00000347528.4	-	28	3292	c.3209G>T	c.(3208-3210)tGc>tTc	p.C1070F	ANK1_ENST00000265709.8_Missense_Mutation_p.C1111F|ANK1_ENST00000379758.2_Missense_Mutation_p.C1070F|ANK1_ENST00000352337.4_Missense_Mutation_p.C1070F|ANK1_ENST00000396945.1_Missense_Mutation_p.C1070F|ANK1_ENST00000396942.1_Missense_Mutation_p.C1070F|ANK1_ENST00000289734.7_Missense_Mutation_p.C1070F	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1070	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.C1070F(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GTAGTCCTGGCAGAGCCGTGA	0.592																																					p.C1070F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3209T	8						.						150.0	121.0	131.0					8																	41552228		2203	4300	6503	41671385	SO:0001583	missense	286	exon28			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3209G>T	8.37:g.41552228C>A	ENSP00000339620:p.Cys1070Phe	Somatic		Capture	Illumina HiSeq	Phase_I	41671385	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591365	0.28357	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.06;-0.04;-0.06;-0.05;-0.08	5.05	3.21	0.36854	.	0.188723	0.51477	D	0.000098	T	0.54902	0.1887	L	0.46157	1.445	0.46631	D	0.999131	B;P;B;P;B;B	0.39282	0.248;0.666;0.17;0.647;0.156;0.331	B;B;B;B;B;B	0.41619	0.18;0.197;0.056;0.12;0.18;0.361	T	0.54853	-0.8231	10	0.87932	D	0	.	7.6895	0.28559	0.0:0.7127:0.1331:0.1542	.	1111;1070;1070;1070;1070;386	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	F	1070;1070;1070;1070;1070;1070;1111;1070	ENSP00000339620:C1070F;ENSP00000289734:C1070F;ENSP00000369082:C1070F;ENSP00000380149:C1070F;ENSP00000380147:C1070F;ENSP00000309131:C1070F;ENSP00000265709:C1111F	ENSP00000265709:C1111F	C	-	2	0	ANK1	41671385	1.000000	0.71417	1.000000	0.80357	0.345000	0.29048	1.444000	0.35068	0.602000	0.29896	0.462000	0.41574	TGC		0.592	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
RP1	6101	broad.mit.edu	37	8	55533950	55533950	+	Missense_Mutation	SNP	G	G	A	rs367600337	byFrequency	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr8:55533950G>A	ENST00000220676.1	+	2	572	c.424G>A	c.(424-426)Gta>Ata	p.V142I		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	142					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.V142I(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCCCCACCCCGTAGCCGTCGC	0.701																																					p.V142I	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G424A	8						.						30.0	35.0	33.0					8																	55533950		2202	4295	6497	55696503	SO:0001583	missense	6101	exon2			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.424G>A	8.37:g.55533950G>A	ENSP00000220676:p.Val142Ile	Somatic		Capture	Illumina HiSeq	Phase_I	55696503	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	G	8.396	0.840883	0.16891	.	.	ENSG00000104237	ENST00000220676	T	0.20463	2.07	3.32	0.248	0.15526	.	2.209180	0.02208	N	0.062866	T	0.12817	0.0311	N	0.19112	0.55	0.09310	N	1	B	0.31040	0.305	B	0.18561	0.022	T	0.19353	-1.0308	10	0.56958	D	0.05	.	3.9699	0.09449	0.2417:0.2003:0.558:0.0	.	142	P56715	RP1_HUMAN	I	142	ENSP00000220676:V142I	ENSP00000220676:V142I	V	+	1	0	RP1	55696503	0.030000	0.19436	0.000000	0.03702	0.003000	0.03518	0.674000	0.25218	-0.075000	0.12798	-0.482000	0.04802	GTA		0.701	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
ZFHX4	79776	broad.mit.edu	37	8	77765292	77765292	+	Silent	SNP	A	A	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr8:77765292A>T	ENST00000521891.2	+	10	6583	c.6135A>T	c.(6133-6135)ccA>ccT	p.P2045P	ZFHX4_ENST00000050961.6_Silent_p.P2000P|ZFHX4_ENST00000455469.2_Silent_p.P2000P|ZFHX4_ENST00000518282.1_Silent_p.P2019P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2000	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.?(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ctcccccaccaccaccacctc	0.617										HNSCC(33;0.089)																											p.P2045P												.	.	1	Unknown(1)	large_intestine(1)	c.A6135T	8						.						3.0	3.0	3.0					8																	77765292		1485	3312	4797	77927847	SO:0001819	synonymous_variant	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6135A>T	8.37:g.77765292A>T		Somatic		Capture	Illumina HiSeq	Phase_I	77927847	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				0.617	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
BRINP1	1620	broad.mit.edu	37	9	121930053	121930053	+	Missense_Mutation	SNP	T	T	C	rs373828125		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr9:121930053T>C	ENST00000265922.3	-	8	2056	c.1595A>G	c.(1594-1596)aAg>aGg	p.K532R	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	532					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.K532R(1)									CATGCGGTTCTTGTTGCTCTT	0.552																																					p.K532R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1595G	9						.						128.0	99.0	109.0					9																	121930053		2203	4300	6503	120969874	SO:0001583	missense	1620	exon8			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1595A>G	9.37:g.121930053T>C	ENSP00000265922:p.Lys532Arg	Somatic		Capture	Illumina HiSeq	Phase_I	120969874	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	T	13.09	2.132265	0.37630	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.16897	2.31	5.74	4.4	0.53042	.	0.044446	0.85682	D	0.000000	T	0.19967	0.0480	M	0.61703	1.905	0.58432	D	0.999996	B	0.10296	0.003	B	0.06405	0.002	T	0.04090	-1.0978	10	0.72032	D	0.01	-30.056	12.2941	0.54836	0.0:0.0766:0.0:0.9234	.	532	O60477	DBC1_HUMAN	R	532	ENSP00000265922:K532R	ENSP00000265922:K532R	K	-	2	0	DBC1	120969874	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.070000	0.64376	2.182000	0.69389	0.533000	0.62120	AAG		0.552	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
LINGO2	158038	broad.mit.edu	37	9	27949432	27949432	+	Missense_Mutation	SNP	C	C	T	rs201950549		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr9:27949432C>T	ENST00000379992.2	-	6	1687	c.1238G>A	c.(1237-1239)cGt>cAt	p.R413H	LINGO2_ENST00000308675.3_Missense_Mutation_p.R413H	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	413	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.R413H(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CTTCTTTTCACGGATTTTGGG	0.488																																					p.R413H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1238A	9						.	C	HIS/ARG	0,4406		0,0,2203	99.0	93.0	95.0		1238	6.2	1.0	9		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	LINGO2	NM_152570.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	413/607	27949432	1,13005	2203	4300	6503	27939432	SO:0001583	missense	158038	exon7			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1238G>A	9.37:g.27949432C>T	ENSP00000369328:p.Arg413His	Somatic		Capture	Illumina HiSeq	Phase_I	27939432	NM_152570	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671219	0.29693	0.0	1.16E-4	ENSG00000174482	ENST00000379992;ENST00000308675	D;D	0.96011	-3.88;-3.88	6.16	6.16	0.99307	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.058147	0.64402	D	0.000001	D	0.91310	0.7260	L	0.38175	1.15	0.58432	D	0.999994	B	0.13145	0.007	B	0.08055	0.003	D	0.85491	0.1185	9	.	.	.	.	11.6865	0.51490	0.0:0.8957:0.0:0.1043	.	413	Q7L985	LIGO2_HUMAN	H	413	ENSP00000369328:R413H;ENSP00000310126:R413H	.	R	-	2	0	LINGO2	27939432	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	4.024000	0.57218	2.937000	0.99478	0.650000	0.86243	CGT		0.488	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
PPP1R26	9858	broad.mit.edu	37	9	138378364	138378364	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chr9:138378364G>A	ENST00000356818.2	+	4	2557	c.2008G>A	c.(2008-2010)Gag>Aag	p.E670K	PPP1R26_ENST00000604351.1_Missense_Mutation_p.E670K|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000605660.1_Missense_Mutation_p.E670K|PPP1R26_ENST00000605286.1_Missense_Mutation_p.E670K|PPP1R26_ENST00000401470.3_Missense_Mutation_p.E670K	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	670					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.E670K(1)									TAAGACAGACGAGGCAAGGCG	0.617																																					p.E670K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2008A	9						.						59.0	58.0	58.0					9																	138378364		2203	4300	6503	137518185	SO:0001583	missense	9858	exon4			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.2008G>A	9.37:g.138378364G>A	ENSP00000349274:p.Glu670Lys	Somatic		Capture	Illumina HiSeq	Phase_I	137518185	NM_014811	Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	ENST00000356818.2	37	CCDS6988.1	.	.	.	.	.	.	.	.	.	.	G	3.732	-0.055352	0.07362	.	.	ENSG00000196422	ENST00000356818	T	0.20881	2.04	4.64	1.6	0.23607	.	1.324750	0.04849	N	0.441999	T	0.07863	0.0197	N	0.02539	-0.55	0.09310	N	1	B	0.32350	0.366	B	0.27608	0.081	T	0.27571	-1.0070	10	0.14656	T	0.56	-19.0505	6.4336	0.21811	0.199:0.3527:0.4483:0.0	.	670	Q5T8A7	PPR26_HUMAN	K	670	ENSP00000349274:E670K	ENSP00000349274:E670K	E	+	1	0	KIAA0649	137518185	0.208000	0.23494	0.004000	0.12327	0.007000	0.05969	0.553000	0.23391	0.388000	0.25054	0.561000	0.74099	GAG		0.617	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811	
ATXN3L	92552	broad.mit.edu	37	X	13337699	13337699	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:13337699G>C	ENST00000380622.2	-	1	819	c.355C>G	c.(355-357)Cac>Gac	p.H119D	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	119	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.H119D(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GTAAACCAGTGTTGTTTATAA	0.328																																					p.H119D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C355G	X						.						52.0	48.0	49.0					X																	13337699		1568	3580	5148	13247620	SO:0001583	missense	92552	exon1				CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.355C>G	X.37:g.13337699G>C	ENSP00000369996:p.His119Asp	Somatic		Capture	Illumina HiSeq	Phase_I	13247620	NM_001135995	B2RNY8	Missense_Mutation	SNP	ENST00000380622.2	37	CCDS48080.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245825	0.39697	.	.	ENSG00000123594	ENST00000380622	T	0.67345	-0.26	0.943	0.943	0.19531	.	0.045629	0.85682	D	0.000000	D	0.83482	0.5264	H	0.95079	3.62	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.83273	-0.0042	10	0.87932	D	0	.	7.4471	0.27217	0.0:0.0:1.0:0.0	.	119	Q9H3M9	ATX3L_HUMAN	D	119	ENSP00000369996:H119D	ENSP00000369996:H119D	H	-	1	0	ATXN3L	13247620	1.000000	0.71417	0.009000	0.14445	0.076000	0.17211	1.873000	0.39558	0.740000	0.32651	0.422000	0.28245	CAC		0.328	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995	
TENM1	10178	broad.mit.edu	37	X	124030087	124030087	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:124030087A>T	ENST00000371130.3	-	2	284	c.221T>A	c.(220-222)aTg>aAg	p.M74K	TENM1_ENST00000422452.2_Missense_Mutation_p.M74K	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	74	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.M74K(1)									ACAGAATTCCATCTCTGAGAA	0.448																																					p.M74K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T221A	X						.						88.0	82.0	84.0					X																	124030087		2203	4300	6503	123857768	SO:0001583	missense	10178	exon2			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.221T>A	X.37:g.124030087A>T	ENSP00000360171:p.Met74Lys	Somatic		Capture	Illumina HiSeq	Phase_I	123857768	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	A	15.64	2.893639	0.52121	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.32023	1.47;1.47	5.46	5.46	0.80206	Teneurin intracellular, N-terminal (2);	0.244180	0.35555	N	0.003127	T	0.26919	0.0659	L	0.29908	0.895	0.41732	D	0.989566	B;B;B	0.26195	0.144;0.144;0.004	B;B;B	0.29663	0.105;0.105;0.031	T	0.06552	-1.0820	10	0.54805	T	0.06	.	14.7377	0.69427	1.0:0.0:0.0:0.0	.	74;74;74	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	74	ENSP00000360171:M74K;ENSP00000403954:M74K	ENSP00000360171:M74K	M	-	2	0	ODZ1	123857768	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.974000	0.70465	1.930000	0.55929	0.486000	0.48141	ATG		0.448	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
MAGEC3	139081	broad.mit.edu	37	X	140984457	140984457	+	Intron	SNP	C	C	G			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:140984457C>G	ENST00000298296.1	+	7	1123				MAGEC3_ENST00000544766.1_Missense_Mutation_p.L7V|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000536088.1_Missense_Mutation_p.L7V|MAGEC3_ENST00000409007.1_Missense_Mutation_p.L7V|MAGEC3_ENST00000443323.2_Intron	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3									p.L7V(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTCCAAACCTTCCACGCCT	0.542																																					p.L7V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C19G	X						.						152.0	128.0	136.0					X																	140984457		2203	4300	6503	140812123	SO:0001627	intron_variant	139081	exon5			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1124-211C>G	X.37:g.140984457C>G		Somatic		Capture	Illumina HiSeq	Phase_I	140812123	NM_177456	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.122789	0.00346	.	.	ENSG00000165509	ENST00000536088;ENST00000544766;ENST00000409007	T;T;T	0.03242	4.0;4.0;4.0	0.961	0.961	0.19638	.	.	.	.	.	T	0.02304	0.0071	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46978	-0.9152	8	0.25751	T	0.34	.	4.9199	0.13865	0.0:1.0:0.0:0.0	.	7	Q3SYA7	.	V	7	ENSP00000441107:L7V;ENSP00000440444:L7V;ENSP00000386566:L7V	ENSP00000386566:L7V	L	+	1	0	MAGEC3	140812123	0.002000	0.14202	0.004000	0.12327	0.068000	0.16541	0.055000	0.14229	0.747000	0.32809	0.179000	0.17066	CTT		0.542	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
MAGEC2	51438	broad.mit.edu	37	X	141291353	141291353	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:141291353G>T	ENST00000247452.3	-	3	768	c.421C>A	c.(421-423)Cta>Ata	p.L141I		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	141	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.L141I(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					TTTTCATCTAGTGTATATGTG	0.502										HNSCC(46;0.14)																											p.L141I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C421A	X						.						110.0	109.0	109.0					X																	141291353		2203	4300	6503	141119019	SO:0001583	missense	51438	exon3			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.421C>A	X.37:g.141291353G>T	ENSP00000354660:p.Leu141Ile	Somatic		Capture	Illumina HiSeq	Phase_I	141119019	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	5.931	0.355855	0.11239	.	.	ENSG00000046774	ENST00000247452	T	0.03035	4.07	1.13	1.13	0.20643	.	0.320966	0.21164	U	0.079103	T	0.04048	0.0113	M	0.63428	1.95	0.09310	N	1	B	0.34015	0.435	B	0.32393	0.145	T	0.34229	-0.9837	10	0.30854	T	0.27	.	5.306	0.15803	0.0:0.0:1.0:0.0	.	141	Q9UBF1	MAGC2_HUMAN	I	141	ENSP00000354660:L141I	ENSP00000354660:L141I	L	-	1	2	MAGEC2	141119019	0.000000	0.05858	0.020000	0.16555	0.006000	0.05464	-0.806000	0.04525	0.861000	0.35504	0.458000	0.33432	CTA		0.502	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
MXRA5	25878	broad.mit.edu	37	X	3228553	3228553	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:3228553C>A	ENST00000217939.6	-	7	7845	c.7691G>T	c.(7690-7692)tGc>tTc	p.C2564F		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2564	Ig-like C2-type 10.					extracellular vesicular exosome (GO:0070062)		p.C2564F(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGCGGCAGAGCAGTTGAGGCT	0.627																																					p.C2564F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7691T	X						.						19.0	19.0	19.0					X																	3228553		2197	4295	6492	3238553	SO:0001583	missense	25878	exon7			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7691G>T	X.37:g.3228553C>A	ENSP00000217939:p.Cys2564Phe	Somatic		Capture	Illumina HiSeq	Phase_I	3238553	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.594364	0.66219	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	D	0.99121	-5.45	4.05	4.05	0.47172	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41605	U	0.000858	D	0.99533	0.9833	H	0.96662	3.86	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97878	1.0290	10	0.87932	D	0	.	15.9085	0.79450	0.0:1.0:0.0:0.0	.	2564	Q9NR99	MXRA5_HUMAN	F	2564	ENSP00000217939:C2564F	ENSP00000217939:C2564F	C	-	2	0	MXRA5	3238553	1.000000	0.71417	0.937000	0.37676	0.725000	0.41563	6.687000	0.74552	1.650000	0.50662	0.597000	0.82753	TGC		0.627	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
SCML2	10389	broad.mit.edu	37	X	18275012	18275012	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:18275012C>A	ENST00000251900.4	-	11	1571	c.1412G>T	c.(1411-1413)aGg>aTg	p.R471M	SCML2_ENST00000398048.3_Missense_Mutation_p.R207M	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	471					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R471M(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					AGTATGACCCCTGGAAGAACT	0.418																																					p.R471M	Esophageal Squamous(100;1252 1965 19021 35517)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1412T	X						.						130.0	125.0	127.0					X																	18275012		2203	4300	6503	18184933	SO:0001583	missense	10389	exon11			Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1412G>T	X.37:g.18275012C>A	ENSP00000251900:p.Arg471Met	Somatic		Capture	Illumina HiSeq	Phase_I	18184933	NM_006089	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	37	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	C	8.409	0.843742	0.16963	.	.	ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000	T;T	0.43294	2.28;0.95	5.54	-6.49	0.01890	.	0.680368	0.14291	N	0.328884	T	0.15305	0.0369	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.15473	0.0;0.008;0.013	B;B;B	0.14023	0.001;0.004;0.01	T	0.18713	-1.0328	10	0.27785	T	0.31	.	10.3163	0.43738	0.2683:0.6181:0.0:0.1136	.	439;207;471	B4DZR9;B4DRC2;Q9UQR0	.;.;SCML2_HUMAN	M	471;207;439	ENSP00000251900:R471M;ENSP00000381126:R207M	ENSP00000251900:R471M	R	-	2	0	SCML2	18184933	0.003000	0.15002	0.000000	0.03702	0.012000	0.07955	-0.371000	0.07513	-1.200000	0.02662	-1.258000	0.01471	AGG		0.418	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
KLHL34	257240	broad.mit.edu	37	X	21675346	21675346	+	Silent	SNP	G	G	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:21675346G>A	ENST00000379499.2	-	1	1102	c.561C>T	c.(559-561)gaC>gaT	p.D187D		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	187	BACK.					extracellular space (GO:0005615)		p.D187D(1)		cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						CCCGCGCCACGTCGGGGGCAC	0.697																																					p.D187D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C561T	X						.						6.0	7.0	6.0					X																	21675346		2035	3997	6032	21585267	SO:0001819	synonymous_variant	257240	exon1			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.561C>T	X.37:g.21675346G>A		Somatic		Capture	Illumina HiSeq	Phase_I	21585267	NM_153270		Silent	SNP	ENST00000379499.2	37	CCDS14199.1																																																																																				0.697	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270	
MAGEB18	286514	broad.mit.edu	37	X	26157612	26157612	+	Silent	SNP	C	C	A			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:26157612C>A	ENST00000325250.1	+	2	697	c.510C>A	c.(508-510)atC>atA	p.I170I		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	170	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)		p.I170I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						TGGATCCCATCAGGCACTACT	0.443																																					p.I170I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C510A	X						.						56.0	44.0	48.0					X																	26157612		2202	4300	6502	26067533	SO:0001819	synonymous_variant	286514	exon2			AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.510C>A	X.37:g.26157612C>A		Somatic		Capture	Illumina HiSeq	Phase_I	26067533	NM_173699		Silent	SNP	ENST00000325250.1	37	CCDS14216.1																																																																																				0.443	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699	
FAM47B	170062	broad.mit.edu	37	X	34962339	34962339	+	Missense_Mutation	SNP	G	G	A	rs151033833		TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:34962339G>A	ENST00000329357.5	+	1	1427	c.1391G>A	c.(1390-1392)cGt>cAt	p.R464H		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	464								p.R464H(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AGAAAACTCCGTGACTTCAAG	0.458													G|||	3	0.000794702	0.0023	0.0	3775	,	,		15081	0.0		0.0	False		,,,				2504	0.0				p.R464H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1391A	X						.	G	HIS/ARG	1,3832		0,1,1630,571	121.0	111.0	114.0		1391	0.2	0.0	X	dbSNP_134	114	0,6723		0,0,2426,1871	no	missense	FAM47B	NM_152631.2	29	0,1,4056,2442	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging	464/646	34962339	1,10555	2202	4297	6499	34872260	SO:0001583	missense	170062	exon1			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1391G>A	X.37:g.34962339G>A	ENSP00000328307:p.Arg464His	Somatic		Capture	Illumina HiSeq	Phase_I	34872260	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	2.970	-0.212715	0.06140	2.61E-4	0.0	ENSG00000189132	ENST00000329357	T	0.42900	0.96	0.235	0.235	0.15431	.	.	.	.	.	T	0.30198	0.0757	M	0.64404	1.975	0.09310	N	1	P	0.41929	0.765	B	0.28139	0.086	T	0.16748	-1.0392	8	0.49607	T	0.09	.	.	.	.	.	464	Q8NA70	FA47B_HUMAN	H	464	ENSP00000328307:R464H	ENSP00000328307:R464H	R	+	2	0	FAM47B	34872260	0.004000	0.15560	0.008000	0.14137	0.018000	0.09664	0.362000	0.20284	0.288000	0.22398	0.292000	0.19580	CGT		0.458	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
HUWE1	10075	broad.mit.edu	37	X	53576434	53576434	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:53576434C>T	ENST00000342160.3	-	66	9978	c.9521G>A	c.(9520-9522)cGc>cAc	p.R3174H	HUWE1_ENST00000474288.1_5'Flank|HUWE1_ENST00000262854.6_Missense_Mutation_p.R3174H			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3174					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.R3064H(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCCTCGGAGGCGGAGGAGAGT	0.498																																					p.R3174H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9521A	X						.						36.0	37.0	36.0					X																	53576434		2201	4296	6497	53593159	SO:0001583	missense	10075	exon67			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9521G>A	X.37:g.53576434C>T	ENSP00000340648:p.Arg3174His	Somatic		Capture	Illumina HiSeq	Phase_I	53593159	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156839	0.57259	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.39229	1.09;1.09	5.62	5.62	0.85841	.	0.063133	0.64402	D	0.000005	T	0.58409	0.2120	L	0.42245	1.32	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.77004	0.976;0.989	T	0.59616	-0.7421	10	0.62326	D	0.03	.	17.3491	0.87318	0.0:1.0:0.0:0.0	.	3174;3158	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	H	3174	ENSP00000340648:R3174H;ENSP00000262854:R3174H	ENSP00000262854:R3174H	R	-	2	0	HUWE1	53593159	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.885000	0.75606	2.363000	0.80096	0.600000	0.82982	CGC		0.498	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
CYSLTR1	10800	broad.mit.edu	37	X	77529109	77529109	+	Silent	SNP	G	G	C			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:77529109G>C	ENST00000373304.3	-	3	427	c.135C>G	c.(133-135)ctC>ctG	p.L45L		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	45					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)	p.L45L(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	TGAGGACATAGAGCACAAAGC	0.423																																					p.L45L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C135G	X						.						134.0	108.0	117.0					X																	77529109		2203	4300	6503	77415765	SO:0001819	synonymous_variant	10800	exon3			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.135C>G	X.37:g.77529109G>C		Somatic		Capture	Illumina HiSeq	Phase_I	77415765	NM_006639	B2R954|D3DTE4|Q5JS94|Q8IV19	Silent	SNP	ENST00000373304.3	37	CCDS14439.1																																																																																				0.423	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057315.1		
SLITRK4	139065	broad.mit.edu	37	X	142716864	142716864	+	Silent	SNP	A	A	T			TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3818-01A-01W-0900-09	TCGA-AA-3818-10A-01W-0900-09	g.chrX:142716864A>T	ENST00000381779.4	-	2	2286	c.2061T>A	c.(2059-2061)atT>atA	p.I687I	SLITRK4_ENST00000338017.4_Silent_p.I687I|SLITRK4_ENST00000356928.1_Silent_p.I687I	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	687						integral component of membrane (GO:0016021)		p.I687I(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TAGTTTGTGGAATGAAAGCTT	0.453																																					p.I687I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2061A	X						.						116.0	116.0	116.0					X																	142716864		2203	4300	6503	142544530	SO:0001819	synonymous_variant	139065	exon2			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2061T>A	X.37:g.142716864A>T		Somatic		Capture	Illumina HiSeq	Phase_I	142544530	NM_173078	Q5JXG3|Q8TCM8|Q96DL3	Silent	SNP	ENST00000381779.4	37	CCDS14679.1																																																																																				0.453	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
